#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 22:28 GMT TreeBASE (cc) 1994-2008 Study reference: Devos N., Oh S., Raspé O., Tyteca D., & Jacquemart A. 2005. The evolution of Dactylorhiza (Orchidaceae) allotetraploid complex: insights from nrDNA sequences and cpDNA PCR-RFLP data. Molecular Phylogenetics and Evolution, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1459] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=69; TAXLABELS Dactylorhiza_angustata_1 Dactylorhiza_angustata_2 Dactylorhiza_angustata_3 Dactylorhiza_angustata_4 Dactylorhiza_angustata_5 Dactylorhiza_elata_1 Dactylorhiza_elata_2_4 Dactylorhiza_elata_3 Dactylorhiza_elata_6 Dactylorhiza_elata_7 Dactylorhiza_elata_8 Dactylorhiza_elata_9 Dactylorhiza_foliosa_1 Dactylorhiza_foliosa_2 Dactylorhiza_foliosa_3 Dactylorhiza_foliosa_4 Dactylorhiza_foliosa_5 Dactylorhiza_foliosa_6 Dactylorhiza_foliosa_7 Dactylorhiza_foliosa_8 Dactylorhiza_fuchsii_1_3_9 Dactylorhiza_fuchsii_10 Dactylorhiza_fuchsii_2_7_8_4_11 Dactylorhiza_fuchsii_5 Dactylorhiza_fuchsii_6 Dactylorhiza_incarnata_1_2 Dactylorhiza_incarnata_3_4_5 Dactylorhiza_incarnata_6_7 Dactylorhiza_incarnata_8 Dactylorhiza_maculata_1 Dactylorhiza_maculata_2 Dactylorhiza_maculata_3 Dactylorhiza_maculata_4 Dactylorhiza_maculata_5 Dactylorhiza_maculata_6_7_10 Dactylorhiza_maculata_8 Dactylorhiza_maculata_9 Dactylorhiza_majalis_1 Dactylorhiza_majalis_10 Dactylorhiza_majalis_11 Dactylorhiza_majalis_12 Dactylorhiza_majalis_2 Dactylorhiza_majalis_3 Dactylorhiza_majalis_4 Dactylorhiza_majalis_5 Dactylorhiza_majalis_6 Dactylorhiza_majalis_7 Dactylorhiza_majalis_8 Dactylorhiza_majalis_9 Dactylorhiza_praetermissa_1 Dactylorhiza_praetermissa_2 Dactylorhiza_praetermissa_3 Dactylorhiza_saccifera_1 Dactylorhiza_saccifera_2 Dactylorhiza_saccifera_3 Dactylorhiza_saccifera_4 Dactylorhiza_saccifera_5 Dactylorhiza_saccifera_6 Dactylorhiza_saccifera_7 Dactylorhiza_saccifera_8 Dactylorhiza_sambucina_1 Dactylorhiza_sambucina_2 Dactylorhiza_sphagnicola_4 Dactylorhiza_sphagnicola_5 Dactylorhiza_traunsteineri_1 Dactylorhiza_traunsteineri_2 Dactylorhiza_traunsteineri_3 Gymnadenia_conopsea_1 Gymnadenia_conopsea_2 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1008] TITLE ITS_and_ETS_nrDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1586; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Dactylorhiza_angustata_1 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGTGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTC-----TAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAAGGGGGATGATTTTCTCTTGACAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCATTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_angustata_2 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATC{AG}CTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGA{CT}TGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGAGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCT{CT}GTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_angustata_3 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTG{CT}GCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTC-----TAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAAGGGGGATGATTTTCTCTTG{AG}CAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATG{GT}GTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGG{CT}G{CT}TTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCC{CG}AAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCT{CT}TGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACT{AC}TGCATGGTGTTGCTATA{GT}GGGGCGGCGAACTAAAA{AG}CATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_angustata_4 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGTGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTC-----TAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAAGGGGGATGATTTTCTCTTGACAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_angustata_5 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGTGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTC-----TAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAAGGGGGATGATTTTCTCTTGACAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGC{CT}CGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCAT{AT}GTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_elata_1 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCG{GT}GC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCACCAATAGTGCGCTCCTAAATTGCCCATTTTGTGTTTTGGCTCGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGT---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCATGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCAGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGG{CT}CACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGA{AT}TCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_elata_2_4 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGTTGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGGGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCACCAATAGTGCGCTCCTAAATTGCCCATTTTGTGTTTTGGCTCGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGT---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCATGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCAGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_elata_3 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGG{AT}TGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGG{GT}GGTGATTATAATGAAGTGTGTGGTCTTTTGGCCACCAATAGTGCGCTCCTAAATTGCCCATTTTGTGTTTTGGCTCGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGT---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCATGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCAGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_elata_6 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGTGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCACCAATAGTGCGCTCCTAAATTGCCCATTTTGTGTTTTGGCTCGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGT---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCATGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCAGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGA{AT}TCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_elata_7 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCACCAATAGTGCGCTCCTAAATTGCCCATTTTGTGTTTTGGCTCGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGT---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCATGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCAGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_elata_8 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGAC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCCACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGTTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACCGGGAAGAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTAGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_elata_9 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGG{AG}C--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCCACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGTTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACCGGGAAGAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTAGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_foliosa_1 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATTGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAAATCTCATGGTGTGCCCC-AAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAATTGCATTCAACATTGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTTGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCAAGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_foliosa_2 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATTGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCC-AAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAATTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTTGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCAAGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_foliosa_3 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATTGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCC-AAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAATTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTTGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATT-GAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTT-GGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCAAGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_foliosa_4 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCC-AAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTTGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATAT-GGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTT-GGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCAAGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_foliosa_5 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATTGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCC-AAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTTGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTT-GGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCAAGGCCACCT-GCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_foliosa_6 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATTGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCC-AAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGAAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAATTGCATTCAACAATGCTTACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTTGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATAT-GGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTATTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCAAGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_foliosa_7 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATTGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCC-AAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTTGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATATGCAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTT-GGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCAAGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_foliosa_8 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCCCGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCC-AAAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTTGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTT-GGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCAAGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_fuchsii_1_3_9 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTG{CT}GCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAA{AT}GAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGA{AG}GGGGGATGATTTTCTCTTG{AG}CAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_fuchsii_10 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTG{CT}GCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAA{AT}GAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGA{AG}GGGGGATGATTTTCTCTTG{AG}CAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_fuchsii_2_7_8_4_11 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGTGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTC-----TAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAAGGGGGATGATTTTCTCTTGACAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_fuchsii_5 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTG{CT}GCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAA{AT}GAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTC-----TAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGA{AG}GGGGGATGATTTTCTCTTG{AG}CAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGACAGAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTC{CG}AGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_fuchsii_6 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAATGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCGCTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGATTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGAGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_incarnata_1_2 TCGAGACCCTAAAGAGACCGAGCGATTTGACAACTTGTGAACTTCTACAGCAGCTCACTTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGAAACATGTTGTAGGCGGATGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCGATTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTCAATGCAATGCAGTGG--TCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGCGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTCAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGTGAGACCCCAACTCAATTGTTTGGAA-GAAAATTGAAATGGGTTCCCGGTAGCCTGACGTGCAATAATAATATCTCGTAGCCTCTTGGCGGTGATAATAATGAAGCATTTGGTCTTTTGGCCGCCGACAATGCGCTCCTAAATTGCCCGTTTTGTGTTTCGGCTCGCCCGCTGGTGCTTGCCGTCTACAAAAGTGGTTGGCG-TGCCGTCTTGGCCCCTCCACAGT-GCC-TCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCGCCACATGTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGGAACGTCCCAAACATTCGTGCCGCGCGGAGCTCGTTATTCCCGCTTAATGCTCGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGCTTCTGGTCGATGACGTGCTGTCGTTGGGGCTTGCCTATTTGGGTTGA-TTCGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTACCCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTCGGTGGCCACAATTCCCTTTGGATGTGGTTGATCTATATGTCATGTTGCTTGCATTTTGATCCCAATCACGTTATTGGCATTGG-ATTTGAAGAAAGAATGATCTCTGCCTCTGCTTTCGATGCGAAACGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTGTGTGCCTAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGATGTTGTTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCGTCCTCACCTCGCGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_incarnata_3_4_5 TCGAGACCCTAAAGAGACCGAGCGATTTGACAACTTGTGAACTTCTACAGCAGCTCACTTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGAAACATGTTGTAGGCGGATGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCGATTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTCAATGCAATGCAGTGG--TCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGCGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTCAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGCGAGACCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCGGTAGCCTGACGTGCAATAATAATATCTCGTAGCCTCTTGGCGGTGATAATAATGAAGCATTTGGTCTTTTGGCCGCCGACAATGCGCTCCTAAATTGCCCGTTTTGTGTTTCGGCTCGCCCGCTGGTGCTTGCCGTCTACAAAAGTGGTTGGCG-TGCCGTCTTGGCCCCTCCACAGT-GCC-TCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCGCCACATGTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGGAACGTCCCAAACATTCGTGCCGCGCGGAGCTCGTTATTCCCGCTTAATGCTCGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGCTTCTGGTCGATGACGTGCTGTCGTTGGGGCTTGCCTATTTGGGTTGA-TTCGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTACCCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTCGGTGGCCACAATTCCCTTTGGATGTGGTTGATCTATATGTCATGTTGCTTGCATTTTGATCCCAATCACGTTATTGGCATTGG-ATTTGAAGAAAGAATGATCTCTGCCTCTGCTTTCGATGCGAAACGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTGTGTGCCTAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGATGTTGTTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCGTCCTCACCTCGCGCAACCATGATTCCTCCCTTCC{CT}TCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_incarnata_6_7 TCGAGACCCTAAAGAGACCGAGCGATTTGACAACTTGTGAACTTCTACAGCAGCTCACTTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGAAACATGTTGTAGGCGGATGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCGATTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTCAATGCAATGCAGTGG--TCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGCGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTCAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGCGAGACCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCGGTAGCCTGACGTGCAATAATAATATCTCGTAGCCTCTTGGCGGTGATAATAATGAAGCATTTGGTCTTTTGGCCGCCGACAATGCGCTCCTAAATTGCCCGTTTTGTGTTTCGGCTCGCCCGCTGGTGCTTGCCGTCTACAAAAGTGGTTGGCG-TGCCGTCTTGGCCCCTCCACAGT-GCC-TCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCGCCACATGTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGGAACGTCCCAAACATTCGTGCCGCGCGGAGCTCGTTATTCCCGCTTAATGCTCGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGCTTCTGGTCGATGACGTGCTGTCGTTGGGGCTTGCCTATTTGGGTTGA-TTCGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTACCCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTCGGTGGCCACAATTCCCTTTGGATGTGGTTGATCTATATGTCATGTTGCTTGCATTTTGATCCCAATCACGTTATTGGCATTGG-ATTTGAAGAAAGAATGATCTCTGCCTCTGCTTTCGATGCGAAACGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTGTGTGCCTAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGATGTTGTTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCGTCCTCACCTCGCGCAACCATGATTCCTCCCTTCCCTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_incarnata_8 TCGAGACCCTAAAGAGACCGAGCGATTTGACAACTTGTGAACTTCTACAGCAGCTCACTTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGAAACATGTTGTAGGCGGATGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCGATTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTCAATGCAATGCAGTGG--TCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGCGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTCAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGCGAGACCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCGGTAGCCTGACGTGCAATAATAATATCTCGTAGCCTCTTGGCGGTGATAATAATGAAGCATTTGGTCTTTTGGCCGCCGACAATGCGCTCCTAAATTGCCCGTTTT{CG}TGTTTCGGCTCGCCCGCTGGTGCTTGCCGTCTACAAAAGTGGTTGGCG-TGCCGTCTTGGCCCCTCCACAGT-GCC-TCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCGCCACATG{CT}TATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGGAACGTCCCAAACATTCGTGCCGCGCGGAGCTCGTTATTCCCGCTTAATGCTCGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGCTTCTGGTCGATGACGTGCTGTCGTTGGGGCTTGCCTATTTGGGTTGA-TTCGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTACCCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTCGGTGGCCACAATTCCCTTTGGATGTGGTTGATCTATATGTCATGTTGCTTGCATTTTGATCCCAATCACGTTATTGGCATTGG-ATTTGAAGAAAGAATGATCTCTGCCTCTGCTTTCGATGCGAAACGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTGTGTGCCTAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGATGTTGTTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCGTCCTCACCTCGCGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_maculata_1 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGAAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGACGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAA{CT}TAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_maculata_2 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCAATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_maculata_3 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACATGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGACGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_maculata_4 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCATATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGACGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAATTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_maculata_5 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGA{AC}GTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCG{CG}TTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGG{CT}ATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_maculata_6_7_10 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_maculata_8 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTG{GT}AA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGACGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAA{CT}TAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_maculata_9 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTC{AT}TATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_1 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGAT{CT}TTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATG{GT}GTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCC?AAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTCGGCCACAAA---CTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACT{AC}TGCATGGTGTTGCTATA?GGGGCGGCGAACTAAAA{AG}CATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_10 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGAT{CT}TTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGT{CT}GGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGA{CT}TGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACT{AC}TGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_11 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTATGCATGGTGTTGCTATAGGGGGAGGCGAACTAAAAACATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTTGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_12 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGTGTTCCCGGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGTGTTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACACTGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACCAATCACTTTGGATGTGGATGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCGATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTATGCATGGTGTTGCTATAGGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_2 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGC{CG}AGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGATCTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTCGGCCACAAA---CTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTAT{AC}TGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_3 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGATCTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTCGGCCACAAA---CTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTAT{AC}TGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_4 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGTGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGTGTTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTATGCATGGTGTTGCTATAGGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_5 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGAT{CT}TTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCC{CG}AAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTCGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCT{CT}TGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACT{AC}TGCATGGTGTTGCTATAGGGGGCGGCGAACTAAAA{AG}CATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_6 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGAT{CT}TTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATG{GT}GTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGG{CT}G{CT}TTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGT{CT}GGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACT{AC}TGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_7 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGAT{CT}TTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGG{CT}G{CT}TTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCC{CG}AAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTCGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTATGCATGGTGTTGCTATAGGGGGCGGCGAACTAAAA{AG}CATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_8 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGAT{CT}TTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATG{GT}GTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGG{CT}G{CT}TTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCC{CG}AAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTCGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACT{AC}TGCATGGTGTTGCTATA{GT}GGGGCGGCGAACTAAAA{AG}CATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_majalis_9 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGAT{CT}TTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATG{GT}GTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCC{CG}AAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGT{CT}GGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTTTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTATGCATGGTGTTGCTATA?GGGGCGGCGAACTAAAA{AG}CATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_praetermissa_1 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTT{CT}TTCAGCAGCTCACGTAGGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTCGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGGTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_praetermissa_2 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTAGGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCG{CG}TGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTCGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGGTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_praetermissa_3 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTAGGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTCGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGGTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_saccifera_1 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTTTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTAATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAATGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCACCCTTCCTTCCACCTGCTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_saccifera_2 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTTTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGACCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCATTTGCAGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGGTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_saccifera_3 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTTTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTGTGCTGCTTG?TGATCAATAACTGTGCATGGTGTTGCTATATGGGGCGGAGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGAGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCCCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_saccifera_4 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTTTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTC??????????????????TT?AC??GGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCAGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGTTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCTTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGAGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAA?GAGGCAATGGTTTGCCATTGCAGTAATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAATGCATATCTCGGTGAGCAATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCACCCTTCCTTCCACCTGCTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_saccifera_5 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTTTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCA?CGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGGTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_saccifera_6 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACATGTGAACTTTTTCAGCAGCTCACGTAGGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGATGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAAAGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATGTCCCGGGC--GATCCCAACTCAATTGATTGGAAGGAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGATAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTCGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGGTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_saccifera_7 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTTTTCAGCAGCTCACGTAGGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTCGGACGCAATGTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGGTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_saccifera_8 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTTTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATATGACCTTT---GCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGCAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGATTGGAA-GAAAATTGACATGGGTTCCCAGTAGCTTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTTTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTAATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAATGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGGTTGAAGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_sambucina_1 TCGAGACCCTAAAGAGATCGAGCGATTTGACAATTTGTGAACTTCTTCAGCAGCTCACTTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCAAT--GGGAACATGTCGTAGGCGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAG--TTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGGGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTAGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTATCC{AT}GTAGCCTGACGTGCGATAAAAATATCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCACCGACAGTGCGCTCCTAAATTGCCCGTTTTGAGTTTTGGCTCGTCCGCTGGCGCTTGCCGTATATAAAAGTGGTTGACGCTG----------------ACAGTTGCCCTCGCTTAGATCTCATGGT-TGCCCCCACAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCTGAGCTTGCATTGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGCATCTGGTTGATGCTGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGA-TTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTATTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGATGTATGTGCCTAAAATAACATC--GTCTGCTGCTTGCTGATCAATAACTCTGCATGATGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAATCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_sambucina_2 TCGAGACCCTAAAGAGATCGAGCGATTTGACAATTTGTGAACTTCTTCAGCAGCTCACTTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCAAT--GGGAACATGTCGTAGGCGGAGGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAG--TTTCAACCACATATCCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGGGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTAGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTATCC{AT}GTAGCCTGACGTGCGATAAAAATATCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCACCGACAGTGCGCTCCTAAATTGCCCGTTTTGAGTTTTGGCTCGTCCGCTGGCGCTTGCCGTATATAAAAGTGGTTGACGCTG----------------ACAGTTGCCCTCGCTTAGATCTCATGGT-TGCCCCCACAATGTCCCTCCATATATTATGCGATGCATTTGTGATGGTTCTTGTGCATCTGAGCTTGCATTGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGCATCTGGTTGATGCTGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGA-TTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTATTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGATGTATGTGCCTAAAATAACATC--GTCTGCTGCTTGCTGATCAATAACTCTGCATGATGTTGCTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAATCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_sphagnicola_4 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGACGTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_sphagnicola_5 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTGACGTACGCTGCTGCACACCCGTCCATCTATTGCATGAACAACCTGATGGGGGAACATGTTGTGGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAA--------CCTCAAAGCATTTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCTAGTAGCCT--------------------CGTTGCCTCTTGGTGGTGATTATAATGA{AC}GTGTGTGGTCTTTTGGCCCTCAACAGTGCGCTCCTAAATTGCCCGTTTTGTGTTTTGGCTCGCACGCTAGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCCTCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCTCCATATATTATGCGAAGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGC---TCATCGATGCGTGGAATCTGGTCGATGTTGCACTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACATCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGGCGGCGAACTAAAAACATATCTCGGTGAGCCATGGCCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCAGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_traunsteineri_1 TCGAGACCCTAAAGAGACCGAGCGATTTGACAACTTGTGAACTTCTACAGCAGCTCACTTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGAAACATGTTGTAGGCGGATGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCGATTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTCAATGCAATGCAGTGG--TCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGCGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTCAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGCGAGACCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCGGTAGCCTGACGTGCAATAATAATATCTCGTAGCCTCTTGGCGGTGATAATAATGAAGCATTTGGTCTTTTGGCCGCCGACAATGCGCTCCTAAATTGCCCGTTTTCTGTTTCGGCTCGCCCGCTGGTGCTTGCCGTCTACAAAAGTGGTTGGCG-TGCCGTCTTGGCCCCTCCACAGT-GCC-TCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCGCCACATGCTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGGAACGTCCCAAACATTCGTGCCGCGCGGAGCTCGTTATTCCCGCTTAATGCTCGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGCTTCTGGTCGATGACGTGCTGTCGTTGGGGCTTGCCTATTTGGGTTGA-TTCGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTACCCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGGTGGCCACAATTCCCTTTGGATGTGGTTGATCTATATGTCATGTTGCTTGCATTTTGATCCCAATCACGTTATTGGCATTGG-ATTTGAAGAAAGAATGATCTCTGCCTCTGCTTTCGATGCGAAACGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTGTGTGCCTAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGATGTTGTTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCGTCCTCACCTCGCGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_traunsteineri_2 TCGAGACCCTAAAGAGACCGAGCGATTTGACAACTTGTGAACTTCTACAGCAGCTCACTTACGCTGCTGCGCACCCGTCCATCTGTTGCATGAACAACCCGAT--GGAAACATGTTGTAGGCGGATGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCGATTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTCAATGCAATGCAGTGG--TCTTATATAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGCGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTCAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGCGAGACCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCGGTAGCCTGGCGTGCAGTAATAATATCTCGTAGCCTCTTGGCGGTGATAATAATGAAGCATTTGGTCTTTTGGCCGCCGACAATGCGCTCCTAAATTGCCCGTTTTGTGTTTCGGCTCGCCCGCTGGTGCTTGCCGTCTACAAAAGTGGTTGGCG-TGCCGTCTTGGCCCCTCCACAGT-GCC-TCGCTTAGATCTCATGGTGTGCCCCCAAAATGTCCCGCCACATGTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGGAACGTCCCAAACATTCGTGCCGCGCGGAGCTCGTTATTCCCGCTTAATGCTCGATCCTTTTGGCTGCTGC---TCATCGATGCTTGGCTTCTGGTCGATGACGTGCTGTCGTTGGGGCTTGCCTATTTGGGTTGA-TTCGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTACCCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTCGGTGGCCACAATTCCCTTTGGATGTGGTTGATCTATATGTCATGTTGCTTGCATTTTGATCCCAATCACGTTATTGGCATTGG-ATTTGAAGAAAGAATGATCTCTGCCTCTGCTTTCGATGCGAAACGAGGCAATGGTTTGGCATTGCAGTTATTATTTGATCAGCTACTGGGA-GAGACGTGTGTGCCTAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGATGTTGTTATATGGGGCGGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCGTCCTCACCTCGCGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Dactylorhiza_traunsteineri_3 TCGAGACCCTAAAGAGATCGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCTCACGTACGCTGCTGCGCACCCGTCCATCCGTTGCATGAACAACCCGAT--GGGAACATGTTGTAGGTGGAGGGGAAATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCAACCACATATCCTCAAAGCATTTTGTTTTGTCGAGTTGTTTGCTCCTAA{AT}GAGTTGTAGGGCTCTCGACAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCCGGCCGAGGGCACGTCCGCCTGGCCGTCAAGCATTGAATCGCTCCATAAGACCTTTAATGCAATGCAATGGTCTCTTATATAGGATGCGGAGAATGGCCCGTCATGCGGTGATGTGTGGCAGGCTGAAGAGGGGGGATGATTTTCTCTTGGCAACGATCGATTAATGGGTGGGATGGAAGCCCCAGTTGATCCTCATCATCGTTAGGTTGCTTTGAGAAAGGTGTGCATATCCCGGGC--GATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGACGTGCAATAAAAATGTCCCGTTGCCTCTTGGTGGTGATTATAATGAAGTGTGCGGTCTTTTGGCCAGCGACAGTCCGCTCCTAAATTGCCCGTTTTGCGTTTTGGCTTGCCCGCTGGCGCTTGCCGTATACAAAAGTGGTTGATG-TGCCATCTTGGCCTCTCCACAGTTGCCATCGCTTAGATCTCATGGTGTGCCCCGAAAATGTCCCTCCATATCTTATGCGATGCATTTGTGATGGTTCTTGTGCATCGGAGCTTGCATCGTCCCAAACATTCGTGCCTCGCGGAGCTCTTTATTCCCGTTTAATGCTTGATCCTTTTGGCTGCTGCTCATCATCGATGCTTGGCATCTGGTCGATGCGGCGCTGTCATTGGGGCTTGCTTATTTGGGTTGATTTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGTGTAACCTCCAGTGTTGCTGATCATTGTTAAAAGCATTCGTTTCATTTTGTTGGCCACAAATCACTTTGGATGTGGTTGATCTATACGTCATGTTGCTTGCATTTTGATCCCATTAACGATATTGGCATTGGGATTTGAAGAAAGACTGATCTCTGCCTCTGCTTTCAATGCGAAAAGAGGCAATGGTTTGCCATTGCAGTTATTATTTGATCAGCTACGGGGA-GAGACGTATGTGCCCAAAATAACATCAAGTCTGCTGCTTGCTGATCAATAACTCTGCATGGTGTTGCTATATGGGG{AC}GGCGAACTAAAAGCATATCTCGGTGAGCCATGGTCACCTTGCGAATGTGAGTTACTTTTGGACGCAATCTTGCCTCCTAACCTCGTGCAACCATGATTCCTCCCTTCCTTCCACCTGCTTGATGGTGTATGGCTGGGCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Gymnadenia_conopsea_1 TCGAGACCCTAAAGAG-{AT}CGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCGCACATAAGTTGCTGTGCACCCGTCCATCTATTGCATGAACAACCCGAT--GGGAACATGTTATAGGCGGATGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCGACAACATATCCTCAAAGGGATTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTGGCGCAATGCAGTGG--TCTTATCTAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGCGGGGATGATTTTCTC{CT}TGGCAACAATCGATTAATGGGTGGGATGGAATCCCCAGTTGATCCTCATCATCGTCAGGTTGCTTTGAGAAAGCTGTGCATATCCCGGGC--TATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGATGTGCAATCAAAATCTCT{CT}GTTGCCTCTTGGTGTTGATAACAATGAAGCATGTGGTCTTTTGGCCATCGACAGTGCGCCCCGGAATTGCATGTTTACTGTAGCGACTCGCCTGCTGGTGCCAGTCGTCTACAAAAGTGGATGATG-TGCCATCTTGGCCTCTCCACGGT-CCCTGCTCGTAGATCGCATGGTGTGACCCCAAAATGTCCCTCCCTAGATTGTACGATGCATATGTGATGGTTCTTGTGCATCGAAACTTCGCTCGTCCCAAACATTCGTGCTTCGCGGAGCTCTTTATTCCCGTTTAATGCTGGATCCTTTTGGCTG{CT}TGC---TCATCGATGCTTGGCATATGGTTGATGTTGCGCTGTCACTGGGGCTTGCTTATTTGGGTTGT-TTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGCGTACCCTCCAGTGTTGCTGATCATTGTTCAAAGCATTCGTTTCATTTTGTTGGCCACGAATCACTTTGGATGTGGTTGATGTA--TGTCATGTTGCTTGCATGTTGATCCCGTTCACGATATTGGCATTGG-ATTTGAAGAAAGACTGATCTTTGCCTCTCGTTTCAATGCGAAAAGAGGCAATGATTTGGCATTGCAGTTATTATGTGATCAGCTACTGGGT-GAGACGTACGTGTCCAAACAAACATCCAGTCAGCTGTTTGCTGATCCATAACTGTACATGATGTTGTTATATGGGGAGGCGAACTGAAAGCATATCTCGGTGCGGCATGGTCACCTTGCGAATGTGAGTTATTTTTGGAGGCAATATCGCCTCCTAATCTCGTGCAACCATGATTCCTCTCTTCCTTACACTTGCTTGATGGTGTATGGCT{GT}{GT}GCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC Gymnadenia_conopsea_2 TCGAGACCCTAAAGAG-{AT}CGAGCGATTTGACAACTTGTGAACTTCTTCAGCAGCGCACATAAGTTGCTGTGCACCCGTCCATCTATTGCATGAACAACCCGAT--GGGAACATGTTATAGGCGGATGGGAGATCAATTCGGCGCAGCTTTGTGCCAAGGTAAATATGCAGCATGAGCAGAGTTTCGACAACATATCCTCAAAGGGATTTGTTTTGTGGAGTTGTTTGCTCCTAAAGAGTTGTAGGGCTCTCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTGAATCGCTCCATAAGACCTTTGGCGCAATGCAGTGG--TCTTATCTAGGATGCGGAGAATGGCCCGTCATGCGCTGATGTGTGGCAGGCTGAAGAGCGGGGATGATTTTCTC{CT}TGGCAACAATCGATTAATGGGTGGGATGGAATCCCCAGTTGATCCTCATCATCGTCAGGTTGCTTTGAGAAAGCTGTGCATATCCCGGGC--TATCCCAACTCAATTGTTTGGAA-GAAAATTGACATGGGTTCCCAGTAGCCTGATGTGCAATCAAAATCTCT{CT}GTTGCCTCTTGGTGTTGATAACAATGAAGCATGTGGTCTTTTGGCCATCGACAGTGCGCCCCGGAATTGCATGTTTACTGTAGCGACTCGCCTGCTGGTGCCAGTCGTCTACAAAAGTGGATGATG-TGCCATCTTGGCCTCTCCACGGT-CCCTGCTCGTAGATCGCATGGTGTGACCCCAAAATGTCCCTCCCTAGATTGTACGATGCATATGTGATGGTTCTTGTGCATCGAAACTTCGCTCGTCCCAAACATTCGTGCTTCGCGGAGCTCTTTATTCCCGTTTAATGCTGGATCCTTTTGGCTG{CT}TGC---TCATCGATGCTTGGCATATGGTTGATGTTGCGCTGTCACTGGGGCTTGCTTATTTGGGTTGT-TTTGAGACCGTTTGCGGCATATGAGTTGCATTCAACAATGCTCACTTTGATCGGCGTACCCTCCAGTGTTGCTGATCATTGTTCAAAGCATTCGTTTCATTTTGTTGGCCACGAATCACTTTGGATGTGGTTGATGTA--TGTCATGTTGCTTGCATGTTGATCCCGTTCACGATATTGGCATTGG-ATTTGAAGAAAGACTGATCTTTGCCTCTCGTTTCAATGCGAAAAGAGGCAATGATTTGGCATTGCAGTTATTATGTGATCAGCTACTGGGT-GAGACGTACGTGTCCAAACAAACATCCAGTCAGCTGTTTGCTGATCCATAACTGTACATGATGTTGTTATATGGGGAGGCGAACTGAAAGCATATCTCGGTGCGGCATGGTCACCTTGCGAATGTGAGTTATTTTTGGAGGCAATATCGCCTCCTAATCTCGTGCAACCATGATTCCTCTCTTCCTTACACTTGCTTGATGGTGTATGGCT{GT}{GT}GCTGGTTTCATGTTGTGTTGAGGTTGTGCTAC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_and_ETS_nrDNA) = N: 1-1586; CODONPOSSET CodonPositions (CHARACTERS = ITS_and_ETS_nrDNA) = N: 1-1586; END; BEGIN TREES; TITLE Tb7598; LINK TAXA = Taxa1; TRANSLATE 1 Dactylorhiza_maculata_9, 2 Dactylorhiza_maculata_8, 3 Dactylorhiza_maculata_6_7_10, 4 Dactylorhiza_maculata_5, 5 Dactylorhiza_maculata_4, 6 Dactylorhiza_maculata_3, 7 Dactylorhiza_maculata_2, 8 Dactylorhiza_maculata_1, 9 Dactylorhiza_saccifera_8, 10 Dactylorhiza_saccifera_7, 11 Dactylorhiza_saccifera_6, 12 Dactylorhiza_saccifera_5, 13 Dactylorhiza_saccifera_4, 14 Dactylorhiza_saccifera_3, 15 Dactylorhiza_saccifera_2, 16 Dactylorhiza_saccifera_1, 17 Dactylorhiza_foliosa_8, 18 Dactylorhiza_foliosa_7, 19 Dactylorhiza_foliosa_6, 20 Dactylorhiza_foliosa_5, 21 Dactylorhiza_foliosa_4, 22 Dactylorhiza_foliosa_3, 23 Dactylorhiza_foliosa_2, 24 Dactylorhiza_foliosa_1, 25 Dactylorhiza_angustata_5, 26 Dactylorhiza_angustata_4, 27 Dactylorhiza_angustata_3, 28 Dactylorhiza_angustata_2, 29 Dactylorhiza_angustata_1, 30 Dactylorhiza_sphagnicola_5, 31 Dactylorhiza_sphagnicola_4, 32 Dactylorhiza_sambucina_2, 33 Dactylorhiza_sambucina_1, 34 Dactylorhiza_elata_9, 35 Dactylorhiza_elata_8, 36 Dactylorhiza_elata_7, 37 Dactylorhiza_elata_6, 38 Dactylorhiza_elata_3, 39 Dactylorhiza_elata_2_4, 40 Dactylorhiza_elata_1, 41 Dactylorhiza_traunsteineri_3, 42 Dactylorhiza_traunsteineri_2, 43 Dactylorhiza_traunsteineri_1, 44 Dactylorhiza_praetermissa_3, 45 Dactylorhiza_praetermissa_2, 46 Dactylorhiza_praetermissa_1, 47 Dactylorhiza_incarnata_8, 48 Dactylorhiza_incarnata_6_7, 49 Dactylorhiza_incarnata_3_4_5, 50 Dactylorhiza_incarnata_1_2, 51 Dactylorhiza_fuchsii_10, 52 Dactylorhiza_fuchsii_6, 53 Dactylorhiza_fuchsii_5, 54 Dactylorhiza_fuchsii_2_7_8_4_11, 55 Dactylorhiza_fuchsii_1_3_9, 56 Dactylorhiza_majalis_12, 57 Dactylorhiza_majalis_11, 58 Dactylorhiza_majalis_10, 59 Dactylorhiza_majalis_9, 60 Dactylorhiza_majalis_8, 61 Dactylorhiza_majalis_7, 62 Dactylorhiza_majalis_6, 63 Dactylorhiza_majalis_5, 64 Dactylorhiza_majalis_4, 65 Dactylorhiza_majalis_3, 66 Dactylorhiza_majalis_2, 67 Dactylorhiza_majalis_1, 68 Gymnadenia_conopsea_2, 69 Gymnadenia_conopsea_1; TREE Fig.1 = [&R] ((69,68),((((((((((((67,((((((64,56),27),57),63),61),59)),60),62),(66,65)),58),(55,((((54,26),25),29),53))),51),((52,28),41)),(((((((46,(45,44)),11),10),15),12),((16,13),9)),14)),((((40,37),36),(39,38)),((35,34),(((((((31,((8,5),2)),6),4),30),(3,1)),7),((((24,19),(23,22)),(20,18)),(21,17)))))),(33,32)),((((50,42),(49,48)),47),43))); END;