#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:02 GMT TreeBASE (cc) 1994-2008 Study reference: Viljoen J., Muasya A., Barrett R.L., Bruhl J.J., Gibbs A., Slingsby J., Wilson K., & Verboom G.A. 2013. Radiation and repeated transoceanic dispersal of Schoeneae (Cyperaceae) through the Southern Hemisphere. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14725] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=63; TAXLABELS Becquerelia_cymosa Capeobolus_brevicaulis Carex_magellanica Carpha_capitellata_var._bracteosa Carpha_glomerata Caustis_dioica Chrysitrix_capensis Cladium_mariscus Costularia_leucocarpa_Lar0140 Costularia_natalensis Costularia_pantopoda Costularia_pantopoda_var._baronii Costularia_sp_Lar0153 Costularia_sp_Lar0219 Costularia_sp_Lar0249 Cyathochaeta_avenacea Cyathocoma_hexandra Cyperus_rigidifolius Epischoenus_cernuus 'Epischoenus gracilis (Verboom 636)' Epischoenus_villosus Eriophorum_vaginatum Ficinia_paradoxa Gahnia_baniensis Gahnia_trifida Gahnia_tristis Hypolytrum_nemorum 'Lagenocarpus albo-niger' Lepidosperma_longitudinale Lepidosperma_tortuosum Machaerina_iridifolia Machaerina_juncea Machaerina_mariscoides Mapania_cuspidata Mesomelaena_pseudostygia Mesomelaena_tetragona Neesenbeckia_punctoria Pseudoschoenus_inanis Rhynchospora_rugosa_subsp._brownii Schoenus_bifidus Schoenus_caespititius Schoenus_curvifolius Schoenus_efoliatus Schoenus_nigricans Schoenus_pennisetis Scleria_distans Tetraria_bolusii Tetraria_compacta Tetraria_compar Tetraria_crassa Tetraria_cuspidata Tetraria_exilis Tetraria_flexuosa Tetraria_involucrata Tetraria_microstachys Tetraria_nigrovaginata Tetraria_octandra Tetraria_picta Tetraria_sylvatica Tetraria_triangularis Tetraria_ustulata Tetraria_variabilis Trianoptiles_capensis ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=86; TAXLABELS Arthrostylis_aphylla Becquerelia_cymosa Capeobolus_brevicaulis Carex_magellanica Carpha_alpina Carpha_capitellata_var._bracteosa Carpha_glomerata Caustis_dioica Chrysitrix_capensis Cladium_mariscus Costularia_arundinacea Costularia_laxa Costularia_leucocarpa_Lar0140 Costularia_natalensis Costularia_nervosa Costularia_pantopoda Costularia_pantopoda_var._baronii Costularia_sp_Lar0153 Costularia_sp_Lar0219 Costularia_sp_Lar0249 Cyathochaeta_avenacea Cyathochaeta_diandra Cyathocoma_hexandra Cyperus_rigidifolius Epischoenus_cernuus 'Epischoenus gracilis (Verboom 636)' Epischoenus_villosus Eriophorum_vaginatum Evandra_aristata Ficinia_paradoxa Gahnia_aspera Gahnia_baniensis Gahnia_trifida Gahnia_tristis Hypolytrum_nemorum 'Lagenocarpus albo-niger' Lepidosperma_filiforme Lepidosperma_laterale Lepidosperma_longitudinale Lepidosperma_tortuosum Machaerina_iridifolia Machaerina_juncea Machaerina_mariscoides Machaerina_rubiginosa Mapania_cuspidata Mesomelaena_pseudostygia Mesomelaena_tetragona Morelotia_gahniiformis Neesenbeckia_punctoria Oreobolus_distichus Oreobolus_kuekenthalii Oreobolus_obtusangulus Oreobolus_oligocephalus Oreobolus_pectinatus Pseudoschoenus_inanis Ptilothrix_deusta Rhynchospora_rugosa_subsp._brownii Schoenus_bifidus Schoenus_caespititius Schoenus_curvifolius Schoenus_efoliatus Schoenus_grandiflorus Schoenus_nigricans Schoenus_nitens Schoenus_pennisetis Schoenus_rigens Scleria_distans Tetraria_bolusii Tetraria_capillaris Tetraria_compacta Tetraria_compar Tetraria_crassa Tetraria_cuspidata Tetraria_exilis Tetraria_flexuosa Tetraria_involucrata Tetraria_microstachys Tetraria_nigrovaginata Tetraria_octandra Tetraria_picta Tetraria_sylvatica Tetraria_triangularis Tetraria_ustulata Tetraria_variabilis Trianoptiles_capensis Tricostularia_pauciflora ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=70; TAXLABELS Arthrostylis_aphylla Becquerelia_cymosa Calyptrocarya Capeobolus_brevicaulis Carex_magellanica Carpha_alpina Carpha_capitellata_var._bracteosa Carpha_glomerata Caustis_dioica Chrysitrix_capensis Cladium_mariscus Costularia_fragilis Costularia_leucocarpa_Lar0140 Costularia_natalensis Costularia_pantopoda Costularia_pantopoda_var._baronii Costularia_sp_Lar0153 Costularia_sp_Lar0249 Cyathochaeta_avenacea Cyathocoma_hexandra Cyperus_rigidifolius Diplacrum Epischoenus_cernuus 'Epischoenus gracilis (Verboom 636)' Epischoenus_villosus Eriophorum_vaginatum Evandra_aristata Ficinia_paradoxa Gahnia_baniensis Gahnia_trifida Hypolytrum_nemorum 'Lagenocarpus albo-niger' Lepidosperma_longitudinale Lepidosperma_tortuosum Machaerina_iridifolia Machaerina_juncea Machaerina_mariscoides Machaerina_rubiginosa Mapania_cuspidata Mesomelaena_pseudostygia Mesomelaena_tetragona Morelotia_gahniiformis Neesenbeckia_punctoria Oreobolus_kuekenthalii Oreobolus_obtusangulus Oreobolus_pectinatus Pseudoschoenus_inanis Rhynchospora_rugosa_subsp._brownii Schoenus_curvifolius Schoenus_efoliatus Schoenus_nigricans Schoenus_pennisetis Scleria_distans Tetraria_bolusii Tetraria_capillaris Tetraria_compacta Tetraria_compar Tetraria_crassa Tetraria_cuspidata Tetraria_exilis Tetraria_flexuosa Tetraria_involucrata Tetraria_microstachys Tetraria_nigrovaginata Tetraria_octandra Tetraria_picta Tetraria_sylvatica Tetraria_ustulata Tetraria_variabilis Tricostularia_pauciflora ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=89; TAXLABELS Arthrostylis_aphylla Becquerelia_cymosa Calyptrocarya Capeobolus_brevicaulis Carex_magellanica Carpha_alpina Carpha_capitellata_var._bracteosa Carpha_glomerata Caustis_dioica Chrysitrix_capensis Cladium_mariscus Costularia_arundinacea Costularia_fragilis Costularia_laxa Costularia_leucocarpa_Lar0140 Costularia_natalensis Costularia_nervosa Costularia_pantopoda Costularia_pantopoda_var._baronii Costularia_sp_Lar0153 Costularia_sp_Lar0219 Costularia_sp_Lar0249 Cyathochaeta_avenacea Cyathochaeta_diandra Cyathocoma_hexandra Cyperus_rigidifolius Diplacrum Epischoenus_cernuus 'Epischoenus gracilis (Verboom 636)' Epischoenus_villosus Eriophorum_vaginatum Evandra_aristata Ficinia_paradoxa Gahnia_aspera Gahnia_baniensis Gahnia_trifida Gahnia_tristis Hypolytrum_nemorum 'Lagenocarpus albo-niger' Lepidosperma_filiforme Lepidosperma_laterale Lepidosperma_longitudinale Lepidosperma_tortuosum Machaerina_iridifolia Machaerina_juncea Machaerina_mariscoides Machaerina_rubiginosa Mapania_cuspidata Mesomelaena_pseudostygia Mesomelaena_tetragona Morelotia_gahniiformis Neesenbeckia_punctoria Oreobolus_distichus Oreobolus_kuekenthalii Oreobolus_obtusangulus Oreobolus_oligocephalus Oreobolus_pectinatus Pseudoschoenus_inanis Ptilothrix_deusta Rhynchospora_rugosa_subsp._brownii Schoenus_bifidus Schoenus_caespititius Schoenus_curvifolius Schoenus_efoliatus Schoenus_grandiflorus Schoenus_nigricans Schoenus_nitens Schoenus_pennisetis Schoenus_rigens Scleria_distans Tetraria_bolusii Tetraria_capillaris Tetraria_compacta Tetraria_compar Tetraria_crassa Tetraria_cuspidata Tetraria_exilis Tetraria_flexuosa Tetraria_involucrata Tetraria_microstachys Tetraria_nigrovaginata Tetraria_octandra Tetraria_picta Tetraria_sylvatica Tetraria_triangularis Tetraria_ustulata Tetraria_variabilis Trianoptiles_capensis Tricostularia_pauciflora ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=67; TAXLABELS Becquerelia_cymosa Calyptrocarya Capeobolus_brevicaulis Carex_magellanica Carpha_capitellata_var._bracteosa Carpha_glomerata Caustis_dioica Chrysitrix_capensis Cladium_mariscus Costularia_leucocarpa_Lar0140 Costularia_natalensis Costularia_pantopoda Costularia_pantopoda_var._baronii Costularia_sp_Lar0153 Costularia_sp_Lar0219 Costularia_sp_Lar0249 Cyathochaeta_avenacea Cyathochaeta_diandra Cyathocoma_hexandra Epischoenus_cernuus 'Epischoenus gracilis (Verboom 636)' Epischoenus_villosus Eriophorum_vaginatum Evandra_aristata Ficinia_paradoxa Gahnia_baniensis Gahnia_trifida Gahnia_tristis 'Lagenocarpus albo-niger' Lepidosperma_filiforme Lepidosperma_laterale Lepidosperma_longitudinale Lepidosperma_tortuosum Machaerina_iridifolia Machaerina_juncea Machaerina_mariscoides Machaerina_rubiginosa Mesomelaena_pseudostygia Neesenbeckia_punctoria Oreobolus_distichus Ptilothrix_deusta Rhynchospora_rugosa_subsp._brownii Schoenus_caespititius Schoenus_curvifolius Schoenus_efoliatus Schoenus_grandiflorus Schoenus_nitens Schoenus_pennisetis Schoenus_rigens Tetraria_bolusii Tetraria_capillaris Tetraria_compacta Tetraria_compar Tetraria_crassa Tetraria_cuspidata Tetraria_exilis Tetraria_flexuosa Tetraria_involucrata Tetraria_microstachys Tetraria_nigrovaginata Tetraria_picta Tetraria_sylvatica Tetraria_triangularis Tetraria_ustulata Tetraria_variabilis Trianoptiles_capensis Tricostularia_pauciflora ; END; BEGIN TAXA; TITLE Taxa6; DIMENSIONS NTAX=40; TAXLABELS Arthrostylis_aphylla Calyptrocarya Capeobolus_brevicaulis Carex_magellanica Carpha_alpina Carpha_glomerata Costularia_laxa Costularia_natalensis Diplacrum Eriophorum_vaginatum Evandra_aristata Ficinia_paradoxa Gahnia_aspera Gahnia_tristis Hypolytrum_nemorum 'Lagenocarpus albo-niger' Lepidosperma_filiforme Lepidosperma_laterale Lepidosperma_longitudinale Lepidosperma_tortuosum Machaerina_rubiginosa Morelotia_gahniiformis Neesenbeckia_punctoria Oreobolus_distichus Oreobolus_kuekenthalii Oreobolus_obtusangulus Oreobolus_oligocephalus Oreobolus_pectinatus Ptilothrix_deusta Rhynchospora_rugosa_subsp._brownii Schoenus_bifidus Schoenus_curvifolius Schoenus_efoliatus Schoenus_grandiflorus Schoenus_nigricans Schoenus_nitens Schoenus_rigens Scleria_distans Tetraria_capillaris Trianoptiles_capensis ; END; BEGIN TAXA; TITLE Taxa7; DIMENSIONS NTAX=89; TAXLABELS Arthrostylis_aphylla Becquerelia_cymosa Calyptrocarya Capeobolus_brevicaulis Carex_magellanica Carpha_alpina Carpha_capitellata_var._bracteosa Carpha_glomerata Caustis_dioica Chrysitrix_capensis Cladium_mariscus Costularia_arundinacea Costularia_fragilis Costularia_laxa Costularia_leucocarpa_Lar0140 Costularia_natalensis Costularia_nervosa Costularia_pantopoda Costularia_pantopoda_var._baronii Costularia_sp_Lar0153 Costularia_sp_Lar0219 Costularia_sp_Lar0249 Cyathochaeta_avenacea Cyathochaeta_diandra Cyathocoma_hexandra Cyperus_rigidifolius Diplacrum Epischoenus_cernuus 'Epischoenus gracilis (Verboom 636)' Epischoenus_villosus Eriophorum_vaginatum Evandra_aristata Ficinia_paradoxa Gahnia_aspera Gahnia_baniensis Gahnia_trifida Gahnia_tristis Hypolytrum_nemorum 'Lagenocarpus albo-niger' Lepidosperma_filiforme Lepidosperma_laterale Lepidosperma_longitudinale Lepidosperma_tortuosum Machaerina_iridifolia Machaerina_juncea Machaerina_mariscoides Machaerina_rubiginosa Mapania_cuspidata Mesomelaena_pseudostygia Mesomelaena_tetragona Morelotia_gahniiformis Neesenbeckia_punctoria Oreobolus_distichus Oreobolus_kuekenthalii Oreobolus_obtusangulus Oreobolus_oligocephalus Oreobolus_pectinatus Pseudoschoenus_inanis Ptilothrix_deusta Rhynchospora_rugosa_subsp._brownii Schoenus_bifidus Schoenus_caespititius Schoenus_curvifolius Schoenus_efoliatus Schoenus_grandiflorus Schoenus_nigricans Schoenus_nitens Schoenus_pennisetis Schoenus_rigens Scleria_distans Tetraria_bolusii Tetraria_capillaris Tetraria_compacta Tetraria_compar Tetraria_crassa Tetraria_cuspidata Tetraria_exilis Tetraria_flexuosa Tetraria_involucrata Tetraria_microstachys Tetraria_nigrovaginata Tetraria_octandra Tetraria_picta Tetraria_sylvatica Tetraria_triangularis Tetraria_ustulata Tetraria_variabilis Trianoptiles_capensis Tricostularia_pauciflora ; END; BEGIN TAXA; TITLE Taxa8; DIMENSIONS NTAX=18; TAXLABELS Capeobolus_brevicaulis Carex_magellanica Carpha_glomerata Costularia_natalensis Eriophorum_vaginatum Evandra_aristata Ficinia_paradoxa Gahnia_tristis 'Lagenocarpus albo-niger' Lepidosperma_longitudinale Lepidosperma_tortuosum Machaerina_rubiginosa Neesenbeckia_punctoria Rhynchospora_rugosa_subsp._brownii Schoenus_curvifolius Schoenus_efoliatus Tetraria_capillaris Trianoptiles_capensis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18780] TITLE rbcL; LINK TAXA = Taxa3; DIMENSIONS NCHAR=1430; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Arthrostylis_aphylla -------------------------------------------------TATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGATACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTACGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTTACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGCCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTGTCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAACGATATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAACCGGTAGACAAACTAGAT--------------------- Becquerelia_cymosa TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGCGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACGAGCCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGCTGGGGAAGACAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGTGCTCTACGCTTGGAAGATTTGCGAATTCCACCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTTTTAGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGCTCCTATTGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACCGAAATCTTTGGAGATGATTCCGTCCTCCAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGGAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTCGATCCGGTAGATAAACTAGAT--------------------- Calyptrocarya TAAGGCAAGTGTTGGGTTTAAAGCAGGGGTTAGAGATTACAAACTTACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTCTTGGAGAAGACAATCAATATATTTGTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGCGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTTTTAGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTATGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Capeobolus_brevicaulis ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGTCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGCGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGAAGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Carex_magellanica TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTTAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Carpha_alpina TAAAGCTAGTGTTGGTTTTAAAGCAGGGGTTAAAGAGTATAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCGGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGCTCTGTTACTAATATGTTCACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTACTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTACTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCA----------------------------------------------------- Carpha_capitellata_var._bracteosa ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTTGATAAGACGAAATAAAAAGATCAA Carpha_glomerata -------------------------------AAAGATTATAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCGGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGCTCTGTTACTAATATGTTCACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTACTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTCATAAAGCACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGGGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTTGAT--------------------- Caustis_dioica TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCTGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTACCATATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAGCAGCTTTATAAAGCACAGGCCGAAACTGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATACGAGCCGGTAGATAAACTAGAT--------------------- Chrysitrix_capensis ---------TGTTGGATTTAAAGCCGGAGTTAAAGATTACAAACTGACTTATTATACTCCTGAGTATGAAACCAAAGATACTGATATTTTGGCAGCGTTCCGAGTCACCCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCCCCTGCTTATTTAAAAACTTTCCAAGGTCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTAAACGCTACTGCAGGCACCTGTGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGCTTGTCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATAATTTTATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGACTCCGTACTTCAATTTGGTGGAGGAACTCTAGGACATCCTTGGGGAAATGCATCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTCCTCGGGAAGGTAATGAAATTATTCGAAGAGCAGCTAAATGGAGTACTGAACTAAGCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTCGATCCGGTAGATAAACTAGATAAGGCGAAATAGAAAAATAAT Cladium_mariscus ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGCACATGTGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAACAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTCCAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCCGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTTGAGCCGGTAGATAAACTAGAT--------------------- Costularia_fragilis TAAAGCTTTTGTTGGTTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGACC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Costularia_leucocarpa_Lar0140 -----------------------------------------AACTTAATTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACTAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGATAAGACGAA------------- Costularia_natalensis ------------------------------------TTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGAT--------------------- Costularia_pantopoda -----------------------------------------AACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGCTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA Costularia_pantopoda_var._baronii -----------------------------------------------------------------------------ATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA Costularia_sp_Lar0153 -----------------------------------------------------ATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA Costularia_sp_Lar0249 --------------------------------------------------------------------------------------------------------------------CCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATGAAAAGAGCCATATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA Cyathochaeta_avenacea ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATCGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTACGGCCGTCCTCTATTGGGATGTACCATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATTGTAATGCATGATTACTTAACCGGAGGATTCACCGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCATATCCACCGTGCAATGCACGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCGGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTCGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACA--------------- Cyathocoma_hexandra ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGAAGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGACTTCGATCCGGTAGATAAACTAGAT--------------------- Cyperus_rigidifolius ------------TGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAACCTGTTGCTGGAGAAGAAAATCAATATATTGCCTATATAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCACGGTATCCAAGCTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCATCAACCTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTAGGAGTTCCTATCATCATGCATGACTACATAACTGGGGGATTCACTGCAAATACTAGTTTGTCTTTTTATTGCCGTGATAATGGTCTACTTCTGCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATTCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGTGAGCGTGAGATGACTTTAGGTTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGATCGTAGCCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATTTTGCTCGTGAAGGTAATGAAATTATTCGCGCAGCAGCTAAATGGAGTCCAGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGACTTCGATCCGGTAGATAAACTAGAT--------------------- Diplacrum TAAAACTAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGTGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACGAGCCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGCTGGAGAAGACAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTTAAAGCCCTACGTGCTCTACGCTTGGAAGATTTGCGAATTCCACCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTAGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTATTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGCTCCAATTATCATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACCGAAATCTTTGGAGATGATTCCGTACTCCAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGGAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTCAATCCGGTAGATAAACTAGTT--------------------- Epischoenus_cernuus ---------------------------------------------------------------------------------------------------------------------------------------------------------------ATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCCTACGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAGCCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTTCAAATACGAGTTTGGCTTTTTATTGTCGTGACAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGATATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCATGTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGGCGAAATAGA-------- 'Epischoenus gracilis (Verboom 636)' ----------------------GCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAAGTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGAT--------------------- Epischoenus_villosus -------------------------------------------------------ACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAAGTCCTCAACCCGGAGTTCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGATAAGTAAGGCGAAATAAA---- Eriophorum_vaginatum TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGCTCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATCCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Evandra_aristata TAAAGCAAGTGTTGGATTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGACAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTCTCTTATTCTGTGCCGGAGCTCTTTATAAAGCACAGGCCGAAACTGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCATGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Ficinia_paradoxa --------------------------------------------------------CTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTGCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGACTTACTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTGATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Gahnia_baniensis --------------------------------------------------------CTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATCGCTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCGCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACTAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAAGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACAGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCATATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTGCGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAATAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGGGAAGGTAATGAGATTATTAAAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAACCGGTAGATAAACTAGAT--------------------- Gahnia_trifida ------------------------------------------ACTTACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGACCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCGCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAAGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACAGCAGGTACATCTGAAGAAATGATCAAACGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCATATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAATAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGGGAAGGTAATGAGATTATTAAAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAACCGGTAGATAAACTAGATAAGTCGAAATAGA-------- Hypolytrum_nemorum TAAAGCATGTGTTGGATTTAAAGCCGGAGTTAAGGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTCACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTCTGTGCTGAAGCAATTTATAAACCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGCACTTGTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCTGAATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTAGATTTATTACGTGATGATTATATTGAAATAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGACTCCGTACTCCAATTTGGTGGAGGAACTCTAGGACACCCTTGGGGAAATGCACCTGGAGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGGGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGTCGTATGGAAAGCAATCAAATTCGAATTCGATCCGGTAGATAAAATAGAT--------------------- 'Lagenocarpus albo-niger' -----------------------------------------AACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTATAAAGGACGATGCTACCATATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATCCCCCCCGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGACGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTT---------------------TTTATAAATCACAGGCCGAAACGGGTGAAATCAAAGGACACTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACTGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTTCGTGTACTTGCTAAAGCATTACGTATGTCTGGTGGAGATCACATTCACGCTGGTACAGTAGTAGGTAAATTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTGCTCGCGGTATCTTTTTTACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACTGAAATCTTTGGAGATGATTCCGTCCTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAATATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTAGAT--------------------- Lepidosperma_longitudinale --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACAGGCTG-AACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTAACCGGGGGCTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lepidosperma_tortuosum TAAAGCAGGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTAACCGGGGGCTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTCAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATACGATCCGGTAGATAAACTAGAT--------------------- Machaerina_iridifolia ---------------------------------AGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTACCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCGACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGATATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATACGATGCGGTAGATAAACTAGATAAAACGAACTAGAAAGATCCG Machaerina_juncea -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCTAAGGACACTACTTGAATGCGACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTA------------------------ Machaerina_mariscoides ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAAGTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATCAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCGACTGCAGCTACGTCTGAAGAAATGATAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATACGAGCCGGTAGATAAACTAGAT--------------------- Machaerina_rubiginosa TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTAACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTACCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTCTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCGACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCGATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGATCTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Mapania_cuspidata ----------------------GCCGGAGTTAAAGATTACAAACTGACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTCACCCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTTCAAGGTCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGACGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGCTTCTGCTTCTGTGCTGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAGTCAAAGGACACTACTTGAATGCTACTGCAGGCACCTGTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGCTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAATACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAATAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGACTCCGTACTCCAATTTGGTGGAGGAACTCTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTGGCTTTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGGGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATAAACTAGAT--------------------- Mesomelaena_pseudostygia ----------------------GCAGGGGTTAAAGATTACAAACTTACTTACTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACGACTGTTTGGACTGACGGACTTACCAGTCTTGATCGCTACAAAGGACGATGCTACCATATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATCCCCCCCGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACCGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGGCTACTTCTTCATATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACGGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTGGATAAACTAGAT--------------------- Mesomelaena_tetragona TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTACTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGCGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGCTACAAAGGACGATGCTACCATATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATCCCCCCCGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACCGCAGGTACATCCGAAGAAATGATCAAAAGGGCGGTATTTGCTAGAGAACTAGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGGCTACTTCTTCATATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACGGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATTTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATAAACTAGAT--------------------- Morelotia_gahniiformis -------AGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCAGGAGCTGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTGGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAGGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTTCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATCGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGAGGAATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAA---------------------------------------------------------------------------------------------------------------------------- Neesenbeckia_punctoria TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTTCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTCTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTGCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCCGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTGTGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Oreobolus_kuekenthalii TAAAGCAGGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCCGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAAGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGGAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Oreobolus_obtusangulus ------AGGTGTTGGTTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACAGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Oreobolus_pectinatus -----------------------------------------------------------------------------ATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCCGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGGAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Pseudoschoenus_inanis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTGAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACTGGAGGATTCACTGCAAATACTAGTTTGGCTTATTATTGCCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAAACAAAATAGAAAGATCAA Rhynchospora_rugosa_subsp._brownii ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTTGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAACCTGTTGCTGGGGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGTCACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACCAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGCGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAACGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAATATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Schoenus_curvifolius ------------------------------------------------------------------------------------------------------------------------AGTTCCCCCCGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCGTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTCATGCATGACTACTTAACCGGGGGATTCACCGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Schoenus_efoliatus ---------------------------------AGATTATAAACTAACCTATTATACTCCTGAGTACGAAACCAAAGACACCGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGATACAAGGGACGATGCTATCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTCTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCTCTACGAGCCCTACGCTTAGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATTCAATCTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAAGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCGGCTACATCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCCATTATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGCGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAATTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATCTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCCTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCCTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGGAATGAGATCATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCCGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTAGATAAAACGAAATAGAAAGATCAA Schoenus_nigricans TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACCGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAAATAGAT--------------------- Schoenus_pennisetis --------------------------------------------------------------------------------------------------------------------------------------AAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCTTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAATTAGCCGCTGCT--------------------------------------------------------------------------- Scleria_distans ----------------------GCAGGGGTTAAAGATTACAAACTCACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGCTGGAGAAGACAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGCGCTTTACGGTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAACGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTAGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTATGGTAGAGCATGTTATGAATGTTTACGTGGTGGGCTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATTAAAAGAGCTGTATTTGCTAGAGAATTAGGAGTTCCTATTATAATGCATGACTACTTAACTGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCATTCTGGTACAGTAGTAGGTAAACTAGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACTGAAATCTTTGGAGATGATTCTGTACTCCAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAGCTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATATGATCCGGTAGATAAACTAGAT--------------------- Tetraria_bolusii ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATA----------------------------- Tetraria_capillaris ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATTTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTGCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACGTCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACCAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCTTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTGTGGAAAGCAATTAAATTTGAATTCGATCCGGTAGATAAACTTGAT--------------------- Tetraria_compacta ----------------------GCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGAT--------------------- Tetraria_compar ----------------------GCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTACTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATTTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGAACCGGTAGATAAATTAGAT--------------------- Tetraria_crassa ----------------------GCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGAT--------------------- Tetraria_cuspidata ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATA----------------------------- Tetraria_exilis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGG{AG}GG{AG}TTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAA{CT}GG{CT}CTACTTCTTCACAT{CT}CACCG{CT}GCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCA{CT}TACGTATGTC{CT}GGTGGAGATCATATTCAC{GT}CTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATAT{CT}GAAAAAGATCGTAGTCG{CT}GGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCC{GT}GTGGCTTC{AT}GGAGG{AT}ATTCATGTTTGGCATATGCCTGCTTT{AG}AC{CT}GA{AG}ATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAAC{CT}TTAGG{AG}CA{CT}CCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATA----------------------------- Tetraria_flexuosa -------------------------------------------------TATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGACTTTGGCTTTTTATTGTCGTGATAACGGTATACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTTCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTGGATCCGGTAGATAAACTAG----------------------- Tetraria_involucrata --------------------------------AAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGAGTTTGTCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATAAACTAGAT--------------------- Tetraria_microstachys --------------------------------AAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTCTGTGCCGAAGCACTTTTTAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGAGTTTGTCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Tetraria_nigrovaginata ----------------------------------------------------------------------------GATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGACCGCCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGACTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTATTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACATTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGGATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT--------------------- Tetraria_octandra ---------------------------------------------------------------------AACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTGGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATCGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGAGGAATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATAAACTAGATAAGGCGAAATAGAAAGAT--- Tetraria_picta -----------------------------------------AACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTACTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATTTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGATAAGTAAGGCAAAATAAAAAGA Tetraria_sylvatica ------------------------------------------------------------------------------------------------------AGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTCCTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTACTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATTTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGAACCGGTAGATAAATTAGATAAGTAGATAAATTAGATAAGG Tetraria_ustulata --------------------------------AAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATTCCGCAAAAAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCCTTTTTGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGAGTTTGTCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAGGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTCATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTAGAT--------------------- Tetraria_variabilis ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGA------------------------------------------------------------------------------------------------------------------------------------------------------- Tricostularia_pauciflora TAAAGCAAGTGTTGGGTTAAAAGAAGGGGTTAAAGAGTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTTTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGACCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTATGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCGGAAGCACTTTTTAAATCACAAGCGGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTTCATCTGAACAAATGATCAGAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCACGACTACCTAACCGGGGGGTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATCGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCGTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAGTTTGAATTCGATCCGGTAGATAAACTATAT--------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18776] TITLE 'well-sampled taxa all genes'; LINK TAXA = Taxa8; DIMENSIONS NCHAR=4975; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Capeobolus_brevicaulis ----------------------------------------------------------------------------------CGTAGGTGAACCTGCGGAAGGATCATTGTTGTTGCCTT-GAAAAGAAT--AACCGTTGGGCATGTG-ATT---GAACCCTGCCGGGGAGGTGCTGCCG-CCTCGGCCAA-ATCGGCACCGGCCTTCATGCCCTAC-CGGGGAGCGTTGGTCC-TG-TGTTGA-AATACGGCGTGGATTGA--TGCCAAGGAACATGAGA--TTTTGTGGTGGTCGGCCGAGCGTT-AGGCGAGCGGCCTGCCGTCGTTGCA--------AAGGAA------CACA-AGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATCCATGCTCGGG--CTA----CCCTGATGCGGATCCTGGCCCTCCGAGCC--TGTGGGCGCGGTGGGCTG-AAGTGTGATGCTGTCGGAT-GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTTTGCGCT---GCCTCGTGTCCCTTGCCGAC------CATTGGCC-GACCCCC-GAATGAGGAGCCGGCTGACGCAGCGCTAT--GCTGTGCGGCATCCTCGGACCGATACCCCAGGTCAGGTGGGGCTACCCGCCGAGTTTAAGCATATCAATA--CTGCATTTTGTTGCGGCCATCTG-TCATGGGGTAGTCTTTTCAC-TCTTTCCTTTTGTGTGCTC-CTTTT--GC---GCAGGGGA----TGGTTGCGAC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAAC-TAATTTGTGGGCTTTGGGA-CGGTG---TTT--GC-TTGCCCTGCGGATA-CTTGCTAT-CTTGGGTGT-GGCTGTTTTAT-TATGTGAGAA----CTTGCGTCG-CAGT--GGTGGATT----GCACC-TATGCT--TCCCTTGTATTTC-ACCGTGTCTCATGGATGCTGTG--CCCGTCGAGGATTTCA-TGGGCCTCTGTTGCCCTGATTT-TCTTG--GGATCTCTGGTTGTGCAT--TGGATCATTTGCCCCCACGCATT--------CTGTGTC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGAGGGGACGTGTTCCATGTGCATATGTGAGATG-TTTTTCC-GACT----CAATGTG-CAA--TTGTCGGTTC---ACGCCATGCGAGTGG-ATTCCC----ATTTGGAG-TGCTCTCAAATGACGTGTCGTCTCTTGCTTAGGACGGGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGTCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGCGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGAAGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTCT---TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CATGATGAAGCTCGAG---------AGATTGATT-------------TTTTT---------ATCAAGCAAGGGAAAAAATCTAAGGTTAGTGAAAATTAA---------TAT---AATT--------AATTTAGACCTACTTTGTAAGTATATTCTTAGCATCGAA----------GAACATTCAATCCGA-----ACAACTTTC----------AAAAAAAAGAGAGAGTGAAATTGTTGG---AAACTAGTAAA-----GTTTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT---TATAAA---------GAAAA-----GAAGTAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAGGTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAGAAAATAAAAAGGATTCCGGAACAAGAAAACACTCT--TTGCAATTGTCTTAAC---AATGTA----ATTGGATCATAATGACGAATCCAAATA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGATAAGGATTT----TCCTTTGAACTTTCTCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATAAGA---------TTTTTTTTTGT-AATGAGGAG-GAAAAAGGATTCAATTC-GAATT--------AGAGTCTAATTCCTTATTAGACGAG-----TCCTTTTTGC-----ATTCTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG--------------CTGAGCTATCCCGACC------------AATCACCTGAGTAAAA------TACTCGTATCTATG-----TACTTATAGATAAGTCATTT-------AAATATTAAAATTATTATTTAATAATTAAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAATGGAATAGTAGATGTTAGGATAATGATATGGATTGGTTATGATTACATTATAGAGATAATGATATGGATTGGTTATGA-------TTACATTATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT-----ATATGTATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTCAAGAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTATAATGAAT--------------GATTTGATTACTCA-------ATATTGAA------------------------GT-CTTTTCTCATTGAACTTC-TATTTGAATTAATTCACAA-TAAATAATTCAGAATTTTT-TGAATTCATA-----AATATTTCCTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATATAACATGATTGTGATTATCATGA-ATTATTTAATTAATCAGT-ATATATACGTATGTT----------------------TTTGGTATATA-------------------GGGCTATCC-ATTATCTTA-TTTCGAT-AAAGA----TATTGCACTT---ACCAATGGAACGTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTC---------- Carex_magellanica -------------------------------------------------------------------------CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCGTTGCCTTTCCAG-AAACACGACCGTCGAACACGTG-ACA---GAATGCTGCCGCGGAGGCGCCGCCT-CCTCGGCCCC-ACCGGCCTCCTCCCTCTTGCCCTTC--GGGGCGCGTCGGTTGCTG--GTCGG-AATACGGCGCGGGATGA--CGCCAAGGAACACGGTA-AAGCTGAGGC-ACCGGCGAGACGCTCAAGGTCTCTGTCGGTTGCCAAGGCC--------ATCAAA-----AAAAA-ATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGT--TGC----CAGAGATGCGGATATTGGCCCTCCGAGCC--GCGAGGCGCGGTGGGCCC-AAGTGTGCGGCCGTCGTGC-GTGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCACGTC-ACCCCGAGCCCCGTACCGAC------CCTTGTAC-GACCCCC-TAACGAGGAGCAAGTCGCTGCGGCTTCG---GCTGTGCGGTGCCTTCGGACCGATACCCCAGGTCAGGCGGGGCTACCCGCCGAGTTTAAGCATATCAATA--CC---TTTTGGTGCGGCCAACCGAACATAGGGCTGTCTCTTCACTCTCCCA-CCCGTCATTGAACATGTTGT-----GGTCGGGA----TGCTT-CTGATCGGTTGCCTGTGCGGTTATACCCTCTTGTGGGTAGCGAAGTCGT---CCC-TTGA-TGGAT---ATTT-GC-TTGCCCTTGTGACATATTTATGT-CATTTGGAC-AGCCGAAATGT-TGGTGATATC----CTTGTGTTG-GCACGTGGTTGAAT----GCTGT-GTTGCTA-TCACTCGGATTTTTGCCGGCTCTCACGGATGCGGTG--CCTAGTGCTAGCTCTG-CGGGACTTTGC-CCCGCAGA---CTTCG--GGAGGTCC---CTTGTAC---GAATCA-TTG-CTCTTATACGC--------CGTCTTG-TCG------------------TGTCGCTACCGCGGCACGCCGGAGCGTGGTC-TTGTGCA--CGTGGAATG-CCTCTCC-GATC-GTATGAGCAG-CGA--TTTCCGATTT---GCGTCACGCGAAGGCCCCGCCCG---TCCGGGTCGGTGCTGGAGCTGACGCGCCGGCTCTCG-TTAAGACGTGC--------------------------TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTTAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------------CCATTTTCTTTATAG-AGTAAT-GAAAATGCTTTTGGTTCGACATAATTTGTTCTGT--------TCCG----------------TAAACAGTA-CATGATGAAGCTCGAA----------GTTTGATT-------------TTTTTATTTGTTCTATCAAATAAGGGAAAGAATCCAGGGTTAGTGAGAATTAACTTAAATTTCATTTTAATT--------AATTGAAAGAAACTTTGTCAGTATATTCTTAACATCGAGATCAAAAA----AAATCCAATTCAA-----ACAAGAAA----AAAAAATAAAAGAGAG-TAAAGTGAAATTGTTGG---AAATTGGTAAA-----ACTCTTTTGATTAT------AAGGTGGAATGGAAGTGAATTCTTCATATTTTATT---TATAAGTA-----------------TCAGGAAAT--C-AGAAAAAGGGGTGTTGCTTTCCCTTTGACAAGAAATAAGGATTTCCAAAATAATGAAATAATGTATAAACCTAAAGATTCCAAAAAGAAAATATAAAGAATTCCGGAACAAGAAAATACTTTG-TTGAAATTATCTCAAC---AATGTA----ATTGGATCATTTT----AATCTAAATATCTTTCTTAGAGATAAGACAAACAAAAGAGTTTATAGACAGCTCAAG-------AAATTTCT--TCATAAAGATTT----TCCTTTGAACTTCCTCAAAATT-----------TTTTAACTTGAGTCATGAGT--CAAAATGATA---------TTTTTCTCTAT-AACGAAAAGGAAAAAGGAACTCTTTTC-----------------------------------------------------C-----ATTCTATA---------------GATAAATTTAAATCA-TTTTTCTTGAGCCGTATGAGGT-GAAAATTTCACATACGTTTCTAGGG-AGGCTTTTTT-------GCTATCCCGACT--ATTTCTTGTGGATCACTCGAGTAGAA------TACTCGTACCTATG-----CCCTTGT--------CAATT-------AAAT-----------------------AAAGGAGCTCAAATAAAATAAA-----------------AATTTATTCAA-AAAAATAGAATAATCAATGT-----------------------------------TTAAGATTATGATA-TGATTGGTAATGA-------TTTCATTATAGA-----------------------AGAATGATTCTT------------TGCATA--TGCT-TAGGATCTTT---AAAGAG-ATTT-------------------TTT-GAAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTCAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTTATCATC---------------ATTTTTTC---------AATCTAACAAACTCTATAATGAATTCCATAAATAGAATAAATTGATTATTAA-------AAATTGAG-------------------------TTTTTTTCTCATTAAATTTCATATTTGAATCAATTCACCAT-AAACAATTCATAATTTAT-GGAATTCATC-----GAAATTCC----TGAATTTGCTATTCCATAATTATTGTTAATTTAATAATATGATTTGATT----TTATGATTA-ATAATTTGATTAATTATT-ATATATACGTACGTC------------------TTTGTTTGGTATAGA-------------------CGGCTATCC-TTTCTCTTA-TTTCGAT-AGAGA----AATTTT-------AGTATTGCAACATAATAAATTCTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCTTAGAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTC---------- Carpha_glomerata ---------------------------------------------------------------------------AGGTTTCCGTAGGTGAACCTGCGGAAGGATC{AT}TTGTCGTTGTCTT-{AC}CAA-AAACATGACCATGGCGCACG-A-GTCACAGAAAGCTGCCGGGGGGGCTTTGCCG-CTCCGGCCC--ACCGGCACCGGCACTCTCCCCCTTCGGGGGGTGTGTTGCATG-TG-TGCCG--AACACGGCGTGGGTTGA--CGCCAAGGAACAAGAGA--TGCTGAGGCGGCCGGCGGAGCGCTGAGGCGCACCGCAGGACGCCGATGCG--------AATGAA------CACAATGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATC-ACGCTCGTGGCGTCTACGCCCCGATGCGGAGCCTGGCTCTCCGAGCC--CCAGGGCACGGTGGGCCT-AAGAGTACGGCCGTCGGAT-CGGGC-------CTGGAGCGGCGAGTGGTGGTC--TA-CTTCGCACGCC-GCCCCGCGCCCATTGCCGGCAGAGGGCCTTGTAC-GACCCCC-GAACGAGGAGACGGCTGT-ATAGCGTACC--GCTGTGCGGCCACTTCGGACCGATACCCCAGGTCAGGC{AG}GGGCTACCCGCTGAGTTTAAGCATATCAATAAGCTGTGCTTCGGCGCAGCCAACCG-TCATGGGGCTGTCTTTTCACTCTCCCTCCCTTGCATT-CT--------GCTG-TGGAGGGA---CACGCTTGTTGCCGGCTGCCTGTGTGGTTTTACCCCTGCGG-GGATCGCAAGTCGTGACGTC---------CT---CCAA-GC-TTGCCCCGCCG--A-CATGTTGT-CGTGGGGGC-AGTCGGAATGT-TGGCGGAATC----CTTGTGTCGTCTGA--GGGCCAAT----GTCCC-CATGCG--GCACTCTGATCCT-GCCGGCTCTCATGGATGCGGTG--CCAAATGAAGGTTCTG-CGGGCCTCCGGT-CCCAGATTT-CCTCG--GGAGGTCC---CTTGCGC---GGATCG-TTG-CACCGCCGCTT--------CGCCCTT-TTA-CGGG-------------TGTCGGAGCGG-TGTGTG----------CTC-CTGCGCA--TGCGAGATG-TCTCTCC-ATTC----GAGTGAG-CGA--CTGCCGGTTC---GGGTTGCGCGGATGG-CCTCCC----TTGTCGGGTGTGCCG-AAGCGTCGTGCCGGCTCTCGTTTAGGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA-------------------------------AAAGATTATAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCGGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGCTCTGTTACTAATATGTTCACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTACTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTCATAAAGCACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGGGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTTGAT-----------------------------------------------------------CTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CATGATGGAGCTCGAGAAAAAAGAAAGATTGATT-------------TTTTT---------ATCAAGCAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA---------TAT---AATT--------AATTTAGACCAACTTTGTAAGTATATGCTTAGCATCGAAATCAAAAAACGAAAATCCAATTCGA-----ACAAGTTTC-----------AAAAAGAGA--GGGTAAAATTGTTTT---AAACTGGTAAA-----ATTTTTTTTATTTT------AAGGTGTAACGGGAGTGAATCCTTC---TTTTATT---TATAAA-------------------GAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTTA-AAGGAATAAAGGTCCCC--------GAAGTAATGTATAAACCCAAAGATTCCAAAAAGAAAAT--------TTCCGGAACAAAAAAACACTATATTTGCAATAGTCTCAAC---AATGTA----ATTGGGTCATAATGACGAATAAAAATA----AGTTAGAGATGAGATAAACAAAAGAGTATAGAGATAGCTCAAG-------AAA----T--TAATAAAGATTT----TCCTTTGAATTTTCTCAAAAAT-----------ATTCAACTTGAGTCGTAAGT--ATGAATGATA----------TTTTTTCTGGTAAAGAAGAG-GAAAAAGGATTCAAATC--------------ATAGTCTAATTCATGATTTTATGAG-----TCTATTTTGC-----ATTCTATA---------------CATAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-AAAACTCTCATATACGTTTCTGGGGGGAGCATTTTTTTTCTGAGCTATCCCGACC--AGTTCTTGCGCATCACCTGAGTATTC------TACTCAGGTCTATA-----TCCTTGTACCTGTATCAATT-------AAAT-----------------------AAAGGAACTCAAA--------T-----------------AATAATAAAA--AAAAATTGAATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGATTGGTAATGATTTCATTTTTCATTATAGA----------------------------GATTTCT------------TGGTT-----ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTTAAAAATCGACGGATTTTCCTCTTACTTTAAATTTCCTTGTTGTCGATATCGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT-ATATATACGTATGTC---------------TTTGGTATTTGGTATATA-------------------GGGTCATCCTTTTCTCTGA-TTTCGAT-AGAAA----AATCCT-------ACCAATGCAACGTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCAGTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Costularia_natalensis ------------------------------------------------------------------------------------------------------------------------------GAATA-AACCGTTGGGCATGTG-ATT---GAACCCTGCAGGGGAGGTGCTGCCG-CCTCGGCCAA-ACCGGCACCGGCCTTCATGCCCTAT-CGGGGAGCGTTGGTCC-TG-TGTTGA-AATACGGCGTGGATTGA--CGCCAAGGAACATGAGA--TTTTGTGGTGGTCGGCCGAGCGCT-AGGCGAGCGGCCTGCCGTAGTTGCA--------AAGGAA------CATA-AGAAGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGGACCTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATCCTTGCTCGGG--CTT----TCCTGATGCGGATCCTGGCCCTCCGAGCC--TGTGGGCGCGGTGGGCTG-AAGTTTGATGCTGTCGGAT-GGGGC-------CGCGAGCGTCGAGTGGTGGGCACAGGCTGAGCGCT---GCCTCGTGTCCCTTGCCGAC------CTTTGTCC-GACCCCC-GAATGAGGAGCCGGTTGACGCAGTGCTAT--GCTGTGCGGCATCCTCGGACCGATACCCCA------------------------------------------------------------------------------------------------------------------------------------GGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAAC-TAATTTGTGGGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA-CTTGCTGT-CTTGGGTGC-AGCCGTATTAT-TGGGTGAGTA----CTTGCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTTC-ACCGTGTCTCATGGATGCTGTG--CCTGTCGAGGATTTCA-TGGGCCTCTGTTGCCCTGATTT-TCTTG--GGATCTCTGGTTGTGCAC--TGGATCA-TTG-CCCCACGCCTT--------CTGTATC-TTG-CTGTTGATGTTGGGC--TGGCGGTGTGT-TGCGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC-GATT----CAATGTG-CAATTTTGACGGTTC---ACGCCATGCGAGTGGATTTCCC----ATTTGGGG-TTCTCTTGAATGACGTGTCGTCTCTTGCTGAGGACGGGCTACCTGGTTGATCCTGCCAGTAT---------------------------------------TTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTCT---TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CATGATGAAGCTCGAG---------AGATTGATT-------------TTTTT---------ATCAAGCAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA---------TAG---AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATCGAA----------GAACATTCAATTCGA-----ACAACTTTC------AAAAAAAAAAAAGAGAGAGTGAAATTGTTGG---AAACTAGTAAA-----GTTTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT---TATAAA---------GAAAA-----GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAGGTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAGAAAATAAAAAGGATTCCGGAACAAGAAAACACTCT--TTGCAATTGTCTCAAC---AATGGA----ATTGGATCATAATGACGAATCAAAATA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGATAAGGATTT----TCCTTTGAACTTTCTCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATGAATGAGA---------TTCTTTTTTGT-AATGAGGAA-CAAAAAGGATTCAATTC-GAATT--------AGAGTCTAATTCCTGATTAGACGAG-----TCCTTTTTGC-----ATTCTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG--------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACCTGAGTAAAA------TACTCGTATCTATG-----TACTTATAGATAAGTCATTT-------AAATAAGAAATTTAAAAATGAAAAATTAAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGAATAGTAGATGT-----------------------------------TAG-GATAATGATATGGATTGGTAATGA-------TTTCATTATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT-----ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGAATTTAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTAAAGAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTATAATGAAT--------------GATTTGATTACTCA-------ATATTGAA------------------------GT-CTTTTCTCATTGAACTTC-TATTTGAATTAATTCACAA-TAAATAATTCAGAATTTTT-TGAATTCATA-----AATATTTCCTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATATAACATGATTGTGATTATCATGA-ATTATTTGATTAATCAGT-ATATATACGTATGTC----------------------TTTGGTATATA-------------------GGGCTATCC-TTTATCTTAATTTCGAT-AAAGA----TATTGCACTT---ACCAATGGAACGTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTC---------- Eriophorum_vaginatum --------------------------------------------------------------------------------------------------------------TCGTTGCCTTTGGAA-AAACACGACCGGCGCACACGTG-ACA---GAATGCTGCTGGGGAGGTGCTGCCT-CCTTGGCCCC-ACCGCCCACAGCCCTCTTGCCCTAC---GGGCGCGTTGGTCG-TGG-GTCGG-AATACGGCGCGGGATGACGCGCCAAGGAACACGAGA-ATGCTGAGGC-ACCGGTCGGCCGCTCAAGGGGGGCGCCGGCTGCCAAAGGCAAATAATTGAAAAA------AAAA-ATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGC--TGC----CCCCGATGCGGACATTGGCCCTCCGAACC--GCGAGGCGCGGTGGGTCT-AAGTGTGCGGCCGTCGTAT-GTGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCACGCC-ACCCCGAGCCCCATGCCGAC------CTTTGTTT-GACCCCC-TAACGAGGAGCATGCCGCCGCGGCTTCAC--GCCGTGCGGCATCTTCGGACC---------------------------------------------------CTGCGCTTTTGCGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCG-ACCGTCAGCAAATTTGCTT------GGTTGGGA----TGCTT-GTCATCGGTTGCCTGTGTGGTTCTACCCTTTTGTGGGTAGCGAAGTCGT---CCC-TTGA-TGGAT---ATTT-GC-TTGCCCGGCTGACATTGTTTTGT-CGCTTGGGT-AGCCGAAATGT-CGGTGGAATC----CTTGTTGTT-GTGT--GGGCGAAT----GCCTT-GTTACAG-TCACTTGGATTTTTGCCGGCTCTCACGGATGTTGTG-CCCCATCGTTAGCTCTG-CGGGCCTCTGT-CCCACAGA---CTTCG--GGAGGTCC---CTTGCAT---GGATCA-TTG-CTCTTGC-----------------------------------------------------------GAGGAGCGTGCTG-ACGTGCA--TGTGGAACG-CCTCTCC-GATC-GTATGAGCAG-CGA--TTGTCGGTTT---GCGTCAAGAGAAGGG-CCTCCCG---TCCGGGTTGGTGCTGGAAATGATGTGCCGACTATCGTTTAAGACGTGC--------------------------TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGCTCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATCCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------CATCCATCGTTTTCTTTCTAT-AGTAAT-GAAAATGCTTTTGGCTCGACATAATTTGTTCTGTCTAGGTTGTCCG----------------TAAACAGTA-CATGATGAAGCTCGAA----------GTTTGATT-------------TTTTGATTTGTTCTATCAAACAAGGGAAAGAATCCAGGGTTAGTGAGAATTCACTT--ATTTAATTCTAATT--------AATTGAAATAAACTTTGTAAGTATATTCTTAACATCGAGATCAAAAA----AAATCCAATTCAA-----ACAAG---------AAAAAAAAAGAGAG--AAAGTGAAATTGTTGA---AAACTGGTAAA-----ACTCTTTTGATTAT--------------ATGGAAATGAATCCTTCGTATTTTATT---TATAAATA-----------------TAAGGAAAT--CAGAAAGAAGGGGTGTTGCTTTCCCTTTGA-CAGGAATAAAGATCTCC--------AAAGTAATGTATAAACCTAAAGATTCCAAAAAGAAAATATAAAGGATTCCGGAACAAGAAAATACTTTG-TTGAAATTATCTCAAC---AATGTA----ATTGGATCATTTTAATGAATCTAAATATCTTTCTTAGAGATAAGACAAACAAAAGAGTTTATAGACAGCTCAAG-------AAATTTCT--TCATAAGGATTT----CCCTTTGAACTTTCTAAAAATT-----------ATTTAACTTGAGTCATGAGT--CAAAATGATATTTTTTTCTATTTTTTCTAT-AACGAAAAG-GAAAAAGGACTTTATTT-GAATC--------ATCGTCTAATTTATGATTTTTTTAG-----CCCATTTTCC-----ATTCTATA---------------CATAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGT-GAAAATTTCATATACGTTTCTAGGG-AGGCTTTTTT---CTGAGCTATCCCGACC--ATTTCTTGTGGATCACCCGAGTAGAA------TACTCGTACCTATG-----CCCTTGTATCTACGTCAATT-------AAAT-----------------------ACAGGAGCTCAAATAAAATAAA-----------------AATTTATTCAA-AAA-TTTGAATAATCAATGT-----------------------------------TTAAGATAATGATA-TGATTGGTAATGA-------TTTCATCATAGA-----------------------ATAATGATTCTA------------TGCATA--TGCT-TAGAATCTTT---GAAGAA-ATAT-------------------TTC-GAAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTCAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTTATCATC---------------ATTTTTTC---------AATCTAACAAATTCTATAATGAAGAAAATAAATAGAATAAATTGATTACTAA-------AAATTGAG-------------------------TTTTTTTCTCATTAAACTTTATATTTGAATCAATTTACCAT-AAATAATTCATAATTTAT-GGAATTCAAA-----AAAATTCC----TGAATTTGCTATTCCATAATCATTGTCAATTTAAAAATATGATTTGATTGTTATTATGATCA-ATCATTTGATCATTGAGT-ATATATACGTACGTC------------------TTTTTTTGGTATAGA-------------------CGGCTATCC-TTTCTCTTA-TTTCGAT-AAAGA----TATTTT-------AGTAATGCAACATAATCAACTTTA-----TTCGTTAGAAAAACTTCCATCGAGTCTCTGCACCTATCTTGAAAGATTTGGCTCAGGATTGCCCATTCTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTC---------- Evandra_aristata CGGGCG-TTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGG-AGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA-CATTGTCGTCCGCTT-GCGA-AAACACGACCGTTGCGCACGTG-ATC---GAATGCTGCCGGGGAGGCGCCGCCC-CCTCGGCCC--ACCGGCCTCGGCCCTCGCGCCCTCT--TGGGCGCGTTGGTCG-TG-TGCCG--AA-ACGGCGCGGGTTGA--CGCCAAGGAACACGAGA--CGCTGAGGCGGCTGGCGGAGCGCTG-GTCGCGCCGCACGCCGCCGATGCA--------ACGGAA------CGCT-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCAT-GATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAA-CCCATCTACGCTCGGG--CGC----CCCCGATGCGGATCCTGGCCCCCCGAGCT--CCAGGGCGCGGTGGGCCC-AAGTGTGCGGCCGTCGGAT-GGGG-------CAGGGAGCGGCGAGTGGTGGGC--TG-CTGCGCACGCC--CCTCGTGCCCCTTACCGTC------CTTTGTCC-GACCCCC-GACCGAGGAGACGAACGACGCAGCGTCCC--GCTGCGCGGCATCTTCGGACCGATACCCCAGGTCAGGCGGGGCTACCCGCCGAGTTTA-GCATATAAATAAGCCGCACTTTGGTGCGGCCAACCG-TTGTGGGGCTGTCTTTTCACTTTTCCT-TCCGTCGTGCTT-CTTTT--GCCG-GGGAGGAA----TGCTTGTTAT-CGG-TGTCTGTATGGTTCTACCCCCGCGG-GGAACAACG---TTGCGTTTAAAGA-AGGAT---TTTT-GCTTTGCCCCGCTGATA-TTTGTTATATTTCGGTGCAAGCTGATTTGT-TGGCTGGGTGAGAACTTGTGTGG-AAGT--GGGCTCAT----GCCCT-GCGGCC--GCACTTGGATTTT-GCCGGCTCTCACGGATGCCGTG--CCCAACGAGGATTCTG-CGGGCATCTTGTCCCCTG-ATTTCCTCG--GGAGTTCC---CATGTATCCTGGGTCA-TTC-CTCCGCCGCTC--------AGCTATC-GTG-TTGCCGTTGTTGGGA--TGTTGGAGCGG-TGCGTGCGGGG-CGTGCTC-CGGTGCG--TGCGAGATG-TCTATCCTGATT----GAACGAG-CGA--CTGTCGGTTT---CCGTCGCGTGAATGG-ACT---------------------------------------------------------------------------------TAAAGCAAGTGTTGGATTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGACAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTCTCTTATTCTGTGCCGGAGCTCTTTATAAAGCACAGGCCGAAACTGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCATGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTTTTGTGGATCATCTGAGTAGAA------TACTCGTATCTAG-TAATGTACTTGTACCTATGTCAATTGTCAATTAAAT-----------------------AAAAGAATTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGAATAGTCAATGT-----------------------------------TAG-GATAATGATATGAATTGGTAATTA-------TTTCATTATAGA----------------------------AT----------------------------AATGTATTATTTTGCGAAGAA-ATAC-------------------TTA-GGAAATCCAATGGGTTTGGGGATAGAGGGACTTGAACCCTCATGATTTCAAAAATCGACGGATTTTCTTCTTACTATAAATTTCATTGTTGTCG-TATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC------------------ATTTTTTT----CAAAAGATCTAGCAAACTCTATAATGAAT--------------GATTTGATTACTCA-------ATATTAAAGAATGATTTGATTACTCAATATCAATTCTTTTCTCATTAAACTTC-TATTTGAATCAATTCACCATTAAAGAATTCAGGATTTTT-TGAATTCATA-----AATATTTC----TGAATTTGCTATTTCATAATCATTCACAATTTAAGAATATAATTTGATCGTGATTATGATGA-ATCATTCGATTAATCAGT-ATATATACGTATGTC----------------------TTTGGTATATA-------------------CAGCTACCC-TTTCCCTTA-TTTCGAT-AGAGA----AATTCCACCT---ACCAATGCAA-ATAATTAACTCTA-----TTTGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTCAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Ficinia_paradoxa --------------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTGTTGCTAACCTTG-----AACACGACCG-TGAACATGTA-ACA---TAATGCTACCGGGGA-GTACCATCT-CCTCGGCCCT-GCCGGCCC--------------------CGGCCTATTGGTCG--GGTGTCGG-AATACGGCGCGGGATGT--CGCCAAGGAACACTGAA-TTGCTGAGGCGGACGACAATACGCTC--GTA---------CTGCTGATGCC--------AACTT-------AACA-TTATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCAACACTCAGT--CGC----CCCTGATGTGGACAATGGACCTCCGAGTCAGTAATGGCACGGTGGGCTG-AAGTTAATGGTCGTCGGAT-GGTAA-------CGGGATCGGCGAGTGGTGGGC-TAA-CTGCGCAAGCCAATCCCGGCTGCCATGTCGAC------CCTCTTTT-GAACCCC-AAATGAGGAGATTGTCGTCGCAGCATCTA--GTTGTGCGGCAATTTCGGACCGATACCCCAGGTCAGGCGGGGCCACCCGCTGAGTTTAAGCATATCA-----CTGCACTTCTGTGCGGCCAACTG-TCATGGGGCTGTCTTTTCGTTGT-CCA-TTTGCCTAGTAATTTGCTA------GTTATGGA----TGATT-GTCATCGGTCGCTTGTATGGTTCTACTCTTTTG--GGTAGTGCATAATT-GTTTTGTTGA-TGCCT---ATTTAGC-CTGTTCTGTTAATGTTAT--TGT-TGACAGGAC-GGTCGAGATGT-CAGTGAATTT----CAAGTGTTT-CCAT---GTGCCTA----GCCAT-GGTAAT--GCACTTGGATGTTCGCTGGGTCTCATGGATGCGGTC--CCTATTGTGAGCTCTG-CGGGCTTCATG-CCCGTAGAA--CCTG---TGAGGTTG-CCCCTGCAT---AGATCA-TTG-CTCT---------------------A-TTG------------------CTTCACTGACACATCTTGTTTGGGTGTTGTT-CTTTGCT--TGCGGCATG-CCTCTTA-GACCCGAATGACTTG-CGA--TTGCTGGTTT---GCGTTGTCACAAGGCTCCTCCCA---ATTGGGTAGTGGCTGGAGATGACGTTCCTGCTCTCGTTTAAGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA--------------------------------------------------------CTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTGCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGACTTACTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTGATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------------------TCTTTCTAT-AGTAATGGAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCCG----------------TAAACAGTA-CATGATGGAGCTCGAG----------GTTTGATT-------------TTTGT---------ATCAAATAAGGGAAAGAATCTAGGGTTAGTGAGAATTAAATT------AATTCTAATT--------AATTTAGACCAATTTTGCAAGTATATTCTTAGTATCAAAATCATAAA---AAAATCCAATTTGA-----ACAAG------------AAAAAAAATAG--AAAGTGAAATTGTTGG---A------TAAA-----ACTATTCTGATTTT------AAGGTGGAAGGGGAATGAATCCTTCGTATTTATTT---TATAAA-------------------GAAGGAAAT--CACAAAGAAGGGGTGTTGCTTTCCCTTTGA-AAGGAATAAAGGTCTCC--------AAAATAATTTCTAAACCTAAAGATTCCAAAAAGAAAAAAGAAAGGATTCCGGAACAAGAAAATACTTT--TTTTAAATATCTTAAC---ACTGTA----ATTGGATCAAATTGAAAAATCTAAAAA----GGTTAGAGATAAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AAATTGTT--TCATAAGGATTTATTTTCCTTC-AACTTTCTAAAAATTTTTT-------ATTTAACTTGAGTCATGAGTAAAAAAAAAATATTATGATA-TTTTTTTATAT-AACGAAGAA-GAAAAAGGACTCTATTT-GAATT--------ATAGTATAATTCATGATTTTCTAAG-----TTCATTTTAT-----ATTCTATA---------------CAGAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGT-GAAAATCTCATATACGTTTCTAGGG--GGCTTTTTT----CCGGCTATCTCCACCAAATTTCTTGTAAATCACCTGAGTAGAA------TACTTGTACCTATA-----CCCTTGTATCTACGTCAATT-------AAAA-----------------------AATTGAGCCCAAC-----AAAA-----------------AATTTATTCAA-AAAAATAAAATAGTAAATG------------------------------------TTAAAATATTGATATTAATTGGTAATTA-------TTTCAATATAGA-------GATTCTTTATTGAAAGAAAGAGATTCTT------------TGCCTA--TGCT-TAGATTCTTTTCAGAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTAAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCCTTGGATTTATCATC---------------ATTTTTTC---------AATATAAAAAACTCTATATTGAAT----ATAATATATTCAATTTATTACTCA-------AATTTGAA------------------------TTTTTTTTTTCATTGAACTTCATATTCGAATCAATTTACCAT-AAAGGATTCTTTATTTTT-TGAATTCATT-----AAAATTTA----TGAATTCACTATTCCATAATCAATAGTAATTGAAAAATATTATATGATTGTTATTATGATTA-ATCATTTTATTAATCAGT-ATGT--ACATACGTC----------------------TTTGGTATAGA-------------------CGGCTATCC-TTTCTATTA-TCTCGAG-AGAGA----AATTCT-------AGCAATGCAACATAATAAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAATGATTTGGCTCAGGATTGCCCTTTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTC---------- Gahnia_tristis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCGTCCACGCTCGGG--CGC----CCTCGATGCGGATCCTGGCCCTCCGAGCC--CGAGGGCGCGGTGGGCCC-AAGCGTGCGGCCGTCGGATGGGGGT-------CTGGAGCGGCGAGTGGTGGGC--TG-CTGCGCACGTC-GCCCCGCGCCCCTTGCCGGC------CTTTGTTTCGACCCCT-GGACGAGGAGCCGGATGACGCAGCGCCAT--GCTGTGCGGCATCCTCGGACCGATACCCC-------------------------------------------CTGCGCTTCGGCGTGGCCAGGCG-TCATGGACTTGTCTTTTCACTTATCCT-CCTGTTGTGCTT-ATTTT--GCCGGGTTCGGAG----CGCTTGTTAT-CGGCTGTCTGTGCGGATCTACCCTGGTGG-GCATCAATG---TCGTGGTTCGTGA-TGGGT---TTT--GC-TTGCCCCGCCGATG-CTCGCTAT-CGTCGGTGC-AGCTGATGCGTCTGGCTTATTA----CTTGTGCGG-TGGT--GGGCGAAT----GCCCTC-GTGCC--GCACTTGGTTTATGCCGGGCTCTCATGGATGCGGTGCCCCATTTGAGGTGTATG-TGGGCCGTCGGTTCCTCTGACTTCCTCG--GGAGGTCC---CATGTGC---GGATCG-TGG-CTCTGCCGCTC--------AGCTCTC-TCG-TTGCGGA----------TGTTGGAGCAG-CGCGTGCGAGG-TGCGATC-TTGTGCA--TGCGAGATG-TTTGTCC-GTTT----GTATGAG-CGA--TTGCTGGCTC---ACGTCGTGGCAGCGG-GCTCCT----GTTTGGGGCGCGCCGGA-GCGACGCGTCGGCTCTCGTTTAAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCACCATTTTC----TAT-AGTAAT-GAAGATGCTCTTAGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CATGATGGAGCTCGAG-AAAAAAAAGGCTTTATTTTTTTATAAAGCATTTTT---------ATAAAGCAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA---------TAT---AATT--------AATTTAGACCAACTTTGTAAGTATATTAGTAGCATCGAAATCAAAAATAAAACATCTAATTAAAATCGAACAAGT---------AAAAAAAGATAAA-----GTGAAATTGTTGG---AAACTCGTAAAATAAAACCATTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCGTATTTTATT-----------C------ATAAA-----GAAGGAAAT-----AAAAAAGGTATGTTGCTTTCCTTTTGA-GAAAAAAAAGAATCCCC--------GAAGTAATGTATAAACCCAACGATTCCAAAAAGAAAATAAAAAGGATTCCGGAACAAGAAAACACTAT--TTGCAATTGTCTCAAC---AATG-------------CATAATGACGAATAAAAATA----CATTAGATATGAGACAAACAAGGGAGTTTAGAGACAGCTCAAG-------AGA----T--TAATAAGCATTT----TCCTTTGAACTTTTTCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA-----------TTTTTCTGT-AAGGGGGAG-GAAAAGGGATTCAATTC-GAATT--------AGAGTTTAATTCATGATTTTATGAGATGAGTCCATTTTAC-----ATTCCATA---------------CAAGAATTGAAATCA-TTTTTCTTGAGCCGTATGAGGG-GAAAATCTCATATACGTTTCTGGGGGGAGCATTTTTTT-CTGAGCTATCCCGACC--ATTTCTTGTGGATCACCAGACCAGAA-----ATACTCGTATCTATG-----TACGAGTACCTGTGTCAATT-------AAAT-----------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGAATAGTCAATGT-----------------------------------TAG-GATAATGATATGAATTGGTAATGA-------TTTCATTATCGA----------------------------GATTCGT------------TGCTT-----ATATGTATTATTTC--GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGGATTTGAACCCTCATGATTTAAAAAATCGACGGATTTTCATCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGT-ATATATACGTATGCC----------------------TTTGGTATATA-------------------CGTCTATCC-TTTCTCTTA-TTTTGAT-AGAGA----AATTCCACCT---ACCAATGCAACGTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCT---------------------------------------------------------------------------------------------------- 'Lagenocarpus albo-niger' --------------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGGCTCAGGGA-AA-CGTGACCGGTGCATATGTG-ATG---TAACATTGCCGGGGAGGTGCTCCTG-ACTCGGCCCACAACGGCTCGGTCCCTCATGCTTGTC---GGGCGTGTCGGACG-CG-TGTCG--AATACGGCGTCGGTTGG--CGCCAAGGAACACGAGG--TGCGGAGGTAGCTGGCGGAGCGTTGGTGCGCGTCGTCAGTTGCTGATGCG--------ACGCAA------AGTG-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAGCCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGGACTCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGTCCATGCACGCTCGGG--TGC----CACCGATGCGGACCCTGGACCTCCGAGCC--TTAGGGCGCGGTGGGCCT-AAGTGTTCGGCTGCCTCTA-GGA----------GGGAGCGGCGAGTGTTGGGC--TG-TTGCGCACGTC-GCCGATAACCCTTGCCCTGA------TCTTGTTG-GACCCCT-GAACGAGGAGCTCGACGTCACGGCGACCT--GTCGTGCGGCATCCTCGGACCGATACCCCAG----------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCGTCTCG-TGACAGGAAATGCTTTGGC-------TAAGT---GCTC-GC-ATGTTTTGCTG---TTTGATAGA-TGGCAGCAC-AAGTGGCTGAT-GGCGGAT-------CCTTGCGTGGATGT--GGGATATC--------C-ATACCACTGCTCAAGGATGTT-GCTGGCTCCTATGGACGCTGTG--TGCAATGAGCGATCTG-TTGGCCGTTGGCCAAGCAGTTT-GCATGAAGGAGGTCT---CATGCGC--TAGCTCA-TTT-GGCT-----------------------------------------------------------------GAGCG--------GTGCG--TGTGAGAC------TCC-CCTGTTCGCTT-GAG-CGG--TAGCCGCTGC---ACGTCATG-TGTGGG------------------------------------ACCCAATCTTGTATAGGGGGT---------------------------------------------------------------------AACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTATAAAGGACGATGCTACCATATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATCCCCCCCGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTAGGATTATCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGACGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTT---------------------TTTATAAATCACAGGCCGAAACGGGTGAAATCAAAGGACACTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACTGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTTCGTGTACTTGCTAAAGCATTACGTATGTCTGGTGGAGATCACATTCACGCTGGTACAGTAGTAGGTAAATTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTGCTCGCGGTATCTTTTTTACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACTGAAATCTTTGGAGATGATTCCGTCCTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAATATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTAGAT-------------------------------TTTC----TAT-AGTAAT-GAAGATGCTCTTGGTTCGACATAATTTGTTCTGTATAGGTTGTTAG----------------TAAACAGTA-CATGATGAAGCTCGAG-AAAAAAAAGGATTGATT-------------TTTTT---------ATCAACCAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA---------TAT---AATTAATTTATAAATTTAGACCAATTTTGTAAGTATATTCTTAGCATCGAAATAAAAAAGTGAAAATCCAATTCGA-----ACAAGTTTCAA--AAAAAAAAAGAAAAG-----ATGATATTGTTGG---AAACCGGTAAA-----ACCACTTTGATTAT------AAGGTATAACGGGAATGAATTCTTTGTATTTTTTT---TATAAA-------------------GAAGGAAATAAT-AAGAAAAGGTATGTTGCTTTCTTTTTGA-GAGGAATAAAGATCCCC--------GAAGTAATATTTAAACCCAATGATTCCAAAAAGAAAATATAAAGGATTCTGGAACAAGAAAACACTAT--TTCCAATTGTCTCAAC---AATT----TAATTGGATTATAATGATGAAAAAAAGTA-----GTTAAAAATGAGACAAACAAAAGAGTTTAGAGACAACTCAAG-------AAG----T--TAATAAGGGTTT----TCCTTTGAACTTTCTCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGATTGATA---------TTTTTTTCTGT-AAGGAAAAC-AAAAAAGAGCTCATTTC-GAATC--------ATAGTCTAATTAATGATTTTATGAG-----CCCATTCTGT------TTCTATG---------------CAGAAATTTGCATCA-TTTTTCATGAGCCGTCTGAGAG-AAAAATCT------------------------------------------CGGCC--ATTTCTTGTGGATCACACAAATAGAA------TACTCATATCTATG-----TCCTTGTACATATGTCAATT-------AAAT-----------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAAGAAAAATTGAATAGTCAATGT-----------------------------------TAG-GATAATGATATAGATTGGTATAAA-------TTTCATTATAGA----------------------------GATTCCT------------TGCTT-----AA--------------GAAGAA-ATAC-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTCAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTTTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC------------------ATTTTTTC----A-AAAAATTTAGCAAATTCTATATTGAAT----------------TTTGATTACTCAATATTCTATATTGAG------------------------TTTTTTTTCTCATTGAACTTC-TATTCGAATCAATTCATCA-AAACAAATTCATAATTTTA-TGAATTCATA-----AATATTTT----TGAATTTGTTATTTCATAATCATTAACAATTT-AAATAATAATTTGATCGTGACTATGAATAAATCATTTGATTAATCAGT-ATGTATACGTATGTC----------------------TTTGGTATATA------------------TGGGCCATCT-TTTCTCTTA-TTTCGAT-AGAGA----AATTCCACCTACCACCAATGCAACGTAATTAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAGTTTGAAAGTTAACACT---------------------------------- Lepidosperma_longitudinale -------------CGCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGGCTT-GCGA-AAACACGACCGTTGTG-ACGTG-ATC---GAACGCTGCCGGGGAGGCTATGCCG-CCTCGGCCC--AACGG-CCCGGCC-TCGCTCCCTT---GGGGCGCGCTGGCCG-TG-TGCCG--AACACGGCGCGGGTTGA--CGCCAAGGAACACGATA--AGCTGA-GCGGCTGGC-GAGCGCTGAGACGCACGGCCTGCCGCCGATGCA--------AAGGAA-----AAACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAA-TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTC--TGC----CCCCGATGCGGATATTGGCCCTCCGTGCC--TAAAGGCGCGGTGGGCCT-AAGTACGTGGCCGTCGGGTTTGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCG-GCCCCTTGTCGGC----------TGCC-GACCCCC-GAACGAGGAGCCGAACGACGCAGCGCCTT--GCTGTGCGGCTTCTTCGGACCGATACCCCAGGTCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG-TGCGCTTCGGCGTAGCTGACCG-TCGTGAAGCTGTCTTTTCACTCCTCCT-CCTGTTGCGCTTCGTTTT--GCGG-GAGAGGAA----C----GTTGT-TGGTTGTCTGTGCGGTTCTACCCTCGAGG-GGAATAACGATCTTTTGTTTCATGA-TGGAT---TTTT-GC-TTGCCCC-TCGGTG-TTTTTTAT-CGTCGGCGT-AGCTGATTTGT-GGGCTAAATA----CTTGAGCTG-CAGC--GGGTGTAC----GCACC-TGTATCCAGCACTTGTGTTTT-GTCGGCTCTCGCGGATGCAGTG--TTCATTGAGGAATCAG-TTGGCCTCTGGTCCCCTGATTT-CCTCG--GGAGGTCC---CTTGCAC---GGATCA-TTG-CTCTGTCGCTC--------TGCTAAC-CTG-TCCCGGTTGTTGGGA--TGTCGTGGCGG-GGCGTGCGGGG-CGTGCTC-CCGTGCA--TGCGAGATGTTTTGCCC-GATTATCGGAATGAG-CGA--CTGCCGGTTC---ACGTCTTGTGAGCGG-ACGCCTATTTATTTAGGGTTTGCCGC-AACGATGTGTCGGCGCTCGTTTAAGACGTGCTACCTGGTTGATCCTGCCAGTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACAGGCTG-AACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTAACCGGGGGCTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTGTTTAGGTTGTCAGTAAATTAGGTTGTCAATAAACAGTA-CGTGACGGAGCTCGAG-AAAAAAAAGGATTGATT-------------TCTTCA--------ATCAAGCAAGGGGAAGAATCTAGGGTTAGTGAAAATTAA---------TAT---GATT--------AATTTAGACCAACTTTGTAAGTATGTTCTTAGCATCGAAATCAAAAAGAGAATATCCAATTCGA-----ACAAGTT--------AAAAAAAAAAAAGAGAAGTTTAAATTGTTGG---AAATTGGTAAA-----ACTGTTTCGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATATTTTATTTT-TATATATT-TTATAAAGAAA-----GAAGGAAATATC-AAAAAAAGGTATGTTGCTTTCCTTTTAA-GAAGAATAAAGGTCCCC--------GAAGTAATGTATAAACCCAATGATTTAAAAAAGAAAATATAAAGGATTCCGGAACAAGAAAACACTAT--TTGCAATTGTCTCAAC---AATGTC----ATTGGATCATAATGACGAATAAAAATA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGACATTGA-------------TAAGGATTT----TCCTTTGAACTTTATAAAAATTATTAAAAAATGATTCAACTTGAGTAACGAGT--ATAAATGATA---------TTTTTTTCTGT-AAGGAGGAG-GAAAAAGGATTCAATTC-GAATC--------AGAGTCTAATTAATGATTTTAAGAG-----TCTATTTTGT-----ATTCTATA-CAAAATTCTATACAAAAAAAGTTGAATCATTTTTTCTTGAGCC----------------------------------------------------------------------------------------------------ACTCGTATCTAGA-----TACGAGTAGCTATGCCAATT-------AAAT-----------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGAATAGTCAATGT-----------------------------------TAG-AATAATGATATGGATTGGTAATGA-------TTTCATTATAGA----------------------------GATTCTT------------TGCTT-----ATATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTAAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC------------------ATTTTTTC----ATAAAGATCTAGCAAAGTCTATAATGAAT--------------GATTTGATTACTAA-------ATATTGAA------------------------TT-CTTTTCTCATTGAACCTC-TATTTGAATCAATTCACCA-TAAAAAATTCATAAATTTT-TGAATTTATA-----AATATTTT----CAAATTTGCTATTTCATAATCATTCACAATTTAAGAATATAAATTGATCGTGATTATCATTA-ATCATTTGATTAATCAGT-GTATATACGTATGTC----------------------TTTAGTATATAGTTTAGTATATAGATAGAGTGGTTATTC-TTTCTCTTA-TCTCGAT-AGAGA----AATTCCACCT---ACCAATGCAACGTATTCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCT------------------------------------------------------- Lepidosperma_tortuosum CGGGCGGTTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTC-TTGGCTT-GCGA-AAACACGACCGTTGTGCACGTG-ATC---GAACGCTGCCGGGGAGGCGCTGCCG-CCTCGGCCC--ACCGG-CCCGGCC-TCGCTCCTTC---AGGGCGCGCTGGCCG-CG-TGCCG--AACACGGCGCGGG-TGA--CGCCAAGGAACACGATA--GGCTGAGGCGGCCGGC-GAGCGCTGAGGCGCACGGCCTGCCGCCGATGCA--------AAGGAA-----AAACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCG-CCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--TGC----TCTCGACGCGGATATTGGCCCTCCGTGCC--CAAAGGAGCGGTGGGCCT-AAGTACGTGGCCTCGGGTT-TGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCGTGCCCCCTGCCGGC------CGGCCGCC-GACCCCC-GAACGAGGAGCCGAACGA-GCAGCGTCTT--GCTGCGCGGCTTCTTCGGACCGATACCCCAGGTCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG-TGCGCTTCGGCGCAGCCGACCG-CCGTGAAGCTGTCTTTTCAC---TCCT-CCTGTTGCGCTTTGTTTT--GCGG-GCGAGGGA----C----GTTGT-CGGTTGTCTGTTTGGTTCTACCCTCGAGG-GGGATGACA--TTATTGTTTCATGA-TGGAT---TTTC-GC-TTGCCCCGTCGGTATTTTTTTAT-CGTTGGTGC-AGCCGATTTGT-TGGCTAAATA----CTTGAGCTG-CAGT--GGGTGTAC----GCACC-TGTACTCGGCACTCGAATTTT-GCTGGCTCTCGCGGATGCAGTG--TCCATCGGGGAATTCGTTGGGCCTCTGGTCCTCGGATTT-CCTCG--GGAGGTCC---CTTGCAC---GGATCA-TTG-CTCTGCCGCTC--------TGCTCTCGTTG-TCCCGGTTGCTGGGA--TGTCGTGGCGG-CGCGTGCGGGG-TGTGCTC-CTGTGCA--TGCGAGATGTTTTGCCC-GATC----GAATGAG-CGA--CTGCCGGTTT---ACGTCTTGTGCGTGG-ACTCCTATTTATTTAGGGTTTGCCGC-AATGATGTGTCGGCGCTCGTTTAAAACGTGCTACCTGGTTGATCCTGCCAGTA----TAAAGCAGGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTAACCGGGGGCTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTCAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATACGATCCGGTAGATAAACTAGAT-----------------------------------------------AT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTGTTTAGGTTGTCAGTAAATTAGGTTGTCAGTAAACAGTA-CGTGACGGAGCTCGAG-AAAAAAAAGGATTGATT-------------TCTTTA--------ATCAAGCAAGGGGAAGAATCTAGGGTTAGTGAAAATTAA---------TAT---GATT--------AATTTAGACCAACTTTGTAAGTATGTTCTTAGCATCGAAATAAAAAAGAGAATATCCAATTCGA-----ACAAGTT--------AAAAAAAAAAAAGAGAAGTTGAAATTGTTGG---AAATTGGTAAA-----ACTGTTTCGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATATTTTATTTTTTATAAATT-TTATAAAGAAA-----CAAGGAAATATC-AAAAAAAGGTATGTTGCTTTCCTTTTAA-GAAGAATAAAGGTCCCC--------GAAGTAATGTATAAACCCAATGATTTAAAAAAGAAAATATAAAGGATTCCGGAACAAGAAAACACTAT--TTGCAATTGTCTCAAC---AATGTC----ATTGGATCATAATGACGAATAAAAATA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGACATTAA-------------TAAGGATTT----TCCTTTGAACTTTCTAAAAATTATTAAAAAATGATTCAACTTGAGTAACGAGT--ATAAATGATA---------TTTTTTTCTGT-AAGGAGGAG-GAAAAAGGATTCAATTC-GAATC--------AGAGTCTAATTAATGATTTTAAGAG-----TCTATTTTGC-----ATTCTATA-CAAAATTCTATACAAAAAAAGTTGAATCATTTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------------------------------------ACCTGAGTAGAA------TACTCGTATCTAGA-----TACGAGTACCTATGCCAATT-------AAAT-----------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGAATAGTCAATGT-----------------------------------TAG-GATAATGATATGGATTGGTAATGA-------TTTCATTATAGA----------------------------GATTCTT------------TGCTT-----ATATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATAAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTAAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC------------------ATTTTTTC----ATAAAGATCTAGCAAAGTCTATAATGAAT--------------GATTTCATTACTAA-------ATATTGAA------------------------TT-CTTTTCTTATTGAACCTC-TATTTGAATCAATTCACCA-TAAAAAATTCAGAAATTTT-TGAATTCATA-----AATATTTT----AAAATTTGCTATTTCATAATCATTCACAATTTAAGAATATAAATTGATCGTGATTATGATTA-ATCATTTGATTAATCAGT-GTATATACGTATGTC----------------------TTTAGTATATAGTTTAGTATATAGATAGGGTGGCTATTC-TTTCTCTTA-TCTCGAT-AGAGA----AATTCCACCT---ACCAATACAACGTATTCACTTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGG------------------------------------------------------------ Machaerina_rubiginosa ------------------------------------------------------------------------------------------------------GATCATTGTCGCTGGCTT-GCAA-AAACACGACCGTTGTGCACGTG-ATC---GAAAGCTGCCGGGGAGGCTCTGCCG-CCTCGGCCC--ACCGGCC-CGGCCATCGCGCCCTC---GGGTCGCGTTGGTCG-TG-TGCCG--AATACGGCGTGGGTTGA--CGCCAAGGAACACGAGA--TGCTGAGGCGGTTGGCGGAGCGCTGAGGCGCACGGCCCGCCGCCGATGCA--------AAGGAA-----AAACT-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--CGC----CCACGATGCGGATATTGGCCCTCCGTGTC--TATAGACGCGGTGGGCCT-AAGTACGTGGCCGTCGGGC-TGGGCTCATCCGCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCGTGCCCCCTGTCGGC--------CT-TCC-GACCCCC-GAACGAGGAGCCGACCGACGCAGCATCCT--GCCGCGCGGCATCTTCGGACCGATACCCCAG-----------------------------------------CTGCGCTTCGGCGCGGCCAACCG-TCGTGGAGCTGTCTTTTCACTCCTCCT-CCCGTTGCGCTTTTTTTT---CGG-GGGAGGGA----CGC--ATTGT-CGGTTGTCTGTGTGGTTCTACCCTTGCGG-GGTATATCA---TTGTGTTGCATGAATGAAT---TTTT-GC-TTGCCCCGTCGATATTTTTTTGT-TGTCGGGGC-AGCCGAT-TGT-TGGCTAGATG----CTTGCGCTC-CAGC--GGGCGAAT----GCCCCCTGTTCTCCGCGCTTGGATTTTTGCCGGCTCTCGCGGATGCCGTG--TCCATCGAGGAATCCG-TTGGCCTCTGG-CCCCGGGTTT-CCTCG--GGAGGTCC---CTTGCAC---GGATCA-TTG-CTCTGCCGCGC--------TGCTATC-TTG-TCCCGTGTGCTGGGA--TGTTGTGGCGG-TGCGTGCAGGG-TGTGCTC-TAGTGCA--TGCGAGATG-TTTGCCC-GATT----GAATGAG-CGA--CCGCCGGTTT---GCGTCGTGCGAGCGG-ACTCCTACTTGTTTAGGGTTCGCCGC-AACGGTGTGCCGGCTCTCGTTTAAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCATAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTAACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTACCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTCTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCGACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCGATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGATCTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGGCC--ATTTAT-GTGGATTACCTGAGTAGAA------TACTCGTATCTAGA-----TACGAGTACCTATACTAATT-------AAAT-----------------------AAAGTAACTAAAA-----TAAA-----------------AATTTATTCAA-AAAATTTGAATAGTCAATGT-----------------------------------TAA-GAAAATGATATGGATTGGTA-TGA-------TTTCATCATAGA----------------------------AATTCTT------------TGCTTA-----TATGTGGTATTTTCTGAAGAA-ATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTAAAAA-TCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTAATTAATATTCTCGTTTAATTAATCATTTTTTTT----CAAAAAATTTAGCAA-CTCTATAATGAAT--------------TATTTTTTTACTAA-------ATATTGAA-------------------------TTCTTTTTTCATTGAACCTC-TATTTGAATCAATTCACCAT-AAAGAATTCATAAATTTG-TGAATTCATC-----AATATTTT----CAAATTTGCTATTT-ATAATCATTTGAAATTTAATAATATAAATTGATCGTGATTATGATTCAATCATTTGATTAATCAGT-GTATATACGTAT-TC----------------------TTTAGT----------------------GGCGACTATTC-TTTCTCTTA-TCT-AAT-AGAGA----AATTCTACCT---ACCGATGCAACGTATTAAACTTTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Neesenbeckia_punctoria ---------------------------------------GAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGCTGGCTT-GCGA-AAACACGACCGTTGTGCACGTGAATC---GAATGCTGCCGGGG-GGCGCTGCCT-CCCCGGCCC--ACCGG-CCCGGCCCTCGCGCCTTC---GGGGCGTGTTGGTCG-TG-TGCCG--AATACGGCGCGGGTTGA--CGCCAAGGAACACGAGA--CGCCGAGGCGGCCGGCGGAGCGCTTAGGCGC-CGGCCCGCCGCCGACGCA---------AGGAAAAAAAAAACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACC-TCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--CGC----CCCCGATG-GGATATTGGCCCTCCGTGCC--TAAAGGCGCGGCGGGCCC-AAGTACGTGGCCGTCTGGT-AGGGCTCATCCCCGGGAGCGGCGAGTGGTGGTCATTT-CTGCGCGCGCC-GCCCCGTGCCCCCTGCCGGC--------TTCGCC-GACCCCC-GAACGAGGAGCCGCTCGACGCAGCTTCGT--GTCGTGCGGCATCTTCGGACCGATACCCCAGGTCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAGCTGCGTTTATGCGCGGCCGACCG-TTGTGAAGTTGTCTTTTCACTCCTCCCGCCCG-CTGCGTT-GTTTT--GCGG-GGGAGGAA----CGC--ATCGT-CGGTTGTCTGTGCGGTTCTACCCACGTGG-GGAATATCA---TGATGTTTCATGA-TGGAT---TTTT-GC-TTGCCCCGTCGATA--TTTTTAT-CGTCGGCGC-AGTCGATTGGT-TGGCTAAATT----CTTGTGCCG-CGGC--GGGTCAAT----GCCCC-GATACTCGGCGCTTGGATTTT-TCCGGCTCTCGCGGATGCCGTG--TCCATCGAGGAATCAG-TTGGCCTCCGGTCCCTTGATTTACCTCGG-GGGGGTCC---CTTGTAC---GGATCG-TTG-CTCCGCCGCTC--------TGCCATC-TTG-TCCGGTGTGATGGGA--TGTCGGAG----------CGGTG-CGTGGTACCCGTGCA--TGCGAGATG-TTCACCC-GATT----GAATGAG-CGA--CTGCCGGTTCTCGTCGTCGTGCGAGTCGGACTCCTATTCACTTAGGGTTCGCCGC-AACGACGTGTCGGCTCTCGTTTAAGACGTGCTACCTGGTTGATCCTGCCAG------TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTTCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTCTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTGCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCCGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTGTGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTC----TAT-AGTAAT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTG-TTAGGTTGTTAG----------------TAAACAGTA-CATGACGTAGCTCGAG-AAAAAAAAGGATTTATT-------------TCTTT---------ATCAAGCAAGGGGAAGAATCTAGGGTTAGTAAAAATTAA---------TAT---AATT--------AATTTAGAACAACTTTGTAAGTATGTTCTTAGCATCGAAATAAAAAAGAGAATATCTAATTTGA-----GCAAGTT-------AAAAAAAAAAAAAAAGAAGTTTAGATTGTTGG---AAATTGGTAAA-----ACTGTTTCGATCAT------AAGGTATAACGGGAGTGAATCCTTCATATTTT------TATAAA-------AAAAAAA-----GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTAA-GAAGAATAAAGGTCCCC--------GAAGTAATGTATAAACCCAATGATTTAAAAAAGAAAATATAAAGGATTCCGGAACAAGAAAATACTAT--TTGCAATTGTCTCAAC---AATGTC----ATTGGATCATATTGACGAAT-AAAATA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------ACA----T--TAATAAGGATTT----TCCTTTGAACTTTCTCAAAATTATTCAAAAATTATTCAACTTGAGTCATGGGT--ATAAATGATA---------TTTTTTTCTGT-AAGGACGAG-AAAAAAGCATTCAATTC-GAATCAGAGTCTTAAATTATGATTTTAAGATTTAAGAG-----TCTATTCAAC-----ATTCTATA-CA------------AAAAAAGTTGAATCATTTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG-------------------------------------TTGTGGATCACCTGAGTAGAA------TACTCGTATCTAGA-----TACGAGTACCTATGCTAATT-------AAAT-----------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGAATAGTCAATGT-----------------------------------TAG-TATAATGATATGTATTGGTAATAA-------TTTCATTATAGG----------------------------GATTGTT------------TGCTT-----ATATGTGTTATTTTGCGAAGAATATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTAAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTATCGATATTGACATGTAGAGTGGACTCTCTCTTTATTCTCGTTTGATTAATT------------------ATTTTTTT----ATAAAGATCTAGCAAAGTCTATAATGAAT--------------GATTTGATTACTAA-------ATATTGAA------------------------TT-CCTTTTTCATTGAACCTT-TATTTGAATCAATTCACCA-TAAAGAATTCAGAAATTTG-TGAATTCATA-----AATATTTT----CAAATTTGCTATTTCATAATCATTCAC--------AACATAAATTGATCGTGATTATGATTT-ATCATTTGATTAATAAGT-GTATATACGTATGTC----------------------TTTAATATATA-------------------------------------------GAT-GGACA----AATTCCACCT---ACCAATGCAACGTATTCAACTTTATTCGTTTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGG------------- Rhynchospora_rugosa_subsp._brownii ------------------------------------------------------------------------------------------------------------------------------------GACCGGTGCACACGTG-ACC---GAAAGATGCCGGGGAGGCGCTGCCG-CCTCGGCCC--AACGGCCA-TGCCCTCTCGCCCTGC---GGGCGTTTGGGTC--TGGTGCCG--AACACGGCGCGGGTTGA--CGCCAAGGAAAACTGGACTTGCTGAGGCGGGAGGCGGACCGCATACGCGTTTCGCCTGCTGCCGATGCG--------AAGGAA------CGCA-AGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--TTT----TCCCGATGCGGATCCTGGCCCTCCGAGCC--GCGAGGCGCGGTGGGCCC-AAGTGTGGGGCCGTCGTAT-GGGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCGCGTC-ACCCCGAGCCCCATGTCGGC------CCTTGGTT-GAACCCC-AAACGAGGAGCCGGCTATCGCAGCGTCCC--GCTGTGCGGCATC-----------------------------------------------------------CTGCGCATCTGCGCGGCTGGCCG-ACATGGGGCCGTCTCTTCATTCTTCCTCCCGTTAGGCGGCGCATATT-GCCT-CGGAGGGATGCGTGCAGTCGGCTT---TGCCTGTGTGGTTCTACCCTTGCGG-GGAAC--TAACTCG-GTCCC-ATGA-CGGATGCGTTTGAGC-TTACCCTGTCGATCATTTATTTT-CGTCAGGGC-AGCCGAATTGT-TGGCGAAACC----CTTGTGCGT-TGCCACAGCGGAAT----GCTGGCGGTACC--GCACTCGAGCGTC-GTCGGCTCTTGCGGATGCTGTG--CCCACGGCCAGTTCTG-CGGGCCTCTGG-CCCGCAG---ACTTTG--GGAG---------------------CG-TGG-CTCCGTCGCTCGCTTGTTGTGTCGGGTTTCCC-----------------GATGCTGGAGCGTTGCG-------------------------AGGGACG-CCTCTCT-GACC-GAACGAGTAG-CGA--TTGCCGGTTA---ACGTAGTGAGTAGGG-CCTCCCT---TCCGGGGCGGTGCCGGAAACAACGTGCCGTCTCTCGTTTAAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTTGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAACCTGTTGCTGGGGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGTCACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACCAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGCGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAACGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAATATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTC----TAT-AGTAAT-GAAGATGCTCTTGACTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CATGATGGAGCTCGAG--ATAAAAAGACTTTATT-------------TTTT----------ATCAAACAGGGGAAAGAATCTAGGGTTAGTGAGAATTAATAT------AATTC-AATT--------AATTTAGACTAACTTTGTAAGTATATTTTTAGCATCGAAATCAAAAAGCGAAAATCCAATTCGA-----ACAAG---------TCAAAAAAAAATAG--AAAGTGAGATTGTTGG---AAACTGGTAAA-----ACTCTTTTGATCAT------AAGGTGTAATGGGAGTGAATCCTTCGTATTTTATT---TATAAA--------------GAAAAGAAGGAAAT--CAAAAAGAAGGTATGTTGCTTTCCTTTTGA-TAGGAATAAAGGTCTCC--------GAAGTAATGTATAAACCCAAAGATTCTAGAAAGAAAATATAAAAGATTCCGGAACAAGAAAACACTAT--TTGAAATTGTCTCAAC---AATGTA----ATTGGATGATATTGACAAATATAAATA----GGTTAGAGATAAGACAAGCAAAAGAGTTTAGAGACAGCTCAAG-------AAA----T--GAATAAGGATTT----TCCTTTGAACTTTCTTAAAAATATTATT-----ATTTAACTTGAGTCATGAGT--ATGAATGATA--------TTCTTTTTCTGT-AACGAGGG--AAAAAAGGAGTCCATTT-GAATT--------ATAGTCTAATTCATGATTTTTTGAG-----CTCATTTTTC-----ATTCTATC---------------CATAAATTTGTATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGG--------------CTGAGCTATCCCGACC--ATTTTTTGTGGATCACCCGAGTAGAA------TACTCGTATCTATG-----CCCTTGTACCTACGTCAATT-------AACT-----------------------AATTGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATGGAATAGTCAATG------------------------------------TTAAGATAATGATA-TGATTGGTAATTA-------TTTCGTTATAGA----------------------------GATTCCT------------TGCTTA--TATT-TTATATATTG---GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTAAAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTTATCATC---------------AATTTTTCAAATGAAAAAATATAAAAAACTCTATAATGAAT--------------AATTTGATTACTAA-------AAATGAAG-------------------------TTCTTTTCTTATTGAACTTC-TATTCGAATCAATTCTCCAT-AAATAATTCAG-AATTTT-TCAATTCATA-----AAAATTTC----AGAATTTGCTATTTCATAATCATTCACAATTTAAAAATGTTATTTGATCATGATTATGATCA-ATCA--AAATGAATCAGTAATAT--ATATATGTC----------------------TTTGGTATATA-------------------CGGCTATCC-TTTCTCTTA-TTTCGATAAGAAA----CATCCT-------ACCAATGCAACA-AATCAATTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGAATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACTAAGGCTCAATCTAATCA Schoenus_curvifolius --------------------------------------------------------------------TGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTATGCTT-CCTA-AAACATGACCGTTGCGCATGTG-ACC---GAACGCTGCCGAATA--------------CGGCCC--ACCGGCCCCGGCCCA----------------CGTGCTGGCCG-GG-TGCCG--AATACGGCGCGGGCTGG--CGCCAAGGAACACGAGA--TGCTGAGGCGGCCGGACGAGCGCCGAGGCGCGCGTCCGGCTGCCGACGCG--------AAGGAA---TAAAACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGC--CGC----CAACGACGCGGAGCTTGGCCCTCCGAGCC--GGATGGCGCGGTGGGCCCTAAGTGTGCGGCCGCCGGAT-GGGG-------CCGGGTGCGGCGAGTGGTGGGT--TG-CTGCGCGCGCC-GTCCCCTGCCCCCTCACGGC------CCTTGTCG-GACCCCC-AAACGAGGAGCCGGCCGACGCAGCGTCCCAAGCTGTGCGGCATCTTCGGACCGATACCCCAGGTCAGGCGGCGCTACCCGCCGAATTTACGCATATCAATA--CTGTGCTTCGGCGCGGCCAACCG-TCGTGGGGCTGTCTCTTCACTAATCAT-CCCGCTCTGCTC-GTGCG--GGAC-GGGAGGAA----TGCTAGCTTG-CGGCTGTCTGTGCGGTTCTACCCTAGT---GGTACCTTG---TTAGGCTTCTTGA-CGGAG---TTTTTGC-TTGCCCCGT-GATG-TTCATTAT-CATTGGGGC-AGTCGATATGC-TGGCTTAATT----TGCGTGCCG-TGGT--GGTCTAG-----GCCTCA-GCATT--GCGCGTGCTTTTT-GTCGGCTCTCACGGATGCTGTG--ACCTTTGAGGAATTCA-TGGGCCTTCGGACCC-TTGATTTC-GCG--GGATATGCCC-CTTGT---------------------------------------------------------------------------------------------TC-CGGAGCA--AGTGGGATG-TTTATCC-GATT----CGATGAG-CGA--TTGCT-GTTC---TCGCGTTGTTCCATG-ATGCGG----------------------------AGACGGCTCTCGTTTAGGACGTGTTACCTGGTTGATCCTGCCAGTAGTCA------------------------------------------------------------------------------------------------------------------------AGTTCCCCCCGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCGTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTCATGCATGACTACTTAACCGGGGGATTCACCGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACCATTTTC----TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAAGGTGTCAG----------------TAAACAGTA-CATGATGGAGCTCGAG-AAAAAAAGGATTTTATT-------------TTTTT---------ATAAAACAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA---------TAG---AATG--------AATTTAGACCAACTTTGTAAATATATTCTTAGCATCGAAATCAAAAAGAGAACATTCAATTCGC-----GCAAGTTTC--TAAAAAAAAAAGGAAAGAAAAAGTGAAATTGGTGAAAAAAACTCTTTTA-----ATCTTTTTGATCATT-----AAGGTGTAATGGGAGTGAATCCTTCCTTTTTTATT---TAGAAA-------------------GAAGGAAATAAC--AAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAGTAAAAGTCCCC--------GAAGTAATGTTTAAACCCAAAGATCTAAAAAAGACGATATAAAGGATTCCGGAACAAGAAAATACTATA-TTGCAATTGTCTCAAC---AATGTATGTCATTGGATCATAATGACGAATAAAAATA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----TTATAATAAGGATTT----TCCTTTTAACTTTCTCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA---------TTTTTTTCTTT--AAGGGGGC-AAAAAAGGATTCAATTC--------------CAAATCGGATCTAA-ATTTTATGAG-----TCCTTTTTATTTTGCATTCTATAACAAAA---------TAAAAAATTGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGGGGTATTT--------------------C--ATTTCTTGTGGATCACCTAAGTAAAATAATG-TACTTGTATCT-------------------ATTTCAAT-----------------------------------AAAGGAACTCGAA-----TATC-----------------AATTTATTCCA-AAAAATTGAATAGTCAATGT-----------------------------------TAG-GATAATGATATGGGTTGGTAATGA-------TTTCATTATAGAGATAAT----------------------GATTCCT------------TGCTTA----CTATGTATTTTTTTGCAAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATAAAAAGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTCAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGGATGGACTCTCTCTTTATTCTCGTTTGATTAAA-------------------TTTTTTTC----A-AAAAATCTAGCAAACTCTATAATGAAT--------------GATTTGATTACTCA-------ATATTGAG------------------------TT-CTTTTCTCATGGAACTTC-TATTTGAATCGATTCACCA-TAAAAAATTCAGAATTTTT-GAAATTCATAAAATAAATACTTC----CGAATTTGCTATCTCACAATCA---------TAATAATAAAATTGGATCGTGATTATGATTC-ATAATTTAATCAATCAGT-ATATAGACGTATGTA----------------------TGTGATATACA-------------------TGGCTATCC-TTTCTCTTA-TTCCGAT-AGAGA----AATTCCACCT---ACCAATGCAACGTAATAAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCCTTTTTAATTCCAGGGTTTCTCTGAA-TTGGAAGTTAACACT---------------------------------- Schoenus_efoliatus -------------------------------------------------------TGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTTGCCC-GGAA-AAACACGACCGTTGTGCACGTA-ACC---TAATGCTGCCGGGGAGGCGTCGCCGCCCCCGGCCC--ACCGGCCGCGGTCCT----------------CGATCGGGCCG-CG-TGCCGGGAATACGGCGCGGTCTG---CGCCAAGGAACACGAGA--TGCTGAGGCGGCCGGCGGAGCGCTCCGGCGCACCGCCCGCCGTCCATGCG--------AATGAA------AACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGG---CGC----TCCCGATGCGGATCGTGGCCCTCCGAGCCTCTCACGGCGCGGTGGGCCT-AAGTGTGCGGCCGCCGGGA-GGAG-------CCGGGAGCGGCGAGTGGTGGAA--TG-CTGCGTACGCC-GCCCCGCGCCCCTTGTCGGC------CTTTGCCC-GTCCCTC-GAACGGGGAGCC--------GTGCCTACC--ACGGCGCGGCGCCTTCGGATCGATACCCC-------------------------------------------CTGTGCTTCGGTGCAGCCAACCG-CCGTGGAGCTGTCTTTTCACTGTTCCT-CCCGATGCGCTCTTTTGG--GCGG-GGGAGGGA---CTGCACGCTGT-CGGTGGTCTGTGTGGTTCTACCCTTGTGC-GGAACAAAA---GTGGGCTTGATAA-TAGGC---TTCT-GC-TTGCGCTGTCGGCA-CGTGTTGT-CGTCGGCGC-GGCTGATTTGT-TGGCATAATG----CTTGTGCGG-CTGC--GGGCGTGTGAATGCCTCCGGTACT--GCACGCGCATTTT-GTCGGCTCTCACGGATGCGGTG--CGCATTGAGGAATCCA-TGCGTCTTCGGTCGC-TGGATTACTTCG--GGATGTCC---CTTGCAC---GGGTTG-TCG-CTCCGTTGCTT-------------------------------------------------TGCTT-CGGGT-CGCGCTC-CCGTGCC--TGCGAGATG-CTTGCCC-GGTT----GAAAGAGACGA--TTGCCTGATC---TCGTCGTGTGAAGGC-CT-------------------------------------------------------------------------------------------------------------------AGATTATAAACTAACCTATTATACTCCTGAGTACGAAACCAAAGACACCGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGATACAAGGGACGATGCTATCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTCTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCTCTACGAGCCCTACGCTTAGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATTCAATCTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAAGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCGGCTACATCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCCATTATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGCGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAATTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATCTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCCTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCCTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGGAATGAGATCATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCCGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTAGATAAAACGAAATAGAAAGATCAA----------TTTT----GAT-ACTAAT-GAAGATGCTTTTGGCTCGACATAATTTGTTCTGT-----------------------------AAACAGTAACATGATGTAGCTCGAA-AAAAAAAAGAATTAGT--------------TTTTT---------ATCAAGCAAAGAAAAGAATCTAGGGTTAGTGAAAATTAA---------TAT---AATT--------AATTGAGATCAACTTTGTAAATATATTTTGAGCATCGAAATCAAAAAGAGAATATCCAATTTGA-----ACAAGTT-------------AAAAAAAA-----GTGAAATTTTTTT---AAAATGGAGAA----AACTATTTTGATTATT-----AAGGTGTAACGGGAATAAAGACTTCCTTTTTTTTT---AAGATA---------TTAAA-----GAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAGGTCCCT--------GAAGTAATTTATAAACCCAATGATTCAAAAAAGAAAATAGGAAGGATTCCGGAACAAGAAAACACTAT--TTGCAATTGTCTCAACATCAATA-ATATATTTTCATCATAATGATGAATAAAAATA----GGTTAGGCATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAA-------AGA----T--TAATAAAGATTT----TACTTTGAATTTTTTCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA---------TTCTTTTCTGT-AAGGAGTA--GAAAAAGGATTCAATTCATAATC--------ATAATTGAATTTATGATTTTATGAA-----TCTATTTTGC-----ATTCTATA---------------CAATAATTTGAATCA-TTTTTCTTGAGCCGTATGAAGA-GAAAATCTCATATACGTTTCTGGG--------------------------------------TTGTGGATTACCTGAGTAGAA-------ACAAGGATCTAGA-----TCCTTGTACCTACGTCAATT-------AAAT-----------------------AAAGGAACTCAAA-----TAACGATTTATTCCAAAAAACAATTTATTCCA-AAAAATAGAATAGTCAATGT-----------------------------------TAG-AATAATGATATGGATTAGTAGTGA-------TTTAATTCTAGA----------------------------GATTTCT------------TGCTTAGCTGATATGTATTTTTTTACGAAGAA-AAAC-------------------GTA-GAAAATCAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTAAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGGTATGGACATGTAGAATGGACTCTCTCTTTATTCTCCTTTGATTAATC------------------ATTTTTTC----A-AAATAT-------------------------------------TTGGATTATTCA-------ATATTGAA------------------------TT-CTTTTCTCATTGAACTTC-TATCTGAATCAATTCACCATTAAAGAATTCAGAATTGTTTTCAATTCTGA-----AATATTTC----AGAGTTTGCTATTTCATAATCATTCCAAATTTAAAAATATAATTTGATCGTGATTATGATTA-ATC------------AGT-ATATATACGTATGTC----------------------TTTGGTATATA-------------------AAGGTATCC-TTTCTCTTA-TTTCGAT-AGAGAAATAAATTCTATTT---ACCAATGTAACGTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTACTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAG------------------------------- Tetraria_capillaris ----------------------------------------------------------------------------AGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGGCTT-GCGA-AAACACGACCGTTGTGCATGTG-ATC---GAATGCTGCCGGGGAGGCGCTGCCT-TCTCGGCCC--ACCGGCC-CGGCCCTCGCGCC-TTC--GGGGCGCGTTGGTCG-TG-TGCCG--AATACGGCGCGGGTTGA--CGCCAAGGAACACGGTA--TGCTGAGGCGGCTGGCGGAGCGCGAAGGCGCACTGCCCGCTGTCGATGCA--------AAGGAA----AAACCA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCATG--CGC----CCCCGATGCGGATATTGGCCCTTCGTGCC--TGAAGGCGCGGCGGGCCC-AAGTACGTGGCCGTCTGGT-TGGGCTCATACCCGGGAGCGGCGAGTGGTGGGAATTT-CTGCGCGCGCC-GCCCCGTGTCCCCAGTCGGC------CCTGCAAT-GAAACCCCAAACGAGGAGCCGGCTGACGCAGCCTGGT--GCTGTGCGGCATCTTCGGACCGATACCCCAGGTCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAGCTGCGCTTCTGCGCGGCCAACCG-TCGTGGAGTTGTCTTTTCACTCTTCCT-CCCGTTTGCATTGCTGTT--GCGG-TTGAGGAA----TGC--GTTGT-CGGTTGCCTGTGTTGTTCTACCCATGCGG-GGAATACGG----AAATTTTCATGA-TGGAT---GTTT-GC-TTGCACCGTTGATA--TTTTTAT-CGTCGGCGC-AGTCGATTGGT-TGGCTAAATC----CTTGTGCCG-CAGC--GGGTCAAT-AATGCCTC-GATACTCGGCACTTGGATTTT-ACCGGCTCTCGCGGATGCCGTG--TCCATCGAGGAATCTG-TTGGCCTCTGGCCATTTGATTT-CCTCG--GGAGGTCC---CATGTAC---GGATTT-TTG-CTCTGCCGCTC--------TGCTATC-TCG-TCTCCGGAATGATGGGATGT----------GTGAGCGGTG-CGTGCCC-CCGTGCA--TGCGAGATG-TTTGCCC-GATTGATTGAATGAG-CGA--CTGCCGGTTC---TCGTCGTGTG-GGCG-ACTCCTATTCATTTAGATTTTCCCGC-CAT----------------------------------------------------------------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATTTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTGCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACGTCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACCAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCTTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTGTGGAAAGCAATTAAATTTGAATTCGATCCGGTAGATAAACTTGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGGCC--ATTTCTTGTGGATCACCTGAGTAGAA------TACTCGTATCTAGA-----TACGAGTACCTATGCCAATT-------AAAT-----------------------AAAGAAACTCAAA-----TAAC------------------ATTTATTCAA-AAAAATTGAATAGTCAATGT-----------------------------------TAG-GATAATGATATGGATTGGTAATGA-------TTTCATTATAGA----------------------------GATTCTT------------TGCTTA-----TATGTGTTATTTTGTGAAGAA-ATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATA-AGGGACTTGAACCCTCATGATTTAAAAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTA-----------------------------------AATATTCTAGCAA-GTCTATAATGAAT--------------GATTTTATTACTAA-------ATATTGAG--------------------------TCCTTTCTCATTGAACCTC-TATTTGAATCAATTCACCAT-AAAAAATTCAGAAATTTG-TGAATTCATA-----AATATTTT----CAAATTTGCTATTTCATA-TCATTCACAATTT-----CATAAATTGATCGTGATTATGATTA-ATAATTTGATTAATCAGT-GTATATACGTATGTC----------------------TTTAGTATATA--------------TAGGGCGGCTATTC-GTTCTCTTA-TCTTGAT-AG-GA----AATTCCACCT---ACCTATGCAACGTATTCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Trianoptiles_capensis ---------------------------------------------------------------------------------------------------------------CGTTGTCTA-ACAA-AAACATGACCATTGCGCACGAA-GTCACAGAAAGCTGCCGGGGTGGCTTTGCCG-CTCCGGCCC--ACCGGCACCGGCACTCTCCTCCTTCGGGGGGTGTGTTGCCCG-TG-TGCCG--AACACGGCGTGGGTTGA--CGCCAAGGAACAATAGA--TGCTGAGGCGGCCGGCGGAGCGCTTAGGTGCCCCGCAGGACGCCGATGCG--------AATGAA------CACAACGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATC-ACGCTCGAG---GC----CCCCGATGCGGAGCCTGGCTCTCCGAGCC--CCCGGGCACGGTGGGCCT-AAGAGTACGGCCGTTGGGT-TGGGC-------CGGGAGCGGCGAGTGGTGGTC--TA-CTTCGCACGCC-GCCCCGCGCCCATTGCCGGC------CCTTGTAC-GATCCCA-GAACGAGGAGACGGCTGT-GCAGCGTACC--GCTGTGTGGCCACTTCGGACCGA-------------------------------------------------CTGTACTTCGGTGCGGCCAACCG-TCATGAGGCTGTCTTT-CATTCT-----CCCTGCCTT-AC-ATTCT--GGCG-GGTAGGGA---CCCGATATTTGCCGGCTGCCTGTGTGGTTTTACCCGTGCGG-GGATCTTAAGTCGTGACGTT---------GT---CCAA-GC-TTGCCTCGTCG--G-CGTGTGGT-TGTGGGGGC-AGTCGGAATGT-TGGCGGAATC----CTTGTGTCGTCTGA--GGGCCAAT----GACCC-TATGCG--GCACTCGGATGCT-GCCGGCTCTCATGGATGCGGTG--CGAAATAAAGGTTCTG-CGGGCCTC-GGT-CCCAGATTT-CCTCG--GGAGTTCC---CTTGTAC---GGATTG-TTG-CTCCGCTGCTT--------CGCCCTC-ATA-CGGG-------------CGTCGGAGCGG-TTTGTG----------CTC-CCGTGCA--TGCGAGATG-TCTCTCC-ATTC----TAGTGAG-CGA--CTGCCGGTTC---GGGTTGCGCTGATGG-CCTCCC----TTCTCGGGCGTGCCG-AAGCGTCGTGCCGGCTCTCGTTTAGGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCACCATTTTC----TATCAGTAAT-GAAGATGCTCTTGACTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CATGATGGAGCTCGAG-AAAAAGAAAGAGTTCTT-------------TTTTT---------ATCAAGCAAGGGAAAGAATCTAGGGTTAGTAAAAATTAA---------TAT---AATT--------AATTTAGACCAACTTTGTAAGTATATGCTTAGCATCGAAATCAAAAAAAGAAAATCCAATTCGA-----ACAAGTTTC-------------AAAAAGATAGGGTAAAATTGTTTG---AAACTTGTAAA-----ATATTTTTTATTTTCTTTTTAAGGTGTAACGGGTGTGAATCTTTC---TTTTATT---TAAAAA-------------------GAAGGAAATT----AAAAAAGGTATGTTGCTTTCCTTTTTA-AAGGAATAAAGGTCCCC--------GAAGTAATGTATAAACCCAAAGATTAAAAAAAAAATATATATATAATTCCGGAACAAGAAAACACTCTATTTGCAATAGTCTCAAC---AATGTA----ATTAAATCATAATGACGAATAAAAATA----AGTTAGAGATGAGACAAACAAAAGAGTATAGAGATAGCTCAAG-------AAA----T--TAATAAAGATTT----TCCTTTGAATTTTATTCAAAAT-----------ATTTAACTTGAGTCGTAAGT--ATGAATGATA----------TTTTTTCTGGTAAAGAAGAT-GAAAAAGGATTCAAATC--------------ATAGTCTAATTTATTATTTTATGAG-----TCTATTTTTC-----ATTCTATA---------------CATAAATTTGAATCG-TTTTTCTTGAGCCGTATGAGGTAAAAAATCTCATATACGTTTCTGGGGGGAGCA--------CTGAGCTATCCCAACG--AGTTCTTGCGCATCACCTGAATATTC------TACTCAGGTCTATA-----TACTTGTACTTGTATCAATA-------AAAT-----------------------AAAAATACTCCAA--------T-----------------AAGAATA---------------------------------------------------------------------------------------------------------------------------------------------T------------TGGC----------------------GAAGAA-ATAT-------------------TTA-GAAAATAAAATGGGCTTGGGGATAGAGGGACTTGAACCCTCATGATTTTAAAAATCGACGGATTTTCCTCTTACTTTCAATTTCCTTGTTGTCGATATCGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTAATC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT-ATATATACGTATGTCTTTCGTATTTTATATTTTGGTATTTGGTATATA-------------------GGGTCATCT-TTTCTCTTA-TTTCGAT-AGAAA----AATCCT-------ATCAATGCAACGTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTCATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTT------------------------- ; END; BEGIN SETS; CHARSET ets (CHARACTERS = 'well-sampled taxa all genes') = 816-1447; CHARSET rps (CHARACTERS = 'well-sampled taxa all genes') = 2877-3867; CHARSET rbcl (CHARACTERS = 'well-sampled taxa all genes') = 1448-2876; CHARSET its (CHARACTERS = 'well-sampled taxa all genes') = 1-815; CHARSET trn (CHARACTERS = 'well-sampled taxa all genes') = 3868-4975; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18779] TITLE ETS; LINK TAXA = Taxa5; DIMENSIONS NCHAR=713; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Becquerelia_cymosa -CGTACTCCGGTGCGGCCAACTG-TC-GTGGAGCTTGTG-TTTTCAGTCC-CCC-CCTG-CCTAGTGCGCTTTTGCAC---GGAACGGA----CAATGTTCAGTGGG-TGCTTGTGTGGGTA---CTTTCGAG-GGAA-CACGAATTCT---GGCCGGTGA-TGGAT---TCTT-TC-TTGCTCGGATTGCA--ACTTTTTGT-CGTCC-GTGC-ATTAGCAATGT-CGGCGGTGT-----TGT-AGCCGT-GCGT--GGGCTGAT----GCTCC-TCGTGAC-GGACTAGGCTAC--C-GCCG-CCTCTTGCGGATG-TTGTA----GCCATTGAGTG-------TTGTG-CGGTCCTTTGGTC-CGCTTGTTT-CCTCC--GG-AGGTCC---TCTGGGC----GAAACA-CTC-CTCT--G----------------------------------CCGCCAG-TCC------------------TCTC---AAGGCGGGCTGTAGGGGCATGGTC-TCGTTCG--TGAGAGATG-----TCC----------GATGTTGCCTAAAAG-CGA--TTGCCGGTCT---GCTTCGCACGG-------------------------------------------------GAAGCTC--A-GTGCCGTCTCTCGTTT--ATGACGTGCTACCTGGTTGATCCTGCCAGTAGTC- Calyptrocarya CCGTACTGTGGTGCGGCCAACCG-TC-ATGGGGCTTGTC-GTTTCAGTCTCCGC-CCGG-----ATGCATTCTTCCAGGG-CGGAGGGA----CCGTATTGAGCTGG-TGCTTGCGTCGGTA---CCTTTGGC-GGAA-T---ATTTGT--AGACTAGCGA-TGGAT---T----AC-TTTCCCGGATTGTG--CACGGATGG-CGTCC-GTGC-GCATAAAATGT-CGGCTGTTC-----CTT-GACCTG-CAGC--GGTTGAAA----TCCCC-AGCGCA--GGGCTCGATTAT--T-GCCG-CCTCTTTCGGATG-CTGTA----GCCATAGACGG-------TGTTG-CGGTCCTGCGGTC-CGCAAAGTC-CCTGG--GT-AGATGC---CTCGTGC----GGGTTG-CTA-CTCC-------------------------------------CTTCTTC-TCC------------------GCTCTGTGCAGCGGGCTGCGGGGCTGAGCGC-TCGTTCG--TGTGCGATG-----TTC----------GTCCCTCGCGGAGAG-CGA--TTGTCGGTCC---ACTACGTGCGAATG--TTTCCCC-----------------------TTCGGGGGGCAGCCGCGGCGG--A-GTGCCGGTTCTCGTTT--ATGACGTGCTACCTGGT------------------ Capeobolus_brevicaulis CTGCATTTTGTTGCGGCCATCTG-TC-ATGGGGT-AGTC-TTTTCAC-TCTTTCCTTTT-GTGTGCTC-CTTTT--GC---GCAGGGGA----TGGTTGCGAC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTG---TTT--GC-TTGCCCTGCGGATA---CTTGCTAT-CTTGG-GTGT-GGCTGTTTTAT-TATGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCACC-TATGCT--TCCCTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAT---TGGATCATTTGCCCCC--ACGCATT----------------------------CTGTGTC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGAGGGGACGTGTTCCATGTGCATATGTGAGATG-TTTTTCC----------GACT----CAATGTG-CAA--TTGTCGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGAG-TGCTCTCAAATG--ACGTGTCGTCTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTAGTCA Carex_magellanica CC---TTTTGGTGCGGCCAACCGAAC-ATAGGGC-TGTC-TCTTCACTCTCCCA-CCCG-TCATTGAACATGTTGT-----GGTCGGGA----TGCTT-CTGATCGGTTGCCTGTGCGGTTATACCCTCTTGTGGGTA-GCGAAGTCGT----CCC-TTGA-TGGAT---ATTT-GC-TTGCCCTTGTGACA--TATTTATGT-CATTT-GGAC-AGCCGAAATGT-TGGTGATATC----CTT-GTGTTG-GCACGTGGTTGAAT----GCTGT-GTTGCTA-TCACTCGGATTT--TTGCCG-GCTCTCACGGATG-CGGTG----CCTAGTGCTAG-------CTCTG-CGGGACTTTGC-C-CCGCAGA---CTTCG--GG-AGGTCC---CTTGTAC----GAATCA-TTG-CTCT--TATACGC----------------------------CGTCTTG-TCG------------------TGTCGCTACCGCGGCACGCCGGAGCGTGGTC-TTGTGCA--CGTGGAATG-CCTCTCC----------GATC-GTATGAGCAG-CGA--TTTCCGATTT---GCGTCACGCGAAGGCCCCGCCCG-----------------------TCCGGGTCGGTGCTGGAGCTG--ACGCGCCGGCTCTCG-TT--AAGACGTGC-------------------------- Carpha_capitellata_var._bracteosa ----------------------------TGGGGC-TG{GT}C-TTTTCACTCTCCCTCCCTT-ACATT-{CT}T--------GCT{AT}-{AG}GGAGGGA---CACGCTTGTTGCCGGCTGCCTGTGTGGTTTTACCCCTGCGG-GGAT-CGCAAGTCGTG-ACTTA---------CT---CCAA-GC-TTGCCCCGCCG--A---CATGTTGT-C{AG}TGG-GGGC-AGTC{AG}GAATGT-GGGCGGAATC----CTT-GTGTCGTCTGA--GGGCCAAT----GACCC-CATGCG--GCACTCTGATCC--T-GCCG-GCTCTCATGGATG-CGGTG----CCAAATGAA{AG}G-------TTCTG-CGGGCCTCCGGT--CCCAGATTT-CCTCG--GG-AGGTCC---CTTGCAC----GGATCG-TTG-CACC--GCCGCTT----------------------------CGCCCTT-CTA-CGGG-------------TGTCGGAGCGG-{GT}GTGTG----------CTC-CTGTGCA--TGCGAGATG-TCTCTCC----------GTTC----TAGTGAG-CGA--CTG{AC}CGGTTC---GGGTTGCGCGGATGG-CCTCCC------------------------TTGCCGGGTGTGCCG-AAGCG--TCGTGCCGGCTCTCGTTT--AGGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA Carpha_glomerata CTGTGCTTCGGCGCAGCCAACCG-TC-ATGGGGC-TGTC-TTTTCACTCTCCCTCCCTT-GCATT-CT--------GCTG-TGGAGGGA---CACGCTTGTTGCCGGCTGCCTGTGTGGTTTTACCCCTGCGG-GGAT-CGCAAGTCGTG-ACGTC---------CT---CCAA-GC-TTGCCCCGCCG--A---CATGTTGT-CGTGG-GGGC-AGTCGGAATGT-TGGCGGAATC----CTT-GTGTCGTCTGA--GGGCCAAT----GTCCC-CATGCG--GCACTCTGATCC--T-GCCG-GCTCTCATGGATG-CGGTG----CCAAATGAAGG-------TTCTG-CGGGCCTCCGGT--CCCAGATTT-CCTCG--GG-AGGTCC---CTTGCGC----GGATCG-TTG-CACC--GCCGCTT----------------------------CGCCCTT-TTA-CGGG-------------TGTCGGAGCGG-TGTGTG----------CTC-CTGCGCA--TGCGAGATG-TCTCTCC----------ATTC----GAGTGAG-CGA--CTGCCGGTTC---GGGTTGCGCGGATGG-CCTCCC------------------------TTGTCGGGTGTGCCG-AAGCG--TCGTGCCGGCTCTCGTTT--AGGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA Caustis_dioica CTGCGTTTCGGCGCAGCCAACCG-TC-GTGGGGC-TGTC-TTTTCACTTTTCCT-TCCT-GTGTGCTT-CTTTT--GCCC-GGGAGGAA----CACTAGTTTT-CGG-TGTCTGTTTGGTTCTACCCTCGCGG-GGAA-CAACG----------CTAATGA-CGGAA---TTTT--C-TTGTCCCATTGATA---TTTGTTAT-CTTCG-GTGCAAGCTGATATGT-TGGCTAGGTGAGAACTT-GTGCAG-CGGT--GGGCGAAT----GCTC{CT}-GCGACT--GCACTTGGATTT--T-GCCC-GCTCTCACGGATG-CCGTG----CCCAACGAGGA-------TTCTG-CGGGCCTATTGTC-CCCTG-ATTCCCTCG--GG-AGTTCC---CTTGTATACTTGGATAA-TTG-CTTT--GCCGCAT----------------------------CGCTATC-TTG-TTGCCGTTGTTGGGAA-TGTCGGAGCGG-TGTGTGCGGAG-CATGGTC-TGGTGCA--TGCGAGATG-TTTATCC----------GATT----GGACGAG-CGA--CTGTCCGTTC---CCGTCGTGCGACCGG-AGTCCC------------------------ATTTAGGGTGTGCCGGA-GCG--ACGTGTCGGCTCTCGTTT--CGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC- Chrysitrix_capensis ----------------------------TGGTGC-CGTC-TTTTCACTGTCTCGCACCC-CTCG-----------------CAATGGGG----TGCTCGTTTT-TGG-TGCCTGTGCGGTTCTACCCTGGAGG-GATA-C-------GTT-TGGATCGTGA-TTGAG---GCTT-GC-TTGTCCCGCCGAAG--ATTTTGTCT-CGACG-GGAC-AGTCGGAATGT-CGGCCAG-------CCC-AGCGTG-CGGT--GGCGGCGC----GTTGC-TGTACCCCGCACATCGGTGC--TCGCCG-GTGCTCTCGGATGTCGGTG----CTAATTATGGCGCAGGTCCTGCA-CGGACCGTGGCGT-CCCTGGTTC--------GG-AATT------TTGCCC----GGATCG-----CTCC--GCTGTCT----------------------------AGCGGTGGATTCCTTATGGCGGACGGAACCGTCGGTCCGG--GTCTGATGGCGTTGATTTTTCGGGCA--AGCGAGATG-CGACCC-----------GTT-----CAATTTG-CGA--TTGCCGGTCC---AC-------------------------------------------------------------------------------------------------------------------------- Cladium_mariscus CTGTGCCTCGGCGCGGCCAACCG-TC-ATGGAGC-TGTC-TTTTCATATCCCCTCTCGT-TGT-------------GCTA-CGGGGGGA-------CTGGGTTACGGGTGCCTGTGCTGTTCTACCCTCATGG-GAAT-GTTTATTTTT--GTCCC-GTGA-CAGAT---TTTTGCT-TTGCCCTGACAGTG--TATTGTGCT-TGTTA-GGGC-GGTTGAAATGT-CGGCCAAATC----CTA-GTGCGG-CGGC--GGGCGTAT----GCCCC-TGCCCT--GCGCTGGGATAT--T-GTCG-GTGCTCTTGGATG-CCGTG----CCCATGGAGGG-------CTCTG-TGGGCCTCTGG-T-CCCTAGTTTTCCTCG--GG-AGTCTC--TCTTGTAC----GGATCA-TTG-CTCC--CCCGCTTC{AG}CTGGTGATGGCACCGTCAGAC{AC}CGATTGACGTGCTTGCCGGGATATTA-------TGATGGCGGTGCGGTGCGTGGGGGGCATGCTCCTGTGTG--AGTGAGGCG-TTTTCCC----------AATT-GAATG---AG-CGA--TTGCCGGTTC---GCGCTGCTTGAGCGG-CCTCCCA-----------------------TTCGGGG-GGCGTCAGGAACA--GCGTGTCGGCTCTCGTGT--AGGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Costularia_leucocarpa_Lar0140 --------------------------------------------------------------------------------------------------------------------------------CAGGG-GGAA-C-TAATTTGTG-GGCTTCGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTGT-CTTGG-GTGC-AGCCGTATTAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCTGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAATTTTGACGGTTC---AC-------------------------------------------------------------------------------------------------------------------------- Costularia_natalensis ----------------------------------------------------------------------------------------------GGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTGT-CTTGG-GTGC-AGCCGTATTAT-TGGGTGAGTA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCTGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTTGATGTTGGGC--TGGCGGTGTGT-TGCGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAATTTTGACGGTTC---ACGCCATGCGAGTGGATTTCCC------------------------ATTTGGGG-TTCTCTTGAATG--ACGTGTCGTCTCTTGCTG--AGGACGGGCTACCTGGTTGATCCTGCCAGTAT--- Costularia_pantopoda ----------------------------------------------------------------------------GCC--GCGG-GGA----TGGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTAATAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTTGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGTGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAA--TTGACGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGGTTTCTCTTGAATG--ACGTGTCGTGTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTA---- Costularia_pantopoda_var._baronii ------------------------------------------------------CTTCT-GCGTGCTC-CTTTT--GCC--GCGG-GGA----TGGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTAATAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGTGTGCGGGGATGTGTTCCAAGTGCATTTGTGAGATG-TTTTTAC----------GATT----CAATGTG-CAA--TTGACGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGGTTTCTCTTGAATG--ACGTGTCGTGTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTAGTC- Costularia_sp_Lar0153 --------TGTTGCGGCCAACTG-TC-ATGGGGC-AGTC-TTTTCACTTTTTTCCTTCT-GCGTGCTC-CTTTT--GCC--GCGG-GGA----TGGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTAATAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGTGTGCGGGGATGTGTTCCAAGTGCATTTGTGAGATG-TTTTTAC----------GATT----CAATGTG-CAA--TTGACGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGGTTTCTCTTGAATG--ACGTGTCGTGTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTA---- Costularia_sp_Lar0219 -----------------------------------------------------------------------TTT--GCC--GCGG-GGA----TGGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCTGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTATTAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TGTGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTTGAGGG-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAA--TTGACGATTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGG-TTCTCTTGAATG--ACGTGTCGTCTCTTGCTT--AGGATGGGCTACCTGGTTGATCCTGCCAGTA---- Costularia_sp_Lar0249 --------TGTTGCGGCCAACTG-TC-ATGGGGC-AGTC-TTTTCACTTTTTTCTTTTT-GCGTGCTC-CTTTT--GCC--GCGG-GGA----TGGTTCCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCTGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTATTAT-TGGGTGAGAT----CTT-GCGTTG-CAGT--GGTGGATT----GTTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------C------------TGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGGGGGGACGTGTTCCAAGTGCATATGTGAGATG-TCTTTCT----------GATT----CAATGTG-CAA--TTGATGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGG-TTCTCTCTAATG--ACGTGTCGTCTCTTGCTT--A---------------------------------- Cyathochaeta_avenacea ---------GGCGTGGCCAGCCG-CC-GTGGAGC-TGTC-TTTTCACTTTTGCG-CCCG-TTGTGCAT-ATCTT--GCCC-GGGCAGGG----CAATTGTTTT-CGGCTGTTTGTGCGGATCTACCCTTGCG--GGGA-ACATC---GTT-GTGTGCGTGA-TGGTT---TT---GC-TTGCGCCGTCGATA---CTTGTTAT-CGTCG-GCGC-AGCCGTTGTGTCCGGCGGGTTA----CTT-GCGCGG-CATG--CGGCGAAT----GGCCCC-GTGCC--GCGCATGTATTG--CGCCGG-GCTCTCATGGATG-CCGTG--TTTTGTTTGAGGT-------CTCCG-CGGGCCGTTGGCT-CCTCGGTTTTCCTCG--GG-TTGTCC---CATGTGC----GTGCCG-TTT-CTCC--GTCGCTA----------------------------TGCTCTG-CCG-TCGCGTA----------TGTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cyathochaeta_diandra ---CGCTTCGGCGTGGCCAGCCG-CC-GTGAGGC-TGTC-TTTTCACTTTTGCT-CCCG-T{AT}GTGCAT-ATCTT--GCCC-GGGCAGGG----CATTTGTTTT-CGGTTGTTTGTGTGGGTCTACCCTTGCGG-GGGA-ACATC---GTT-GCGTGTGTGA-TGGTT---TTT--GC-TTGCACCGTCGATA-----CGTTAT-CGTCG-GTGC-AGCCGTTGT{AG}TCCGGCGGGTTA----CTT-GCGCGG-CATT--TGGTCATT---TGGCCCC-GTGCC--GCGCATGTATTG--CGCCGG-GCTCTCATGGATG-CGGTG--TTTTGTTTGAGGT-------CTCCG-TGGGCCGTTGGTT-CCTCGGTTTTCCTCG--GG-TTGTCC---CATGTGC----GTGCCG-TTT-CTCC--GTCGCTA----------------------------TGCTCTG-CCG-CCGCGTA----------AGTCGGAGCAG-TGCGTGCGGGG-CGCGGTC-TTGTGCA--TGCGAGATG-CTTATCC----------GTTC----GATTGAG-CGA--TTGCCGGCTC---ACGCCGCGTAAGCGG-GGTCCCAACTA-------------------GATTGGGGCT-------------------------------------------------------------------- Cyathocoma_hexandra ------------------------------------------------------------GCGTGCTC-CTTTT--GC---GCGGGTGG----TGGTTGCGGC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTCGGGA-CGGTG---TTT--GC-TTGCCCTGTGGATA---CATGCTAT-CCTGG-GCGC-AGCCGTTTTAT-TACGTGAGGA----CTT-GTGTCG-CGGT--GGTGGATT----GCACC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CCGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTCGTGCAT---TGGATCA-TTGCCCCC--ACGCATT----------------------------CTGTGTC-TCG-ATGTGGATGTTGGGC--TGTCGGTGTGC-TGCGTGAGGGGACGTGTTCCAAGTGCACATGTGAGATG-TTTTGCC----------GATT----CAGTGTG-CAA--TTGTCGGTCC---GCGCCATGCGAGTGG-TGTCCCCATTCCC-----------------ATTTGGGG-TGCTCTCTAATG--ACGTGCCGTCTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCC-------- Epischoenus_cernuus ---------GGCACGGCTAACCG-TC-ATGGTGC-TGTC-TTTTCACTGTGCCT-CCCG-TTGTGCCC-GCGCG--GCCC-GGTAGGAA----TGTTTGTTTTTCGGTCGTCTGTGTGGTTCTACCCTAGTGA-GGTA-TGACA---TTC-GGTTCCATGA-CGGAT---ATTT-GC-TTGCCCCGTTGATG---TTTGTTAT-CATCG-GTGC-AGCCGAGTTGC-GGGCTTAATT----CAT-GTGCTG-CAGT--GGGCGAGG----GCCTCG-GCACT--GCACTTGGATTT--C-GCCA-GCTCTCTCGGATG-CCGTG----CCCTTCGAGGA-------ACTCG-TGGGCCTCCTGT--CCACTGATTCCCACG--GG-AAGTCC---CTTGCAT---TGGATCA-TTG-CTCC--GCCGCTG----------------------------TGCTATC-TTGTTTGCGGGTGTTGGGA--TGTCGGCGTGG-TGCGTGGGGGG-CGTGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GATC----TAATGAG-CGA--TTGTCGCGCG---ACGTTCCTC-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTCT--AAAACGTGCTACCTGGTTGATCCTGCCAGTA---- 'Epischoenus gracilis (Verboom 636)' CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGT-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-TAGCA--GCC--GGGATGAA----TGCCTGAAAT-ATGTTGCCTGTGCGGTTGTACCCTCGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GCTTTGTGTTGTTGCTA---GCTTCTAT-CAACA-GCGC-AGCCGATTTGA-TGGCATAGTA----CAT-GTGCGG-TTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACGTGTTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-ATGTCC---CTTTTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGGTCTCGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAAGT----GAATGAG-CGA--TTGTCGTATG---TCGTCGTGTGAAA-GTACACCC--CCGTCTTAGTCTTGTTACCGAGATATGGGGTGTGCCGGAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGG{AT}TGATCCTGCCAG------ Epischoenus_villosus ---------------------------------------------------------CA-TTGTGCTC-TAGAA--GCC--GGGATGAA----TGCCTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTTGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACA-GCGC-AGCCGGTTTGA-TGGCATAGTA----CAT-GTGCGG-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACGTGTTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTACG--GG-ATGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGGTCTCGTCT-TGACTAATGTCAGGA--TGTTTGAGTGG-TGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAATT----GAATGAG-CGA--TTGTCGTATG---TCGTCGTGTGAAA-GTACACCC--CCGTCTTAGTCTTGTTACCGAGATGTGGGGTGTGCCGGAAAATG-GCGCGTCGGCTCTCGTTT--AAAACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Eriophorum_vaginatum CTGCGCTTTTGCGCGGCCAACCG-AC-ATGGGGC-TGTC-TCTTCACTCTCCCG-ACCG-TCAGCAAATTTGCTT------GGTTGGGA----TGCTT-GTCATCGGTTGCCTGTGTGGTTCTACCCTTTTGTGGGTA-GCGAAGTCGT----CCC-TTGA-TGGAT---ATTT-GC-TTGCCCGGCTGACA--TTGTTTTGT-CGCTT-GGGT-AGCCGAAATGT-CGGTGGAATC----CTT-GTTGTT-GTGT--GGGCGAAT----GCCTT-GTTACAG-TCACTTGGATTT--TTGCCG-GCTCTCACGGATG-TTGTG---CCCCATCGTTAG-------CTCTG-CGGGCCTCTGT-C-CCACAGA---CTTCG--GG-AGGTCC---CTTGCAT----GGATCA-TTG-CTCT--TGC-------------------------------------------------------------------------------GAGGAGCGTGCTG-ACGTGCA--TGTGGAACG-CCTCTCC----------GATC-GTATGAGCAG-CGA--TTGTCGGTTT---GCGTCAAGAGAAGGG-CCTCCCG-----------------------TCCGGGTTGGTGCTGGAAATG--ATGTGCCGACTATCGTTT--AAGACGTGC-------------------------- Evandra_aristata CCGCACTTTGGTGCGGCCAACCG-TT-GTGGGGC-TGTC-TTTTCACTTTTCCT-TCCG-TCGTGCTT-CTTTT--GCCG-GGGAGGAA----TGCTTGTTAT-CGG-TGTCTGTATGGTTCTACCCCCGCGG-GGAA-CAACG---TTG-CGTTTAAAGA-AGGAT---TTTT-GCTTTGCCCCGCTGATA---TTTGTTATATTTCG-GTGCAAGCTGATTTGT-TGGCTGGGTGAGAACTT-GTGTGG-AAGT--GGGCTCAT----GCCCT-GCGGCC--GCACTTGGATTT--T-GCCG-GCTCTCACGGATG-CCGTG----CCCAACGAGGA-------TTCTG-CGGGCATCTTGTC-CCCTG-ATTTCCTCG--GG-AGTTCC---CATGTATC-CTGGGTCA-TTC-CTCC--GCCGCTC----------------------------AGCTATC-GTG-TTGCCGTTGTTGGGA--TGTTGGAGCGG-TGCGTGCGGGG-CGTGCTC-CGGTGCG--TGCGAGATG-TCTATCCT---------GATT----GAACGAG-CGA--CTGTCGGTTT---CCGTCGCGTGAATGG-ACT--------------------------------------------------------------------------------------------------------- Ficinia_paradoxa CTGCACTTCTGTGCGGCCAACTG-TC-ATGGGGC-TGTC-TTTTCGTTGT-CCA-TTTG-CCTAGTAATTTGCTA------GTTATGGA----TGATT-GTCATCGGTCGCTTGTATGGTTCTACTCTTTTG--GGTA-GTGCATAATT--GTTTTGTTGA-TGCCT---ATTTAGC-CTGTTCTGTTAATG--TTAT--TGT-TGACA-GGAC-GGTCGAGATGT-CAGTGAATTT----CAA-GTGTTT-CCAT---GTGCCTA----GCCAT-GGTAAT--GCACTTGGATGT--TCGCTG-GGTCTCATGGATG-CGGTC----CCTATTGTGAG-------CTCTG-CGGGCTTCATG-C-CCGTAGAA--CCTG---TG-AGGTTG-CCCCTGCAT----AGATCA-TTG-CTCT-------------------------------------------A-TTG------------------CTTCACTGACACATCTTGTTTGGGTGTTGTT-CTTTGCT--TGCGGCATG-CCTCTTA----------GACCCGAATGACTTG-CGA--TTGCTGGTTT---GCGTTGTCACAAGGCTCCTCCCA-----------------------ATTGGGTAGTGGCTGGAGATG--ACGTTCCTGCTCTCGTTT--AAGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA Gahnia_baniensis CTGCGCTGCGGCGTGGCCAGGCG-TC-ATGGACT-TGTC-TTTTCACTTATTCT-CCTG-TCGTGCTT-ATTTT--GCCGAGTTCGGAG----CGCTTGTTAT-CGGCTGTCTGTGCGGATCTACCCTCGTGG-GCAT-CAATG---TCT-TGTTTCGTGA-TGGGT---TTT--GC-TTGCCCCGCCGATA---CTCGCTAT-CGTCG-GTGC-AGCTGATGTGTCTGGCTTATTC----ATT-GTGCGG-TGGT--GGGCAAAC----GCCCTT-GTGCC--GCACTTGGTTTA--TGCCGG-GCTCTCATGGATG-CGGTG--CCCCATTTGAGGT-------GTATG-TGGGCCGTTGGTT-CCTCTGACTTCCTCG--GG-AGGTCC---CATGTGC----GGATCG-TGG-CTCT--GTCGCTC----------------------------TGCTCTC-TCG-TTGCGGAT---------TGCTGGAGCAG-CGCGTGCGGGG-TGCGATC-TTGTGCA--TGCGAGATG-TTTGTCC----------GTTT----GTATGAT-CGA--TTGCTGGCTC---ACGTCGTCGCAGCGG-GCTCCC------------------------GTTTGGGGCGCGCCGGA-GCG--ATGCGTCGGCTCTCGTTT--AAGATGTGCTACCTGGTTGATCCTGCCAGTA---- Gahnia_trifida CTGCGCTTCGGCGTGGCCAGGCG-TC-GTGGACT-TGTC-TTTTCACTTATCCT-CCTG-TCGTGCTT-ATTAA--GCCGGGTTCGGAG----CGCTTGTTAT-CGGTTGTCTGTGCGGATCTACCCTCGGGG-GCAT-CAATG---TCA-TGGTTCGCGA-TGGGT---TTT--GC-TTGCCCCGCCAATA---CTTGCTAT-CGTCG-GCGC-AGCTGATGAGTCTGGCTTATTC----CTT-GTGCGG-TGGT--GGGCGAAT----GCCCCC-GCGCC--GCATTTGGTTTA--TGACGG-GCTCTCATGGATG-CGGTGCTCCCCATTTGAGGT-------GTCAG-TGGGCCGTTGGTT-CCCCTGACTTCCTCA--GG-ATGTCC---CATGTGC----GGATCG-TGG-CTCT--GCTG------------------------------------TC-TCG-TTGCGGA----------TGCTGGAGCAG-CGCGTGCGGGG-TGCGATCTTTGTGCA--TGCGAGATG-TTTGTCC----------GTTT----GAATGAG-CGA--TTGCCGGCTC---ACGTCGTGGCA----------------------------------------------------------------------------------------------------------------- Gahnia_tristis CTGCGCTTCGGCGTGGCCAGGCG-TC-ATGGACT-TGTC-TTTTCACTTATCCT-CCTG-TTGTGCTT-ATTTT--GCCGGGTTCGGAG----CGCTTGTTAT-CGGCTGTCTGTGCGGATCTACCCTGGTGG-GCAT-CAATG---TCG-TGGTTCGTGA-TGGGT---TTT--GC-TTGCCCCGCCGATG---CTCGCTAT-CGTCG-GTGC-AGCTGATGCGTCTGGCTTATTA----CTT-GTGCGG-TGGT--GGGCGAAT----GCCCTC-GTGCC--GCACTTGGTTTA--TGCCGG-GCTCTCATGGATG-CGGTG--CCCCATTTGAGGT-------GTATG-TGGGCCGTCGGTT-CCTCTGACTTCCTCG--GG-AGGTCC---CATGTGC----GGATCG-TGG-CTCT--GCCGCTC----------------------------AGCTCTC-TCG-TTGCGGA----------TGTTGGAGCAG-CGCGTGCGAGG-TGCGATC-TTGTGCA--TGCGAGATG-TTTGTCC----------GTTT----GTATGAG-CGA--TTGCTGGCTC---ACGTCGTGGCAGCGG-GCTCCT------------------------GTTTGGGGCGCGCCGGA-GCG--ACGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC- 'Lagenocarpus albo-niger' ---------------------------------------------------------------------------------------------------------------------------ACCCGTCTCG-TGAC-AGGAAATGCTT-TGGC-------TAAGT---GCTC-GC-ATGTTTTGCTG-----TTTGATAGA-TGGCA-GCAC-AAGTGGCTGAT-GGCGGAT-------CCT-TGCGTGGATGT--GGGATATC--------C-ATACCACTGCTCAAGGATGT--T-GCTG-GCTCCTATGGACG-CTGTG----TGCAATGAGCG-------ATCTG-TTGGCCGTTGGCC-AAGCAGTTT-GCATGAAGG-AGGTCT---CATGCGC---TAGCTCA-TTT-GGCT---------------------------------------------------------------------------------------GAGCG--------GTGCG--TGTGAGAC------TCC----------CCTGTTCGCTT-GAG-CGG--TAGCCGCTGC---ACGTCATG-TGTGGG----------------------------------------------------------ACCCAATCTTGTAT--AGGGGGT---------------------------- Lepidosperma_filiforme CTGCGCTTCGGCGCAGCCGACCG-CC-ATGAAGC-TGTC-TTTTCACTCCTCCT-ACTG-TTGCGCTTTGTTTT--GCGG-GCGAGGA----------CGTTGTCGGTTGTCTGTGTGGTTCTACCCTCGAGG-GGGA-TAACA---TTATTGTTTCATG-ATGGAT---TTTT-GC-TTGCCCCGTCGGTA-TTTTTTTTAT-CGTTG-GCGC-AGCCGATTTGT-TGGCTAAATA----CTT--AGCTG-CAGC--GGGTGTAC----GCACC-TGTACTCGGCACTCGAATTT--T-GCCG-GCTCTCGCGGATG-CAGTG----TCCATCGGGGA-------ATCTGTTGGGCCTCTGGT--CCTCGGATTTCCTCG--GG-AGGTCC---CTTGCAC-----GGAAA-TTG-CTCC--GCCGCTC----------------------------TGCTCTCGCTGTCCTAGTTGCTGGGATGTCGTGGTGGCGCGTGCG----GGG-CGTGCTC-CTGTGCA--TGCGAGATGTTTTGCCC----------GATC----GAATGAG-CGA--CTGCCGATTC---ACGTCTTG-GCGCGGG-CTCCTATTT--------------------ATTTAGGGTTTGCCGCAA-TG--ATGTGTCGGCGCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Lepidosperma_laterale ---------------------------------------------------------------------GTTTT--GCGG-GCGAGGGA---------CGTTGTCGGTTGTCTGTGTGGTTCTACCCTCA-GG-GGAA-TAACA---TTCTTGTTTCATG-ATGGAT---TTTC-GC-TTGCACTGTCGGTATTTTTTTTTAT-CGTCG-GCGC-AGCCGATTTGT-GGGCTAAATA----CTTGGGGCTG-CAGC--GGGTGTAC----GCACC-TGTACTC-GCACCTGAATTT--T-GCCG-GCTCTTGCGGATG-CAGTG----TTCATCGAGGA-------ATTTGTTGGCCTTTGGT---CCCCTGATTTCCTCG--GG-AGGTCC---CTTGCAT----GGATCG-TTG-CCCT--GCCGCTC----------------------------TGCTAT--CTTGTCTCTTTGTCGGGATGTTGTGGCGGTGCGTGCG----GGG-CGTGCTC-TTGTGCG--TGCGAGATG-TTTGCCC----------GATC----GAATGAG-CGA--CTGCCGGTTC---ACGTCTTGTGAGCGGA-CTCCTATTT--------------------ATTTAGGGTTTGCCGCG--TG--ATGTGTCGGCGCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Lepidosperma_longitudinale -TGCGCTTCGGCGTAGCTGACCG-TC-GTGAAGC-TGTC-TTTTCACTCCTCCT-CCTG-TTGCGCTTCGTTTT--GCGG-GAGAGGAA----C----GTTGT-TGGTTGTCTGTGCGGTTCTACCCTCGAGG-GGAA-TAACGATCTTT-TGTTTCATGA-TGGAT---TTTT-GC-TTGCCCC-TCGGTG---TTTTTTAT-CGTCG-GCGT-AGCTGATTTGT-GGGCTAAATA----CTT-GAGCTG-CAGC--GGGTGTAC----GCACC-TGTATCCAGCACTTGTGTTT--T-GTCG-GCTCTCGCGGATG-CAGTG----TTCATTGAGGA-------ATCAG-TTGGCCTCTGGTC-CCCTGATTT-CCTCG--GG-AGGTCC---CTTGCAC----GGATCA-TTG-CTCT--GTCGCTC----------------------------TGCTAAC-CTG-TCCCGGTTGTTGGGA--TGTCGTGGCGG-GGCGTGCGGGG-CGTGCTC-CCGTGCA--TGCGAGATGTTTTGCCC----------GATTATCGGAATGAG-CGA--CTGCCGGTTC---ACGTCTTGTGAGCGG-ACGCCTATTT--------------------ATTTAGGGTTTGCCGC-AACG--ATGTGTCGGCGCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTA---- Lepidosperma_tortuosum -TGCGCTTCGGCGCAGCCGACCG-CC-GTGAAGC-TGTC-TTTTCAC---TCCT-CCTG-TTGCGCTTTGTTTT--GCGG-GCGAGGGA----C----GTTGT-CGGTTGTCTGTTTGGTTCTACCCTCGAGG-GGGA-TGACA--TTAT-TGTTTCATGA-TGGAT---TTTC-GC-TTGCCCCGTCGGTA--TTTTTTTAT-CGTTG-GTGC-AGCCGATTTGT-TGGCTAAATA----CTT-GAGCTG-CAGT--GGGTGTAC----GCACC-TGTACTCGGCACTCGAATTT--T-GCTG-GCTCTCGCGGATG-CAGTG----TCCATCGGGGA-------ATTCGTTGGGCCTCTGGTC-CTCGGATTT-CCTCG--GG-AGGTCC---CTTGCAC----GGATCA-TTG-CTCT--GCCGCTC----------------------------TGCTCTCGTTG-TCCCGGTTGCTGGGA--TGTCGTGGCGG-CGCGTGCGGGG-TGTGCTC-CTGTGCA--TGCGAGATGTTTTGCCC----------GATC----GAATGAG-CGA--CTGCCGGTTT---ACGTCTTGTGCGTGG-ACTCCTATTT--------------------ATTTAGGGTTTGCCGC-AATG--ATGTGTCGGCGCTCGTTT--AAAACGTGCTACCTGGTTGATCCTGCCAGTA---- Machaerina_iridifolia CTGCGCTTTGGCGCGGCCGACCG-TC-GTGAAGC-AGTC-TTTTCACTCCTCCC-CCCG-TTGCGCTT-GTTTT--GCGG-GGAAGGGA----TGC--GTTGT-CGGTTGTCTGTGTGGTTCTACCCTTGCGG-GGAA-TAACA---TTA-TGTCCCATGAATGAAT---TTTT-GC-TCGCCCCGTCGATA--TTTTTTTAT-TGTCG-GGGC-AGCCGATATGT-TGGCTAAATG----CCT-GCGCTC-CAGC--GGGTGAAT----GCCCC-TACGCTCTGCGCTTGGATTT--TGGCCG-GCTCTCACGGATG-CCGTG----TCCATCGAGGA-------ACCCG-TCGGCCTCGGGTC-CCTGGGTTT-CCTCG--GG-AGGTCC---CTTGTAC----GGATCC-TTG-CTCC--GCCGCGC----------------------------TGCTATC-TTG-TCCCGGATGCTGGGA--TGTTGTAGCGG-CGCGCGCGGTG-CGTGGTC-CTGTGCA--TGCGAGATG-TTTGCCC----------GATT----GAAGGAG-CGA--CCGCCGGTTC---ATGTCGTGTGCGCGG-ACTCCTACTC--------------------GTTTAGGGTTCGCCGC-AACG--ATGTGTCGGCCCTCGTTT--AAGATGTGCTACCTGGTTGATCCTGCCA------- Machaerina_juncea CCGCGCTTCGGCGCGGCCGACCG-TC-GTGAAGC-AGTT-TTTTCACTCGCCCT-CCCG-TTGCGCTT-GTTTT--GCGG-GGGAGGG-------GCGCGTTGTCGGCTGTCTGTG-GGTTCTACCCTTGTGG-GGAAGCAACG---TTC-TGTTCCGCGAATGAAT---TTTA-GC-TTGCCCCGTCGATG-TTTTTTTTAT-CGTCG-GAGC-AGCCGATTTGT-TGGCTAAATG----CTT-GCGCTC-CAGC--GGGCGAAT----GC-CC-TGCGCTCCGCGCTTGGATTC--T-GCCG-GCTCTCACGGATG-CCGTG----TCCATCGAGGA-------ATCCGTTGGCCCCTGG----TCTCGGTTTTCCTCG--GT-ATGTCC---CGTGTGC----GGATCA-TTG-CTCC--GCCGCGC----------------------------TGCCG-----------GATGCCGGGATGTTG{CG}{AG}GCGGCGCGCGCG----GCG-CGTGGTC--GGTGCA--TGCGAGATG-TTTGCCC----------GATT----GAATGAG-CGA--CCGCCGGTTC---ACGTCGTGCGAGCGGG-CTCCTGTTC--------------------ATTTAGGGTCCGCCGCA--CG--ATTTGCCGGCTCTCGTTT--AAGACGTGCTACCTGGTAG---------------- Machaerina_mariscoides CTGCGCTTTGGCGCGGCCGACCG-TC-GTGAAGC-TGTC-TTTTCACTCCTCCT-CCCG-TTGCGCTT-CTTTT--GCAG-GGGAGGGA----CGC--GTTGT-CGGCTGTCTGTGTGGTTCTACCCTTGCGG-GGAA-TAACA---TTC-TGTTCCAAGAGTTAAT---TTTT-GC-TTGCCCCGTCAATA---TTTTTTGT-TGTCG-GGGC-AGCCGAT-TGT-TGGCTAAATG----CTT-GCGCTC-CAGC--GGCTGAAT----GCCCC-TGTTCTCCGCGCTTGGATTT--T-GTCG-GCTCTCACGGATG-CCGTG----TCCATCGAGGA-------ATCTG-TTGGCCTCTGGTC-CC-GGGTTT-CCTAG--GG-AGGTCC---CTTGTAC----GGATCA-TTG-CTCT--GCCGCGC----------------------------TGCTATC-TTG-TCCCGGGTGCTGGGA--TGTTGTAGCGG-TGCGCGCGGGG-CGTGCTC-CTGTGCG--TGCGAGACG-TTTGCCC----------GATT----GAATGAG-CGA--CCGCCGGTTC---ACGTCTTGTGAGCGG-ACTCCTACTC--------------------ATTTAGGGTTCGCCGC-AACG--ATGTGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Machaerina_rubiginosa CTGCGCTTCGGCGCGGCCAACCG-TC-GTGGAGC-TGTC-TTTTCACTCCTCCT-CCCG-TTGCGCTTTTTTTT---CGG-GGGAGGGA----CGC--ATTGT-CGGTTGTCTGTGTGGTTCTACCCTTGCGG-GGTA-TATCA---TTG-TGTTGCATGAATGAAT---TTTT-GC-TTGCCCCGTCGATA--TTTTTTTGT-TGTCG-GGGC-AGCCGAT-TGT-TGGCTAGATG----CTT-GCGCTC-CAGC--GGGCGAAT----GCCCCCTGTTCTCCGCGCTTGGATTT--TTGCCG-GCTCTCGCGGATG-CCGTG----TCCATCGAGGA-------ATCCG-TTGGCCTCTGG-C-CCCGGGTTT-CCTCG--GG-AGGTCC---CTTGCAC----GGATCA-TTG-CTCT--GCCGCGC----------------------------TGCTATC-TTG-TCCCGTGTGCTGGGA--TGTTGTGGCGG-TGCGTGCAGGG-TGTGCTC-TAGTGCA--TGCGAGATG-TTTGCCC----------GATT----GAATGAG-CGA--CCGCCGGTTT---GCGTCGTGCGAGCGG-ACTCCTACTT--------------------GTTTAGGGTTCGCCGC-AACG--GTGTGCCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Mesomelaena_pseudostygia C-GCGCTTCGGCGCGGCCAGCCG-CC-GTGGGGC-GGCC-TCTTCACTTTTCCT--CCG-TTGCGCTC-TTTGT--GTCG-GGACGGAG-----ATCGCGCCGCGGTTTGTTTGTGCGTTTTACCCCGTGTAG-GAAC-CTTCA---CGG-GGTTTCGG--ATGGCC---TCT--GC-TTGCCCCGCCCATA---CTTGTTGT-CGGCG-GCGC-AGCTGTTATGTCCGGCTGACTC----GGT-GTGCGG-CGGT--T-GCGGAT----GCTGC-AGCGCGCCGCACTCGGGTTG--T-GCTTTGCTCTCATGGATG-CGGTG----CTCCGCTTGCT-------GTTCTGCGGGTTGTACTTGGCCCCAGAATGCTTTG--GG-TTGTCC---CGCGAGC--TGTGGCCG-TCG-CGGC---TCGTGC----------------------------CGC---------------------------ATAGCGGCGCGTGCG--GGCGGATGTGCCG-TAGCGCG--TGTGCGACGTCCCTTCC----------GACC----GAATGAG-CGA--TTGTCGGCGC---GTGCGGCCCGTTCGGT-CTCCC------------------------CCTTGGGGTGCACCCGGGGCG--GCGCGCC-GTTCTCGTCTAGAGGACGTGCTACCTGGTTGATCCTGCCA------- Neesenbeckia_punctoria CTGCGTTTATGCGCGGCCGACCG-TT-GTGAAGT-TGTC-TTTTCACTCCTCCCGCCCG--CTGCGTT-GTTTT--GCGG-GGGAGGAA----CGC--ATCGT-CGGTTGTCTGTGCGGTTCTACCCACGTGG-GGAA-TATCA---TGA-TGTTTCATGA-TGGAT---TTTT-GC-TTGCCCCGTCGATA----TTTTTAT-CGTCG-GCGC-AGTCGATTGGT-TGGCTAAATT----CTT-GTGCCG-CGGC--GGGTCAAT----GCCCC-GATACTCGGCGCTTGGATTT--T-TCCG-GCTCTCGCGGATG-CCGTG----TCCATCGAGGA-------ATCAG-TTGGCCTCCGGTC-CCTTGATTTACCTCGG-GG-GGGTCC---CTTGTAC----GGATCG-TTG-CTCC--GCCGCTC----------------------------TGCCATC-TTG-TCCGGTGTGATGGGA--TGTCGGAG----------CGGTG-CGTGGTACCCGTGCA--TGCGAGATG-TTCACCC----------GATT----GAATGAG-CGA--CTGCCGGTTCTCGTCGTCGTGCGAGTCGGACTCCTATTC--------------------ACTTAGGGTTCGCCGC-AACG--ACGTGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAG------ Oreobolus_distichus ---------GTTGCGGCCAACTG-TC-ATGGGGC-GGTC-TTCTCAC-TTTTTCCTTTT-GCGTGCTC-CTTTT--GCG--GCGGGGGA----TGGTTGCGAC-TTGTTGTTTGTTTGGTTCTATCCCCACGG-GGAA-C-TAATTTTTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCATTTTAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ATCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAT---TGGATCA-TTGCCCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGCGGGGGCGTGTTCCAAGTGCATGTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAA--TTGTCGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGG-TGCTCTCAAATG--ACGTGTCGTCTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTA---- Ptilothrix_deusta C-GCGCTTCGGCGCGGCCAGCCG-TC-GTGGGGC-GGTC-TCTTCACTTTTCCT-TCCG-CCGCCCTC-TCGGC--GCCG-GGACGGAG-----CACTAGCTGCGGGCTGT-TGTGCGGTTCTACCCTCGCAG-GGTA-CGAGT---TTC-GGCTTCCAG-ATGGTT---TCGG-CT-TTGCTCCGCCGATA------CTTGT-CGGCG-GCGC-AGCTGCTGTTTCCGGCTAAATC----AGT-GTGCGA-CGGT--T-GCGGAT----GCCCT-GCCGCGCCGCACTCGGATTTTGT-GCCGTGCTCTCACGGATG-CGGTG----CTCCATTTGCG-------GTTCTGCGGGTCGTAGTT--CCCCAGAACGCTTCG--GG-TTGTCC---CGCGTGC---AAAGCCG-TCG-CGGT----------------------------------------------------------------------------------------------CCC-TTTTGCG--TGCGTGATGTCCCATCC----------GACC----GAACGAG-CGA--TTGCCGGCGC---GCGTC---CGACCGGT-CTGC-------------------------CCTTTGGGTGTTCCGGGG-CG--GCGCGCTGGCTCTCGTCT-GAGGACGTGCTACCTGGTTGATCCTGCA-------- Rhynchospora_rugosa_subsp._brownii CTGCGCATCTGCGCGGCTGGCCG-AC-ATGGGGC-CGTC-TCTTCATTCTTCCTCCCGT-TAGGCGGCGCATATT-GCCT-CGGAGGGATGCGTGCAGTCGGCTT---TGCCTGTGTGGTTCTACCCTTGCGG-GGAA-C--TAACTCG--GTCCC-ATGA-CGGATGCGTTTGAGC-TTACCCTGTCGATC--ATTTATTTT-CGTCA-GGGC-AGCCGAATTGT-TGGCGAAACC----CTT-GTGCGT-TGCCACAGCGGAAT----GCTGGCGGTACC--GCACTCGAGCGT--C-GTCG-GCTCTTGCGGATG-CTGTG----CCCACGGCCAG-------TTCTG-CGGGCCTCTGG-C-CCGCAG---ACTTTG--GG-AG----------------------CG-TGG-CTCC--GTCGCTCGCTTGTTG--------------------TGTCGGGTTTCCC-----------------GATGCTGGAGCGTTGCG-------------------------AGGGACG-CCTCTCT----------GACC-GAACGAGTAG-CGA--TTGCCGGTTA---ACGTAGTGAGTAGGG-CCTCCCT-----------------------TCCGGGGCGGTGCCGGAAACA--ACGTGCCGTCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Schoenus_caespititius CTGTGCTTCGGTGCAGCCAACCG-CC-GTGGGGC-TGTC-TTTTCACTGTTCCT-CCCG-ATGCGCTTTTTTGT--GCGG-GGGAGGGG---TCGCTTGCTAT-CGGTGGTCTGTGTAGTTCTACCCTCGTGC-GGAA-CAAAA---GTG-GGTTTCATGA-TAGGT---TTCT-GC-CTGCGCCGTCGACA---CGTGCTGT-CATCG-GCGC-GGCTGATTTGT-TGGCATAATG----CTT-GTGCGG-CTGT--GGGCGCATGAATAGCTCCAGTACT--GTACACGCGTTG--T-GTCG-GCCCTCACGGATG-CGGTG----CGCAATGAGGA-------ATCCA-TGCGTCTTCGGTC-GC-TGGATTATTTCG--GG-ATGTCC---CTCGCAC----GGATTG-CCG-CTTC--GTTGCTT---------------------------------------------------------------------TGCTT-CGAGG-CGCGGTC-CTGTGCT--GGCGAGATG-GTTGCCC----------GGTT----GAAAGTG-CGA--TTGTCCGGTC---TCGTCGTGCAAAGGC-GCTCCC------------------------GTTGAGGGCGCGCCGGAAGCG--ACTTGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTA---- Schoenus_curvifolius CTGTGCTTCGGCGCGGCCAACCG-TC-GTGGGGC-TGTC-TCTTCACTAATCAT-CCCG-CTCTGCTC-GTGCG--GGAC-GGGAGGAA----TGCTAGCTTG-CGGCTGTCTGTGCGGTTCTACCCTAGT---GGTA-CCTTG---TTA-GGCTTCTTGA-CGGAG---TTTTTGC-TTGCCCCGT-GATG---TTCATTAT-CATTG-GGGC-AGTCGATATGC-TGGCTTAATT----TGC-GTGCCG-TGGT--GGTCTAG-----GCCTCA-GCATT--GCGCGTGCTTTT--T-GTCG-GCTCTCACGGATG-CTGTG----ACCTTTGAGGA-------ATTCA-TGGGCCTTCGGAC-CC-TTGATTTC-GCG--GG-ATATGCCC-CTTGT--------------------------------------------------------------------------------------------------------------------TC-CGGAGCA--AGTGGGATG-TTTATCC----------GATT----CGATGAG-CGA--TTGCT-GTTC---TCGCGTTGTTCCATG-ATGCGG--------------------------------------------------AGACGGCTCTCGTTT--AGGACGTGTTACCTGGTTGATCCTGCCAGTAGTCA Schoenus_efoliatus CTGTGCTTCGGTGCAGCCAACCG-CC-GTGGAGC-TGTC-TTTTCACTGTTCCT-CCCG-ATGCGCTCTTTTGG--GCGG-GGGAGGGA---CTGCACGCTGT-CGGTGGTCTGTGTGGTTCTACCCTTGTGC-GGAA-CAAAA---GTG-GGCTTGATAA-TAGGC---TTCT-GC-TTGCGCTGTCGGCA---CGTGTTGT-CGTCG-GCGC-GGCTGATTTGT-TGGCATAATG----CTT-GTGCGG-CTGC--GGGCGTGTGAATGCCTCCGGTACT--GCACGCGCATTT--T-GTCG-GCTCTCACGGATG-CGGTG----CGCATTGAGGA-------ATCCA-TGCGTCTTCGGTC-GC-TGGATTACTTCG--GG-ATGTCC---CTTGCAC----GGGTTG-TCG-CTCC--GTTGCTT---------------------------------------------------------------------TGCTT-CGGGT-CGCGCTC-CCGTGCC--TGCGAGATG-CTTGCCC----------GGTT----GAAAGAGACGA--TTGCCTGATC---TCGTCGTGTGAAGGC-CT---------------------------------------------------------------------------------------------------------- Schoenus_grandiflorus CGGTGTTTCGGCATCGCTAACCG-TT-GTGGCGC-GGTC-TTTTCAGCATGCCT-CCTG-TTGTGCCC-GCGCG--GCTC-GGGAGGAT----CAATTGTTTATTGGTCGTCTGTGTGGATCTACCCTAGTGC-GGAA-CGATG---TTT-GGTTCCATCA-TGGTT---TTTT-GT-TCGCCCCGTTGATA---TTCGTTAT-CATCG-GTGC-GACTGCGTTGT-GGGCTTAATT----CAT-GTGTTG-TTGA--GGGCGAGG----GCCTC-GTTGGT--GCATTTGGATTT--T-GTCG-GCTCTCACGGATG-CTGTA----CCGTTTGCGGA-------AGTCG-TGGGCTTTTGGAC-CC-CCGATTTTCACG--GG-ATGTCC---CTTGCGT---TGGATCA-TTG-CTCC--GTCGCTA----------------------------CGCGATC-TTG-TTGTGGGTGTTGGTA--TGTCGGCACGG-TGCGTGCGGGG-CGTGCTC-TTGTGCA--AGTGAGATG-TTTGTCC----------GTCT----GAAAGAG-CGA--TTGCC-GCTC---TCG--------CATC-ATTCCA----------------------------------------TAATG--ATGTGGCGGCTCTTGTTT--ATGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Schoenus_nitens CTGCACTTTGGTGCGGCCAACCG-CC-GTGGGGC-TGTC-TTTTCACTATTTCT-TCCG-CTGTGCCC-TATAA--GCCT-GGGAAGAA----TGCTCGGATT-CGGTCGCCTGTGTGGTTGTACCCTTGTGT-GGTA-TGTT----CTC-GTTGGACT---GTAAT--------GC-CTGTGTTGTTGCTT---GCTTCTAT-TGACAGGCGC-AGCTGTTTCGA-TGGCATAGTG----CAT-CTGCGG-TTTT--GGGCGAAT----GTCCTT-TTGTT--GCACACGCATTA--T-GTCA-GCTCTCATGGATT-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGTC--CTGTGGATTTCTTCG--GG-ATGTCC---CTTGTGC--GTGGATTCATTA-CTTT--GCTGCTC----------------------------CGCTCTCGTCT-TAACAAATGTTGGGA--TGTTTGAGCGGGTGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCGAGATG-CCTGTCCC-----ATTGAAA-----TAAAGGAGCGA--TTGTCGTATG---CCGTCGTTTGAAA-GCACACCCC-CGCCATGGTCTTTGTCACAGAGATGTGGGGTGTGCCGGAAGATG-GCGCGTCGACCCTCGTAT--AAGACGTGCTACCTGGTTGATCCTGCCA------- Schoenus_pennisetis -TGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-TGTC-TCTTCACTGTTTCC-TCCG-TCGTGCTC-TGGAA--GCCG-GGGAGGAA----CGC-TGGAAT-CGGTTGCCTGTGCGGTTGTACCCTCGTGC-GGTA-TTTT----TCC-GTCCGACT--TGCGAT--------GC-TTGCGACGTCGATA---GCTTCTGT-CGACGGGCGC-GGCCGAGTTGA-CGGCACGGTA----CGT-GCGCGG-TTTC--GGGCGGAG----GCCCTG-TCGCC--GCGGGCGTATTT--T-GTCG-GCTCTCACGGATG-CGGTG----CCCATCGAGGA-------TTCCG-CGGGCCTATGGC--TTGCGGATTTCTTCG--GG-ACGTCC---GTTGCGC--GTGGACTG-TTG-CTCC--{GT}CTCTCT----------------------------CA-----------------TGAGAGGG--------AGTCGTTGCTGC{GT}-------------CTGC{GT}CG--CGCGAGATG-TTTGTCCCGTCGGACCGAACC----GAATGAG-CGA--CTGTCGTGCG---TCGCCTCGCGACG-GTGCTCCC--CTGTCCCCGTCTTTGGGCGCGGGCGCGGGGTGCGCCGGTCTCGGAGCGCGCCGGCTCTCGTTT--AGGACGTGCTACCTGGTTGATCCTGCC-------- Schoenus_rigens ------------GCAGCCAACCG-CC-GTGGAGC-TGTC-TTTTCACTGTTCCT-CCCG-ATGCATTCTTTTGG--GCAG-GGGAGGGA----TCGCTTGCTATCGGTGATCTGTGTGGTTCTACCCTTGTGC-GGAA-TAAAA---GTA-GGCTTGAA--ATAGGC---TTTT-GC-TTGCGCTGTCGGCA---CGTGTTGT-CGTCA-GCGC-GGCTGATTTGT-TGGCATAATG----CTT-GTGCTG-CTGT--GGGCCAATGATGGCTCC-AGTACT--GCACACGCGTTT--T-GTCG-GCTCTCAC-GATG-CGGTG----CGTAATGAGGA-------AATCCATGCGTCTTCGGT--CGCTGGATTACTTCG--GGAATGTCC---CTTGCAC----GGATTG-TCG-CTTC--GTTGCTT----------------------------TGCTT--------------------------------------CG----GGG-CGCTTTC-CTGTGC---TGCGAGATG-CTTGCCC----------G-TT----GAAAAAG-CGA--TTGCCTGATC---TTGTCGTGTGATGGCG-CTCTC------------------------ATTGAGGGTGTGCCGGAAGCG--ACTTGTCGGCTCTCGT---GAAGAC------------------------------ Tetraria_bolusii CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-T{AG}GAA--GCCG-GGGATGAA----TGCTTGAAAT-CGGTGGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TAGCATAGTA----CAT-GTGC{AG}G-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATAC{AG}TATTA--T-GTCG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-{CT}GGGCCTTTGGC--{CT}CGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTTGTCT-TGACCAAT{AG}TCAGGA--TGTTTGAGTGG-TGCTCGCGGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTTGTTTGAAA-GTACACCC--TCGTCTTAGTCATGTTACCGAGATG{CT}GGGGTGTGCCGAAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC- Tetraria_capillaris CTGCGCTTCTGCGCGGCCAACCG-TC-GTGGAGT-TGTC-TTTTCACTCTTCCT-CCCG-TTTGCATTGCTGTT--GCGG-TTGAGGAA----TGC--GTTGT-CGGTTGCCTGTGTTGTTCTACCCATGCGG-GGAA-TACGG----AA-ATTTTCATGA-TGGAT---GTTT-GC-TTGCACCGTTGATA----TTTTTAT-CGTCG-GCGC-AGTCGATTGGT-TGGCTAAATC----CTT-GTGCCG-CAGC--GGGTCAAT-AATGCCTC-GATACTCGGCACTTGGATTT--T-ACCG-GCTCTCGCGGATG-CCGTG----TCCATCGAGGA-------ATCTG-TTGGCCTCTGGCC-ATTTGATTT-CCTCG--GG-AGGTCC---CATGTAC----GGATTT-TTG-CTCT--GCCGCTC----------------------------TGCTATC-TCG-TCTCCGGAATGATGGGATGT----------GTGAGCGGTG-CGTGCCC-CCGTGCA--TGCGAGATG-TTTGCCC----------GATTGATTGAATGAG-CGA--CTGCCGGTTC---TCGTCGTGTG-GGCG-ACTCCTATTC--------------------ATTTAGATTTTCCCGC-CAT---------------------------------------------------------- Tetraria_compacta CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-TGGAA--GCCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-{AT}AGCATAGTA----CAT-GTGCGG-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACATATTA--T-GTCA-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGA{AT}CA-TTA-CTCT--GCTGCTT----------------------------CGCTCTT{AG}TCT-TGACCAATG{CT}CAGGA--TGTTTGAGTGG-TGCTCGCGGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----AGTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTTGTTTGAAA-GTACACCC--TCGTCTTAGTCATGTTACCGAGATGTGGGGTGTGCCGAAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTA---- Tetraria_compar ---------------------------------C-AGTC-TTTTCACTATTTCT-TCCG-TTGTGCTC-TAGAA--GCCG-GGGATGAA----TGCTTCAGAT-CGGTTGCCTGTGCGGTTGTACCCTCGTGC-GGTA-TGTT----TTC-GGCGGACTCT-GTAAT--------GC-TTGTGCTGTTGCTA---GCTTCTAT-CGACAAGCGC-AACCGGTTTGA-TGGGATAGTA----CAT-GTGCGG-CTGT--GGGTGGAT----ACCCTG-TTGTT--GCATACGTATTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCTATCGAGGA-------TTCCG-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-ATGTCC---CTTGTGC--ATGGATCG-TTA-CTCC--GCTGCTT----------------------------CGCTCTCGTCT-TGACCAATGTCGGGA--TGTTTGAGCGG-TGCTCGCAGGG-CGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAAAT----GAATGAG-CGA--TTGCCGTATG---TCGTCGTGTGAAA-GTACACCC--CCATCTTAGTCTTGTTACCGAGATGTGGGGTGTGCCGGAAGATG-GCGCATCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_crassa CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-TGGAA--GTCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TAGCATAGTA----CAT-GTGCGG-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACATATTA--T-GTCG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTTGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGCGGGG-TGTGCTC-TTGTGCA--TGTGAGATG-TTTGTCCC-----AGTGAATT----GAATGAG-CGA--TTGCCGTATG---TTGTTGTTCGAAA-GTACACCC--TCGTCTTAGTCATGTTACCGAGATGTGGGGTGTGCCGAAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_cuspidata CTGCACTTCGGTGCGGCCAACCG-CCGTGGAAGC-AGTCTTTTTCACTATTTCT-TCCATTTGTGCTC-TGGAA--GTCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TAGCATAGTA----CAT-GTGCGG-AATT--GGGTGAAC----ACCCTA-TTGTT--GCATACATATTA--T-GTCG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTTGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGTGGGG-TGTGCTC-TTGTGCT--TGCGAGATG-TTTGTCCC-----AT--AATT----GAATG------------------------------------------------------------------------------------------------------------------------------------------------- Tetraria_exilis CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-TGGAA--GTCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TAGCATAGTA----CAT-GTGCGG-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACATATTA--T-GTTG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTACTT----------------------------CGCTCTTGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGCGGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----AGTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTTGTTTGAAA-GTACCCCC--TCGTCTTAGTCATGTTACCGAGATGTGGGGTGTGCCGAAAGATG-GCGCATCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_flexuosa CTGTGCTTCGGCGCGGCTAACCG-TC-ATGGCGC-TGTC-TTTTCACTGTGTCT-TCCG-TTGTGCCC-GCGCG--GCCC-GGGAGGAA----TGCTCGTTTTTCGGTCGTCTGTGTGGTTCTACCCTGGTGT-GGTA-CGATA---TTC-GGTTCCATGA-CGGAT---ATTT-GC-TTGCCCCGTTGGTA---CTCGCTAC-CATCG-GTGC-AGCCGGGTTGC-GGGCTCAATT----CAT-GTGCTG-CAGC--GGGCGAAG----GCCTCG-GCGCT--GCACTTGGATTT--C-CCCA-GCTCTCACGGATG-CCGTG----CCCTTCGAGGA-------ACTCG-CGGGCCTCCAGA--CCCCCGATTCCCACG--GG-AAGTCC---CTTGCAT---TGGATCA-TTG-CTCC--GCCGCTC----------------------------TGCTCTT-TTG-TTGCGGGTGTTGGGA--TGTTGGCGCGG-TGCGTGCGGG--CGTGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GTTC----GAATGAG-CGA--TTGTCGCGCG---TCGTTCCTT-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_involucrata --GTGCTTCGGCGCGGCTAACCG-TC-ATGGCGT-TGTC-TTTTCATTGTGCCA-CCCG-TTGTGCGC-GTGTG--GCCC-GGGAGGAA----CCCTCGTTTTTTGGTCGTCTGTGTGGTTCTACCCTTGTGC-GGTA-TGACA---TTC-GGTTCCATGA-CGGTT---ATTT-GC-TTGCCCCGTTGAAA---TTTGTTAT-CATCG-GTGC-AGCCGAGTTGC-GGACTTAATT----CAT-GTGCTG-AAGT--GGGCGAGG----GCCTCG-GTACT--GCACTTGGATTT--T-GTCG-GCTCTCACGGATG-CTGTG----CCCTTCGAGGA-------ACTCG-CGGGCCTCCGGTC-CCCCCGATTCCCACG--GG-ATGTCC---CTTGCAT---TGGATCT-TTG-GTCC--GTCGTTC----------------------------CGCTATA-TTG-TTGCGGGTGTTGGGA--TGTCGGCGCGG-TGCGTGCGGGT-CGAGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCCCG---TCGTTCCTC-AGC-GT------------------------------------------------------CGCGGCGACACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_microstachys CTGCGCTTTGGCGCGGCTAACCG-TC-ATGACGC-TGTC-TTCTCACTGTGCCT-CCCG--TGTGCCC-GCGTG--GCCC-GGGAGGGT----CGCTCGTTTTTCGGTCGTCTGTGTGGTTCTACCCTAGTGCGGGTA-CGACA---TTC-GGTTTCATGA-TGGAT---ATTT-GC-TTGCCCCGTTGATA---TTCG-TAT-CATCG-GTGT-AGCCGACTTGC-GGGCTCAATT----CAT-GTGTTG-CAGT--GGGCGTGG----GCCTCG-GCACT--GCACTTGGATTT--T-GTCG-GCTCTCGCGGATG-CCGTG----TCCTTTGAGGA-------ACTT--TGGGCCTCCGGT--CCCTCCATTCCCACG--GG-AAGTCC---CTTGCAT---TGGATCA-TTA-CTCC--GCCGCTC----------------------------CGCTATC-TTG-TTGTGGGTGTTGGGA--TGTTGGCGCGG-TGCGTGCGGGG-CGTGCTC-TTGTGCA--AGTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCGCG---TCGTTCCAC-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_nigrovaginata CTGCGCTTTGGCGCGGCTAACCG-TC-ATGGCGC-TGTC-TTTTCATTGTGTCC-CCCG-TGGTGCGC-GTGCG--GCCC-GGGAGGAT----CGCTCGTTTTTCGGTCGTCTGTGTGGTTCTACCCTAGTGC-GGTA-CGTCA---TTC-GGTTCAATGA-TGGAT---ATTT-GC-TTGCCTCGTTGATA--TTTCATTAT-CATCG-GTGT-AGCCGACTTGC-GGGCTTAATT----CAT-GTGTTG-CAGT--GGGCGTGG----GCCTCG-GTACT--GCACTTGGATTT--C-GTCG-GCTCTCACGGATG-CCGTG----TCCTTTGAGGA-------ACTT--TGGGCCTCCGGT--CCCTCGATTCCCACG--GG-AAGTCC---CTTGCAT---TGGATCA-TTA-CTCC--GCCGCTC----------------------------TGCAATC-TTG-TTGCGGGTGTTGGGA--TGTCGGCGCGG-TGCGTGCGGGG-CGTGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCGCG---TCGTTCCAC-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_picta CTGCACCTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTAT-TCCA-TTGTGCTA-TAGAA--GTCG-GGGAAGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTCGCGC-GGTA-TGTTT---TTC-GGTGGACTCT-ATAAT--------GC-TTGTGCTGTTGCTA---GCTTCTAT-CAACAAGTGC-AATCGGTTTGA-TGGGATAGTA----CAT-GTGCGG-CTGT--GGGTGAAT----ACCCTA-TTGTT--GCATACGTATTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCA--GG-ATGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTCGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCAAGATG-TTTGTCCC-----ATTGAATT----GAATGAG-CGA--TTGCCATATG---TCGCCGTGTGAAA-GTACACCC--CCTTCTTAGTCTTGTTACTGAGATGTGGGGTGTGCC--AAGATG-GCGCATCAACACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_sylvatica CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCG-TTGAGCTC-TAGGA--GCCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTCGTGC-GGTA-TGTT----TTC-GGTTGACTCT-ATAAT--------GC-TTGTGCTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TGGGATAGTA----CAT-GTGCGG-CTGT--GGGTGAGT----ACCCTA-TCGTT--GCATACGTATTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-ATGTCC---CTTGTGC--ATGGATCA-TTA-CTCC--G{AC}TGCTT----------------------------CGCTCTCGCCT-CGACCGATGTCGGGA--TGTTTGAGTGG-TGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTCGTGTGAAA-GTACACCC--CCATCTTAGTCTTGCTACCGAGAAGTGGGGTGTGCCGGAAGATG-GCGCATCACCTCTCGTTT--AAAACGTGCTACCTGGTTGATCCTGCCAG------ Tetraria_triangularis ---TGCTTCGGCGCGGCTAACCG-TC-ATGGCGC-TGTC-TTTTCACTGTGCTT-CTCG--TGTGCCA-GCTTG--GCCC-GGGAGGAA----TGCTCATTTTTCGGTCGTCTGTGTGGTTCTACCCTAGTGCGGGTA-CGACA---TTC-TATTCTATGA-TGGAT---ATTT-GT-TTGCCCCGTTGATA---CTCGTTAT-CATCG-GTGC-AGCTGATTTGC-GGGCTTAATT----CAT-GTGCTG-CCGT--GGGCGAGG----GCCTCG-GCACT--GCACTTGGATTT--T-GCCG-GCTCTCACGGATG-CCGTG----CCCTTCGAGGA-------ACTCG-CGGGCCTCCGGT--CCCCCGATTCCCACG--GG-AATTCC---CTTGCAT---TGGATCA-TTG-CTCC--GCCGCCT----------------------------CGCTATC-TTG-TTGCGGGTGTTGGGA--TGTCGGCGCGG-TGCGTGTGGGG-CGTGCTC-CTGTGCA--ATTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCGCG---TCGTTCCAT-AGC-GT------------------------------------------------------CGTGGCGGCA-------------------------------------------- Tetraria_ustulata --GTGCTTCGGCGCGGCCAACCG-CC-ATGGTGC-TGTC-TTTTCACTGTGCCT-CCCG-TCGTGCCC-TCGCG--GCCC-GGGAGGAA----CGTTCGTTTTACGGTCGTCTGTGTGGTTCTACCCTAGTGC-GGTA-CGACA---TTT-GGTTCCATGA-CGGAT---ATTT-GC-TTGCCCCGTTGATA---TTCGTTAT-CATCG-GTGC-AGCCGAGTTGC-GGGTTTAATT----CAT-GTGCTG-CAGT--GGGCGAGG----GCCTCT-GCACT--GCACTTGGATTT--C-GCCA-GCTCTCATGGATG-CCGTG----CCCTTCGGGGA-------ACTCG-CGGGCCTACGGG--CCCCCGATTCCCACG--AG-AAGTCC---CTTGCAT---TGGATCA-TTG-CTCT--GCCGCTC----------------------------CGCTATC-TTG-TTGCGGATGTTGGGA--TGTCGGCGCGGTTGCGTGCGGGG-CGTGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCCCG---TCGTTCCTC-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tetraria_variabilis ----------------------------------------------------------------------------------------------GCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TGGCATAGTA----CAT-GTGCGG-A{AT}TT--GGGTGAAC----ACCCTA-TTGTT--GCATACGTATTA--T-GTCG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTTGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGTGGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----AGTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTTGTTTGAAA-GTACACCC--TCGTCTTAGTCATGTTACCGAGATGTGGGGTGTGCCGAAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCA------- Trianoptiles_capensis CTGTACTTCGGTGCGGCCAACCG-TC-ATGAGGC-TGTC-TTT-CATTCT-----CCCT-GCCTT-AC-ATTCT--GGCG-GGTAGGGA---CCCGATATTTGCCGGCTGCCTGTGTGGTTTTACCCGTGCGG-GGAT-CTTAAGTCGTG-ACGTT---------GT---CCAA-GC-TTGCCTCGTCG--G---CGTGTGGT-TGTGG-GGGC-AGTCGGAATGT-TGGCGGAATC----CTT-GTGTCGTCTGA--GGGCCAAT----GACCC-TATGCG--GCACTCGGATGC--T-GCCG-GCTCTCATGGATG-CGGTG----CGAAATAAAGG-------TTCTG-CGGGCCTC-GGT--CCCAGATTT-CCTCG--GG-AGTTCC---CTTGTAC----GGATTG-TTG-CTCC--GCTGCTT----------------------------CGCCCTC-ATA-CGGG-------------CGTCGGAGCGG-TTTGTG----------CTC-CCGTGCA--TGCGAGATG-TCTCTCC----------ATTC----TAGTGAG-CGA--CTGCCGGTTC---GGGTTGCGCTGATGG-CCTCCC------------------------TTCTCGGGCGTGCCG-AAGCG--TCGTGCCGGCTCTCGTTT--AGGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA Tricostularia_pauciflora CTGCGCTTTGGTGTGGCTAACCG-TC-TTGGGGC-TGTC-TTTTCACTGGGCCT-CCCG-TCGGGCTC-GTGTG--GCTC-GGGAGGCA-----CGCTTTCCTACGGTTGTCTGTGTGGGTCTACCCGTCTGC-GGTA-TGACG---TTC-GGTCTCATG-ACGGAT---CTCT-GC-TAGCCCCGTTGATA---TTCGCTAT-CAGCG-GGGC-AGCTGTTTTGC-TGGCACTATG----CAC-GTGCTG-TTGT--G-GCGAGG----GCCTC-GATCCT--GCGCGTGCATTT--T-GTCG-GCTCTCACGGATA-CCGTG----CCCTTGGAGGA-------ATTCTCGGGCCTACGAGT--CTCTTGATTTTCACG--GG-TTGTCC---CTTGCAC---TCGTTCA-GTG-CTCCGTGTCTCAT----------------------------TGCT------------GATGTGGCGATGTCGGCGCG-------------GGG-CGTACTG-CAGTGCA--GGTGAGATG-CTTATCC----------GATT----GGCCGAG-CGA--TTGCCGT----------------------------------------------------TCTCACGTTGTTCTCCAA-CG--ACGAGGCGGTTCTCGTTT---AGGCGCGCTACCTGGTTGATCCTGCCAGTAGTCA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18781] TITLE ITS; LINK TAXA = Taxa6; DIMENSIONS NCHAR=844; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrostylis_aphylla -----------------------------------------------------------------------------------------------------GGATCATTGTCG---TTGCCTTTCGGA-GAATGC-GACCGGCGCACGCGTA-AAG-----------GCC--GTGGAGAAGCCTTCT-CCTCGGCCCT-ACCGG-CCC-----------------------CGACGC--TGGTCG-TGGCGTCGG------AATACGGCGCGGAACGA--CG-CCAAGGAACACAGAT--TGTCGAGGC--GGACGGCGATGCGCGCTTGCGCTGCGTCGT--CTGTTGAGGCCG-------AAGCAA------AAAG-AGATGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCACGGGCGTGAGTAGCCCACGCACGCTCGGG--AGC----CCCCGACGCGGACATTGGCCCTTCGAGCC--GCGAGGCG-CGACGGGCTC-AAGCGGAACGGCCGCCGGCT--GAGGC-------CGGGAGCGACGAGTGGTGGGC-CAC-TAGCGCGCGTT-GCCCCGGA-ACTCTGTGCCGGC------CCT-GTTT-GGACCCC-GAGAA-AGGACGGCGT{CT}GTTGCGGCGCGAA--GTCGTGCGACGCGGTCGGACCGATA-CCCCAGGGTCAGGCGAA------------------------------- Calyptrocarya --------------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTATCG---TTTTGCTTGCCG-AAACAC-GACCTGTGCACGTGTG-ATC---GAATGCT-GCT--GGGGCGGCTGTGCCG-TCCCCGCCCC-CCCGG-CCGCGGCGG-CTGTGCCCTT------GGGTGTTGCTGCCG-TG-AGCCG-------AAAACGGCATGGGGTCA--TG-CCAAGGTACACTCAA--TGCGGAGGTCGGGACG-CTGCGTGTTTGATCG-TGCGGCCCT-CGACCGAAGCT--------AAGGAA------AACA-ATAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTACCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCAACGCTCGGG--CG-----TCTCGATGCGGATCTTGGCCCTTCGAGCT--GCACGGCT-CGGCGGGCCG-AAGT-GCGCCTCGGTCGTAT--GTGGC-------TGGGAGCGGCGAGTGGTGAGT--TC-CTTCGCGCGCC-GCCCCTGA-GCCTC-CGTCGAC------ATTCATTT-GACCCCA-TGACG-AGGTGATTGCCGATGCGGTGTTGC-CGCTGTGCGGCCTCCTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCTGAGTTTAAGCATATCA----- Capeobolus_brevicaulis ----------------------------------------------------------------------------------CGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAAT---AACCGTTGGGCATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCAA-ATCGG-CACCGGCCT-TCATGCCCTAC---CGGGGAGCGTTGGTCC-TG-TGTTGA------AATACGGCGTGGATTGA--TG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGTT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CACA-AGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATCCATGCTCGGG--CTA----CCCTGATGCGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGGCTG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTTTGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CATTGGCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCAGCGCTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATATCAATA-- Carex_magellanica -------------------------------------------------------------------------CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCG---TTGCCTTTCCAG-AAACAC-GACCGTCGAACACGTG-ACA---GAATGCT-GCC--GCGGAGGCGCCGCCT-CCTCGGCCCC-ACCGG-CCTCCTCCC-TCTTGCCCTTC----GGGGCGCGTCGGTTGCTG--GTCGG------AATACGGCGCGGGATGA--CG-CCAAGGAACACGGTA-AAGCTGAGGC---ACCGGCGAGACGCTCAAGGT-CTCTGTCGG-TTGCCAAGGCC--------ATCAAA-----AAAAA-ATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGT--TGC----CAGAGATGCGGATATTGGCCCTCCGAGCC--GCGAGGCG-CGGTGGGCCC-AAGT-GTGCGGCCGTCGTGC--GTGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCACGTC-ACCCCGAG-CCCCG-TACCGAC------CCTTGTAC-GACCCCC-TAACG-AGGAGCAAGTCGCTGCGGCTTCG---GCTGTGCGGTGCCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATCAATA-- Carpha_alpina -GGCGGTCCGCCGCCCGTGAACGTCGAGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGTCTT-ACAA-AAACAT-GACCATGGCGCACG-A-GTCACAGAAAGCT-GCC--GGGGGGGCTTTGCCC-CGCCGGCCC--ACCGG-CACCGGCAG-TCTCCCCCTTC--GGGGGGTGTGTTGCCTG-TG-TGCCG-------AACACGGCGTGGGTTGA--CG-CCAAGGAACAAGAGA--TGCTGAGGC--GGCCGGCGGAGCGCTGTGGTG-CCCCGCAGG-GCGCCGATGCG--------AATGAA------CACAATGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATC-ACGCTCGAG---GC----GCCCGATGCGGAGCCTGGCTCTCCGAGCC--CCACGGCA-CGGTGGGCCT-AAGA-GTACGGCCGTCGGAT--GGGGC-------CGGGAGCGGCGAGTGGTGGTC--TA-CTTCGCACGCC-GCCCCGCA-CCCAT-TGCCGGC------CCTTGTAC-GACCCCCCGAACG-AGGAGACGGCCGT-ATAGCGTACC--GCTGTGCGGCCACTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCTGAGTTTAAGCATATAAATAAG Carpha_glomerata ---------------------------------------------------------------------------AGGTTTCCGTAGGTGAACCTGCGGAAGGATC{AT}TTGTCG---TTGTCTT-{AC}CAA-AAACAT-GACCATGGCGCACG-A-GTCACAGAAAGCT-GCC--GGGGGGGCTTTGCCG-CTCCGGCCC--ACCGG-CACCGGCAC-TCTCCCCCTTC--GGGGGGTGTGTTGCATG-TG-TGCCG-------AACACGGCGTGGGTTGA--CG-CCAAGGAACAAGAGA--TGCTGAGGC--GGCCGGCGGAGCGCTGAGGCG-CACCGCAGG-ACGCCGATGCG--------AATGAA------CACAATGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATC-ACGCTCGTGGCGTCTACGCCCCGATGCGGAGCCTGGCTCTCCGAGCC--CCAGGGCA-CGGTGGGCCT-AAGA-GTACGGCCGTCGGAT--CGGGC-------CTGGAGCGGCGAGTGGTGGTC--TA-CTTCGCACGCC-GCCCCGCG-CCCAT-TGCCGGCAGAGGGCCTTGTAC-GACCCCC-GAACG-AGGAGACGGCTGT-ATAGCGTACC--GCTGTGCGGCCACTTCGGACCGATA-CCCCAGG-TCAGGC{AG}GGGCTACCCGCTGAGTTTAAGCATATCAATAAG Costularia_laxa TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAATA--AACCGCTGGGCATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCT-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTGGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CATA-AGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCATGCTCGGG--CTC----CCCTGATGTGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCAGCGCTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATAT------- Costularia_natalensis ---------------------------------------------------------------------------------------------------------------------------------GAATA--AACCGTTGGGCATGTG-ATT---GAACCCT-GCA--GGGGAGGTGCTGCCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCC-TG-TGTTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTAGTTGCA--------AAGGAA------CATA-AGAAGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGGACCTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATCCTTGCTCGGG--CTT----TCCTGATGCGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGGCTG-AAGT-TTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACAGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGTTGACGCAGTGCTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCA------------------------------------------- Diplacrum ----------------------------------------------------------------------------------------------------------ATTGTCG---TCGGCCC-GTGA-AAACACTGACCCGTGAACGTGTG-ACC---GAATGCTTGCC--GGCGCGGTCATGCCG-TGCCGGCCC--CCCAG-CACCGTGGG-CT--------------CAACATTGAGTCCG-CG-TGCTG-------AATACGGCATGGGATTG--TG-CCAAGGTACACTGGA--TGCGGAGGTCGGGGCGACGGCACGAGCA-GCG-TGCGGCTGC-CGGCCAATGCG--------TAGGAA------CACG-AGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGGCCAACCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--TGC----TCCCGACGCGGATCTTGGCCCTCCGCGCC--ACAGGGTG-CGGCAGGCTG-AAGT-GCGCCTCTGTCCGAC--GGTGC-------GGGGAGCGGCGAGTGGTGGGT--CT-CTTCGCACACC-GCCCCTTG--CCGC-CGTCGGT------ATATGTTT-GACCCCA-AGACG-AGGGGCTTGCTGCCGCGGCCACAG-TGCTGCGAGGCGACCCCGGACCGATA-CCCCAG------------------------------------------ Eriophorum_vaginatum --------------------------------------------------------------------------------------------------------------TCG---TTGCCTTTGGAA-AAACAC-GACCGGCGCACACGTG-ACA---GAATGCT-GCT--GGGGAGGTGCTGCCT-CCTTGGCCCC-ACCGC-CCACAGCCC-TCTTGCCCTAC-----GGGCGCGTTGGTCG-TGG-GTCGG------AATACGGCGCGGGATGACGCG-CCAAGGAACACGAGA-ATGCTGAGGC---ACCGGTCGGCCGCTCAAGGG-GGGCGCCGG-CTGCCAAAGGCAAATAATTGAAAAA------AAAA-ATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGC--TGC----CCCCGATGCGGACATTGGCCCTCCGAACC--GCGAGGCG-CGGTGGGTCT-AAGT-GTGCGGCCGTCGTAT--GTGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCACGCC-ACCCCGAG-CCCCA-TGCCGAC------CTTTGTTT-GACCCCC-TAACG-AGGAGCATGCCGCCGCGGCTTCAC--GCCGTGCGGCATCTTCGGACC----------------------------------------------------- Evandra_aristata CGGGCG-TTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGG-AGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA-CATTGTCG---TCCGCTT-GCGA-AAACAC-GACCGTTGCGCACGTG-ATC---GAATGCT-GCC--GGGGAGGCGCCGCCC-CCTCGGCCC--ACCGG-CCTCGGCCC-TCGCGCCCTCT----TGGGCGCGTTGGTCG-TG-TGCCG-------AA-ACGGCGCGGGTTGA--CG-CCAAGGAACACGAGA--CGCTGAGGC--GGCTGGCGGAGCGCTG-GTCG-CGCCGCACG-CCGCCGATGCA--------ACGGAA------CGCT-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCAT-GATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAA-CCCATCTACGCTCGGG--CGC----CCCCGATGCGGATCCTGGCCCCCCGAGCT--CCAGGGCG-CGGTGGGCCC-AAGT-GTGCGGCCGTCGGAT--GGGG-------CAGGGAGCGGCGAGTGGTGGGC--TG-CTGCGCACGCC--CCTCGTG-CCCCT-TACCGTC------CTTTGTCC-GACCCCC-GACCG-AGGAGACGAACGACGCAGCGTCCC--GCTGCGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTA-GCATATAAATAAG Ficinia_paradoxa --------------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---CTAACCTTG-----AACAC-GACCG-TGAACATGTA-ACA---TAATGCT-ACC--GGGGA-GTACCATCT-CCTCGGCCCT-GCCGG-CCC-----------------------CGGCCTATTGGTCG--GGTGTCGG------AATACGGCGCGGGATGT--CG-CCAAGGAACACTGAA-TTGCTGAGGC--GGACGACAATACGCTC--GTA-----------CTGCTGATGCC--------AACTT-------AACA-TTATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCAACACTCAGT--CGC----CCCTGATGTGGACAATGGACCTCCGAGTCAGTAATGGCA-CGGTGGGCTG-AAGT-TAATGGTCGTCGGAT--GGTAA-------CGGGATCGGCGAGTGGTGGGC-TAA-CTGCGCAAGCCAATCCCGGC-TGCCA-TGTCGAC------CCTCTTTT-GAACCCC-AAATG-AGGAGATTGTCGTCGCAGCATCTA--GTTGTGCGGCAATTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCCACCCGCTGAGTTTAAGCATATCA----- Gahnia_aspera -----------------------------------------------------------------------------------------------GCGGAAGGATCATTGTCG---TTTGCTT-GCGA--AACAC-GACCGTTGCACGCGTG-ATC---GAATGCT-GCC--GGGGG-GCGACGCCC-CCCCGGCTC--ACCGG-CCTCGGCCC-TCACGCCCTCC-----GGGCGCGTTCGTCG-TG-TGCCG-------AATACGGCGCGGGTTGA--CG-CCAAGGAACACGAGA-TTGCTGAGGC--GGCATGCCGGGCGCCGAGGCG-TGCGGCCTGCCCGCCGATGCA--------GAGGAA------CACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTACCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCGTCCACGCTCGGG--CGC----CCTCGATGCGGATCCTGGCCCTCCGAGCC--CGAGGGCG-CGGTGGGCCC-AAGC-GCGCGGCCGTCGGAT-GGGGGT-------CTGGAGCGGCGAGTGGTGGGC--TG-CTGCGCACGTC-GCTCCGCG-CCCCT-TGCCGGC------CTTTGTTTCGACCCCT-GGACG-AGGAGCCGGGTGACGCAGCGCCAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAG------------------------------------------ Gahnia_tristis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCGTCCACGCTCGGG--CGC----CCTCGATGCGGATCCTGGCCCTCCGAGCC--CGAGGGCG-CGGTGGGCCC-AAGC-GTGCGGCCGTCGGAT-GGGGGT-------CTGGAGCGGCGAGTGGTGGGC--TG-CTGCGCACGTC-GCCCCGCG-CCCCT-TGCCGGC------CTTTGTTTCGACCCCT-GGACG-AGGAGCCGGATGACGCAGCGCCAT--GCTGTGCGGCATCCTCGGACCGATA-CCCC-------------------------------------------- Hypolytrum_nemorum --------------------------------------------------------------------------------------------------------------TCG---TTGGCCGAGCAA-AA-GAC-GATCGTCGCACACGTC-ACC---GAATGCT-GCC--GGGGCGGTGCTGTCG-CCCCGGCC---ACCGG-CCCCTGCCT-CCGCGCCCT-------GGGCGCGTCGGCAG-CG-TGCCG-------AATACGGCGCGGACTGT--CG-CCAAGGAATACACGA--TGCGGCGGC--GGCCGGCGGCGTGCTGTGCCG-CGCGGCCTG-TCGCCGATGCG--------AAGGAA------CACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTTATGGGCGTTAGAAGCCCATCCATGCTCGTG--CGC----CCCCGATGCAGATCTTGGCCCTCCGAGCC--CGCGGGCG-CGGCGGGCCC-AAGC-GTGCGGCTGTCGGAC--GGGGC-------CGGGAGCGTCGAGTGGTGGAC--TG-CTGCGCACGCC-GCCCCGTG-ACCCC-GTTCGGC------CCTCGTTT-GATCCC--GAAGG-AGGAGACGGCCGCCGCGGCGTCTG--GCCGCGCGTCGTCCTCGGACC----------------------------------------------------- 'Lagenocarpus albo-niger' --------------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGGCTCAGGGA-AA-CGT-GACCGGTGCATATGTG-ATG---TAACATT-GCC--GGGGAGGTGCTCCTG-ACTCGGCCCACAACGG-CTCGGTCCC-TCATGCTTGTC-----GGGCGTGTCGGACG-CG-TGTCG-------AATACGGCGTCGGTTGG--CG-CCAAGGAACACGAGG--TGCGGAGGT--AGCTGGCGGAGCGTTGGTGCG-CGTCGTCAG-TTGCTGATGCG--------ACGCAA------AGTG-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAGCCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGGACTCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGTCCATGCACGCTCGGG--TGC----CACCGATGCGGACCCTGGACCTCCGAGCC--TTAGGGCG-CGGTGGGCCT-AAGT-GTTCGGCTGCCTCTA--GGA----------GGGAGCGGCGAGTGTTGGGC--TG-TTGCGCACGTC-GCCGATAA-CCCTT-GCCCTGA------TCTTGTTG-GACCCCT-GAACG-AGGAGCTCGACGTCACGGCGACCT--GTCGTGCGGCATCCTCGGACCGATA-CCCCAG------------------------------------------ Lepidosperma_filiforme CGGGCGGTTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TGTCG---TTGGCTA-GCGA-AAACAC-GACCGTTGTGCACGTG-ATC---GAATGCT-GCC--GGGGAGGCGCTGTCG-CCTCGGCCC--ACCGG--CCCGGCC--TCGCTCCCTC-----AGGGCGCGCTGGCCG-CG-TGCTG-------AACACGGCG-GGGTTGA--CG-CCAAGGAACACGATA--GGCTGAGGC--GGCTGGC-GAGCGCTGACGCG-CACGGCCTG-CCGCCGATGCA--------AAGGAA-----AAACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATG-AGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCA-GCTCGTG--TGC----TCCCGACGCGGATATTGGCCCTCCGTGCC--CAACGGAG-CGGTGGGCCT-AAGT-ACGTGGCCGTCGGGTTTTGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTGC-CGCGCC-GCCCCGTG-CCCCC-TGCCGGC------CGGCTGTC-GACCCCC-GAACG-AGGAGCCGAACGACGCGGCGTCTT--GCTGCGCGGCTTCTTCGGACCGATA-CCCCAGG-TCAGGCGG-GCTACCCGCCGAGTTTAAGCATAT-AATAAG Lepidosperma_laterale -GGCGGTCCGCCGCCCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TAGGCTT-GCGA-AAACAC-GACCGTTGTGCACGTG-ATC---GAACGTC-GCC--GGGGAGGCGATGCCT-TCTCGGCCC--AACGG-CC-CGGCC--ACGCTCCCTC-----GGGGCGCGCTGGCCG-TG-TGCCG-------AACACGGCGCGGGTTGA--CG-CCAAGGAACACGATA--AGCTGAGGC--GGCTGGCG-GGCGTTGAGGCG-CACCGCTTG-CCGCCGATGCA--------AAGGAA-----AAACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--TGC----TCTCGATGCGGATATTGGCCCTCCGTGCC--AAAAGGAG-CGGTGGGCCT-AAGT-ACGTGGCCGTCGGGT-TTGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTG{CT}GCGCGCC-GCCCCGTG-CCCCC-TGTCGGT----------TGCC-GACCCCC-GAACG-AGGAGCCGAACGACGCGGCGTCTT--GCTGTGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG Lepidosperma_longitudinale -------------CGCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGGCTT-GCGA-AAACAC-GACCGTTGTG-ACGTG-ATC---GAACGCT-GCC--GGGGAGGCTATGCCG-CCTCGGCCC--AACGG--CCCGGCC--TCGCTCCCTT-----GGGGCGCGCTGGCCG-TG-TGCCG-------AACACGGCGCGGGTTGA--CG-CCAAGGAACACGATA--AGCTGA-GC--GGCTGGC-GAGCGCTGAGACG-CACGGCCTG-CCGCCGATGCA--------AAGGAA-----AAACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAA-TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTC--TGC----CCCCGATGCGGATATTGGCCCTCCGTGCC--TAAAGGCG-CGGTGGGCCT-AAGT-ACGTGGCCGTCGGGT-TTGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCG-G-CCCCT-TGTCGGC----------TGCC-GACCCCC-GAACG-AGGAGCCGAACGACGCAGCGCCTT--GCTGTGCGGCTTCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG Lepidosperma_tortuosum CGGGCGGTTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTC----TTGGCTT-GCGA-AAACAC-GACCGTTGTGCACGTG-ATC---GAACGCT-GCC--GGGGAGGCGCTGCCG-CCTCGGCCC--ACCGG--CCCGGCC--TCGCTCCTTC-----AGGGCGCGCTGGCCG-CG-TGCCG-------AACACGGCGCGGG-TGA--CG-CCAAGGAACACGATA--GGCTGAGGC--GGCCGGC-GAGCGCTGAGGCG-CACGGCCTG-CCGCCGATGCA--------AAGGAA-----AAACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCG-CCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--TGC----TCTCGACGCGGATATTGGCCCTCCGTGCC--CAAAGGAG-CGGTGGGCCT-AAGT-ACGTGGCCTCGGGTT--TGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCGTG-CCCCC-TGCCGGC------CGGCCGCC-GACCCCC-GAACG-AGGAGCCGAACGA-GCAGCGTCTT--GCTGCGCGGCTTCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG Machaerina_rubiginosa ------------------------------------------------------------------------------------------------------GATCATTGTCG---CTGGCTT-GCAA-AAACAC-GACCGTTGTGCACGTG-ATC---GAAAGCT-GCC--GGGGAGGCTCTGCCG-CCTCGGCCC--ACCGG-CC-CGGCCA-TCGCGCCCTC-----GGGTCGCGTTGGTCG-TG-TGCCG-------AATACGGCGTGGGTTGA--CG-CCAAGGAACACGAGA--TGCTGAGGC--GGTTGGCGGAGCGCTGAGGCG-CACGGCCCG-CCGCCGATGCA--------AAGGAA-----AAACT-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--CGC----CCACGATGCGGATATTGGCCCTCCGTGTC--TATAGACG-CGGTGGGCCT-AAGT-ACGTGGCCGTCGGGC--TGGGCTCATCCGCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCGTG-CCCCC-TGTCGGC--------CT-TCC-GACCCCC-GAACG-AGGAGCCGACCGACGCAGCATCCT--GCCGCGCGGCATCTTCGGACCGATA-CCCCAG------------------------------------------ Morelotia_gahniiformis CGGGCG--TTGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA-CATTGTCG---TTGGCTC-GCGA-AAACAT-GACCGTTGCGCATGTG-ACC---AAACGCT-GCC--GGGGAGGCGCTGCCG-CCTCGGCCC--ATCGGACCCCGGCCC-CAGAGCCCGC-----CGGGCGCGCCGGTCG-GG-TGCCG-------AA-ACGGCGCGGGTTGG--CG-CCAAGGAACACGATA--TGCAGAGGC--GGCAGGCGGAGCGCTGAGGCG-CGAGGCCAG-CCGCCGATGCG--------AAGGAA---CAACACA-AGATGACTCTCGGCAACGGATATCTCGGCTCTC-CATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAG-AGCCCAACCACGCTCGG---TGC----CCCCGACGCGGATCTTGGCCCTCCGAGCC--TGCGGGCG-CGGTGGGCCC-AAGT-GTGCGGCCGCCGGAT--GGGG-------CCGGGTGCGG-GAGTGGTGGGT--TG-CTGCGCGCGCC-GTCCCGT--TCCCC-TCCCGGC------CCATGTCC-GACCCCC-GAACG-AGGAGCCGGCTGACGCAGCGTGCT--GCAGCACGGCATCTTCGGACCGATA-CCCCAGG-TC-GGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG Neesenbeckia_punctoria ---------------------------------------GAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---CTGGCTT-GCGA-AAACAC-GACCGTTGTGCACGTGAATC---GAATGCT-GCC--GGGG-GGCGCTGCCT-CCCCGGCCC--ACCGG--CCCGGCCC-TCGCGCCTTC-----GGGGCGTGTTGGTCG-TG-TGCCG-------AATACGGCGCGGGTTGA--CG-CCAAGGAACACGAGA--CGCCGAGGC--GGCCGGCGGAGCGCTTAGGCG-C-CGGCCCG-CCGCCGACGCA---------AGGAAAAAAAAAACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACC-TCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--CGC----CCCCGATG-GGATATTGGCCCTCCGTGCC--TAAAGGCG-CGGCGGGCCC-AAGT-ACGTGGCCGTCTGGT--AGGGCTCATCCCCGGGAGCGGCGAGTGGTGGTCATTT-CTGCGCGCGCC-GCCCCGTG-CCCCC-TGCCGGC--------TTCGCC-GACCCCC-GAACG-AGGAGCCGCTCGACGCAGCTTCGT--GTCGTGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG Oreobolus_distichus TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGGAT---AACCGTTGGACATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGTCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCC-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGCCGTTGCA--------AAGGAA------CATA-TGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCATGCTCGGG--CTC----CCCTGATGTGGATCTTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCAGCGTTAT--GCTGTGCGGCATCCTCGAACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATAT------- Oreobolus_kuekenthalii --------------------------------------------------------------------------------------------------------------TTG---TTGCCTT-GAAAAGAAT---AACCGTTGGACATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCCA-ACCGG-CACCGGCCT-TCGTGCCCAAT---CGGGGAGCGTTGGTCT-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CATA-TGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCATGCTCGGG--CTC----CCCTGATGTGGATCGTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTTTCT-GACCCCC-GAATG-AGGAGCCGGCTGATGCAGCGTTAT--GCTGTGCGGCATCCTCGGACC----------------------------------------------------- Oreobolus_obtusangulus TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAAT---AACCGTTGGGCATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCACGCCTTAT---CGGGGAGCGTTGGTCC-TG-TGCTGG------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTGGGCCGAGCGCT-AGGCG-TGCGGCCCG-CCGTCGCTGCA--------AAGGAA------CATA-AGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATCCATGCTCGGG--CTC----TCCTGATGCGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACCGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGTTGATGCAGCGCTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGAGGCTACCCGCCGAGTTTAAGCATAT------- Oreobolus_oligocephalus TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAAT---AACCGTCGGACATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGTCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCT-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CATA-TGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCATGCTCGGG--CTC----CCCTGATGTGGATCTTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCGGCGTTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATAT------- Oreobolus_pectinatus TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAAT---AACCGTTGGACATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCAT-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCC-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATTAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CATA-TGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCACGCTCGGG--CTC----CCCTGATGTGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCAGCGTTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATAT------- Ptilothrix_deusta -----------------------------------------------------AGAGGAAGGAGAAGTTGTAACAAGTTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGGCTT-GCGA-AAAGAC-GACTGTTGTGCGCGTG-ATC---GAATGCT-ATCCG{AC}A{AC}GGGGCGCCCATTGCCTTGCCCT--TCCAG-AGCCGACCCTTCGTGCCCCC-----CGAGAGCGCAGACCG-CG-TGTTG-------AACACGGCGCGGACTGG--CACCCAAGGAATACAAGA-ATGCAGAGGC--GGTCGGAC-----------CG-CACGGCCCA-CCGTTGGTGGA---------AGGAA------CACA-CGATGACTATCGGCAACGTATATCTCGGCTCTCGCATCGATGAATAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAATGCAAGTT-CGTCCGAGGGACCCGCCCAAAGGCACCCATGCT---TGGGCGTTAGAAGCCCATCCACGCTCGGC--ACC----CACTGATGCGGATCCTGGCCGTCTGAGCCTCTGATGGCA-TTGGAGGCCC-AAGT-GTGCGGTCG-CGGAT--AGGG-------CTGGGAGCGGCGAGTGGTTGAC--TG-CTGCGCGCGCC-TCTCCGTGGCCCCC-TGCCGGT------CTCCGCTCAGACCACT-GAACGAAGGTGCCGGCCAAC-------------------AGCATACTCGGACCGATA--CTTAGG-TCAGGCGAGGATACCCATCGAGTATAAGCATGTAAATAAG Rhynchospora_rugosa_subsp._brownii ----------------------------------------------------------------------------------------------------------------------------------------GACCGGTGCACACGTG-ACC---GAAAGAT-GCC--GGGGAGGCGCTGCCG-CCTCGGCCC--AACGG-CCA-TGCCC-TCTCGCCCTGC-----GGGCGTTTGGGTC--TGGTGCCG-------AACACGGCGCGGGTTGA--CG-CCAAGGAAAACTGGACTTGCTGAGGC--GGGAGGCGGACCGCATACGCG-TTTCGCCTG-CTGCCGATGCG--------AAGGAA------CGCA-AGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--TTT----TCCCGATGCGGATCCTGGCCCTCCGAGCC--GCGAGGCG-CGGTGGGCCC-AAGT-GTGGGGCCGTCGTAT--GGGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCGCGTC-ACCCCGAG-CCCCA-TGTCGGC------CCTTGGTT-GAACCCC-AAACG-AGGAGCCGGCTATCGCAGCGTCCC--GCTGTGCGGCATC------------------------------------------------------------- Schoenus_bifidus --------------------------------------------------------------------------AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTTGTTCGAAAA-AAACAC-GACC-CTGTGCACGTA-ACC---TAATGTT-GTC--GTGGAGGCATCGCCT-CCTCGGCCC--ACCGG-CCACGGTCC-T------------------CACTCGGCCCG-TG-CGTCGGG-----AATACGGCGCGGTCTG---CG-CCAAGGAACACGATA--TGCTGAGGC--GGCTGGCGGAGCGCTCCGGTG-CACCGCCCT-CCGTCGATGCA--------AACTAA------AACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCTGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCATGCTCGG---TGC----TCCCGATGCGGATCATGGCCCTCCGAGCC--TGAAGGCG-CGGTGGGCCC-AAGT-GTGAGGCCGCCGGGA--GGAG-------CCGGGAGCGGCGAGTGGTGGAA--TG-CTGCGTACGCC-GCCTCGCG-CCCCT-TCGTGGC------CTTTGACC-GACCCTC-GAACG-AGGAGC--GTTG---CCGATTACC--ACGGCACGGCTCATTCGGAACGATACCCCCAGG-TCAGGCGGGGCTACCCGCTGAGTTTAAG------------ Schoenus_curvifolius --------------------------------------------------------------------TGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TATGCTT-CCTA-AAACAT-GACCGTTGCGCATGTG-ACC---GAACGCT-GCC--GAATA--------------CGGCCC--ACCGG-CCCCGGCCC-A------------------CGTGCTGGCCG-GG-TGCCG-------AATACGGCGCGGGCTGG--CG-CCAAGGAACACGAGA--TGCTGAGGC--GGCCGGACGAGCGCCGAGGCG-CGCGTCCGG-CTGCCGACGCG--------AAGGAA---TAAAACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGC--CGC----CAACGACGCGGAGCTTGGCCCTCCGAGCC--GGATGGCG-CGGTGGGCCCTAAGT-GTGCGGCCGCCGGAT--GGGG-------CCGGGTGCGGCGAGTGGTGGGT--TG-CTGCGCGCGCC-GTCCCCTG-CCCCC-TCACGGC------CCTTGTCG-GACCCCC-AAACG-AGGAGCCGGCCGACGCAGCGTCCCAAGCTGTGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGCGCTACCCGCCGAATTTACGCATATCAATA-- Schoenus_efoliatus -------------------------------------------------------TGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTTGCCC-GGAA-AAACAC-GACCGTTGTGCACGTA-ACC---TAATGCT-GCC--GGGGAGGCGTCGCCGCCCCCGGCCC--ACCGG-CCGCGGTCC-T------------------CGATCGGGCCG-CG-TGCCGGG-----AATACGGCGCGGTCTG---CG-CCAAGGAACACGAGA--TGCTGAGGC--GGCCGGCGGAGCGCTCCGGCG-CACCGCCCG-CCGTCCATGCG--------AATGAA------AACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGG---CGC----TCCCGATGCGGATCGTGGCCCTCCGAGCCTCTCACGGCG-CGGTGGGCCT-AAGT-GTGCGGCCGCCGGGA--GGAG-------CCGGGAGCGGCGAGTGGTGGAA--TG-CTGCGTACGCC-GCCCCGCG-CCCCT-TGTCGGC------CTTTGCCC-GTCCCTC-GAACG-GGGAGCC--------GTGCCTACC--ACGGCGCGGCGCCTTCGGATCGATA-CCCC-------------------------------------------- Schoenus_grandiflorus -------------------------------------------------------------------TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGGCTT-GCAA-AAATGT-GACCGTTGCGCATGTG-ACT---GAATGCT-GCC--GAGGAGGCGCTGCCG-CCTTGGCCC--AACGGACCCCGGCCC-TCATGCCCTT-----CGGGAGTGAGAGTCG-GG-TGCCG-------AATACGGTGCTGCCTGG--CG-CCAAGGAACACGAGA--TGCTGAGGC--GGCAGGCGGAGCGCTGACGCG-CGAGGTCGG-CCGCCGATGCG--------AACGAA---AAACACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGG---TGC----CACCGTCGCGGATCTTGGCCCTCCGAGCC--TGCGGGCG-CGGTGGGCCC-AAGT-GTGCGGCCGCCGGAT--GGGG-------CCGGGTGCGGCGAGTGGTGGGT--TG-CTGCGCGCGTC-GTCCCGTG-CCCCC-T-CAGGA------CCTTGTCG-GACCCCC-GATCG-AGGAGCCGGCTGACGCAGTGAGCC--GCTGCGCGGCACCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATCAATAAG Schoenus_nigricans ---------------------------------------------------------------------------AGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCTG---CCGCCTA-GCGA-AAACAC-GACCGTTGCGCACGTG-ATC---GAGCTCC-GCC--GGGGAGGCGTCGCCC-CCCCGGACC--ACCGG--CCCGGCCC-TCGCGCCCCTTGT--CGAGCGCGCGGGCCG-TG-CGCCGGGAAAAAAATACGGCGCGGGCTGT--CG-CCAAGGAACACGATA--TGCTGAGGC--GGCCGGCGGAGCGCTTCGGCG-CGCCGCCTG-CCGTCGATGCA--------AAGGAT---ATTCACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--AGC----CCCCGATGCGGATCGTGGCCCTCCGAGCC--CTAGGGCG-CGGTGGGCCC-AAGT-GCGCGGCCGTCGGAA--GGAG-------CCGGGAGCGGCGAGTGGTGGAA--TG-CTGCGCGCGCC-GTCCCGGG-ACCCC-TGCCGGC------CTTTGACC-GACCCTC-GA-CG-AGGAGCCGCGT----CACCTTCGAAAGGAGTGCGGCATTCTCGGATCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCTGAGTTT--------------- Schoenus_nitens ------------------------------------------------------------------------------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTT-----GCGA-AAACAC-GACCGTTGTGCTCGTG-ATC---GAACGCT-GCG--GGGGCAGCTTTTGCCTGCCCGTCCC--A---------------------------------------------------------AAAAAATACGGCGCGGGTTG---CG-CCAAGGAACACGATA--TGCAGAGGC--GGCGGGCGGAGCGCTCTGGCG-TGACGTCCG-CCATTGATGCA--------AGAGAT---ATACACA-TTATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--AGCCTAGCCTCGATGTGGATCTTGGCCCTCCGAGCC--CCAGGGCG-CGGTGGGCCC-AAGT-GCGTGGCCGTCGGAA--GGAG-------CCGGGAGCGGCGAGTGGTGGAC--TG-CTGCGTTCGTC-GCCCTATG-CGCCT-TTCCGGCATATGGCTTTGCTC-GACCCTC-GA-CG-AGGAG-TTG-CGTCGCA-TTTTGT--TGCGCGCGGCAACTTCGGATCGATA-CCCCAGG-TCAGGCGAGGCTACCCGCTGAGTTTAAGCATAT------- Schoenus_rigens ----GGTTCGCCGCCCGTG-ACTTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTTGCTC-GGAA-AAACAC-GACC-CTGTGCACGTA-ACC---TAATGCT-GCC--GGGGCGGCTTAGCGG-CCCCGGCCC--ACCGG-ACGCGGTCC-TCACG--------------------GGCCG-CG-CGCCGGG-----AATACGGCGCGGTATG---CG-CCAAGGAACACGAGA--TGCTGAGGC--GGCCGGCGGAGCGCTCCGGCG-CACCGCCTG-TCGTCGATGCA--------AAGTAA------TACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCAAGGGCACGCCTGCC---TGGGCGTTAGAAGCCTATCCACGCTCG-G--TGC----TCCCGATGCGGATCATGGCCCTCCGAGTC--CTACGACG-CGGTGGGCCT-AAGT-GTGCGGCCGCTGGGA--GGAGC-------CGTGAGCGGCGAGTGGTGGAA--CG-CTGCGTACGCC-GCCTCGCG-CTCCT-TGTCGGC------CCTTGACA-GACCCTT-TAACG-AGGAGCCTT--------GCCTACC--AAGGCGTGGCACTTTCGGATCGATA-CCCCAGG-TCAGGCGGGGCTACCCGC---------------------- Scleria_distans ----------------------------------------------------------------------------------CGTAGGTGAACCTGCGGAAGGATCATTGTCGGTTTTGACTC-GTGA-AAACAC-GATCGGAGCACACGTG-ATA---GAACGCT-GGT--GCGGAGGCGCT-CCG-CTCCAGCAA--ACCGG-CCACAGTCG-CCGTGCCCTCC-----GGGTGCGTTGGCTG-CC-TGGCAG------AATACGGCGCGGGCTGA--CG-CCAAGTAACCAGCGA--TGTGGAGGC------------ATACTGTAGTG-CTCC-TTTG-TGGCTGATGCC--------AATGAT------TTTG-ACATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCTAGGGACCTGCCCGAGGGCACGCCTGCCTCATGGGCGTAATTAGCCCATCAACGCTCATG--TGC----CACCGTAGCGGATGATGGCCCTCCGAGCC-TTGAGGGCAACGGCGGGCCC-AAGT-GTTTGCCGGTCGCAA--GTGTC-------TGGGAGCGGTGAGTTGTGGGA--AC-CTACATGCTCC-GCCCCGTG--CATC-TGCTGGC------TCGAATTC-GACCCC--GGTTG-AGGAGCTCGTTGTCGGTGCGTCCG--GCCATGAGGAACCCTCGGACCGATA-CCCCAGG-TCAGGCGGGGTTACCCGCCGAGTTTAAGCATA-------- Tetraria_capillaris ----------------------------------------------------------------------------AGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGGCTT-GCGA-AAACAC-GACCGTTGTGCATGTG-ATC---GAATGCT-GCC--GGGGAGGCGCTGCCT-TCTCGGCCC--ACCGG-CC-CGGCCC-TCGCGCC-TTC----GGGGCGCGTTGGTCG-TG-TGCCG-------AATACGGCGCGGGTTGA--CG-CCAAGGAACACGGTA--TGCTGAGGC--GGCTGGCGGAGCGCGAAGGCG-CACTGCCCG-CTGTCGATGCA--------AAGGAA----AAACCA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCATG--CGC----CCCCGATGCGGATATTGGCCCTTCGTGCC--TGAAGGCG-CGGCGGGCCC-AAGT-ACGTGGCCGTCTGGT--TGGGCTCATACCCGGGAGCGGCGAGTGGTGGGAATTT-CTGCGCGCGCC-GCCCCGTG-TCCCC-AGTCGGC------CCTGCAAT-GAAACCCCAAACG-AGGAGCCGGCTGACGCAGCCTGGT--GCTGTGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG Trianoptiles_capensis ---------------------------------------------------------------------------------------------------------------CG---TTGTCTA-ACAA-AAACAT-GACCATTGCGCACGAA-GTCACAGAAAGCT-GCC--GGGGTGGCTTTGCCG-CTCCGGCCC--ACCGG-CACCGGCAC-TCTCCTCCTTC--GGGGGGTGTGTTGCCCG-TG-TGCCG-------AACACGGCGTGGGTTGA--CG-CCAAGGAACAATAGA--TGCTGAGGC--GGCCGGCGGAGCGCTTAGGTG-CCCCGCAGG-ACGCCGATGCG--------AATGAA------CACAACGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATC-ACGCTCGAG---GC----CCCCGATGCGGAGCCTGGCTCTCCGAGCC--CCCGGGCA-CGGTGGGCCT-AAGA-GTACGGCCGTTGGGT--TGGGC-------CGGGAGCGGCGAGTGGTGGTC--TA-CTTCGCACGCC-GCCCCGCG-CCCAT-TGCCGGC------CCTTGTAC-GATCCCA-GAACG-AGGAGACGGCTGT-GCAGCGTACC--GCTGTGTGGCCACTTCGGACCGA--------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18778] TITLE trnL; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1285; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrostylis_aphylla --CCCGGCTATCCCGACC--ATTTATCTTGAATCACC-----TGAATAGAA------TACTCCTATCTATT-----CCCTT-GTA---------------TCTACGTCAATT-------AAATAATTGAA------------------------------------CATTGAGCCTAAC-----AAAA-----------------AATTGATTCAA-AAA-----A-AAAGTCAATGT-----------------------------------TAATAATATTGATA-TTA-TTGGTAATAA-------TATCACCAATAGA----------------------------GATTTTT------------TGCATA---------TGCT-TAGATTCTTT---GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTAAATTATCATC---------------ATTTTTTC---------AATCTAAAAAACTCTAT-------------------GATTGATAAAATCAATTAAATTCAATTGATTATTCA------------AA-ATTGAA-------------------------TTCTTTTTTCATTGAACTGCAT---------------AT--TCGAATCAA-TTCACCAT-AAAGAATTCATTATTTTTTGATAGAATTTTT-TGAATTCATT--------AAAATTTAA----TGAATTTGCTATTCCATAATCAATAGCAATTTAATTCTAT----------TTTTTGATTTTTAATATATATGATTA-AACGTTGGATTAATCAGT----ATATATAA--ACGTACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTATCT-TA------TCTT--------GAG-AGATA-----AAT-TCA---------AG-CAATGCAAC----ACAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAATGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATGCA---- Becquerelia_cymosa ----------------------------------ATC-----TGAGTAGAA------TACTGGTATCTATG-----CCCTT-GTA---------------CCTATGTCAATT-------AACTA------------------------------------------AATTGAGCTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATGGA-GTAGTCATGG----------------------------------------GATATTGATATGGC-TTGGTAATGA-------TTTCGTT-ATAGA----------------------------GATTTCT------------TGCTTA---------TTATATAAACTCCTTGCTGAAGAA-ATAC-------------------TTA-CGAAGTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAGAAATCGACGGATTTTCCTCTTACTAG-AAATTTCATTGTTGTCAATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAGTCAT-----------------TTTGT-C-----AAAAGATCTAGCAAATTCTAT-------------------CATGAAT---------------GATTTGGTTACTAA------------AT-ATGGAG------------------------TT-CTTCTCTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCACCAT-AAAAAATTATGA-------------ATTTTT-GGAATTCAAA----AATCAATATTTT-----CGAATTTGCTATTTCCTAATTATTCACAATTGAAA----------------ATTTGATTGTGATT---AATCATTA-CACATTTGACTAATCAAT----ATATAT----ACGTATGTC-----------------------TT-----TGGTGTA-TA-------------------GGGTCATCC-TTTTTCT-TATTTTT-TTTTATTTAATAGAA-AAAAA-----AATATCT---------AC-CAATACAAC----ATAATAAACTATA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGT------------------------------------------------------------ Capeobolus_brevicaulis --CTGAGCTATCCCGACC------------AATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATATTAAAATTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAATGGA-ATAGTAGATGTTAGGATAATGATATGGATTGGTTATGATTACATTATAGAGATAATGATATGGA-TTGGTTATGA-------TTACATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGTATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTAATTAATCAGT----ATATAT----ACGTATGTT-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-ATTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Carex_magellanica ------GCTATCCCGACT--ATTTCTTGTGGATCACT-----CGAGTAGAA------TACTCGTACCTATG-----CCCTT-GT-----------------------CAATT-------AAAT-------------------------------------------AAAGGAGCTCAAATAAAATAAA-----------------AATTTATTCAA-AAAAATAGA-ATAATCAATGT-----------------------------------TTAAGATTATGATA-TGA-TTGGTAATGA-------TTTCATT-ATAGA-----------------------AGAATGATTCTT------------TGCATA---------TGCT-TAGGATCTTT---AAAGAG-ATTT-------------------TTT-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTTATCATC---------------ATTTTTTC---------AATCTAACAAACTCTAT-------------------AATGAAT-TCCATAAATAGAATAAATTGATTATTAA------------AA-ATTGAG-------------------------TTTTTTTCTCATTAAATTTCAT---------------AT--TTGAATCAA-TTCACCAT-AAACAATTCATA-------------ATTTAT-GGAATTCATC--------GAAATTCC-----TGAATTTGCTATTCCATAATTATTGTTAATTTAATAATAT----------GATTTGATT-----T---TATGATTA-ATAATTTGATTAATTATT----ATATAT----ACGTACGTC-------------------TTTGTT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TTT---------AG-TATTGCAAC----ATAATAAATTCTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCTTAGAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Carpha_alpina --CTGGGCTATCCCGACC--AGTTCTTGCGCATCCCC-----TGAGTATTT------TACTCAGGTCTATA-----TCCTT-GGG---------------CCTGGATCAATT-------TAAT-------------------------------------------AAAGGAACTCAAA--------C-----------------CATAATAAAAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGGAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCGTCC-TTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Carpha_capitellata_var._bracteosa ----------------------TTCTTGCGCATCACC-----TGAGTATTC------TACTCAGGTCTATA-----TCCTT-GTA---------------CCTGTATCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA--------T-----------------AATAATAATAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGTAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCATCC-TTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACT---------------------------------- Carpha_glomerata --CTGAGCTATCCCGACC--AGTTCTTGCGCATCACC-----TGAGTATTC------TACTCAGGTCTATA-----TCCTT-GTA---------------CCTGTATCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA--------T-----------------AATAATAAAA--AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGTAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCATCCTTTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCAGTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Caustis_dioica -----------------C--ATTTTTTGTGGATCACC-----TGAGTAGAA------TTCTCGTATCTATATAATGTACTT-GTA---------------CCTATGCCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTAA-ATAGTCAATGT-----------------------------------TAG-GATAACGATATGGA-TTGGTAATGA-------TTTCATT-ATAAA----------------------------GATTCTT------------TGCTT------------ATATGTATTATTTTGCGAAGAA-ATAC-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTTATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-TTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCAT-AAATAATTCAGG-------------ATTTTT-TGAATTTAGA--------AATATTTC-----TGAGTTTGCTATTTCATAATCATTCACAATCAAAGAATAT----------AATTTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------CGGCGACCC-TTTCCCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGTAAC----GTATTCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTACCCATTTTTAATTCCAGGGTTTCTCTGAATT------------------------------------------------- Chrysitrix_capensis ---TGAGCTCTCCCGCCT----TTCTTGTG-ATTACC-----TAAGAAAAA------T-CTTATATCTATG-----TCCTT-ATA---------------CTTATGTTAATT------------------------------------------------------AAAGGAACTCAAT-----TAAA-----------------AATTTATTCAA-AAATTTTGA-ATAGTCAATG------------------------------------TTAGGATAATGATATGGG-TTGATAATCA-------TTTCATT-ATTTA----------------------------GAT-------------------------------------------------TATTAA-ATAC-------------------TTA-GGAAGTAAAATAGGCTTGGGGATAGAGGG-ACTTGA-CCCTCA-TGATTTTTAACATC-CCGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATCAC------------------TTTTTA-----AAAAGATCTAGCAAACTTTGT-------------------AATGAAT---------------AATTTGATTACAAA------------AT-ATTGAG-------------------------TTCTTCTTTCATTGACCTTC-T---------------AT--TCGAATCAA-TTCATCAT-----AATTTAG--------------AATTAT-TTAATT-ATA-----AAAAATATTTA-----AGAATTTGCTATTTCATAATCATTCAAAATCTAACAATAT----------AATTTGATCATAA-T---GAAAATCA-ATCAGTTGATTAATCAGT----ATAATT----ACGTATGTC-----------------------TT-----CGGTATATTA-------------------GAGCTATTC-TCTCTCT-TA------TCGA--------GATAAGAAA-----AAT-TCCACT------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Cladium_mariscus --CTGAGCTATCCCGGCC--ATTTC-----GATCACC-----TGAGTAGAA------TACTTGTATCTATG-----------------------------------TCAATT------------------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTA-TTTGCGAAGAA-ATAC-------------------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTA----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCACCAT-AAATAATTCAGA-------------ATTATT-TGAATTCTGA--------AATATTTC-----CGAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AATTTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----CGGTATA-TA-------------------GGGCCATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-TAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCGTTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGCATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCGAGGCTCAC-------- Costularia_arundinacea --CTGAGGTATGCCCGCC--GGTTCTTGGGAATCACC-----AGAGTAGATACATGATACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TTTTTCGAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCGTTTGATTTTTGATTAATC--TT--------------TTTTTTTT----T-TAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCATTAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTCCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Costularia_laxa ----------------------------------------------------------ACTAGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCT------------------------------------------------------TCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATATT---ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Costularia_leucocarpa_Lar0140 ---------------------------------CACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTTAATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTTA-----------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA-----ATTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTT------------------------------------------------------------------------ Costularia_natalensis --CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAAGAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGAATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA-----ATTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Costularia_nervosa --CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Costularia_pantopoda ----------------------------------------------------------------------G-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATTA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTT------------------------------------------------- Costularia_pantopoda_var._baronii -----------------------------------CT-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACT---------------------------------- Costularia_sp_Lar0153 -----------------------------------------------AAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAT--------------------------------------------------- Costularia_sp_Lar0219 ----------------------------------ACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATCAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATT-------------------------------------------------- Costularia_sp_Lar0249 --------------------------------------------------------------------------------------------------------AGTCATTT-------AAATAATAAATTTAAAAAT---GAGAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTT------------------------------------------------- Cyathochaeta_avenacea --------------------------------------------------------ATATTCGTATTTATG-----TACGA-GTA---------------TCTATATCAATT-------AAAT-------------------------------------------AAAGGAATTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATAAA-ATAGTCAATGT-------------------------------------------ATGGTATGAA-TTGGGAATGA-------TTTCATT-AAAGA----------------------------AA----------------------------------ATATG-----------GAAGAA-GTAT-------------------TTA-GGAAATCAAACGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCATTTTACTAT-AAATTTCATTCTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATT--------------------------------------------------------------------------------------------------AT-ATTAAA------------------------TTACTTTTCTTATTGAATTTC---------------------------------------------------------------------------------------------------------------------------------------AAGAATATGGATAATATTAATTTGATCGTGA-T---TATCATTT-ATCATTTGATTAATTAGT----ATATAT----ACGTATGCT-----------------------CT-----TGGTATA-TA-------------------CGTCTATCT-TTTCTCT-TA------TTTC--------GAT-AGATA-----AAT-TCCA------------AATGCAAC----GTAATCAACTGTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTACCCATTTTTAATTCC----------------------------------------------------------------- Cyathochaeta_diandra --CTGAGCTATCCCGACC--ATTTCAGGCGGATC----------ACCTGAA-----ATATTCGTATTTATG-----TACGA-GTA---------------TCTATATCAATT-------AAAT-------------------------------------------AAAGGAATTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATAAA-ATAGTCAATGT-------------------------------------------ATGGTATGAA-TTGGTAATGA-------TTTCATT-AAAGA----------------------------AA----------------------------------ATATG-----------GAAGAA-ATAT-------------------TTA-GGAAATCAAACGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCATTTTACTATAAAATTTCATTCTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATT--------------------------------------------------------------------------------------------------AT-ATTAAA------------------------TTACTTATCTTATTGAATTTC---------------------------------------------------------------------------------------------------------------------------------------AAGAATATGGATAATATTAATTTGATCGTGA-T---TATCATTT-ATCATTTGATTAATCAGT----ATATAT----ACGTATGCT-----------------------CT-----TGGTATA-TA-------------------CGTCTATCT-TTTCTCT-TA------TTTC--------GAT-AGATA-----GAT-TCCA------------AATGCAAC----GTAATCAACTGTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTACCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Cyathocoma_hexandra --CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAAATTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTGAA-AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTACATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATAAGGATTCTT------------ATATGGATTTTTTTGCGAAAAA-ATAC-------------------TTATGGGATTCAAATGG---------------------------------------AGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-AGAATTCAGA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTT-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTT--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Cyperus_rigidifolius --CTGAGCTATCCCGGGC-----------------------------------------------------------------TA---------------TCCTCAATGTTT------------------------------------------------------------------------AAAA-----------------TATTTAT-----ATTAATTGG-TAA-------------------------------------------TATTAATATTAATAATAA-TTGGTAATTA-------TTTCAAT-ATAGA----------------------------GATTCTT------------TGCCTA---------TGCT-TAGATTCTTT---GAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCACTGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTGAAATGGGACTCTCTCTTTATTCTTC-------TTGGATTTATCATC---------------ATTTTTTC------TTCATAATAAAAAACTCTAT-------------------ATATAAT---TAATAATATATTCAATTTATTACTCA------------AA-ATTGAG-------------------------TTTTTTTTTCATTGAACTTCAT---------------AT--TCGAATCAA-TTCACCAT-AAAGGATTCATT-------------ATTTTT-TGAATTCATC--------AAAATTTA-----GGAATTTGCTATTCCATAATCAATAGCAATTTAA-AATAT----------TATTTGATTGTTA-T---TATGATTA-ATCATTTGATTAATCAGT----ATAT------ACGTACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTTT-TATTTCG-TCTC--------GAG-AGAGA-----AAT-TCT---------AG-CAATGCAAC----ATAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTATAGATTTGGCTCAGGATTGCCCTTTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGA-TCCATACCAAGGCTCA-TCCAA--- Epischoenus_cernuus ----------------CC--GTTTCTTGTGAATCACA-----AGAGTAGAATAATG-TACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATATA----------------------------GATTCTT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAAGAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC-ATC--------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTTATTACTCA------------AT-ATTGAG------------------------TT-ATTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCACCATTAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCTACCATAC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA 'Epischoenus gracilis (Verboom 636)' --CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTTAAA-----AAAG-----------------AATTTATTCAA-AA------------------------------------------------------TAG-GATAATGTTATGGA-TTGATAATGA-------TTTCATT-TTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTATAATGAATGAATGATTCTATAATGAAT---------------CATTTTATTACTTA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATTC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTATTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Epischoenus_villosus ----------------------------TGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----AAAG-----------------AATTTATTCAA-AA------------------------------------------------------TAG-GATAATGTTATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTTA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTATTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGA--------------------------------------------- Eriophorum_vaginatum --CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----CGAGTAGAA------TACTCGTACCTATG-----CCCTT-GTA---------------TCTACGTCAATT-------AAAT-------------------------------------------ACAGGAGCTCAAATAAAATAAA-----------------AATTTATTCAA-AAA-TTTGA-ATAATCAATGT-----------------------------------TTAAGATAATGATA-TGA-TTGGTAATGA-------TTTCATC-ATAGA-----------------------ATAATGATTCTA------------TGCATA---------TGCT-TAGAATCTTT---GAAGAA-ATAT-------------------TTC-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTTATCATC---------------ATTTTTTC---------AATCTAACAAATTCTAT-------------------AATGAAG-AAAATAAATAGAATAAATTGATTACTAA------------AA-ATTGAG-------------------------TTTTTTTCTCATTAAACTTTAT---------------AT--TTGAATCAA-TTTACCAT-AAATAATTCATA-------------ATTTAT-GGAATTCAAA--------AAAATTCC-----TGAATTTGCTATTCCATAATCATTGTCAATTTAAAAATAT----------GATTTGATTGTTA-T---TATGATCA-ATCATTTGATCATTGAGT----ATATAT----ACGTACGTC-------------------TTTTTT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AAAGA-----TAT-TTT---------AG-TAATGCAAC----ATAATCAACTTTA-----TTCGTTAGAAAAACTTCCATCGAGTCTCTGCACCTATCTTGAAAGATTTGGCTCAGGATTGCCCATTCTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Evandra_aristata --CTGAGCTATCCCGACC--ATTTTTTGTGGATCATC-----TGAGTAGAA------TACTCGTATCTAG-TAATGTACTT-GTA---------------CCTATGTCAATTGTCAATTAAAT-------------------------------------------AAAAGAATTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTGGTAATTA-------TTTCATT-ATAGA----------------------------AT-----------------------------------AATGTATTATTTTGCGAAGAA-ATAC-------------------TTA-GGAAATCCAATGGGTTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCG-TATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTT----CAAAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAAGAATGATTTGATTACTCAATATCAATTCTTTTCTCATTAAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTCAGG-------------ATTTTT-TGAATTCATA--------AATATTTC-----TGAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AATTTGATCGTGA-T---TATGATGA-ATCATTCGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------CAGCTACCC-TTTCCCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAA-----ATAATTAACTCTA-----TTTGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTCAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Ficinia_paradoxa ---CCGGCTATCTCCACCAAATTTCTTGTAAATCACC-----TGAGTAGAA------TACTTGTACCTATA-----CCCTT-GTA---------------TCTACGTCAATT-------AAAA-------------------------------------------AATTGAGCCCAAC-----AAAA-----------------AATTTATTCAA-AAAAATAAA-ATAGTAAATG------------------------------------TTAAAATATTGATATTAA-TTGGTAATTA-------TTTCAAT-ATAGA-------GATTCTTTATTGAAAGAAAGAGATTCTT------------TGCCTA---------TGCT-TAGATTCTTTTCAGAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTGGATTTATCATC---------------ATTTTTTC---------AATATAAAAAACTCTAT-------------------ATTGAAT-----ATAATATATTCAATTTATTACTCA------------AA-TTTGAA------------------------TTTTTTTTTTCATTGAACTTCAT---------------AT--TCGAATCAA-TTTACCAT-AAAGGATTCTTT-------------ATTTTT-TGAATTCATT--------AAAATTTA-----TGAATTCACTATTCCATAATCAATAGTAATTGAAAAATAT----------TATATGATTGTTA-T---TATGATTA-ATCATTTTATTAATCAGT----ATGT------ACATACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTAT-TA------TCTC--------GAG-AGAGA-----AAT-TCT---------AG-CAATGCAAC----ATAATAAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAATGATTTGGCTCAGGATTGCCCTTTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Gahnia_aspera --CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----AGACCAGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTGTGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCGT------------TGCTT------------ATATGTATTATTTC--GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCT--GGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTCTATCC-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATA------------------- Gahnia_baniensis --CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----AGACCAGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTGTGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTATTTC--GAAAAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTCTATCC-TTTCTCT-TA------TTTT--------G------GA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Gahnia_trifida ------------------------------------------------GAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTGTGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTAGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTATTTCTTGAATAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAA------------------------TT-CTTCTCTCATTGAATTTC-T---------------ATA-TTGAATCAA-TTCACCA-TAAAGAATTCAGA-------------AATTTT-GGAATTTCTAA-ATATTGGATATTTCCTTTCCGAATTTGCTATTTAATATTTTAATTAAAATCATTAATATGAAGAATATTAATTTGATCGTAA-T---TATCATTT-ATCATTTGATTAATCAGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTCTATCC-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Gahnia_tristis --CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----AGACCAGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTGTGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTGGTAATGA-------TTTCATT-ATCGA----------------------------GATTCGT------------TGCTT------------ATATGTATTATTTC--GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTCTATCC-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCT----------------------------------------------------------------------------------------------------- Hypolytrum_nemorum --CTGAGCTA-CCCGGCC--ATTTCTTGTGCATCACCCGAGTCGAGTAAAA------TACTTGTATCTATG-----TCCTT-ATA---------------CCTATGTCAATT------------------------------------------------------AAAGGAACTCAAA-----CAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCGATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTAT----TTGCGAAGAA-ATAC-------------------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTGCAAATCGACGGATTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lagenocarpus albo-niger' -------------CGGCC--ATTTCTTGTGGATCACA-----CAAATAGAA------TACTCATATCTATG-----TCCTT-GTA---------------CATATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAAGAAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATAGA-TTGGTATAAA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------AA--------------GAAGAA-ATAC-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTTTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAAATTTAGCAAATTCTAT-------------------ATTGAAT-----------------TTTGATTACTCAATATTCT-----AT-ATTGAG------------------------TTTTTTTTCTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCATCA-AAACAAATTCATA-------------ATTTTA-TGAATTCATA--------AATATTTT-----TGAATTTGTTATTTCATAATCATTAACAATTT-AAATAAT----------AATTTGATCGTGA-C---TATGAATAAATCATTTGATTAATCAGT----ATGTAT----ACGTATGTC-----------------------TT-----TGGTATA-TA------------------TGGGCCATCT-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCTACC--AC-CAATGCAAC----GTAATTAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAGTTTGAAAGTTAA-CACT---------------------------------- Lepidosperma_filiforme --CTGAGCTATCCCGGCC--ATTTCTCGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGCCAATT-------AAATAAAGAAACTCAAATAACAATTTATTCAAAAAAATTGAATAGTCAAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------TATTCTT------------TGCTT------------ATATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATCAAAT-GGCT----------------------------------------------------------------------------------------------------------------------------------ATTAATC------------------ATTTTTTC----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAA------------------------TT-CTTTTCTTATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAAAATTCAGA-------------AATTTT-TGAATTCATA--------AATATTTT-----CAAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AAATTGATCGTGA-T---TATGATTA-ATAATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TAGTTTAGTATATAGATAGGGTGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACTT-----AC-CAATACAAC----GTATTCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATA------------------- Lepidosperma_laterale --CTGAGCTATCCCGGCC--ATTTCTCGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGC{CT}AATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAAT-GA-ATAGTCAATGT-----------------------------------TAG-{GT}ATAATGATATG{GT}A-TTGGTAAT{AG}A-------TTTCATT-ATAG{AG}----------------------------GATT{CG}TT------------TGCTTA------------TATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATCAAATGGGCT-GGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAAT-------------------CATTTTTC----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAA-------------------------TTCTTTTCTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCAT-AAAAAATTAAGA-------------AATTTT-TGAATTCATA--------AAT-TTTT-----CAAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AAATTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA-GTTTGTATATAGATAGGGTGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATACAAC----GTATTCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATA------------------- Lepidosperma_longitudinale ----------------------------------------------------------ACTCGTATCTAGA-----TACGA-GTA---------------GCTATGCCAATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-AATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCTT------------TGCTT------------ATATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAA------------------------TT-CTTTTCTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAAAATTCATA-------------AATTTT-TGAATTTATA--------AATATTTT-----CAAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AAATTGATCGTGA-T---TATCATTA-ATCATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TAGTTTAGTATATAGATAGAGTGGTTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTATTCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCT-------------------------------------------------------- Lepidosperma_tortuosum ----------------------------------ACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGCCAATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCTT------------TGCTT------------ATATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATAAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTCATTACTAA------------AT-ATTGAA------------------------TT-CTTTTCTTATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAAAATTCAGA-------------AATTTT-TGAATTCATA--------AATATTTT-----AAAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AAATTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TAGTTTAGTATATAGATAGGGTGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATACAAC----GTATTCACTTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGG------------------------------------------------------------- Machaerina_iridifolia ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTAATTAATC------------------ATTTTTTC----A-AAAGATTTAGCAAACTCTAT-------------------AATGAAT---------------TATTATATTACTAA------------AT-ATTGAA------------------------TT-CTTTTTTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTCAATT--------CATAAATTTG-TGAATTCATA--------AATATTGG-----AAAATTTGCTATTTCATAATCATTTAAAATTTAATAATAT----------AAATTGATCGTGA-T---TATGATTCAATCATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA------------CGTAGGGCGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTATTCAACTCTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Machaerina_juncea ----------------------------------ACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATACTAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATTTATTAAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------AATTATT------------TGCTT------------ATATGTGTTATTTTTTAAAAAA-ATAG-------------------TTA-GGAAATCAAAGGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTAATTAATC------------------ATTTTTTC----A-AAAGATTTAGCAAACTCTAT-------------------AATGAAT---------------TATTAAATTACTAA------------AT-ATTGAA------------------------TT-CTTTTTTCATTGAACCTC-T---------------GT--CTGAATCAA-TTCACCATAAAAGAATTCATA-------------AATTTG-TGAATTCATC--------AATATTTT-----CAAATTTGCTATTTCATAATCATTTGAAATTTCATAATAG----------AAATTGATCATGA-T---TTTGAATC-AATATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA------------CGTAGGGCGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AT-CAATGCAAC----GTATTCAACTCTA-----TTCGTTAGAAAAGCTTCCATTGAGTCTCTGCACCTATCCT----------------------------------------------------------------------------------------------------- Machaerina_mariscoides --CTGAGCTATCCCGGCC--ATTTATTGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATACTAATT-------AAAT-------------------------------------------AAAGGAACTAAAA-----GAAA-----------------AATTTATTCAA-AAAAATTGA-ATA-------------------------------------------TAG-GATAATGATATGGA-TTGGTCATGA-------TTTCATC-ATAGA----------------------------AATTCTT------------TGTTT------------ATATGTATTATTTTGTGAAGAA-ATAG-------------------TTA-GGAAATAAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTAATTAATC------------------ATTTTTTC----A-AAAGATTTAGCAAACTCTAT-------------------AATGGGT---------------AATTTTTTTACTAA------------AT-ATTGAA------------------------TT-CTTTTTTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAGAATTCATA-------------AATTTG-TGAATTCATC--------AATATTTG-----CAAATTTGCTATTTCATAATCATTTTAAATTTAATAATAT----------AAATTTATCGTGA-T---TATGATTCAAAAATTTGATTAATCGTT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA------------CGTAGGGCGGCTATTC-TTTCTCT-TA------TCTC--------G------GA-----AAT-TCCACCT-----AC-CAATGCAAC----GTATTCAACTCTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Machaerina_rubiginosa --CTGAGCTATCCCGGCC--ATTTAT-GTGGATTACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATACTAATT-------AAAT-------------------------------------------AAAGTAACTAAAA-----TAAA-----------------AATTTATTCAA-AAAATTTGA-ATAGTCAATGT-----------------------------------TAA-GAAAATGATATGGA-TTGGTA-TGA-------TTTCATC-ATAGA----------------------------AATTCTT------------TGCTTA------------TATGTGGTATTTTCTGAAGAA-ATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAA-TCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTAATTAATATTCTCGTTTAATTAATCATTTTTTTT----CAAAAAATTTAGCAA-CTCTAT-------------------AATGAAT---------------TATTTTTTTACTAA------------AT-ATTGAA-------------------------TTCTTTTTTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCAT-AAAGAATTCATA-------------AATTTG-TGAATTCATC--------AATATTTT-----CAAATTTGCTATTT-ATAATCATTTGAAATTTAATAATAT----------AAATTGATCGTGA-T---TATGATTCAATCATTTGATTAATCAGT----GTATAT----ACGTAT-TC-----------------------TT-----TAGT-----------------------GGCGACTATTC-TTTCTCT-TA------TCT---------AAT-AGAGA-----AAT-TCTACCT-----AC-CGATGCAAC----GTATTAAACTTTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Mapania_cuspidata --CTGAGCTATCCCGGCC--ATTTCTTGTGCATCACC-----CGAGTAAAA------TACTCGTATCTATG------TCTT-ATA---------------GATACGTCAATT------------------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAGTTGA----------GT-----------------------------------TAG-------GATATGGG-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTAT----TTGCGAAGAA-ATAC-------------------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTTAAAATCAACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ACTTTTTA----A-AAAGATGTAGCAAACTTTGT-------------------AATGAAT---------------AATTTGATTACAAA------------AT-ATTGAG------------------------TT-CTTCTTTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCACCA-----TAATTTAGA-------------ATTATT-TCAATTCATA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCATAATCTAAGAATAT----------AATTTCTTCGTGA-T---TATGATCA-ATCGGTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TTCAATATAATATA-CA-------------------GGGTTATTC-TTTCTCC-TA------TTTT--------GAT-AGAGA-----AAT-TCCACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCTATACCAAGGCTC---------- Mesomelaena_pseudostygia -------------CGACC--ATTTCTTGTGAATC----------ACCTGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ACTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------CAG-GATAATGACATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------TATTCCT------------TGCTT------------ATATTTATTATTTTGCGAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTTAAAAATCGGCGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATT------------------ATTTTTTG----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTTTATATTTAATTTAAT-ATTAAA------------------------TT-CTTATCTCATTAAACTTC-T---------------ATAATTGAATCAA-TTCACCA-TAAAGAATTCAAA-------------AATTTT-TGAATTCATAA-------ATATTTCC-TTTCCGAATTTTTTATTTGATATTTAATAAAAATTCAATAATATTATTATTTTGAATTTGATCGTGA-T---TATCATTT--TCATTTAATTAATCAGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTATGTCT-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGTAAC----GTAATCAACCCTG-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Mesomelaena_tetragona ------------------------CTTGTGAATC----------ACCTGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TCAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------CCG-GATAATGAGATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------TATTCCT------------TGCTT------------ATATTTATTATTTTGCGAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTG----A-AAAGATCTAGAAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTTAATATTTAATTTAAT-ATGAAA------------------------TT-CTTATCTCATTAAAGTTC-T---------------ATAATTGAATCAATTTCACCA-TAAAGAATTCCAA-------------AATTTT-GGAATTCATAA-------ATATTTCC-TTTCCGAATTTGTTATTTGATATTTTATAATCATTCAATAATATTATTATTTTGACTTTGATCGTGA-T---TATCATTT--TCATTTAATTAATCAGT----ATATAT----CCGTATGCC-----------------------TT-----TGGTATA-TA-------------------GGTATGTCT-TTTCTCT-TA------TTTT--------GAT-AGATA-----AAT-TCCACCT-----AC-CAATGTAAT----GTAATCAAACCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCT----------------------------------------------------------------------------------------------------- Morelotia_gahniiformis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATCTTTT--------------TTTTTTTT----TCAAAAATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG-------------------------TTCTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCACCAT-AAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATT-GCTATCTCATAATCATTCCCATTTTAAAAAGAA----------AATTTGATCGTGA-T---TATAATTC-ATCATTTGATTAATCAGT----ATATAT----ACGTATATA-----------------------TT-----TGATATA-TA-------------------TGGTTATCC-TTCCTCT--A------TTTC--------GAT-AGAGG-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTACCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAGGGCTCAATCCAATCA Neesenbeckia_punctoria -------------------------TTGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGCTAATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-TATAATGATATGTA-TTGGTAATAA-------TTTCATT-ATAGG----------------------------GATTGTT------------TGCTT------------ATATGTGTTATTTTGCGAAGAATATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTATCGATATTGACATGTAGAGT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATT------------------ATTTTTTT----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAA------------------------TT-CCTTTTTCATTGAACCTT-T---------------AT--TTGAATCAA-TTCACCA-TAAAGAATTCAGA-------------AATTTG-TGAATTCATA--------AATATTTT-----CAAATTTGCTATTTCATAATCATTCAC--------AACAT----------AAATTGATCGTGA-T---TATGATTT-ATCATTTGATTAATAAGT----GTATAT----ACGTATGTC-----------------------TT-----TAATATA-TA---------------------------------------------------------GAT-GGACA-----AAT-TCCACCT-----AC-CAATGCAAC----GTATTCAACTTTATTCGTTTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGG------------- Oreobolus_distichus --CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TATTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATTAAAAAAAAAAA-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAAAAAAAATGGACATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCAATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTTATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTTA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTT-CTTCCAAATTTGCTATTTCATAAAAATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGTTATCC-TTTATCT-TA------TTTC--------GAT-AAAAA-----TAT-TGCACTT-----AC-CTATGGAAC----GTAATCCATTATA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Oreobolus_kuekenthalii --CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TATTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATTAAAAAAAAAAA-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAAAAAAAATGGACATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCAATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTTATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTTA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTT-CTTCCAAATTTGCTATTTCATAAAAATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGTTATCC-TTTATCT-TA------TTTC--------GAT-AAAAA-----TAT-TGCACTT-----AC-CTATGGAAC----GTAATCCATTATA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Oreobolus_obtusangulus -----------------------------------------------------------------------------ACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATT---TAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AAATTAGTCAAAAAAAATGGA-ATAGTAGATGT-----------------------------------TAG----------------------------------------------GATAATGATTCCTCATTATAGATATAATGATTCCTTACATATATGGATTCTTATATGGATTCTTATATGGATTTTTTTGCGAAGAA-AT-C-------------------TTATGGGATTCAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oreobolus_oligocephalus ----------------------------------------------------------ACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTAAT---TAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAAAGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TAAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAAAAATTCACAATTT-ATGATAT----------AACATCATTGTGA-T---TATCATGA-ATTATTTGATTAATAAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATTC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Oreobolus_pectinatus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTAACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATAAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACGT-----TC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Pseudoschoenus_inanis ---------------------------GTGAATCACA-----AGAGTAGAA------TACTCGTACCTATG-----CCCTT-GTA---------------TCTAGGTCAATT-------AAAT-------------------------------------------AATTGACCCCAAC-----AAAA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATG------------------------------------TTAAGATATTGATATTAA-TTGGTAATTA-------TTTCAAT-ATAGA----------------------------TATTCTT------------TGCATA---------TTTT-TAAAATCTTT---GAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTC-------TTTGATTTCTCATC---------------ATTTTTTC---------AATATAACAAACTCTAT-------------------AATGAAT-ATAATAAATATATTCAATTAATTACTCA------------AA-ATTGAG--------------------------TTTTTTTTCATTGAACTTCAT---------------ATT-TCGAATCAA-TTCACCAT-AAAGGATTCATTACTTTTTGACATAATTTTT-TGAATTCATC--------AAAATTTA-----TGAATTTGCTATTCCATAATGAATAGCAATTTACAAAAAT----------TATTTGATTGTTA-T---TATGATCA-ATCATTTGATTAATCAGTATGTATGTATATACACATACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTCT-TA------TCTC--------GAG-AGAAA-----AAT-TCT---------AG-CAACGCAAC----ATAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAATGATTTGGCTCAGGATTGCCCTTTTTTAATTCCAGGGTTTCTCTGAA--------------------------------------------------- Ptilothrix_deusta --CTGAGCTATCCCGACC--ATTTATTGTGAATC----------ACCTGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------CAG-GATAATGAGATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------TATTCCT------------TGCTT------------ATTTTTATTATTTTGCGAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTT----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTTAATATTCAATTTAAT-ATTAAA------------------------TT-CTTATCTCATTAAACTTC-T---------------ATAATTGAATCAA-TTCACCA-TAAAGAATTCAAA-------------AATTTT-TGAATTCATAA-------ATATTTCC-TTTCCGAATTTGTTATTTGATATTTTATAATCATTCAATATTATTATTATTTTGAATTTGATCGTGA-T---TATCATTT--TCATTTAATTAATCAGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGCATGTCT-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGTAAC----GTAATCAACCCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAATCACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Rhynchospora_rugosa_subsp._brownii --CTGAGCTATCCCGACC--ATTTTTTGTGGATCACC-----CGAGTAGAA------TACTCGTATCTATG-----CCCTT-GTA---------------CCTACGTCAATT-------AACT-------------------------------------------AATTGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATGGA-ATAGTCAATG------------------------------------TTAAGATAATGATA-TGA-TTGGTAATTA-------TTTCGTT-ATAGA----------------------------GATTCCT------------TGCTTA---------TATT-TTATATATTG---GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTTATCATC---------------AATTTTTCAAATGAAAAAATATAAAAAACTCTAT-------------------AATGAAT---------------AATTTGATTACTAA------------AA-ATGAAG-------------------------TTCTTTTCTTATTGAACTTC-T---------------AT--TCGAATCAA-TTCTCCAT-AAATAATTCAG--------------AATTTT-TCAATTCATA--------AAAATTTC-----AGAATTTGCTATTTCATAATCATTCACAATTTAAAAATGT----------TATTTGATCATGA-T---TATGATCA-ATCA--AAATGAATCAGTA---ATAT------ATATATGTC-----------------------TT-----TGGTATA-TA-------------------CGGCTATCC-TTTCTCT-TA------TTTC--------GATAAGAAA-----CAT-CCT---------AC-CAATGCAAC----A-AATCAATTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGAATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACTAAGGCTCAATCTAATCA Schoenus_bifidus -------------CGGCC--ATTTCTTGTGGATCGCC-----TGAGTAGAA------TATAAGTATCTGAA-----TCCTT-GTACCTACATCACTTGTACCTATATCAATT-------AAAT-------------------------------------------AAAGGAACTAAAA------CTCAATTTATTTCAAAAAAGAATTTATTCCA-AAAAATAGA-ATAGTCAATGT-----------------------------------TAG-TATAATGATATGGATTTAGTAGTGA-------TTTCGTT-CTAGA----------------------------GATTTTT------------TGCTTA-------GCTTATATGTATTTTTTTGGGAAGAA-AAAC-------------------GTA-GAAAATAAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGGTATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC------------------ATTTTTTC----A-AAAGAT---------------------------------------------------------TTTGATTATTCC------------AT-ATTGAA------------------------TT-CTTTTTTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATGAAAGAATTCCGA-------------ATTTAA-AAAATTCATA--------AATATTTC-----CGAGTTTGCTATTTCATAATCATTCCAAATTTAATAATAT----------AAATTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GAGCTATCC-TTTACCT-TA------TTTT--------GAT-AGAGATAAGAAAT-TCTATTC-----AC-CAATACAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATTAATTCCAGGGTTTCTCTGAAT-------------------------------------------------- Schoenus_caespititius --------------------ATTTCTTGTGGATTACC-----TGAGTAGAA------TACAAGTATCTAGA-----TCTTT-GTA---------------CCTACCTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAACGATTTATTCCAAAAAACAATTTATTCAA-AAAAATAGA-ATAGTCAATGT-----------------------------------TAG-AATAATGATATGGA-TTAGTAGTGA-------TTTCATT-CTAGA----------------------------GATTTCT------------TGCCTA-------GCTGATATGTATTCAGCTACGAAGAA-AAAC-------------------GTA-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGGCATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC------------------ATTTTTTC----A-AAATAT---------------------------------------------------------TGGGATTATTCA------------AT-ATTGAA------------------------TT-CTTTTCTTATTGAACTTC-T---------------AT--CTGAATCAA-CTCACCATTAAAGAATTCAGA-------------ATTGTTTTCAATTCATA--------AATATTTC-----CGAGTTTGCTATTTCAAAATCATTCCAAATTTAATAATAT----------AATTTGATCGTGA-T---TATGATTA-ATC------------AGT----GTATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------AAAATATCC-TTTCTATTTTCTATTATTTC--------GAT-AGAGA-AAGAAAT-TCTATTT-----AC-CAATGTAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATTAATTCCAGGG------------------------------------------------------------- Schoenus_curvifolius -----------------C--ATTTCTTGTGGATCACC-----TAAGTAAAATAATG-TACTTGTATCT-----------------------------------ATTTCAAT-------------------------------------------------------AAAGGAACTCGAA-----TATC-----------------AATTTATTCCA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATT-ATAGAGATAAT----------------------GATTCCT------------TGCTTA-----------CTATGTATTTTTTTGCAAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATAAAAAGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGGAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAAA-------------------TTTTTTTC----A-AAAAATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATGGAACTTC-T---------------AT--TTGAATCGA-TTCACCA-TAAAAAATTCAGA-------------ATTTTT-GAAATTCATAAAATA---AATACTTC-----CGAATTTGCTATCTCACAATCA---------TAATAATAA----------AATTGGATCGTGA-T---TATGATTC-ATAATTTAATCAATCAGT----ATATAG----ACGTATGTA-----------------------TG-----TGATATA-CA-------------------TGGCTATCC-TTTCTCT-TA------TTCC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATAAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCCTTTTTAATTCCAGGGTTTCTCTGAA-TTGGAAGTTAA-CACT---------------------------------- Schoenus_efoliatus -------------------------TTGTGGATTACC-----TGAGTAGAA-------ACAAGGATCTAGA-----TCCTT-GTA---------------CCTACGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAACGATTTATTCCAAAAAACAATTTATTCCA-AAAAATAGA-ATAGTCAATGT-----------------------------------TAG-AATAATGATATGGA-TTAGTAGTGA-------TTTAATT-CTAGA----------------------------GATTTCT------------TGCTTA-------GCTGATATGTATTTTTTTACGAAGAA-AAAC-------------------GTA-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGGTATGGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC------------------ATTTTTTC----A-AAATAT---------------------------------------------------------TTGGATTATTCA------------AT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--CTGAATCAA-TTCACCATTAAAGAATTCAGA-------------ATTGTTTTCAATTCTGA--------AATATTTC-----AGAGTTTGCTATTTCATAATCATTCCAAATTTAAAAATAT----------AATTTGATCGTGA-T---TATGATTA-ATC------------AGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------AAGGTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-AATAAAT-TCTATTT-----AC-CAATGTAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTACTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAG------------------------------- Schoenus_grandiflorus ---TGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TAAT---------G-----TACTT-GTA---------------TTTATTTTAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAACTGA-ATAG-CAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATTTTTTTGCGAAGAA-ATAC-------------------TTA-GGCAA---------------AGAAGAAGT-ACTAGA---------------------CGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTATC-------------------TTTTTTTT----CAATAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTTAG-------------------------TTCTTTTCTCATTGAACTTC-TTTTCATTGAACTTCTAT--TTGAATCGA-TTCACCAC-AAAGAATTCAGA--------------TTTTT-TTAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCATTTTAAAAATAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATA-----ACGTATATA-----------------------TG-----TAATATA-TA---------------TGGCTGGCTATCT-TTTCTCT-TA------TTTC--------AAT-AGAGA-----AAT-TCCACCT-----AA-CAATGCAAC----GTATTCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTT-CCATACCAAG-------------- Schoenus_nigricans ---------------------TTTCTTGTGGATCACC-----TGAGTAGAA------TACTCGTATCTATA-----CGCTT-GTACCTAT----------CCTATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCCA-AAAGAATGG-AA--------------------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TACTT------------ATATGTATTCTTTTGC--AGAA-AAAA-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTGAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAGATTAAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------TT-ATTGAA------------------------TT-TTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTTACCA-AAAAAAATTTCGA-------------ATTTTT--CAATTCATA--------AATATTTC-----CGAATTTGCTATTTCATAATCATTCAAAATTTAATAATAT----------ATTTTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------CGGTTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGAAAAGAAAT-TATATTT-----AC-CAATGCAAC----GTAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Schoenus_nitens CACTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGT-------------------------------------------------------AAAT-------------------------------------------AAACGAACTCAAA-----TAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGTTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TT--GGAAATCCAAAGGGGTTGGGGAT-GAGGGGACT-GGACCCTCC-TGGATAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAGAATTTAGA-------------ATTTTT--CAATTC------------------------AGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAA----------AAATTGATCATAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATATAT--ACATATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AACCAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTT-CC---------------------- Schoenus_pennisetis --CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------GTTATGTCAATT-------AACT-------------------------------------------AAAGGAATTCAAA--AAATAAG-----------------AATTTATTCCA-AA------------------------------------------------------TA-----AATGGTATG----------TGA-------TTTCATA-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGGATTATTTTGCAAAAAA-AAAT-------------------GGA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTCAAAAAATCGACGGATTTTCTTCTTACTAA-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------CTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTATTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT-GTTGAATTAA-TTCAACA-TAAAGAATTTCGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CAAATTTGCTATTTCATAATTATTCAAAAATTAATAATAT----------AATTTGATCATAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATATCTTGGTTAGTATATATCATATGTCTT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAATATAAGTAATCAACTGTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGT------------------------------------------ Schoenus_rigens --CTGAGCTATCCCGGCC--ATTTCTTGTGGATTACC-----TGAGTAGAA------TACAAATATCTAGA-----TCCTT-GTA---------------CCTACGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAACGATTTATTCAAAAAAT-AATTTATTCAA-AAAAATAGA-ATAGTCAATGT-----------------------------------TAG-AATAATGATATGGA-TTAGTAGTGA-------TTTAATT-CTAGA----------------------------GATTTCT------------TGCTTA-------GCTGATATGTATTCTTTTACGAAGAA-AAAC-------------------GTA-GAAAATCAAATGGCTTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTTTTGTCGGTATTGACATGTAGAAT-GGACTCTCTCTTTATTCTC--------CTTGATTAAT-------------------CATTTTTT----CAAAATAT---------------------------------------------------------TTTGATTATTCA------------AT-ATTGAA-------------------------TTCTTTTTTCATTGAACTTC-T---------------AT--CTGAATCAA-TTCACCAT-AAAGAATTCAGATAAAGAATTCAGAATTCTTTTCAATTCAG---------AATATTTC-----CGAGTTTGCTATTTCATAATCATTCCAAATTTAACAATAT----------AATTTGATCGTGA-T---TGTGATT-------------AATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------AAGGTATCC-TTTCT-T-TA------TTTC--------GAT-AGAGA-AAGAAAT-TCTATTT-----AC-CAATGTAAC----GTAATCAACTCTA-----TTCGTTAGAATAACTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Scleria_distans --CTGAGCTATTCCGGCT--ATTTTTTGTGGATTATC-----TGAGTAGAA------TA------------------TCTT-GTA---------------TCTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATA----------------------------TAATAGA----------------------------GATTCCT------------TCCTTA---------TTATATATATTCCTTGC-TTATAA-ATATTTAGGAAG-----------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTGAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCTATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAGTCAT---------------------------------TTTATAGCAAACTTTAT-------------------CATGAAT---------------GATTTGATTATTAA------------ATCATCAAT------------------------TCTTCTCTCTTATAGAACTTT-T---------------AT--TCGAATCAA-TTCATCATATAAGAATTCAAA---------------------TAATTCTTA--------ATTATTTT-----CAGATTTGCTATTTTCTAATCATTCACAATTGATAAAGAA----------AATTTCATTGTGATT---AATGATTA-AACATTTGAATAATCAAT----ATATATACATACGTATGTC-----------------------TT-----CGGTATA-TA-------------------GGATGACCC-TTTCTCTCTA------TATT--------TAATAGAGA-----AAT-TCTACT------TGCCAATGCAAC----GTAATAAATTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCCCTGAATTTGGAAGTTAA-CACTTAG-AAGTT------------------------- Tetraria_bolusii --CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Tetraria_capillaris --CTGAGCTATCCCGGCC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGCCAATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC------------------ATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCTT------------TGCTTA------------TATGTGTTATTTTGTGAAGAA-ATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATA-AGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTA-----------------------------------AATATTCTAGCAA-GTCTAT-------------------AATGAAT---------------GATTTTATTACTAA------------AT-ATTGAG--------------------------TCCTTTCTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCAT-AAAAAATTCAGA-------------AATTTG-TGAATTCATA--------AATATTTT-----CAAATTTGCTATTTCATA-TCATTCACAATTT-----CAT----------AAATTGATCGTGA-T---TATGATTA-ATAATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA--------------TAGGGCGGCTATTC-GTTCTCT-TA------TCTT--------GAT-AG-GA-----AAT-TCCACCT-----AC-CTATGCAAC----GTATTCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_compacta --CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTACAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Tetraria_compar --CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTT--------GAT-AGAGAAAAGAAAC-TCTACTT-----AC-CAATGCAAC----GTAATTAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Tetraria_crassa --CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAT----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Tetraria_cuspidata ----------------CC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTTATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAAA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATTCAATCA Tetraria_exilis ---------------------------GTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACGATTAAAGAAT--------------------TTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-C---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATTCAATCA Tetraria_flexuosa --------------------------------------------------ATAATG-TACTTGTATCTATT-----------------------------TCAATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATGGA-ATAGTAAATGT-----------------------------------TAG-GATAATGATATGAG-TTAGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAATAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-CTTTTCTCATTTAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATTC-TTTCCCT-TA------TTTC--------G------GA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTAAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_involucrata ---------------------------------------------------TAATG-TACTTGTATTT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAAGAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------TTTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCAGA-------------ATTTTT-GGAATTCATA--------AATACTTC-----CTAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAACTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_microstachys ----------------CC--GTTTCTTGTGAATCACA-----AGAGTAGAATAATG-TACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TAAA-----------------AATTTATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAAGAATTACTTA-GGAAAT-AAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC---T--------------TTTTTTCC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------AATTTGATTATTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTTAATCGA-TTCATCA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATA-----------------------------------------------------------ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACTT-----AC-CAATCCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_nigrovaginata ----------------CC--GTTTCTTGTGAATCACA-----AGAGTAGAATAATG-TACTTGTATCT-----------------------------------ATTTAAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------TTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAATAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTTATTAATC------------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCATA-------------ATTTTG-TGAATTCATA--------AATACTTA-----CGAATTTGCTATCTCATAATCATTCCCA--TT--AAAAAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCTACCT-----AC-CAATCCAAC----GTAATAAACTATA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_octandra -----------------C--ATTTCTTGTGGATCACC-----TGAGTAGAATAATA-TACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATACGGG-TTGGTAATGA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TTTTTCGAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--TT--------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCACCA-TAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATAATTC-ATCATTTGATTAATCAGT----ATATAT----ACGTATATA-----------------------TT-----TGATATA-TA-------------------TGGTTATCC-TTCCTCT-TA------TTTC--------GAT-AGAGG-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACT---------------------------------- Tetraria_picta ----------------CC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAGAATTAAG----------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTT--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGTCAC----GTAATTAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATTCAATCA Tetraria_sylvatica ----------------CC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATTAAATGGGCTTGGGGATAGAGGG-ACCTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATT-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATATCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTT--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATTAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATTCAATCA Tetraria_triangularis ---------------------------GTGAATCACA-----AGAGTAGAATAATG-TACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAAGAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATCTTTT--------------TTTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCTACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTA-------------------------------- Tetraria_ustulata ----------------CG--GTTTCTTGTGAATCACA-----AGAGTAGAATAATG-TAATTGTATCT-----------------------------------TTTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTTCT------------TGCTTA-----------CTATATA---------GAAGAA-ATACTTAGGCAAAGAATAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCTAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATA------------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTT-----CGAATTTGCTATCTCATAATCATTCCCATTTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTT-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATTC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_variabilis -------------CGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTTATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAATAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAAA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACT---------------------------------- Trianoptiles_capensis --CTGAGCTATCCCAACG--AGTTCTTGCGCATCACC-----TGAATATTC------TACTCAGGTCTATA-----TACTT-GTA---------------CTTGTATCAATA-------AAAT-------------------------------------------AAAAATACTCCAA--------T-----------------AAGAATA------------------------------------------------------------------------------------------------------------------------------------------------T------------TGGC-----------------------------GAAGAA-ATAT-------------------TTA-GAAAATAAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-CAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTCTTTCGTATTTTATAT-TTTGGTATT-----TGGTATA-TA-------------------GGGTCATCT-TTTCTCT-TA------TTTC--------GAT-AGAAA-----AAT-CCT---------AT-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTCATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTT------------------------- Tricostularia_pauciflora --CTGTGCTATCCCGACC--CTTTTTTGGGGATCACC-----TGAGGAGAATAATG-TACTTGTATCT-----------------------------------ATTTCAAT-------------------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAA-GATAATGATATGGG-TTGGTAATGA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATTATTTTGCGAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------CTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCACCA-TAAAGAATTCAGA-------------ATTTTT-TCAATTCATA--------AATACTTC-----CGAATTTGCTATCT-ATAATCATTCCCA-TATAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTA-----------------------TT-----TGATACA-TA-------------------TGGTTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCTACCT-----AC-CAATGCAAC----GTAATCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18774] TITLE all_taxa_all_genes; LINK TAXA = Taxa4; DIMENSIONS NCHAR=5476; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430 5440 5450 5460 5470 5480 5490 5500 5510 5520 5530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrostylis_aphylla -----------------------------------------------------------------------------------------------------GGATCATTGTCG---TTGCCTTTCGGA-GAATGC-GACCGGCGCACGCGTA-AAG-----------GCC--GTGGAGAAGCCTTCT-CCTCGGCCCT-ACCGG-CCC-----------------------CGACGC--TGGTCG-TGGCGTCGG------AATACGGCGCGGAACGA--CG-CCAAGGAACACAGAT--TGTCGAGGC--GGACGGCGATGCGCGCTTGCGCTGCGTCGT--CTGTTGAGGCCG-------AAGCAA------AAAG-AGATGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCACGGGCGTGAGTAGCCCACGCACGCTCGGG--AGC----CCCCGACGCGGACATTGGCCCTTCGAGCC--GCGAGGCG-CGACGGGCTC-AAGCGGAACGGCCGCCGGCT--GAGGC-------CGGGAGCGACGAGTGGTGGGC-CAC-TAGCGCGCGTT-GCCCCGGA-ACTCTGTGCCGGC------CCT-GTTT-GGACCCC-GAGAA-AGGACGGCGT{CT}GTTGCGGCGCGAA--GTCGTGCGACGCGGTCGGACCGATA-CCCCAGGGTCAGGCGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGATACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTACGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTTACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGCCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTGTCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAACGATATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAACCGGTAGACAAACTAGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCGGCTATCCCGACC--ATTTATCTTGAATCACC-----TGAATAGAA------TACTCCTATCTATT-----CCCTT-GTA---------------TCTACGTCAATT-------AAATAATTGAA------------------------------------CATTGAGCCTAAC-----AAAA-----------------AATTGATTCAA-AAA-----A-AAAGTCAATGT-----------------------------------TAATAATATTGATA-TTA-TTGGTAATAA-------TATCACCAATAGA----------------------------GATTTTT------------TGCATA---------TGCT-TAGATTCTTT---GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTAAATTATCATC---------------ATTTTTTC---------AATCTAAAAAACTCTAT-------------------GATTGATAAAATCAATTAAATTCAATTGATTATTCA------------AA-ATTGAA-------------------------TTCTTTTTTCATTGAACTGCAT---------------AT--TCGAATCAA-TTCACCAT-AAAGAATTCATTATTTTTTGATAGAATTTTT-TGAATTCATT--------AAAATTTAA----TGAATTTGCTATTCCATAATCAATAGCAATTTAATTCTAT----------TTTTTGATTTTTAATATATATGATTA-AACGTTGGATTAATCAGT----ATATATAA--ACGTACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTATCT-TA------TCTT--------GAG-AGATA-----AAT-TCA---------AG-CAATGCAAC----ACAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAATGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATGCA---- Becquerelia_cymosa -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTACTCCGGTGCGGCCAACTG-TC-GTGGAGCTTGTG-TTTTCAGTCC-CCC-CCTG-CCTAGTGCGCTTTTGCAC---GGAACGGA----CAATGTTCAGTGGG-TGCTTGTGTGGGTA---CTTTCGAG-GGAA-CACGAATTCT---GGCCGGTGA-TGGAT---TCTT-TC-TTGCTCGGATTGCA--ACTTTTTGT-CGTCC-GTGC-ATTAGCAATGT-CGGCGGTGT-----TGT-AGCCGT-GCGT--GGGCTGAT----GCTCC-TCGTGAC-GGACTAGGCTAC--C-GCCG-CCTCTTGCGGATG-TTGTA----GCCATTGAGTG-------TTGTG-CGGTCCTTTGGTC-CGCTTGTTT-CCTCC--GG-AGGTCC---TCTGGGC----GAAACA-CTC-CTCT--G----------------------------------CCGCCAG-TCC------------------TCTC---AAGGCGGGCTGTAGGGGCATGGTC-TCGTTCG--TGAGAGATG-----TCC----------GATGTTGCCTAAAAG-CGA--TTGCCGGTCT---GCTTCGCACGG-------------------------------------------------GAAGCTC--A-GTGCCGTCTCTCGTTT--ATGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGCGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACGAGCCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGCTGGGGAAGACAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGTGCTCTACGCTTGGAAGATTTGCGAATTCCACCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTTTTAGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGCTCCTATTGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACCGAAATCTTTGGAGATGATTCCGTCCTCCAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGGAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTCGATCCGGTAGATAAACTAGAT---------------------------------------------AATAAT-GAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG----AAAAAAAGGATTAATT-------------TTTG----------ATC-----AAA---------CAAGGGAAAGAATCTAGGGTTAATGAAATTCAATAT-------------------------------------AATT--------AATTTAGACCAGCTTTGTAAGTATATTCTTAGCATC--------GAAATCAAAAAGTGAAAACCCAATTCGA-----ACAAGTA---------------AAAAAAAACAAGAA---AAAGTGAAATTGTTGG----AAAAAGGTAAA-----AC-----------GATTTTGATCAA------AAGGTGTAACGGGAGTTAACTCTTCTT---------------------TATAAA---------------------------GAAGGAA------AAAAAAGGATATGTTGCTTCCCTTTTGA-AAGGAGTAAAG-GTCCCT--------GAAGTAATGTATAAACCCAAAGATTTTAAAAAG-----AAAATC-TAAA-AGATTCCGGAACAAGAAAACACTAT--TTGCAAACGTCTCTCTCAAC-----ATTATA----AT---------------------------------TTTAATGAT--------A---AATAAAAA------TA----AGTTAGAGATGGGACAAACAAAAGAGTCTAGAGATAACTCAAG-------AAT----T--TCC----TAAAGATTT---TTCTTTTGAATTTTC-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAATGTAAA---AAACTATAAAAAAGAATTCAATTT-GAATC-----------------------ATAGTCTAAGT-CATTATT-----TTATGAC-----TTTATTTTTC-------ATT-------------CTATA---------------CAGAAATTTTTTTCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG------------------------------------------------ATC-----TGAGTAGAA------TACTGGTATCTATG-----CCCTT-GTA---------------CCTATGTCAATT-------AACTA------------------------------------------AATTGAGCTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATGGA-GTAGTCATGG----------------------------------------GATATTGATATGGC-TTGGTAATGA-------TTTCGTT-ATAGA----------------------------GATTTCT------------TGCTTA---------TTATATAAACTCCTTGCTGAAGAA-ATAC-------------------TTA-CGAAGTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAGAAATCGACGGATTTTCCTCTTACTAG-AAATTTCATTGTTGTCAATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAGTCAT-----------------TTTGT-C-----AAAAGATCTAGCAAATTCTAT-------------------CATGAAT---------------GATTTGGTTACTAA------------AT-ATGGAG------------------------TT-CTTCTCTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCACCAT-AAAAAATTATGA-------------ATTTTT-GGAATTCAAA----AATCAATATTTT-----CGAATTTGCTATTTCCTAATTATTCACAATTGAAA----------------ATTTGATTGTGATT---AATCATTA-CACATTTGACTAATCAAT----ATATAT----ACGTATGTC-----------------------TT-----TGGTGTA-TA-------------------GGGTCATCC-TTTTTCT-TATTTTT-TTTTATTTAATAGAA-AAAAA-----AATATCT---------AC-CAATACAAC----ATAATAAACTATA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGT------------------------------------------------------------ Calyptrocarya --------------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTATCG---TTTTGCTTGCCG-AAACAC-GACCTGTGCACGTGTG-ATC---GAATGCT-GCT--GGGGCGGCTGTGCCG-TCCCCGCCCC-CCCGG-CCGCGGCGG-CTGTGCCCTT------GGGTGTTGCTGCCG-TG-AGCCG-------AAAACGGCATGGGGTCA--TG-CCAAGGTACACTCAA--TGCGGAGGTCGGGACG-CTGCGTGTTTGATCG-TGCGGCCCT-CGACCGAAGCT--------AAGGAA------AACA-ATAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTACCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCAACGCTCGGG--CG-----TCTCGATGCGGATCTTGGCCCTTCGAGCT--GCACGGCT-CGGCGGGCCG-AAGT-GCGCCTCGGTCGTAT--GTGGC-------TGGGAGCGGCGAGTGGTGAGT--TC-CTTCGCGCGCC-GCCCCTGA-GCCTC-CGTCGAC------ATTCATTT-GACCCCA-TGACG-AGGTGATTGCCGATGCGGTGTTGC-CGCTGTGCGGCCTCCTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCTGAGTTTAAGCATATCA-----CCGTACTGTGGTGCGGCCAACCG-TC-ATGGGGCTTGTC-GTTTCAGTCTCCGC-CCGG-----ATGCATTCTTCCAGGG-CGGAGGGA----CCGTATTGAGCTGG-TGCTTGCGTCGGTA---CCTTTGGC-GGAA-T---ATTTGT--AGACTAGCGA-TGGAT---T----AC-TTTCCCGGATTGTG--CACGGATGG-CGTCC-GTGC-GCATAAAATGT-CGGCTGTTC-----CTT-GACCTG-CAGC--GGTTGAAA----TCCCC-AGCGCA--GGGCTCGATTAT--T-GCCG-CCTCTTTCGGATG-CTGTA----GCCATAGACGG-------TGTTG-CGGTCCTGCGGTC-CGCAAAGTC-CCTGG--GT-AGATGC---CTCGTGC----GGGTTG-CTA-CTCC-------------------------------------CTTCTTC-TCC------------------GCTCTGTGCAGCGGGCTGCGGGGCTGAGCGC-TCGTTCG--TGTGCGATG-----TTC----------GTCCCTCGCGGAGAG-CGA--TTGTCGGTCC---ACTACGTGCGAATG--TTTCCCC-----------------------TTCGGGGGGCAGCCGCGGCGG--A-GTGCCGGTTCTCGTTT--ATGACGTGCTACCTGGT------------------TAAGGCAAGTGTTGGGTTTAAAGCAGGGGTTAGAGATTACAAACTTACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTCTTGGAGAAGACAATCAATATATTTGTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGCGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTTTTAGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTATGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Capeobolus_brevicaulis ----------------------------------------------------------------------------------CGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAAT---AACCGTTGGGCATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCAA-ATCGG-CACCGGCCT-TCATGCCCTAC---CGGGGAGCGTTGGTCC-TG-TGTTGA------AATACGGCGTGGATTGA--TG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGTT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CACA-AGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATCCATGCTCGGG--CTA----CCCTGATGCGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGGCTG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTTTGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CATTGGCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCAGCGCTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATATCAATA--CTGCATTTTGTTGCGGCCATCTG-TC-ATGGGGT-AGTC-TTTTCAC-TCTTTCCTTTT-GTGTGCTC-CTTTT--GC---GCAGGGGA----TGGTTGCGAC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTG---TTT--GC-TTGCCCTGCGGATA---CTTGCTAT-CTTGG-GTGT-GGCTGTTTTAT-TATGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCACC-TATGCT--TCCCTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAT---TGGATCATTTGCCCCC--ACGCATT----------------------------CTGTGTC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGAGGGGACGTGTTCCATGTGCATATGTGAGATG-TTTTTCC----------GACT----CAATGTG-CAA--TTGTCGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGAG-TGCTCTCAAATG--ACGTGTCGTCTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGTCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGCGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGAAGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAAAATCTAAGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATCCGA-----ACAACTTTC------------------AAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGTAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTTAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCCAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATAAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTTATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGACC------------AATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATATTAAAATTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAATGGA-ATAGTAGATGTTAGGATAATGATATGGATTGGTTATGATTACATTATAGAGATAATGATATGGA-TTGGTTATGA-------TTACATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGTATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTAATTAATCAGT----ATATAT----ACGTATGTT-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-ATTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Carex_magellanica -------------------------------------------------------------------------CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCG---TTGCCTTTCCAG-AAACAC-GACCGTCGAACACGTG-ACA---GAATGCT-GCC--GCGGAGGCGCCGCCT-CCTCGGCCCC-ACCGG-CCTCCTCCC-TCTTGCCCTTC----GGGGCGCGTCGGTTGCTG--GTCGG------AATACGGCGCGGGATGA--CG-CCAAGGAACACGGTA-AAGCTGAGGC---ACCGGCGAGACGCTCAAGGT-CTCTGTCGG-TTGCCAAGGCC--------ATCAAA-----AAAAA-ATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGT--TGC----CAGAGATGCGGATATTGGCCCTCCGAGCC--GCGAGGCG-CGGTGGGCCC-AAGT-GTGCGGCCGTCGTGC--GTGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCACGTC-ACCCCGAG-CCCCG-TACCGAC------CCTTGTAC-GACCCCC-TAACG-AGGAGCAAGTCGCTGCGGCTTCG---GCTGTGCGGTGCCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATCAATA--CC---TTTTGGTGCGGCCAACCGAAC-ATAGGGC-TGTC-TCTTCACTCTCCCA-CCCG-TCATTGAACATGTTGT-----GGTCGGGA----TGCTT-CTGATCGGTTGCCTGTGCGGTTATACCCTCTTGTGGGTA-GCGAAGTCGT----CCC-TTGA-TGGAT---ATTT-GC-TTGCCCTTGTGACA--TATTTATGT-CATTT-GGAC-AGCCGAAATGT-TGGTGATATC----CTT-GTGTTG-GCACGTGGTTGAAT----GCTGT-GTTGCTA-TCACTCGGATTT--TTGCCG-GCTCTCACGGATG-CGGTG----CCTAGTGCTAG-------CTCTG-CGGGACTTTGC-C-CCGCAGA---CTTCG--GG-AGGTCC---CTTGTAC----GAATCA-TTG-CTCT--TATACGC----------------------------CGTCTTG-TCG------------------TGTCGCTACCGCGGCACGCCGGAGCGTGGTC-TTGTGCA--CGTGGAATG-CCTCTCC----------GATC-GTATGAGCAG-CGA--TTTCCGATTT---GCGTCACGCGAAGGCCCCGCCCG-----------------------TCCGGGTCGGTGCTGGAGCTG--ACGCGCCGGCTCTCG-TT--AAGACGTGC--------------------------TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTTAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------------CCATTTTCT--TTATAG-AGTAAT-GAAAATGCTTTTGGTTCGACATAATTTGTTCTGT--------TCCG----------------TAAACAGTA-CAT----------GATGAAGCTCGAA------------GTTTGATT-------------TTTTTATTTGTTCTATC-----AAA---------TAAGGGAAAGAATCCAGGGTTAGTGAGAATTAACTTAAATTT-CAT------------------------TTTAATT--------AATTGAAAGAAACTTTGTCAGTATATTCTTAACATC--------GAGATCAAAAA----AAATCCAATTCAA-----ACAAGAAA------------AAAAAATAAAAGAGAG--TAAAGTGAAATTGTTGG----AAATTGGTAAA-----AC-----------TCTTTTGATTAT------AAGGTGGAATGGAAGTGAATTCTTCATATTTTATT-------------TATAAGTA-------------------------TCAGGAAAT--C-AGAAAAAGGGGTGTTGCTTTCCCTTTGACAAGAAATAAGG-ATTTCCAAAATAATGAAATAATGTATAAACCTAAAGATTCCAAAAAG-----AAAATA-TAAA-GAATTCCGGAACAAGAAAATACTTTG-TTGAAA----TTATCTCAAC-----AATGTA----AT---TGGAT-------------------------CATTTT---------------AATCTAAA------TATCTTTCTTAGAGATAAGACAAACAAAAGAGTTTATAGACAGCTCAAG-------AAATTTCT--TCA----TAAAGATTT----TCCTTTGAACTTCC-----TCAAAATT-----------TTTTAACTTGAGTCATGAGT--CAAAATGATA---------TTTTTCTCTAT-AACGAAAAGG---------AAAAAGGAACTCTTTTC--------------------------------------------------------------------------C-------ATT-------------CTATA---------------GATAAATTTAAATCA-TTTTTCTTGAGCCGTATGAGGT-GAAAATTTCACATACGTTTCTAGGG-AGGCTTTTTT---------GCTATCCCGACT--ATTTCTTGTGGATCACT-----CGAGTAGAA------TACTCGTACCTATG-----CCCTT-GT-----------------------CAATT-------AAAT-------------------------------------------AAAGGAGCTCAAATAAAATAAA-----------------AATTTATTCAA-AAAAATAGA-ATAATCAATGT-----------------------------------TTAAGATTATGATA-TGA-TTGGTAATGA-------TTTCATT-ATAGA-----------------------AGAATGATTCTT------------TGCATA---------TGCT-TAGGATCTTT---AAAGAG-ATTT-------------------TTT-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTTATCATC---------------ATTTTTTC---------AATCTAACAAACTCTAT-------------------AATGAAT-TCCATAAATAGAATAAATTGATTATTAA------------AA-ATTGAG-------------------------TTTTTTTCTCATTAAATTTCAT---------------AT--TTGAATCAA-TTCACCAT-AAACAATTCATA-------------ATTTAT-GGAATTCATC--------GAAATTCC-----TGAATTTGCTATTCCATAATTATTGTTAATTTAATAATAT----------GATTTGATT-----T---TATGATTA-ATAATTTGATTAATTATT----ATATAT----ACGTACGTC-------------------TTTGTT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TTT---------AG-TATTGCAAC----ATAATAAATTCTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCTTAGAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Carpha_alpina -GGCGGTCCGCCGCCCGTGAACGTCGAGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGTCTT-ACAA-AAACAT-GACCATGGCGCACG-A-GTCACAGAAAGCT-GCC--GGGGGGGCTTTGCCC-CGCCGGCCC--ACCGG-CACCGGCAG-TCTCCCCCTTC--GGGGGGTGTGTTGCCTG-TG-TGCCG-------AACACGGCGTGGGTTGA--CG-CCAAGGAACAAGAGA--TGCTGAGGC--GGCCGGCGGAGCGCTGTGGTG-CCCCGCAGG-GCGCCGATGCG--------AATGAA------CACAATGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATC-ACGCTCGAG---GC----GCCCGATGCGGAGCCTGGCTCTCCGAGCC--CCACGGCA-CGGTGGGCCT-AAGA-GTACGGCCGTCGGAT--GGGGC-------CGGGAGCGGCGAGTGGTGGTC--TA-CTTCGCACGCC-GCCCCGCA-CCCAT-TGCCGGC------CCTTGTAC-GACCCCCCGAACG-AGGAGACGGCCGT-ATAGCGTACC--GCTGTGCGGCCACTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCTGAGTTTAAGCATATAAATAAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCTAGTGTTGGTTTTAAAGCAGGGGTTAAAGAGTATAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCGGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGCTCTGTTACTAATATGTTCACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTACTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTACTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGGCTATCCCGACC--AGTTCTTGCGCATCCCC-----TGAGTATTT------TACTCAGGTCTATA-----TCCTT-GGG---------------CCTGGATCAATT-------TAAT-------------------------------------------AAAGGAACTCAAA--------C-----------------CATAATAAAAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGGAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCGTCC-TTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Carpha_capitellata_var._bracteosa --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGC-TG{GT}C-TTTTCACTCTCCCTCCCTT-ACATT-{CT}T--------GCT{AT}-{AG}GGAGGGA---CACGCTTGTTGCCGGCTGCCTGTGTGGTTTTACCCCTGCGG-GGAT-CGCAAGTCGTG-ACTTA---------CT---CCAA-GC-TTGCCCCGCCG--A---CATGTTGT-C{AG}TGG-GGGC-AGTC{AG}GAATGT-GGGCGGAATC----CTT-GTGTCGTCTGA--GGGCCAAT----GACCC-CATGCG--GCACTCTGATCC--T-GCCG-GCTCTCATGGATG-CGGTG----CCAAATGAA{AG}G-------TTCTG-CGGGCCTCCGGT--CCCAGATTT-CCTCG--GG-AGGTCC---CTTGCAC----GGATCG-TTG-CACC--GCCGCTT----------------------------CGCCCTT-CTA-CGGG-------------TGTCGGAGCGG-{GT}GTGTG----------CTC-CTGTGCA--TGCGAGATG-TCTCTCC----------GTTC----TAGTGAG-CGA--CTG{AC}CGGTTC---GGGTTGCGCGGATGG-CCTCCC------------------------TTGCCGGGTGTGCCG-AAGCG--TCGTGCCGGCTCTCGTTT--AGGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTTGATAAGACGAAATAAAAAGATCAA--TCCACCATTTTC------TATCAGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG--AAAAAAGAAAGATTGATT-------------TTTTT---------ATCAAATCAAG---------CAAGGGAAAAAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATGCTTAGCATC--------GAAATCAAAAAACGAAAATCCAATTCGA-----ACAAATTTC-------------------AAAAAAAGA---GGGTAAAATTGTTTT----AAACTGGTAAA-----AT-----------TTTTTTTATTTT------AAGGTGTAACGGGAGTGAATCCTTC---TTTTATT-------------TCTAAA---------------------------GAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTTA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-TAAA-AAATTCCGGAACAAAAAAACACTATATTTGCAA----TAGTCTCAAC-----AATGTA----AT---TGGGT-------------------------CATAATGAC--------G---AATAAAAA------TA----AGTTAGAGATGAGATAAACAAAAGAGTATAGAGATAGCTCAAG-------AAA----T--TAA----TAAAGATTT----TCCTTTGAATTTTC-----TCAAAAAT-----------ATTCAACTTGAGTCGTAAGT--ATGAATGAGA----------TTTTTTCTGGTAAAGAAGAG----------GAAAAAGGATTCAAATC-----------------------------ATAGTCTAATT-CATGATT-----TTATGAG-----TCTATTTTTC-------ATT-------------CTATA---------------CATAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-AAAAATCTCATATACGTTTCTGGGGGGAGCATTTTTTT-----------------------TTCTTGCGCATCACC-----TGAGTATTC------TACTCAGGTCTATA-----TCCTT-GTA---------------CCTGTATCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA--------T-----------------AATAATAATAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGTAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCATCC-TTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACT---------------------------------- Carpha_glomerata ---------------------------------------------------------------------------AGGTTTCCGTAGGTGAACCTGCGGAAGGATC{AT}TTGTCG---TTGTCTT-{AC}CAA-AAACAT-GACCATGGCGCACG-A-GTCACAGAAAGCT-GCC--GGGGGGGCTTTGCCG-CTCCGGCCC--ACCGG-CACCGGCAC-TCTCCCCCTTC--GGGGGGTGTGTTGCATG-TG-TGCCG-------AACACGGCGTGGGTTGA--CG-CCAAGGAACAAGAGA--TGCTGAGGC--GGCCGGCGGAGCGCTGAGGCG-CACCGCAGG-ACGCCGATGCG--------AATGAA------CACAATGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATC-ACGCTCGTGGCGTCTACGCCCCGATGCGGAGCCTGGCTCTCCGAGCC--CCAGGGCA-CGGTGGGCCT-AAGA-GTACGGCCGTCGGAT--CGGGC-------CTGGAGCGGCGAGTGGTGGTC--TA-CTTCGCACGCC-GCCCCGCG-CCCAT-TGCCGGCAGAGGGCCTTGTAC-GACCCCC-GAACG-AGGAGACGGCTGT-ATAGCGTACC--GCTGTGCGGCCACTTCGGACCGATA-CCCCAGG-TCAGGC{AG}GGGCTACCCGCTGAGTTTAAGCATATCAATAAGCTGTGCTTCGGCGCAGCCAACCG-TC-ATGGGGC-TGTC-TTTTCACTCTCCCTCCCTT-GCATT-CT--------GCTG-TGGAGGGA---CACGCTTGTTGCCGGCTGCCTGTGTGGTTTTACCCCTGCGG-GGAT-CGCAAGTCGTG-ACGTC---------CT---CCAA-GC-TTGCCCCGCCG--A---CATGTTGT-CGTGG-GGGC-AGTCGGAATGT-TGGCGGAATC----CTT-GTGTCGTCTGA--GGGCCAAT----GTCCC-CATGCG--GCACTCTGATCC--T-GCCG-GCTCTCATGGATG-CGGTG----CCAAATGAAGG-------TTCTG-CGGGCCTCCGGT--CCCAGATTT-CCTCG--GG-AGGTCC---CTTGCGC----GGATCG-TTG-CACC--GCCGCTT----------------------------CGCCCTT-TTA-CGGG-------------TGTCGGAGCGG-TGTGTG----------CTC-CTGCGCA--TGCGAGATG-TCTCTCC----------ATTC----GAGTGAG-CGA--CTGCCGGTTC---GGGTTGCGCGGATGG-CCTCCC------------------------TTGTCGGGTGTGCCG-AAGCG--TCGTGCCGGCTCTCGTTT--AGGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA-------------------------------AAAGATTATAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCGGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGCTCTGTTACTAATATGTTCACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTACTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTCATAAAGCACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGGGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTTGAT-------------------------------------------------------------CTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG--AAAAAAGAAAGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATGCTTAGCATC--------GAAATCAAAAAACGAAAATCCAATTCGA-----ACAAGTTTC-------------------AAAAAGAGA---GGGTAAAATTGTTTT----AAACTGGTAAA-----AT-----------TTTTTTTATTTT------AAGGTGTAACGGGAGTGAATCCTTC---TTTTATT-------------TATAAA---------------------------GAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTTA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAAAGATTCCAAAAAG-----AAAAT----------TTCCGGAACAAAAAAACACTATATTTGCAA----TAGTCTCAAC-----AATGTA----AT---TGGGT-------------------------CATAATGAC--------G---AATAAAAA------TA----AGTTAGAGATGAGATAAACAAAAGAGTATAGAGATAGCTCAAG-------AAA----T--TAA----TAAAGATTT----TCCTTTGAATTTTC-----TCAAAAAT-----------ATTCAACTTGAGTCGTAAGT--ATGAATGATA----------TTTTTTCTGGTAAAGAAGAG----------GAAAAAGGATTCAAATC-----------------------------ATAGTCTAATT-CATGATT-----TTATGAG-----TCTATTTTGC-------ATT-------------CTATA---------------CATAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-AAAACTCTCATATACGTTTCTGGGGGGAGCATTTTTTTT--CTGAGCTATCCCGACC--AGTTCTTGCGCATCACC-----TGAGTATTC------TACTCAGGTCTATA-----TCCTT-GTA---------------CCTGTATCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA--------T-----------------AATAATAAAA--AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGTAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCATCCTTTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCAGTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Caustis_dioica ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGTTTCGGCGCAGCCAACCG-TC-GTGGGGC-TGTC-TTTTCACTTTTCCT-TCCT-GTGTGCTT-CTTTT--GCCC-GGGAGGAA----CACTAGTTTT-CGG-TGTCTGTTTGGTTCTACCCTCGCGG-GGAA-CAACG----------CTAATGA-CGGAA---TTTT--C-TTGTCCCATTGATA---TTTGTTAT-CTTCG-GTGCAAGCTGATATGT-TGGCTAGGTGAGAACTT-GTGCAG-CGGT--GGGCGAAT----GCTC{CT}-GCGACT--GCACTTGGATTT--T-GCCC-GCTCTCACGGATG-CCGTG----CCCAACGAGGA-------TTCTG-CGGGCCTATTGTC-CCCTG-ATTCCCTCG--GG-AGTTCC---CTTGTATACTTGGATAA-TTG-CTTT--GCCGCAT----------------------------CGCTATC-TTG-TTGCCGTTGTTGGGAA-TGTCGGAGCGG-TGTGTGCGGAG-CATGGTC-TGGTGCA--TGCGAGATG-TTTATCC----------GATT----GGACGAG-CGA--CTGTCCGTTC---CCGTCGTGCGACCGG-AGTCCC------------------------ATTTAGGGTGTGCCGGA-GCG--ACGTGTCGGCTCTCGTTT--CGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCTGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTACCATATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAGCAGCTTTATAAAGCACAGGCCGAAACTGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATACGAGCCGGTAGATAAACTAGAT---------------------CATCCACCATTTTC------TAT-AG{AT}AAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTTTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG---AAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAC---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATGAA----------TAT---------------------------AATT--------AATTTCGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATCAAAAAGAGAACACCCAATTTGA-----ACAAATTTC-------------------AAAAAAAGA---AAGTGAAATTTTTGG----AAATTGGTAAA-----AC-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCGTATTTTTTTT------------TCTGAA---------------------------GAAGGAAATAAC-AAAAAAAGGTATGTTGTTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AGAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGACAAAATAACG---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAGGGATTT----TCTTTTGAACTTTA-----TCAAAACT-----------ATTCAACTTGAGTCATGAGT--ATGAATGATA----------CTTTTTTTGT--AAAGAGAA----------GGAAAAGGATTCAATTC-GAATC-----------------------ATAGTCGAATTGAATCCTT-----TTATGAG-----TCCATTTCGC--------------------------------------------AAAAACTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGG------------------------------C--ATTTTTTGTGGATCACC-----TGAGTAGAA------TTCTCGTATCTATATAATGTACTT-GTA---------------CCTATGCCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTAA-ATAGTCAATGT-----------------------------------TAG-GATAACGATATGGA-TTGGTAATGA-------TTTCATT-ATAAA----------------------------GATTCTT------------TGCTT------------ATATGTATTATTTTGCGAAGAA-ATAC-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTTATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-TTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCAT-AAATAATTCAGG-------------ATTTTT-TGAATTTAGA--------AATATTTC-----TGAGTTTGCTATTTCATAATCATTCACAATCAAAGAATAT----------AATTTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------CGGCGACCC-TTTCCCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGTAAC----GTATTCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTACCCATTTTTAATTCCAGGGTTTCTCTGAATT------------------------------------------------- Chrysitrix_capensis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTGC-CGTC-TTTTCACTGTCTCGCACCC-CTCG-----------------CAATGGGG----TGCTCGTTTT-TGG-TGCCTGTGCGGTTCTACCCTGGAGG-GATA-C-------GTT-TGGATCGTGA-TTGAG---GCTT-GC-TTGTCCCGCCGAAG--ATTTTGTCT-CGACG-GGAC-AGTCGGAATGT-CGGCCAG-------CCC-AGCGTG-CGGT--GGCGGCGC----GTTGC-TGTACCCCGCACATCGGTGC--TCGCCG-GTGCTCTCGGATGTCGGTG----CTAATTATGGCGCAGGTCCTGCA-CGGACCGTGGCGT-CCCTGGTTC--------GG-AATT------TTGCCC----GGATCG-----CTCC--GCTGTCT----------------------------AGCGGTGGATTCCTTATGGCGGACGGAACCGTCGGTCCGG--GTCTGATGGCGTTGATTTTTCGGGCA--AGCGAGATG-CGACCC-----------GTT-----CAATTTG-CGA--TTGCCGGTCC---AC-----------------------------------------------------------------------------------------------------------------------------------TGTTGGATTTAAAGCCGGAGTTAAAGATTACAAACTGACTTATTATACTCCTGAGTATGAAACCAAAGATACTGATATTTTGGCAGCGTTCCGAGTCACCCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCCCCTGCTTATTTAAAAACTTTCCAAGGTCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTAAACGCTACTGCAGGCACCTGTGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGCTTGTCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATAATTTTATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGACTCCGTACTTCAATTTGGTGGAGGAACTCTAGGACATCCTTGGGGAAATGCATCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTCCTCGGGAAGGTAATGAAATTATTCGAAGAGCAGCTAAATGGAGTACTGAACTAAGCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTCGATCCGGTAGATAAACTAGATAAGGCGAAATAGAAAAATAATCATCC-CCATTTTC------TAT-AGTAAT-GAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAAGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG----AAAAAAAGA-TTGATT-------------TTTTTT--------ATC-----AAT---------CAAGGGAAAGAATCTAGGGTTAGTGAAGATTAA----------TAT---------------------------AATT--------AAGTTAGACC-ACTTTGTAAATATATTCTTAGCATC--------GAAATCAAAAAGTGAAAATCCAATTTGA-----ACAAGCAAG--------T----AAAAGAAAAAAGAG---ATTGTGCAATTTTTAT----AAATTGGTAAA-----AC-----------TTTTTTGATCA-------AAGGTGTAACGGGAGTGAATCCTTTTTTTTTAATT-------------TATAAA---------------------------GAAGGAAATCGC-AAAAAAAGGTATGTTGTTTTCCTTTTGA-AAGAAATAAAG-GTCCCC--------GAAGTAATGTATAAACCTAATGATTTCAAAAAG-----AAAAGA-TAAA-AGATTCCGGAACAAGAAAATACTTT--TTGCAA----TTGTCTCAAG-----AATGTG----AT--CTTAAT---------------GCGAATAAGACTTAATGAC--------G---AATAAGAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AAA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTTAACTTGAGTTATGAGT--ATTAATGACT----------TTTTTTCTGT-AAGGAAGA-----------AAACAAGGACTCAATTC-AAATC-----------------------ATAGTCTAATT-CATAATT-----TTATAAG-----TCCA-TTTGC-------GTT-------------CTATA---------------CGGAAATTCAAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATGTACGTTTCT---------------------TGAGCTCTCCCGCCT----TTCTTGTG-ATTACC-----TAAGAAAAA------T-CTTATATCTATG-----TCCTT-ATA---------------CTTATGTTAATT------------------------------------------------------AAAGGAACTCAAT-----TAAA-----------------AATTTATTCAA-AAATTTTGA-ATAGTCAATG------------------------------------TTAGGATAATGATATGGG-TTGATAATCA-------TTTCATT-ATTTA----------------------------GAT-------------------------------------------------TATTAA-ATAC-------------------TTA-GGAAGTAAAATAGGCTTGGGGATAGAGGG-ACTTGA-CCCTCA-TGATTTTTAACATC-CCGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATCAC------------------TTTTTA-----AAAAGATCTAGCAAACTTTGT-------------------AATGAAT---------------AATTTGATTACAAA------------AT-ATTGAG-------------------------TTCTTCTTTCATTGACCTTC-T---------------AT--TCGAATCAA-TTCATCAT-----AATTTAG--------------AATTAT-TTAATT-ATA-----AAAAATATTTA-----AGAATTTGCTATTTCATAATCATTCAAAATCTAACAATAT----------AATTTGATCATAA-T---GAAAATCA-ATCAGTTGATTAATCAGT----ATAATT----ACGTATGTC-----------------------TT-----CGGTATATTA-------------------GAGCTATTC-TCTCTCT-TA------TCGA--------GATAAGAAA-----AAT-TCCACT------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Cladium_mariscus ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTGCCTCGGCGCGGCCAACCG-TC-ATGGAGC-TGTC-TTTTCATATCCCCTCTCGT-TGT-------------GCTA-CGGGGGGA-------CTGGGTTACGGGTGCCTGTGCTGTTCTACCCTCATGG-GAAT-GTTTATTTTT--GTCCC-GTGA-CAGAT---TTTTGCT-TTGCCCTGACAGTG--TATTGTGCT-TGTTA-GGGC-GGTTGAAATGT-CGGCCAAATC----CTA-GTGCGG-CGGC--GGGCGTAT----GCCCC-TGCCCT--GCGCTGGGATAT--T-GTCG-GTGCTCTTGGATG-CCGTG----CCCATGGAGGG-------CTCTG-TGGGCCTCTGG-T-CCCTAGTTTTCCTCG--GG-AGTCTC--TCTTGTAC----GGATCA-TTG-CTCC--CCCGCTTC{AG}CTGGTGATGGCACCGTCAGAC{AC}CGATTGACGTGCTTGCCGGGATATTA-------TGATGGCGGTGCGGTGCGTGGGGGGCATGCTCCTGTGTG--AGTGAGGCG-TTTTCCC----------AATT-GAATG---AG-CGA--TTGCCGGTTC---GCGCTGCTTGAGCGG-CCTCCCA-----------------------TTCGGGG-GGCGTCAGGAACA--GCGTGTCGGCTCTCGTGT--AGGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGCACATGTGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAACAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTCCAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCCGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTTGAGCCGGTAGATAAACTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAGTTTGTTCTGCTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG---AAAAAAAAGGATTGATC-------------CTTTT---------ATC-----AAG---------CAAGGG-AAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AAGTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------GAAATCAAAAAGTGAAAATCCAATTCGA-----ACAAGTT----------------AAAAAAAAAAAAGA-GAAATTCAAATTGTTGG----AAACTGGTAAA-----AC-----------TATTTTGATCAT------AAGGTGTAACGGGAATGAATCCTTCGTATTTTATT-------------TATAAA---------------------------GAAGGAAATAAA-AAAAAAAGGCATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GGAGTTACGTATAAACCCAATGATTCTAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGTAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAATAGTTTAGAGACAGCTCAAG-------AAA----T--TAA----TAAGGATTT----TCCTTTGAACTTTG-----TAAAAATT-----------ATTCAACTTGAGTCATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGGAAGAG----------AAAAAAGGACTCAATTC-GAATTATAGTCT-------------------GTCTAATT-CATAATT-----TTATAAG-----TCCATTTTGC-------ATT-------------CTATA---------------CAGGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGG-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGGCC--ATTTC-----GATCACC-----TGAGTAGAA------TACTTGTATCTATG-----------------------------------TCAATT------------------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTA-TTTGCGAAGAA-ATAC-------------------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTA----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCACCAT-AAATAATTCAGA-------------ATTATT-TGAATTCTGA--------AATATTTC-----CGAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AATTTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----CGGTATA-TA-------------------GGGCCATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-TAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCGTTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGCATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCGAGGCTCAC-------- Costularia_arundinacea -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGGTATGCCCGCC--GGTTCTTGGGAATCACC-----AGAGTAGATACATGATACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TTTTTCGAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCGTTTGATTTTTGATTAATC--TT--------------TTTTTTTT----T-TAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCATTAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTCCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Costularia_fragilis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCTTTTGTTGGTTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGACC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Costularia_laxa TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAATA--AACCGCTGGGCATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCT-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTGGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CATA-AGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCATGCTCGGG--CTC----CCCTGATGTGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCAGCGCTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCT------------------------------------------------------TCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATATT---ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Costularia_leucocarpa_Lar0140 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGGG-GGAA-C-TAATTTGTG-GGCTTCGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTGT-CTTGG-GTGC-AGCCGTATTAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCTGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAATTTTGACGGTTC---AC-------------------------------------------------------------------------------------------------------------------------------------------------------------------AACTTAATTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACTAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGATAAGACGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------GATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTAAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC----------AAAAAAAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGGA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATGAATGAGA---------TTCTTTTTTGT-AATGAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTTAATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTTA-----------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA-----ATTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTT------------------------------------------------------------------------ Costularia_natalensis ---------------------------------------------------------------------------------------------------------------------------------GAATA--AACCGTTGGGCATGTG-ATT---GAACCCT-GCA--GGGGAGGTGCTGCCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCC-TG-TGTTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTAGTTGCA--------AAGGAA------CATA-AGAAGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGGACCTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATCCTTGCTCGGG--CTT----TCCTGATGCGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGGCTG-AAGT-TTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACAGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGTTGACGCAGTGCTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCA-----------------------------------------------------------------------------------------------------------------------------------------GGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTGT-CTTGG-GTGC-AGCCGTATTAT-TGGGTGAGTA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCTGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTTGATGTTGGGC--TGGCGGTGTGT-TGCGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAATTTTGACGGTTC---ACGCCATGCGAGTGGATTTCCC------------------------ATTTGGGG-TTCTCTTGAATG--ACGTGTCGTCTCTTGCTG--AGGACGGGCTACCTGGTTGATCCTGCCAGTAT---------------------------------------TTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC--------------AAAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGGA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATGAATGAGA---------TTCTTTTTTGT-AATGAGGAA----------CAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAAGAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGAATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA-----ATTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Costularia_nervosa -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Costularia_pantopoda --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCC--GCGG-GGA----TGGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTAATAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTTGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGTGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAA--TTGACGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGGTTTCTCTTGAATG--ACGTGTCGTGTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTA---------------------------------------------AACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGCTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA-------------CT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC----------AAAAAAAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------TTTAAACTTGAGTTATGAGT--ATAAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTTTGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATT----------------------------------------------------------------------------G-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATTA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTT------------------------------------------------- Costularia_pantopoda_var._baronii ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCT-GCGTGCTC-CTTTT--GCC--GCGG-GGA----TGGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTAATAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGTGTGCGGGGATGTGTTCCAAGTGCATTTGTGAGATG-TTTTTAC----------GATT----CAATGTG-CAA--TTGACGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGGTTTCTCTTGAATG--ACGTGTCGTGTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTAGTC------------------------------------------------------------------------------ATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA--TCCACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC---------------AAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTTATGAGT--ATAAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTT----------------------------------------CT-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACT---------------------------------- Costularia_sp_Lar0153 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTGCGGCCAACTG-TC-ATGGGGC-AGTC-TTTTCACTTTTTTCCTTCT-GCGTGCTC-CTTTT--GCC--GCGG-GGA----TGGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTAATAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGTGTGCGGGGATGTGTTCCAAGTGCATTTGTGAGATG-TTTTTAC----------GATT----CAATGTG-CAA--TTGACGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGGTTTCTCTTGAATG--ACGTGTCGTGTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTA---------------------------------------------------------ATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA--TCCACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC---------------AAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTTATGAGT--ATAAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTTT---------------------------------------------------AAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAT--------------------------------------------------- Costularia_sp_Lar0219 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT--GCC--GCGG-GGA----TGGTTGCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCTGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTATTAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TGTGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTTGAGGG-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGCGGGGACGTGTTCCAAGTGCATTTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAA--TTGACGATTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGG-TTCTCTTGAATG--ACGTGTCGTCTCTTGCTT--AGGATGGGCTACCTGGTTGATCCTGCCAGTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCCACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGTATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC----------------AAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATGAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTTT--------------------------------------ACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATCAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATT-------------------------------------------------- Costularia_sp_Lar0249 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTGCGGCCAACTG-TC-ATGGGGC-AGTC-TTTTCACTTTTTTCTTTTT-GCGTGCTC-CTTTT--GCC--GCGG-GGA----TGGTTCCGTC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCTGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCGTATTAT-TGGGTGAGAT----CTT-GCGTTG-CAGT--GGTGGATT----GTTCC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAC---TGGATCA-TTG-CCCC--ACGCCTT----------------------------C------------TGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGGGGGGACGTGTTCCAAGTGCATATGTGAGATG-TCTTTCT----------GATT----CAATGTG-CAA--TTGATGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGG-TTCTCTCTAATG--ACGTGTCGTCTCTTGCTT--A------------------------------------------------------------------------------------------------------------------------------------------------------CCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATGAAAAGAGCCATATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA-ATCCACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTTAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC--------------AAAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------CTTAAACTTGAGTCATGAGT--ATGAATGAGA--------TTTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTT-------------------------------------------------------------------------------------------------------------AGTCATTT-------AAATAATAAATTTAAAAAT---GAGAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTT------------------------------------------------- Cyathochaeta_avenacea -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGCGTGGCCAGCCG-CC-GTGGAGC-TGTC-TTTTCACTTTTGCG-CCCG-TTGTGCAT-ATCTT--GCCC-GGGCAGGG----CAATTGTTTT-CGGCTGTTTGTGCGGATCTACCCTTGCG--GGGA-ACATC---GTT-GTGTGCGTGA-TGGTT---TT---GC-TTGCGCCGTCGATA---CTTGTTAT-CGTCG-GCGC-AGCCGTTGTGTCCGGCGGGTTA----CTT-GCGCGG-CATG--CGGCGAAT----GGCCCC-GTGCC--GCGCATGTATTG--CGCCGG-GCTCTCATGGATG-CCGTG--TTTTGTTTGAGGT-------CTCCG-CGGGCCGTTGGCT-CCTCGGTTTTCCTCG--GG-TTGTCC---CATGTGC----GTGCCG-TTT-CTCC--GTCGCTA----------------------------TGCTCTG-CCG-TCGCGTA----------TGTCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATCGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTACGGCCGTCCTCTATTGGGATGTACCATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATTGTAATGCATGATTACTTAACCGGAGGATTCACCGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCATATCCACCGTGCAATGCACGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCGGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTCGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACA-------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTAGCTCGACATAATTTGTTCTGTCTAGGTTGTGAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG-----AAAAAAGGCTTGATTT------------TTTTT---------ATA-----AAG---------CAAGGGGAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGATCAACTTTGTAAGTATATTCGTAGCATC--------GAAATCAAAAATAAAACATTCAATTCGAATTGAACAAGTTAAAATTGAACAAGTTAAAAAAAACATAAA------GTGAATTTATTGG----AAACTGGTAAA--AAAAC-----------TATTTTGATCAT------AAGGTGTAACGGGAATGAATCCTTCATATTTTATT----------------------CAGAAATTCATAAATAAA------TAAGGAAGT-----AAAAAAGGTATGTTGCTTGCCTTTTGA-GGATAAAAAGG-ATCCCC--------GAAGTAATGTATAAACCCAACGATTCCAAAAAG-----AAAATA-AAAA-GCATTCCGAAACAAGAAAACACTAT--TTCCAA----TTGTCTTAAC-----AATG----TGAT---TGGAT-------------------------CATAATGAC--------G---AATCAAAATACATTTA----CATTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGCATTT----TCCTTTGAACTTTC-----TACAAATT-----------ATTTAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTCTCTGT-AAGGGGGA---------------AAGGATTCAATTT-GAATTAGAGTCTAATTCATTATTTTATTAGAGTCTAATT-CATTATT-----TTATGAGATGAGTCCATTTTAC-------ATT-------------CTATA---------------GAAGAGTTTGAATTA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGAGCATTTT------------------------------------------------------------ATATTCGTATTTATG-----TACGA-GTA---------------TCTATATCAATT-------AAAT-------------------------------------------AAAGGAATTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATAAA-ATAGTCAATGT-------------------------------------------ATGGTATGAA-TTGGGAATGA-------TTTCATT-AAAGA----------------------------AA----------------------------------ATATG-----------GAAGAA-GTAT-------------------TTA-GGAAATCAAACGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCATTTTACTAT-AAATTTCATTCTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATT--------------------------------------------------------------------------------------------------AT-ATTAAA------------------------TTACTTTTCTTATTGAATTTC---------------------------------------------------------------------------------------------------------------------------------------AAGAATATGGATAATATTAATTTGATCGTGA-T---TATCATTT-ATCATTTGATTAATTAGT----ATATAT----ACGTATGCT-----------------------CT-----TGGTATA-TA-------------------CGTCTATCT-TTTCTCT-TA------TTTC--------GAT-AGATA-----AAT-TCCA------------AATGCAAC----GTAATCAACTGTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTACCCATTTTTAATTCC----------------------------------------------------------------- Cyathochaeta_diandra -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTTCGGCGTGGCCAGCCG-CC-GTGAGGC-TGTC-TTTTCACTTTTGCT-CCCG-T{AT}GTGCAT-ATCTT--GCCC-GGGCAGGG----CATTTGTTTT-CGGTTGTTTGTGTGGGTCTACCCTTGCGG-GGGA-ACATC---GTT-GCGTGTGTGA-TGGTT---TTT--GC-TTGCACCGTCGATA-----CGTTAT-CGTCG-GTGC-AGCCGTTGT{AG}TCCGGCGGGTTA----CTT-GCGCGG-CATT--TGGTCATT---TGGCCCC-GTGCC--GCGCATGTATTG--CGCCGG-GCTCTCATGGATG-CGGTG--TTTTGTTTGAGGT-------CTCCG-TGGGCCGTTGGTT-CCTCGGTTTTCCTCG--GG-TTGTCC---CATGTGC----GTGCCG-TTT-CTCC--GTCGCTA----------------------------TGCTCTG-CCG-CCGCGTA----------AGTCGGAGCAG-TGCGTGCGGGG-CGCGGTC-TTGTGCA--TGCGAGATG-CTTATCC----------GTTC----GATTGAG-CGA--TTGCCGGCTC---ACGCCGCGTAAGCGG-GGTCCCAACTA-------------------GATTGGGGCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTCAGGCGGATC----------ACCTGAA-----ATATTCGTATTTATG-----TACGA-GTA---------------TCTATATCAATT-------AAAT-------------------------------------------AAAGGAATTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATAAA-ATAGTCAATGT-------------------------------------------ATGGTATGAA-TTGGTAATGA-------TTTCATT-AAAGA----------------------------AA----------------------------------ATATG-----------GAAGAA-ATAT-------------------TTA-GGAAATCAAACGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCATTTTACTATAAAATTTCATTCTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATT--------------------------------------------------------------------------------------------------AT-ATTAAA------------------------TTACTTATCTTATTGAATTTC---------------------------------------------------------------------------------------------------------------------------------------AAGAATATGGATAATATTAATTTGATCGTGA-T---TATCATTT-ATCATTTGATTAATCAGT----ATATAT----ACGTATGCT-----------------------CT-----TGGTATA-TA-------------------CGTCTATCT-TTTCTCT-TA------TTTC--------GAT-AGATA-----GAT-TCCA------------AATGCAAC----GTAATCAACTGTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTACCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Cyathocoma_hexandra ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGTGCTC-CTTTT--GC---GCGGGTGG----TGGTTGCGGC-TGGTTGTCTGTTTGGTTCTATCCCCATGG-GGAA-C-TAATTTGTG-GGCTTCGGGA-CGGTG---TTT--GC-TTGCCCTGTGGATA---CATGCTAT-CCTGG-GCGC-AGCCGTTTTAT-TACGTGAGGA----CTT-GTGTCG-CGGT--GGTGGATT----GCACC-TATGCT--TCACTTGTATTT--C-ACCG-TGTCTCATGGATG-CCGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTCGTGCAT---TGGATCA-TTGCCCCC--ACGCATT----------------------------CTGTGTC-TCG-ATGTGGATGTTGGGC--TGTCGGTGTGC-TGCGTGAGGGGACGTGTTCCAAGTGCACATGTGAGATG-TTTTGCC----------GATT----CAGTGTG-CAA--TTGTCGGTCC---GCGCCATGCGAGTGG-TGTCCCCATTCCC-----------------ATTTGGGG-TGCTCTCTAATG--ACGTGCCGTCTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCC------------------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGAAGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGACTTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAAAATCTAAGGTTAGTGAAAATTAA----------TAT---------------------------AATG--------AATTTAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATCCGA-----ACAACTTTC------------------AAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATTTTTCATTTTTTCTT-------------TATTAA---------------AGAAAA------GAAGTAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTTAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCCAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATGAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTTATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAAATTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTGAA-AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTACATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATAAGGATTCTT------------ATATGGATTTTTTTGCGAAAAA-ATAC-------------------TTATGGGATTCAAATGG---------------------------------------AGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-AGAATTCAGA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTT-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTT--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Cyperus_rigidifolius ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAACCTGTTGCTGGAGAAGAAAATCAATATATTGCCTATATAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCACGGTATCCAAGCTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCATCAACCTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTAGGAGTTCCTATCATCATGCATGACTACATAACTGGGGGATTCACTGCAAATACTAGTTTGTCTTTTTATTGCCGTGATAATGGTCTACTTCTGCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATTCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGTGAGCGTGAGATGACTTTAGGTTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGATCGTAGCCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATTTTGCTCGTGAAGGTAATGAAATTATTCGCGCAGCAGCTAAATGGAGTCCAGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGACTTCGATCCGGTAGATAAACTAGAT---------------------CATCCACCATTTTCT--TTCTAT-AGTAAT-GAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCCG----------------TAAACAGTA-CAT----------GATGGAGCTCGAA------------GTTTGATT-------------TTTTT---------ATC-----AAA---------CAAGGGAAAGAATCTAGGGTTAGTGATAATTCAATT-------AAT------------------------TCTAATT--------AATTTAGACCAATTTTGTAAGTATA-TCTTAGTATC--------AGAATCAGAAA---AAAATACAATTCGA-----ACAAG-------------------AAAAAAAAATAT---AAAGTGAAATTCTTGG----AAACTGGTAAA-----AC-----------TATTCTGATTTT------AAGGTGGAACGGGAATGAATCCTTCGTATTTATTT-------------TATAAA---------------------------GAAGGAAAT--CAAAAAGAAGGGGTGTTGCTTTCCCTTTGA-AAGGAATAAAG-GTCTTC--------AAAATAATTTCTAAACCTAAAGATTCCAAAAAG-----AAAAAA-GAAA-GGATTCCGGAACAAGAAAATACTTT--TTTAAA----TTATCTCAAC-----AGTGTA----AT---TCGAT-------------------------CAAATTGAC--------A---AATCTAAA------AA----GGTTAGAGATAAAACAAACAAAAGAGTTTAGAGATAGCTCAAG-------AAATTCTT--TCA----TAAGGATTT--------ATGAACTTTC-----TAAAAATTTTTT-------ATTTAACTTGAGTCATGAGT--AAAAAAAATATTATGATA-TTTTTTTATAT-AACGAAAAG----------AAAAAAGGACTCTATTT-GAATC-----------------------ATAGTATAATT-CATGATT-----TTATGAG-----TCCATTTTGC-------ATT-------------CTATA---------------CAGAAATTTGAATTA-TTTTTCTTGAGCCGTATGAGAT-GAAAATTTCATATACGTTTCTAGGG-AGACTTTTTTT----CTGAGCTATCCCGGGC-----------------------------------------------------------------TA---------------TCCTCAATGTTT------------------------------------------------------------------------AAAA-----------------TATTTAT-----ATTAATTGG-TAA-------------------------------------------TATTAATATTAATAATAA-TTGGTAATTA-------TTTCAAT-ATAGA----------------------------GATTCTT------------TGCCTA---------TGCT-TAGATTCTTT---GAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCACTGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTGAAATGGGACTCTCTCTTTATTCTTC-------TTGGATTTATCATC---------------ATTTTTTC------TTCATAATAAAAAACTCTAT-------------------ATATAAT---TAATAATATATTCAATTTATTACTCA------------AA-ATTGAG-------------------------TTTTTTTTTCATTGAACTTCAT---------------AT--TCGAATCAA-TTCACCAT-AAAGGATTCATT-------------ATTTTT-TGAATTCATC--------AAAATTTA-----GGAATTTGCTATTCCATAATCAATAGCAATTTAA-AATAT----------TATTTGATTGTTA-T---TATGATTA-ATCATTTGATTAATCAGT----ATAT------ACGTACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTTT-TATTTCG-TCTC--------GAG-AGAGA-----AAT-TCT---------AG-CAATGCAAC----ATAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTATAGATTTGGCTCAGGATTGCCCTTTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGA-TCCATACCAAGGCTCA-TCCAA--- Diplacrum ----------------------------------------------------------------------------------------------------------ATTGTCG---TCGGCCC-GTGA-AAACACTGACCCGTGAACGTGTG-ACC---GAATGCTTGCC--GGCGCGGTCATGCCG-TGCCGGCCC--CCCAG-CACCGTGGG-CT--------------CAACATTGAGTCCG-CG-TGCTG-------AATACGGCATGGGATTG--TG-CCAAGGTACACTGGA--TGCGGAGGTCGGGGCGACGGCACGAGCA-GCG-TGCGGCTGC-CGGCCAATGCG--------TAGGAA------CACG-AGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGGCCAACCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--TGC----TCCCGACGCGGATCTTGGCCCTCCGCGCC--ACAGGGTG-CGGCAGGCTG-AAGT-GCGCCTCTGTCCGAC--GGTGC-------GGGGAGCGGCGAGTGGTGGGT--CT-CTTCGCACACC-GCCCCTTG--CCGC-CGTCGGT------ATATGTTT-GACCCCA-AGACG-AGGGGCTTGCTGCCGCGGCCACAG-TGCTGCGAGGCGACCCCGGACCGATA-CCCCAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAACTAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGTGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACGAGCCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGCTGGAGAAGACAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTTAAAGCCCTACGTGCTCTACGCTTGGAAGATTTGCGAATTCCACCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTAGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTATTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGCTCCAATTATCATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACCGAAATCTTTGGAGATGATTCCGTACTCCAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGGAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTCAATCCGGTAGATAAACTAGTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Epischoenus_cernuus -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGCACGGCTAACCG-TC-ATGGTGC-TGTC-TTTTCACTGTGCCT-CCCG-TTGTGCCC-GCGCG--GCCC-GGTAGGAA----TGTTTGTTTTTCGGTCGTCTGTGTGGTTCTACCCTAGTGA-GGTA-TGACA---TTC-GGTTCCATGA-CGGAT---ATTT-GC-TTGCCCCGTTGATG---TTTGTTAT-CATCG-GTGC-AGCCGAGTTGC-GGGCTTAATT----CAT-GTGCTG-CAGT--GGGCGAGG----GCCTCG-GCACT--GCACTTGGATTT--C-GCCA-GCTCTCTCGGATG-CCGTG----CCCTTCGAGGA-------ACTCG-TGGGCCTCCTGT--CCACTGATTCCCACG--GG-AAGTCC---CTTGCAT---TGGATCA-TTG-CTCC--GCCGCTG----------------------------TGCTATC-TTGTTTGCGGGTGTTGGGA--TGTCGGCGTGG-TGCGTGGGGGG-CGTGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GATC----TAATGAG-CGA--TTGTCGCGCG---ACGTTCCTC-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTCT--AAAACGTGCTACCTGGTTGATCCTGCCAGTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCCTACGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAGCCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTTCAAATACGAGTTTGGCTTTTTATTGTCGTGACAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGATATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCATGTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGGCGAAATAGA--------CATCCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG--AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAA---------CAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATAAAAAAGAGAACATCCAATTCGC-----ACAAGTTTC-------------AAAAAAAAGAAAAGATTAAAGTGAAATTGATGA--AAAAACTCTTTTT-----AT-----------CTTTTTGATTAT------AAGGTGTAACGGGAGTGAATCCTTCCTATTTTATT-------------TAGAAA---------------------------GAAGGAAATAGC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAAGAATAAAA-GTCCCC--------GAAGTGATGTGTAAACCCAAAGATTTAAAAAAG-----ACGATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----ATGTCTCAAC-----AATATATGTCAT---TGGAT-------------------------CATAATGAT--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGGATTT----TCTTTTGAACTTTC-----TAAAAATT-----------ATTAAACTTGAGTCATGAGT--ATTAATGATA----GATAT-TTTTTTCTGT--AAGGGGAC----------GAAAAAGGATTCAATT---------------------------------------------------------------------------------------------------CAAAA-CA------------AAAAAAATTGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGAGGCATTTTTTT-----------------CC--GTTTCTTGTGAATCACA-----AGAGTAGAATAATG-TACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATATA----------------------------GATTCTT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAAGAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC-ATC--------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTTATTACTCA------------AT-ATTGAG------------------------TT-ATTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCACCATTAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCTACCATAC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA 'Epischoenus gracilis (Verboom 636)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGT-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-TAGCA--GCC--GGGATGAA----TGCCTGAAAT-ATGTTGCCTGTGCGGTTGTACCCTCGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GCTTTGTGTTGTTGCTA---GCTTCTAT-CAACA-GCGC-AGCCGATTTGA-TGGCATAGTA----CAT-GTGCGG-TTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACGTGTTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-ATGTCC---CTTTTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGGTCTCGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAAGT----GAATGAG-CGA--TTGTCGTATG---TCGTCGTGTGAAA-GTACACCC--CCGTCTTAGTCTTGTTACCGAGATATGGGGTGTGCCGGAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGG{AT}TGATCCTGCCAG----------------------------GCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAAGTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG--AAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATC-AAAAAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAACGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G-AAAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TAAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTAAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGATA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTTAAA-----AAAG-----------------AATTTATTCAA-AA------------------------------------------------------TAG-GATAATGTTATGGA-TTGATAATGA-------TTTCATT-TTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTATAATGAATGAATGATTCTATAATGAAT---------------CATTTTATTACTTA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATTC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTATTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Epischoenus_villosus -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CA-TTGTGCTC-TAGAA--GCC--GGGATGAA----TGCCTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTTGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACA-GCGC-AGCCGGTTTGA-TGGCATAGTA----CAT-GTGCGG-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACGTGTTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTACG--GG-ATGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGGTCTCGTCT-TGACTAATGTCAGGA--TGTTTGAGTGG-TGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAATT----GAATGAG-CGA--TTGTCGTATG---TCGTCGTGTGAAA-GTACACCC--CCGTCTTAGTCTTGTTACCGAGATGTGGGGTGTGCCGGAAAATG-GCGCGTCGGCTCTCGTTT--AAAACGTGCTACCTGGTTGATCCTGCCAGTAGTCA-------------------------------------------------------ACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAAGTCCTCAACCCGGAGTTCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGATAAGTAAGGCGAAATAAA----------CCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATATAATTAATTTAGAATAATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATCAAAAAAAAAAAATCAAAAATAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAACGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACGCTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G-AAAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTA-----TAAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTAAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGATA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATT----------------------------------TGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----AAAG-----------------AATTTATTCAA-AA------------------------------------------------------TAG-GATAATGTTATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTTA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTATTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGA--------------------------------------------- Eriophorum_vaginatum --------------------------------------------------------------------------------------------------------------TCG---TTGCCTTTGGAA-AAACAC-GACCGGCGCACACGTG-ACA---GAATGCT-GCT--GGGGAGGTGCTGCCT-CCTTGGCCCC-ACCGC-CCACAGCCC-TCTTGCCCTAC-----GGGCGCGTTGGTCG-TGG-GTCGG------AATACGGCGCGGGATGACGCG-CCAAGGAACACGAGA-ATGCTGAGGC---ACCGGTCGGCCGCTCAAGGG-GGGCGCCGG-CTGCCAAAGGCAAATAATTGAAAAA------AAAA-ATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGC--TGC----CCCCGATGCGGACATTGGCCCTCCGAACC--GCGAGGCG-CGGTGGGTCT-AAGT-GTGCGGCCGTCGTAT--GTGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCACGCC-ACCCCGAG-CCCCA-TGCCGAC------CTTTGTTT-GACCCCC-TAACG-AGGAGCATGCCGCCGCGGCTTCAC--GCCGTGCGGCATCTTCGGACC-----------------------------------------------------CTGCGCTTTTGCGCGGCCAACCG-AC-ATGGGGC-TGTC-TCTTCACTCTCCCG-ACCG-TCAGCAAATTTGCTT------GGTTGGGA----TGCTT-GTCATCGGTTGCCTGTGTGGTTCTACCCTTTTGTGGGTA-GCGAAGTCGT----CCC-TTGA-TGGAT---ATTT-GC-TTGCCCGGCTGACA--TTGTTTTGT-CGCTT-GGGT-AGCCGAAATGT-CGGTGGAATC----CTT-GTTGTT-GTGT--GGGCGAAT----GCCTT-GTTACAG-TCACTTGGATTT--TTGCCG-GCTCTCACGGATG-TTGTG---CCCCATCGTTAG-------CTCTG-CGGGCCTCTGT-C-CCACAGA---CTTCG--GG-AGGTCC---CTTGCAT----GGATCA-TTG-CTCT--TGC-------------------------------------------------------------------------------GAGGAGCGTGCTG-ACGTGCA--TGTGGAACG-CCTCTCC----------GATC-GTATGAGCAG-CGA--TTGTCGGTTT---GCGTCAAGAGAAGGG-CCTCCCG-----------------------TCCGGGTTGGTGCTGGAAATG--ATGTGCCGACTATCGTTT--AAGACGTGC--------------------------TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGCTCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATCCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------CATCCATCGTTTTCT--TTCTAT-AGTAAT-GAAAATGCTTTTGGCTCGACATAATTTGTTCTGTCTAGGTTGTCCG----------------TAAACAGTA-CAT----------GATGAAGCTCGAA------------GTTTGATT-------------TTTTGATTTGTTCTATC-----AAA---------CAAGGGAAAGAATCCAGGGTTAGTGAGAATTCACTT--ATTT-AAT------------------------TCTAATT--------AATTGAAATAAACTTTGTAAGTATATTCTTAACATC--------GAGATCAAAAA----AAATCCAATTCAA-----ACAAG-----------------AAAAAAAAAGAGAG---AAAGTGAAATTGTTGA----AAACTGGTAAA-----AC-----------TCTTTTGATTAT--------------ATGGAAATGAATCCTTCGTATTTTATT-------------TATAAATA-------------------------TAAGGAAAT--CAGAAAGAAGGGGTGTTGCTTTCCCTTTGA-CAGGAATAAAG-ATCTCC--------AAAGTAATGTATAAACCTAAAGATTCCAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAATACTTTG-TTGAAA----TTATCTCAAC-----AATGTA----AT---TGGAT-------------------------CATTTTAAT--------G---AATCTAAA------TATCTTTCTTAGAGATAAGACAAACAAAAGAGTTTATAGACAGCTCAAG-------AAATTTCT--TCA----TAAGGATTT----CCCTTTGAACTTTC-----TAAAAATT-----------ATTTAACTTGAGTCATGAGT--CAAAATGATATTTTTTTCTATTTTTTCTAT-AACGAAAAG----------GAAAAAGGACTTTATTT-GAATC-----------------------ATCGTCTAATT-TATGATT-----TTTTTAG-----CCCATTTTCC-------ATT-------------CTATA---------------CATAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGT-GAAAATTTCATATACGTTTCTAGGG-AGGCTTTTTT-----CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----CGAGTAGAA------TACTCGTACCTATG-----CCCTT-GTA---------------TCTACGTCAATT-------AAAT-------------------------------------------ACAGGAGCTCAAATAAAATAAA-----------------AATTTATTCAA-AAA-TTTGA-ATAATCAATGT-----------------------------------TTAAGATAATGATA-TGA-TTGGTAATGA-------TTTCATC-ATAGA-----------------------ATAATGATTCTA------------TGCATA---------TGCT-TAGAATCTTT---GAAGAA-ATAT-------------------TTC-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTTATCATC---------------ATTTTTTC---------AATCTAACAAATTCTAT-------------------AATGAAG-AAAATAAATAGAATAAATTGATTACTAA------------AA-ATTGAG-------------------------TTTTTTTCTCATTAAACTTTAT---------------AT--TTGAATCAA-TTTACCAT-AAATAATTCATA-------------ATTTAT-GGAATTCAAA--------AAAATTCC-----TGAATTTGCTATTCCATAATCATTGTCAATTTAAAAATAT----------GATTTGATTGTTA-T---TATGATCA-ATCATTTGATCATTGAGT----ATATAT----ACGTACGTC-------------------TTTTTT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AAAGA-----TAT-TTT---------AG-TAATGCAAC----ATAATCAACTTTA-----TTCGTTAGAAAAACTTCCATCGAGTCTCTGCACCTATCTTGAAAGATTTGGCTCAGGATTGCCCATTCTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Evandra_aristata CGGGCG-TTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGG-AGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA-CATTGTCG---TCCGCTT-GCGA-AAACAC-GACCGTTGCGCACGTG-ATC---GAATGCT-GCC--GGGGAGGCGCCGCCC-CCTCGGCCC--ACCGG-CCTCGGCCC-TCGCGCCCTCT----TGGGCGCGTTGGTCG-TG-TGCCG-------AA-ACGGCGCGGGTTGA--CG-CCAAGGAACACGAGA--CGCTGAGGC--GGCTGGCGGAGCGCTG-GTCG-CGCCGCACG-CCGCCGATGCA--------ACGGAA------CGCT-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCAT-GATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAA-CCCATCTACGCTCGGG--CGC----CCCCGATGCGGATCCTGGCCCCCCGAGCT--CCAGGGCG-CGGTGGGCCC-AAGT-GTGCGGCCGTCGGAT--GGGG-------CAGGGAGCGGCGAGTGGTGGGC--TG-CTGCGCACGCC--CCTCGTG-CCCCT-TACCGTC------CTTTGTCC-GACCCCC-GACCG-AGGAGACGAACGACGCAGCGTCCC--GCTGCGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTA-GCATATAAATAAGCCGCACTTTGGTGCGGCCAACCG-TT-GTGGGGC-TGTC-TTTTCACTTTTCCT-TCCG-TCGTGCTT-CTTTT--GCCG-GGGAGGAA----TGCTTGTTAT-CGG-TGTCTGTATGGTTCTACCCCCGCGG-GGAA-CAACG---TTG-CGTTTAAAGA-AGGAT---TTTT-GCTTTGCCCCGCTGATA---TTTGTTATATTTCG-GTGCAAGCTGATTTGT-TGGCTGGGTGAGAACTT-GTGTGG-AAGT--GGGCTCAT----GCCCT-GCGGCC--GCACTTGGATTT--T-GCCG-GCTCTCACGGATG-CCGTG----CCCAACGAGGA-------TTCTG-CGGGCATCTTGTC-CCCTG-ATTTCCTCG--GG-AGTTCC---CATGTATC-CTGGGTCA-TTC-CTCC--GCCGCTC----------------------------AGCTATC-GTG-TTGCCGTTGTTGGGA--TGTTGGAGCGG-TGCGTGCGGGG-CGTGCTC-CGGTGCG--TGCGAGATG-TCTATCCT---------GATT----GAACGAG-CGA--CTGTCGGTTT---CCGTCGCGTGAATGG-ACT---------------------------------------------------------------------------------------------------------TAAAGCAAGTGTTGGATTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGACAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTCTCTTATTCTGTGCCGGAGCTCTTTATAAAGCACAGGCCGAAACTGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCATGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTTTTGTGGATCATC-----TGAGTAGAA------TACTCGTATCTAG-TAATGTACTT-GTA---------------CCTATGTCAATTGTCAATTAAAT-------------------------------------------AAAAGAATTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTGGTAATTA-------TTTCATT-ATAGA----------------------------AT-----------------------------------AATGTATTATTTTGCGAAGAA-ATAC-------------------TTA-GGAAATCCAATGGGTTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCG-TATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTT----CAAAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAAGAATGATTTGATTACTCAATATCAATTCTTTTCTCATTAAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTCAGG-------------ATTTTT-TGAATTCATA--------AATATTTC-----TGAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AATTTGATCGTGA-T---TATGATGA-ATCATTCGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------CAGCTACCC-TTTCCCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAA-----ATAATTAACTCTA-----TTTGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTCAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Ficinia_paradoxa --------------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---CTAACCTTG-----AACAC-GACCG-TGAACATGTA-ACA---TAATGCT-ACC--GGGGA-GTACCATCT-CCTCGGCCCT-GCCGG-CCC-----------------------CGGCCTATTGGTCG--GGTGTCGG------AATACGGCGCGGGATGT--CG-CCAAGGAACACTGAA-TTGCTGAGGC--GGACGACAATACGCTC--GTA-----------CTGCTGATGCC--------AACTT-------AACA-TTATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCAACACTCAGT--CGC----CCCTGATGTGGACAATGGACCTCCGAGTCAGTAATGGCA-CGGTGGGCTG-AAGT-TAATGGTCGTCGGAT--GGTAA-------CGGGATCGGCGAGTGGTGGGC-TAA-CTGCGCAAGCCAATCCCGGC-TGCCA-TGTCGAC------CCTCTTTT-GAACCCC-AAATG-AGGAGATTGTCGTCGCAGCATCTA--GTTGTGCGGCAATTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCCACCCGCTGAGTTTAAGCATATCA-----CTGCACTTCTGTGCGGCCAACTG-TC-ATGGGGC-TGTC-TTTTCGTTGT-CCA-TTTG-CCTAGTAATTTGCTA------GTTATGGA----TGATT-GTCATCGGTCGCTTGTATGGTTCTACTCTTTTG--GGTA-GTGCATAATT--GTTTTGTTGA-TGCCT---ATTTAGC-CTGTTCTGTTAATG--TTAT--TGT-TGACA-GGAC-GGTCGAGATGT-CAGTGAATTT----CAA-GTGTTT-CCAT---GTGCCTA----GCCAT-GGTAAT--GCACTTGGATGT--TCGCTG-GGTCTCATGGATG-CGGTC----CCTATTGTGAG-------CTCTG-CGGGCTTCATG-C-CCGTAGAA--CCTG---TG-AGGTTG-CCCCTGCAT----AGATCA-TTG-CTCT-------------------------------------------A-TTG------------------CTTCACTGACACATCTTGTTTGGGTGTTGTT-CTTTGCT--TGCGGCATG-CCTCTTA----------GACCCGAATGACTTG-CGA--TTGCTGGTTT---GCGTTGTCACAAGGCTCCTCCCA-----------------------ATTGGGTAGTGGCTGGAGATG--ACGTTCCTGCTCTCGTTT--AAGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA--------------------------------------------------------CTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTGCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGACTTACTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTGATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------------------TCT--TTCTAT-AGTAATGGAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCCG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG------------GTTTGATT-------------TTTGT---------ATC-----AAA---------TAAGGGAAAGAATCTAGGGTTAGTGAGAATTAAATT-------AAT------------------------TCTAATT--------AATTTAGACCAATTTTGCAAGTATATTCTTAGTATC--------AAAATCATAAA---AAAATCCAATTTGA-----ACAAG--------------------AAAAAAAATAG---AAAGTGAAATTGTTGG----A------TAAA-----AC-----------TATTCTGATTTT------AAGGTGGAAGGGGAATGAATCCTTCGTATTTATTT-------------TATAAA---------------------------GAAGGAAAT--CACAAAGAAGGGGTGTTGCTTTCCCTTTGA-AAGGAATAAAG-GTCTCC--------AAAATAATTTCTAAACCTAAAGATTCCAAAAAG-----AAAAAA-GAAA-GGATTCCGGAACAAGAAAATACTTT--TTTTAA----ATATCTTAAC-----ACTGTA----AT---TGGAT-------------------------CAAATTGAA--------A---AATCTAAA------AA----GGTTAGAGATAAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AAATTGTT--TCA----TAAGGATTTATTTTCCTTC-AACTTTC-----TAAAAATTTTTT-------ATTTAACTTGAGTCATGAGTAAAAAAAAAATATTATGATA-TTTTTTTATAT-AACGAAGAA----------GAAAAAGGACTCTATTT-GAATT-----------------------ATAGTATAATT-CATGATT-----TTCTAAG-----TTCATTTTAT-------ATT-------------CTATA---------------CAGAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGT-GAAAATCTCATATACGTTTCTAGGG--GGCTTTTTT------CCGGCTATCTCCACCAAATTTCTTGTAAATCACC-----TGAGTAGAA------TACTTGTACCTATA-----CCCTT-GTA---------------TCTACGTCAATT-------AAAA-------------------------------------------AATTGAGCCCAAC-----AAAA-----------------AATTTATTCAA-AAAAATAAA-ATAGTAAATG------------------------------------TTAAAATATTGATATTAA-TTGGTAATTA-------TTTCAAT-ATAGA-------GATTCTTTATTGAAAGAAAGAGATTCTT------------TGCCTA---------TGCT-TAGATTCTTTTCAGAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTGGATTTATCATC---------------ATTTTTTC---------AATATAAAAAACTCTAT-------------------ATTGAAT-----ATAATATATTCAATTTATTACTCA------------AA-TTTGAA------------------------TTTTTTTTTTCATTGAACTTCAT---------------AT--TCGAATCAA-TTTACCAT-AAAGGATTCTTT-------------ATTTTT-TGAATTCATT--------AAAATTTA-----TGAATTCACTATTCCATAATCAATAGTAATTGAAAAATAT----------TATATGATTGTTA-T---TATGATTA-ATCATTTTATTAATCAGT----ATGT------ACATACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTAT-TA------TCTC--------GAG-AGAGA-----AAT-TCT---------AG-CAATGCAAC----ATAATAAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAATGATTTGGCTCAGGATTGCCCTTTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Gahnia_aspera -----------------------------------------------------------------------------------------------GCGGAAGGATCATTGTCG---TTTGCTT-GCGA--AACAC-GACCGTTGCACGCGTG-ATC---GAATGCT-GCC--GGGGG-GCGACGCCC-CCCCGGCTC--ACCGG-CCTCGGCCC-TCACGCCCTCC-----GGGCGCGTTCGTCG-TG-TGCCG-------AATACGGCGCGGGTTGA--CG-CCAAGGAACACGAGA-TTGCTGAGGC--GGCATGCCGGGCGCCGAGGCG-TGCGGCCTGCCCGCCGATGCA--------GAGGAA------CACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTACCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCGTCCACGCTCGGG--CGC----CCTCGATGCGGATCCTGGCCCTCCGAGCC--CGAGGGCG-CGGTGGGCCC-AAGC-GCGCGGCCGTCGGAT-GGGGGT-------CTGGAGCGGCGAGTGGTGGGC--TG-CTGCGCACGTC-GCTCCGCG-CCCCT-TGCCGGC------CTTTGTTTCGACCCCT-GGACG-AGGAGCCGGGTGACGCAGCGCCAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----AGACCAGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTGTGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCGT------------TGCTT------------ATATGTATTATTTC--GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCT--GGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTCTATCC-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATA------------------- Gahnia_baniensis ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGCTGCGGCGTGGCCAGGCG-TC-ATGGACT-TGTC-TTTTCACTTATTCT-CCTG-TCGTGCTT-ATTTT--GCCGAGTTCGGAG----CGCTTGTTAT-CGGCTGTCTGTGCGGATCTACCCTCGTGG-GCAT-CAATG---TCT-TGTTTCGTGA-TGGGT---TTT--GC-TTGCCCCGCCGATA---CTCGCTAT-CGTCG-GTGC-AGCTGATGTGTCTGGCTTATTC----ATT-GTGCGG-TGGT--GGGCAAAC----GCCCTT-GTGCC--GCACTTGGTTTA--TGCCGG-GCTCTCATGGATG-CGGTG--CCCCATTTGAGGT-------GTATG-TGGGCCGTTGGTT-CCTCTGACTTCCTCG--GG-AGGTCC---CATGTGC----GGATCG-TGG-CTCT--GTCGCTC----------------------------TGCTCTC-TCG-TTGCGGAT---------TGCTGGAGCAG-CGCGTGCGGGG-TGCGATC-TTGTGCA--TGCGAGATG-TTTGTCC----------GTTT----GTATGAT-CGA--TTGCTGGCTC---ACGTCGTCGCAGCGG-GCTCCC------------------------GTTTGGGGCGCGCCGGA-GCG--ATGCGTCGGCTCTCGTTT--AAGATGTGCTACCTGGTTGATCCTGCCAGTA------------------------------------------------------------CTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATCGCTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCGCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACTAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAAGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACAGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCATATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTGCGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAATAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGGGAAGGTAATGAGATTATTAAAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAACCGGTAGATAAACTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTAGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG--AAAAAAAAAGGCTTTATTTTTT-ATAAAGCATTTTT---------ATA-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATTAGTAGCATC--------GAAATCAAAAATAAAACATCCAATTCGAATCGAACAAGT-----------------AAAAAAAGATAAA------GTGAAATTGTTGG----AAACTCGTAAAATAAAAC-----------CATTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCGTATTTTATT----------------------C------------ATAAA------GAAGGAAAT-----AAAAAAGGTATGTTGCTTTCCTTTTGA-GAAAAAAAAGA-ATCCCC--------GAAGGAATGTATAAACCCAACGATTCCAAAAAG-----AAAATA-AAAA-GGATTCTGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATG-----------------------------------------CATAATGAC--------G---AATAAAAA------TA----CATTAGATATGAGACAAACAAAGGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGCATTT----TCCTTTGAACTTTT-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGAGA-----------TTTTTCTGT-AAGGGGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTTTAATT-CATGATT-----TTATGAGATGAGTCCATTTTAC-------ATT-------------CTATA---------------CAAGAATTTAAATCA-TTTTTCTTGAGCCGTATGAGGG-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----AGACCAGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTGTGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTATTTC--GAAAAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTCTATCC-TTTCTCT-TA------TTTT--------G------GA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Gahnia_trifida ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGCTTCGGCGTGGCCAGGCG-TC-GTGGACT-TGTC-TTTTCACTTATCCT-CCTG-TCGTGCTT-ATTAA--GCCGGGTTCGGAG----CGCTTGTTAT-CGGTTGTCTGTGCGGATCTACCCTCGGGG-GCAT-CAATG---TCA-TGGTTCGCGA-TGGGT---TTT--GC-TTGCCCCGCCAATA---CTTGCTAT-CGTCG-GCGC-AGCTGATGAGTCTGGCTTATTC----CTT-GTGCGG-TGGT--GGGCGAAT----GCCCCC-GCGCC--GCATTTGGTTTA--TGACGG-GCTCTCATGGATG-CGGTGCTCCCCATTTGAGGT-------GTCAG-TGGGCCGTTGGTT-CCCCTGACTTCCTCA--GG-ATGTCC---CATGTGC----GGATCG-TGG-CTCT--GCTG------------------------------------TC-TCG-TTGCGGA----------TGCTGGAGCAG-CGCGTGCGGGG-TGCGATCTTTGTGCA--TGCGAGATG-TTTGTCC----------GTTT----GAATGAG-CGA--TTGCCGGCTC---ACGTCGTGGCA-----------------------------------------------------------------------------------------------------------------------------------------------------------ACTTACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGACCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCGCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAAGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACAGCAGGTACATCTGAAGAAATGATCAAACGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCATATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAATAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGGGAAGGTAATGAGATTATTAAAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAACCGGTAGATAAACTAGATAAGTCGAAATAGA-----------------------------------AAT-GAAGATGCTCTTAGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG---AAAAAAAAGGCTTTATTTTTTTATAAAGCATTTTT---------ATA-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATTAGTAGCATC--------GAAATCAAAAATAAAACATCCAATTCGAATCGAACAAGT-----------------AAAAAAAGATAAA------GTGAAATTGTTGG----AAACTCGTAAAATAAAAC-----------CATTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCGTATTTTATT----------------------C------------ATAAA------GAAGGAAAT-----AAAAAAGGTATGTTGCTTTCCTTTTGA-GAAAAAAAAAGAATCCCC--------GAAGTAATGTATAAACCCAACGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATG-----------------------------------------CATAATGAC--------G---AATAAAAA------TA----CATTAGATATGAGACAAACAAAGGAGTTTAGAGACAGCTCAAG-------AGA----T--TCA----TAAGCATTT----TCCTTTGAACTTTT-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA-----------TTTTTCTGT-AAGGGGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTTTAATT-CATGATT-----TTATGAGATGAGTCCATTTTAC-------ATT-------------CTATA---------------CAAGAATTTAAATCA-TTTTTCTTGAGCCGTATGAGGG-GAAAATCTCATATACGTTTCTGGGG--------------------------------------------------------------GAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTGTGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTAGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTATTTCTTGAATAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAA------------------------TT-CTTCTCTCATTGAATTTC-T---------------ATA-TTGAATCAA-TTCACCA-TAAAGAATTCAGA-------------AATTTT-GGAATTTCTAA-ATATTGGATATTTCCTTTCCGAATTTGCTATTTAATATTTTAATTAAAATCATTAATATGAAGAATATTAATTTGATCGTAA-T---TATCATTT-ATCATTTGATTAATCAGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTCTATCC-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Gahnia_tristis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCGTCCACGCTCGGG--CGC----CCTCGATGCGGATCCTGGCCCTCCGAGCC--CGAGGGCG-CGGTGGGCCC-AAGC-GTGCGGCCGTCGGAT-GGGGGT-------CTGGAGCGGCGAGTGGTGGGC--TG-CTGCGCACGTC-GCCCCGCG-CCCCT-TGCCGGC------CTTTGTTTCGACCCCT-GGACG-AGGAGCCGGATGACGCAGCGCCAT--GCTGTGCGGCATCCTCGGACCGATA-CCCC--------------------------------------------CTGCGCTTCGGCGTGGCCAGGCG-TC-ATGGACT-TGTC-TTTTCACTTATCCT-CCTG-TTGTGCTT-ATTTT--GCCGGGTTCGGAG----CGCTTGTTAT-CGGCTGTCTGTGCGGATCTACCCTGGTGG-GCAT-CAATG---TCG-TGGTTCGTGA-TGGGT---TTT--GC-TTGCCCCGCCGATG---CTCGCTAT-CGTCG-GTGC-AGCTGATGCGTCTGGCTTATTA----CTT-GTGCGG-TGGT--GGGCGAAT----GCCCTC-GTGCC--GCACTTGGTTTA--TGCCGG-GCTCTCATGGATG-CGGTG--CCCCATTTGAGGT-------GTATG-TGGGCCGTCGGTT-CCTCTGACTTCCTCG--GG-AGGTCC---CATGTGC----GGATCG-TGG-CTCT--GCCGCTC----------------------------AGCTCTC-TCG-TTGCGGA----------TGTTGGAGCAG-CGCGTGCGAGG-TGCGATC-TTGTGCA--TGCGAGATG-TTTGTCC----------GTTT----GTATGAG-CGA--TTGCTGGCTC---ACGTCGTGGCAGCGG-GCTCCT------------------------GTTTGGGGCGCGCCGGA-GCG--ACGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTAGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG---AAAAAAAAGGCTTTATTTTTTTATAAAGCATTTTT---------ATA-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATTAGTAGCATC--------GAAATCAAAAATAAAACATCTAATTAAAATCGAACAAGT-----------------AAAAAAAGATAAA------GTGAAATTGTTGG----AAACTCGTAAAATAAAAC-----------CATTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCGTATTTTATT----------------------C------------ATAAA------GAAGGAAAT-----AAAAAAGGTATGTTGCTTTCCTTTTGA-GAAAAAAAAGA-ATCCCC--------GAAGTAATGTATAAACCCAACGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATG-----------------------------------------CATAATGAC--------G---AATAAAAA------TA----CATTAGATATGAGACAAACAAGGGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGCATTT----TCCTTTGAACTTTT-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA-----------TTTTTCTGT-AAGGGGGAG----------GAAAAGGGATTCAATTC-GAATT-----------------------AGAGTTTAATT-CATGATT-----TTATGAGATGAGTCCATTTTAC-------ATT-------------CCATA---------------CAAGAATTGAAATCA-TTTTTCTTGAGCCGTATGAGGG-GAAAATCTCATATACGTTTCTGGGGGGAGCATTTTTTT---CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----AGACCAGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTGTGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGAA-TTGGTAATGA-------TTTCATT-ATCGA----------------------------GATTCGT------------TGCTT------------ATATGTATTATTTC--GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTCTATCC-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCT----------------------------------------------------------------------------------------------------- Hypolytrum_nemorum --------------------------------------------------------------------------------------------------------------TCG---TTGGCCGAGCAA-AA-GAC-GATCGTCGCACACGTC-ACC---GAATGCT-GCC--GGGGCGGTGCTGTCG-CCCCGGCC---ACCGG-CCCCTGCCT-CCGCGCCCT-------GGGCGCGTCGGCAG-CG-TGCCG-------AATACGGCGCGGACTGT--CG-CCAAGGAATACACGA--TGCGGCGGC--GGCCGGCGGCGTGCTGTGCCG-CGCGGCCTG-TCGCCGATGCG--------AAGGAA------CACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTTATGGGCGTTAGAAGCCCATCCATGCTCGTG--CGC----CCCCGATGCAGATCTTGGCCCTCCGAGCC--CGCGGGCG-CGGCGGGCCC-AAGC-GTGCGGCTGTCGGAC--GGGGC-------CGGGAGCGTCGAGTGGTGGAC--TG-CTGCGCACGCC-GCCCCGTG-ACCCC-GTTCGGC------CCTCGTTT-GATCCC--GAAGG-AGGAGACGGCCGCCGCGGCGTCTG--GCCGCGCGTCGTCCTCGGACC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCATGTGTTGGATTTAAAGCCGGAGTTAAGGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTCACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTTTCGTATTCTGTGCTGAAGCAATTTATAAACCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGCACTTGTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCTGAATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTAGATTTATTACGTGATGATTATATTGAAATAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGACTCCGTACTCCAATTTGGTGGAGGAACTCTAGGACACCCTTGGGGAAATGCACCTGGAGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGGGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGTCGTATGGAAAGCAATCAAATTCGAATTCGATCCGGTAGATAAAATAGAT---------------------CATCCATCATTTTC------TAT-AGTAAT-GAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG----AAAAAAAGGATTGGTT-------------TTTTT---------ATCAAATCAAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AAGTTAGACCGACTTTGTAAATATATTTTTAGCATC--------GAAATCAAAAAGTGAAAATCCAATTCGA-----ACAAGCAAG--------TTTCAAAAAAAAGAAGGAG---ATAGTGCAATTGTTAG----AAATTGGTAAA-----AC-----------TTTTTCGATCA-------AAGGTGTAACGGGACTGAATCCTTTTTATTGTATT-------------TATAAA---------------------------GAAGGAAATAAC-AAAAAAGGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTTCAAAAAG-----AAAAGA-TAAA-AGATTCCGAAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGATAAACAAAAGAGTTTAGAGACAGCTCAAG-------AAA----T--TAA----TAAGGATTT----TCCTTTGAACTTTG-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGAT-----------TTTTTTCTGT-AAGGAAGA-----------AAACGAGGACTCAATTC-AAATC-----------------------ATAGTCTAATT-CATAATT-----TTATGAG-----TCCA-TTTGC-------ATT-------------CTATA---------------CAGAAATTCGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCT--------------------CTGAGCTA-CCCGGCC--ATTTCTTGTGCATCACCCGAGTCGAGTAAAA------TACTTGTATCTATG-----TCCTT-ATA---------------CCTATGTCAATT------------------------------------------------------AAAGGAACTCAAA-----CAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCGATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTAT----TTGCGAAGAA-ATAC-------------------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTGCAAATCGACGGATTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lagenocarpus albo-niger' --------------------------------------------------------------------------------TCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGGCTCAGGGA-AA-CGT-GACCGGTGCATATGTG-ATG---TAACATT-GCC--GGGGAGGTGCTCCTG-ACTCGGCCCACAACGG-CTCGGTCCC-TCATGCTTGTC-----GGGCGTGTCGGACG-CG-TGTCG-------AATACGGCGTCGGTTGG--CG-CCAAGGAACACGAGG--TGCGGAGGT--AGCTGGCGGAGCGTTGGTGCG-CGTCGTCAG-TTGCTGATGCG--------ACGCAA------AGTG-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAGCCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGGACTCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGTCCATGCACGCTCGGG--TGC----CACCGATGCGGACCCTGGACCTCCGAGCC--TTAGGGCG-CGGTGGGCCT-AAGT-GTTCGGCTGCCTCTA--GGA----------GGGAGCGGCGAGTGTTGGGC--TG-TTGCGCACGTC-GCCGATAA-CCCTT-GCCCTGA------TCTTGTTG-GACCCCT-GAACG-AGGAGCTCGACGTCACGGCGACCT--GTCGTGCGGCATCCTCGGACCGATA-CCCCAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCGTCTCG-TGAC-AGGAAATGCTT-TGGC-------TAAGT---GCTC-GC-ATGTTTTGCTG-----TTTGATAGA-TGGCA-GCAC-AAGTGGCTGAT-GGCGGAT-------CCT-TGCGTGGATGT--GGGATATC--------C-ATACCACTGCTCAAGGATGT--T-GCTG-GCTCCTATGGACG-CTGTG----TGCAATGAGCG-------ATCTG-TTGGCCGTTGGCC-AAGCAGTTT-GCATGAAGG-AGGTCT---CATGCGC---TAGCTCA-TTT-GGCT---------------------------------------------------------------------------------------GAGCG--------GTGCG--TGTGAGAC------TCC----------CCTGTTCGCTT-GAG-CGG--TAGCCGCTGC---ACGTCATG-TGTGGG----------------------------------------------------------ACCCAATCTTGTAT--AGGGGGT---------------------------------------------------------------------AACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTATAAAGGACGATGCTACCATATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATCCCCCCCGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGACGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTT---------------------TTTATAAATCACAGGCCGAAACGGGTGAAATCAAAGGACACTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACTGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTTCGTGTACTTGCTAAAGCATTACGTATGTCTGGTGGAGATCACATTCACGCTGGTACAGTAGTAGGTAAATTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTGCTCGCGGTATCTTTTTTACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACTGAAATCTTTGGAGATGATTCCGTCCTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAATATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTAGAT-------------------------------TTTC------TAT-AGTAAT-GAAGATGCTCTTGGTTCGACATAATTTGTTCTGTATAGGTTGTTAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG---AAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAC---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATTAATTTATAAATTTAGACCAATTTTGTAAGTATATTCTTAGCATC--------GAAATAAAAAAGTGAAAATCCAATTCGA-----ACAAGTTTCAA----------AAAAAAAAAGAAAAG------ATGATATTGTTGG----AAACCGGTAAA-----AC-----------CACTTTGATTAT------AAGGTATAACGGGAATGAATTCTTTGTATTTTTTT-------------TATAAA---------------------------GAAGGAAATAAT-AAGAAAAGGTATGTTGCTTTCTTTTTGA-GAGGAATAAAG-ATCCCC--------GAAGTAATATTTAAACCCAATGATTCCAAAAAG-----AAAATA-TAAA-GGATTCTGGAACAAGAAAACACTAT--TTCCAA----TTGTCTCAAC-----AATT----TAAT---TGGAT-------------------------TATAATGAT--------G---AAAAAAAG------TA-----GTTAAAAATGAGACAAACAAAAGAGTTTAGAGACAACTCAAG-------AAG----T--TAA----TAAGGGTTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGATTGATA---------TTTTTTTCTGT-AAGGAAAAC----------AAAAAAGAGCTCATTTC-GAATC-----------------------ATAGTCTAATT-AATGATT-----TTATGAG-----CCCATTCTGT--------TT-------------CTATG---------------CAGAAATTTGCATCA-TTTTTCATGAGCCGTCTGAGAG-AAAAATCT--------------------------------------------CGGCC--ATTTCTTGTGGATCACA-----CAAATAGAA------TACTCATATCTATG-----TCCTT-GTA---------------CATATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAAGAAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATAGA-TTGGTATAAA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------AA--------------GAAGAA-ATAC-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTTTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAAATTTAGCAAATTCTAT-------------------ATTGAAT-----------------TTTGATTACTCAATATTCT-----AT-ATTGAG------------------------TTTTTTTTCTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCATCA-AAACAAATTCATA-------------ATTTTA-TGAATTCATA--------AATATTTT-----TGAATTTGTTATTTCATAATCATTAACAATTT-AAATAAT----------AATTTGATCGTGA-C---TATGAATAAATCATTTGATTAATCAGT----ATGTAT----ACGTATGTC-----------------------TT-----TGGTATA-TA------------------TGGGCCATCT-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCTACC--AC-CAATGCAAC----GTAATTAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAGTTTGAAAGTTAA-CACT---------------------------------- Lepidosperma_filiforme CGGGCGGTTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA-TGTCG---TTGGCTA-GCGA-AAACAC-GACCGTTGTGCACGTG-ATC---GAATGCT-GCC--GGGGAGGCGCTGTCG-CCTCGGCCC--ACCGG--CCCGGCC--TCGCTCCCTC-----AGGGCGCGCTGGCCG-CG-TGCTG-------AACACGGCG-GGGTTGA--CG-CCAAGGAACACGATA--GGCTGAGGC--GGCTGGC-GAGCGCTGACGCG-CACGGCCTG-CCGCCGATGCA--------AAGGAA-----AAACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATG-AGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCA-GCTCGTG--TGC----TCCCGACGCGGATATTGGCCCTCCGTGCC--CAACGGAG-CGGTGGGCCT-AAGT-ACGTGGCCGTCGGGTTTTGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTGC-CGCGCC-GCCCCGTG-CCCCC-TGCCGGC------CGGCTGTC-GACCCCC-GAACG-AGGAGCCGAACGACGCGGCGTCTT--GCTGCGCGGCTTCTTCGGACCGATA-CCCCAGG-TCAGGCGG-GCTACCCGCCGAGTTTAAGCATAT-AATAAGCTGCGCTTCGGCGCAGCCGACCG-CC-ATGAAGC-TGTC-TTTTCACTCCTCCT-ACTG-TTGCGCTTTGTTTT--GCGG-GCGAGGA----------CGTTGTCGGTTGTCTGTGTGGTTCTACCCTCGAGG-GGGA-TAACA---TTATTGTTTCATG-ATGGAT---TTTT-GC-TTGCCCCGTCGGTA-TTTTTTTTAT-CGTTG-GCGC-AGCCGATTTGT-TGGCTAAATA----CTT--AGCTG-CAGC--GGGTGTAC----GCACC-TGTACTCGGCACTCGAATTT--T-GCCG-GCTCTCGCGGATG-CAGTG----TCCATCGGGGA-------ATCTGTTGGGCCTCTGGT--CCTCGGATTTCCTCG--GG-AGGTCC---CTTGCAC-----GGAAA-TTG-CTCC--GCCGCTC----------------------------TGCTCTCGCTGTCCTAGTTGCTGGGATGTCGTGGTGGCGCGTGCG----GGG-CGTGCTC-CTGTGCA--TGCGAGATGTTTTGCCC----------GATC----GAATGAG-CGA--CTGCCGATTC---ACGTCTTG-GCGCGGG-CTCCTATTT--------------------ATTTAGGGTTTGCCGCAA-TG--ATGTGTCGGCGCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGGCC--ATTTCTCGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGCCAATT-------AAATAAAGAAACTCAAATAACAATTTATTCAAAAAAATTGAATAGTCAAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------TATTCTT------------TGCTT------------ATATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATCAAAT-GGCT----------------------------------------------------------------------------------------------------------------------------------ATTAATC------------------ATTTTTTC----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAA------------------------TT-CTTTTCTTATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAAAATTCAGA-------------AATTTT-TGAATTCATA--------AATATTTT-----CAAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AAATTGATCGTGA-T---TATGATTA-ATAATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TAGTTTAGTATATAGATAGGGTGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACTT-----AC-CAATACAAC----GTATTCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATA------------------- Lepidosperma_laterale -GGCGGTCCGCCGCCCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TAGGCTT-GCGA-AAACAC-GACCGTTGTGCACGTG-ATC---GAACGTC-GCC--GGGGAGGCGATGCCT-TCTCGGCCC--AACGG-CC-CGGCC--ACGCTCCCTC-----GGGGCGCGCTGGCCG-TG-TGCCG-------AACACGGCGCGGGTTGA--CG-CCAAGGAACACGATA--AGCTGAGGC--GGCTGGCG-GGCGTTGAGGCG-CACCGCTTG-CCGCCGATGCA--------AAGGAA-----AAACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--TGC----TCTCGATGCGGATATTGGCCCTCCGTGCC--AAAAGGAG-CGGTGGGCCT-AAGT-ACGTGGCCGTCGGGT-TTGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTG{CT}GCGCGCC-GCCCCGTG-CCCCC-TGTCGGT----------TGCC-GACCCCC-GAACG-AGGAGCCGAACGACGCGGCGTCTT--GCTGTGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG---------------------------------------------------------------------GTTTT--GCGG-GCGAGGGA---------CGTTGTCGGTTGTCTGTGTGGTTCTACCCTCA-GG-GGAA-TAACA---TTCTTGTTTCATG-ATGGAT---TTTC-GC-TTGCACTGTCGGTATTTTTTTTTAT-CGTCG-GCGC-AGCCGATTTGT-GGGCTAAATA----CTTGGGGCTG-CAGC--GGGTGTAC----GCACC-TGTACTC-GCACCTGAATTT--T-GCCG-GCTCTTGCGGATG-CAGTG----TTCATCGAGGA-------ATTTGTTGGCCTTTGGT---CCCCTGATTTCCTCG--GG-AGGTCC---CTTGCAT----GGATCG-TTG-CCCT--GCCGCTC----------------------------TGCTAT--CTTGTCTCTTTGTCGGGATGTTGTGGCGGTGCGTGCG----GGG-CGTGCTC-TTGTGCG--TGCGAGATG-TTTGCCC----------GATC----GAATGAG-CGA--CTGCCGGTTC---ACGTCTTGTGAGCGGA-CTCCTATTT--------------------ATTTAGGGTTTGCCGCG--TG--ATGTGTCGGCGCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGGCC--ATTTCTCGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGC{CT}AATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAAT-GA-ATAGTCAATGT-----------------------------------TAG-{GT}ATAATGATATG{GT}A-TTGGTAAT{AG}A-------TTTCATT-ATAG{AG}----------------------------GATT{CG}TT------------TGCTTA------------TATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATCAAATGGGCT-GGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAAT-------------------CATTTTTC----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAA-------------------------TTCTTTTCTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCAT-AAAAAATTAAGA-------------AATTTT-TGAATTCATA--------AAT-TTTT-----CAAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AAATTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA-GTTTGTATATAGATAGGGTGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATACAAC----GTATTCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATA------------------- Lepidosperma_longitudinale -------------CGCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGGCTT-GCGA-AAACAC-GACCGTTGTG-ACGTG-ATC---GAACGCT-GCC--GGGGAGGCTATGCCG-CCTCGGCCC--AACGG--CCCGGCC--TCGCTCCCTT-----GGGGCGCGCTGGCCG-TG-TGCCG-------AACACGGCGCGGGTTGA--CG-CCAAGGAACACGATA--AGCTGA-GC--GGCTGGC-GAGCGCTGAGACG-CACGGCCTG-CCGCCGATGCA--------AAGGAA-----AAACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAA-TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTC--TGC----CCCCGATGCGGATATTGGCCCTCCGTGCC--TAAAGGCG-CGGTGGGCCT-AAGT-ACGTGGCCGTCGGGT-TTGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCG-G-CCCCT-TGTCGGC----------TGCC-GACCCCC-GAACG-AGGAGCCGAACGACGCAGCGCCTT--GCTGTGCGGCTTCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG-TGCGCTTCGGCGTAGCTGACCG-TC-GTGAAGC-TGTC-TTTTCACTCCTCCT-CCTG-TTGCGCTTCGTTTT--GCGG-GAGAGGAA----C----GTTGT-TGGTTGTCTGTGCGGTTCTACCCTCGAGG-GGAA-TAACGATCTTT-TGTTTCATGA-TGGAT---TTTT-GC-TTGCCCC-TCGGTG---TTTTTTAT-CGTCG-GCGT-AGCTGATTTGT-GGGCTAAATA----CTT-GAGCTG-CAGC--GGGTGTAC----GCACC-TGTATCCAGCACTTGTGTTT--T-GTCG-GCTCTCGCGGATG-CAGTG----TTCATTGAGGA-------ATCAG-TTGGCCTCTGGTC-CCCTGATTT-CCTCG--GG-AGGTCC---CTTGCAC----GGATCA-TTG-CTCT--GTCGCTC----------------------------TGCTAAC-CTG-TCCCGGTTGTTGGGA--TGTCGTGGCGG-GGCGTGCGGGG-CGTGCTC-CCGTGCA--TGCGAGATGTTTTGCCC----------GATTATCGGAATGAG-CGA--CTGCCGGTTC---ACGTCTTGTGAGCGG-ACGCCTATTT--------------------ATTTAGGGTTTGCCGC-AACG--ATGTGTCGGCGCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACAGGCTG-AACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTAACCGGGGGCTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTGTTTAGGTTGTCAGTAAATTAGGTTGTCAATAAACAGTA-CGT----------GACGGAGCTCGAG---AAAAAAAAGGATTGATT-------------TCTTCA--------ATC-----AAG---------CAAGGGGAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------GATT--------AATTTAGACCAACTTTGTAAGTATGTTCTTAGCATC--------GAAATCAAAAAGAGAATATCCAATTCGA-----ACAAGTT----------------AAAAAAAAAAAAGA-GAAGTTTAAATTGTTGG----AAATTGGTAAA-----AC-----------TGTTTCGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATATTTTATTTT-----------TATATATT--------TTATAAAGAAA------GAAGGAAATATC-AAAAAAAGGTATGTTGCTTTCCTTTTAA-GAAGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTTAAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATGTC----AT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGACATTGA-----------------TAAGGATTT----TCCTTTGAACTTTA-----TAAAAATTATTAAAAAATGATTCAACTTGAGTAACGAGT--ATAAATGATA---------TTTTTTTCTGT-AAGGAGGAG----------GAAAAAGGATTCAATTC-GAATC-----------------------AGAGTCTAATT-AATGATT-----TTAAGAG-----TCTATTTTGT-------ATT-------------CTATA-CAAAATTCTATACAAAAAAAGTTGAATCATTTTTTCTTGAGCC-----------------------------------------------------------------------------------------------------------ACTCGTATCTAGA-----TACGA-GTA---------------GCTATGCCAATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-AATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCTT------------TGCTT------------ATATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAA------------------------TT-CTTTTCTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAAAATTCATA-------------AATTTT-TGAATTTATA--------AATATTTT-----CAAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AAATTGATCGTGA-T---TATCATTA-ATCATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TAGTTTAGTATATAGATAGAGTGGTTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTATTCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCT-------------------------------------------------------- Lepidosperma_tortuosum CGGGCGGTTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTC----TTGGCTT-GCGA-AAACAC-GACCGTTGTGCACGTG-ATC---GAACGCT-GCC--GGGGAGGCGCTGCCG-CCTCGGCCC--ACCGG--CCCGGCC--TCGCTCCTTC-----AGGGCGCGCTGGCCG-CG-TGCCG-------AACACGGCGCGGG-TGA--CG-CCAAGGAACACGATA--GGCTGAGGC--GGCCGGC-GAGCGCTGAGGCG-CACGGCCTG-CCGCCGATGCA--------AAGGAA-----AAACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCG-CCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--TGC----TCTCGACGCGGATATTGGCCCTCCGTGCC--CAAAGGAG-CGGTGGGCCT-AAGT-ACGTGGCCTCGGGTT--TGGGCTCATCCCCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCGTG-CCCCC-TGCCGGC------CGGCCGCC-GACCCCC-GAACG-AGGAGCCGAACGA-GCAGCGTCTT--GCTGCGCGGCTTCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG-TGCGCTTCGGCGCAGCCGACCG-CC-GTGAAGC-TGTC-TTTTCAC---TCCT-CCTG-TTGCGCTTTGTTTT--GCGG-GCGAGGGA----C----GTTGT-CGGTTGTCTGTTTGGTTCTACCCTCGAGG-GGGA-TGACA--TTAT-TGTTTCATGA-TGGAT---TTTC-GC-TTGCCCCGTCGGTA--TTTTTTTAT-CGTTG-GTGC-AGCCGATTTGT-TGGCTAAATA----CTT-GAGCTG-CAGT--GGGTGTAC----GCACC-TGTACTCGGCACTCGAATTT--T-GCTG-GCTCTCGCGGATG-CAGTG----TCCATCGGGGA-------ATTCGTTGGGCCTCTGGTC-CTCGGATTT-CCTCG--GG-AGGTCC---CTTGCAC----GGATCA-TTG-CTCT--GCCGCTC----------------------------TGCTCTCGTTG-TCCCGGTTGCTGGGA--TGTCGTGGCGG-CGCGTGCGGGG-TGTGCTC-CTGTGCA--TGCGAGATGTTTTGCCC----------GATC----GAATGAG-CGA--CTGCCGGTTT---ACGTCTTGTGCGTGG-ACTCCTATTT--------------------ATTTAGGGTTTGCCGC-AATG--ATGTGTCGGCGCTCGTTT--AAAACGTGCTACCTGGTTGATCCTGCCAGTA----TAAAGCAGGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTAACCGGGGGCTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACCCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTCAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATACGATCCGGTAGATAAACTAGAT-------------------------------------------------AT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTGTTTAGGTTGTCAGTAAATTAGGTTGTCAGTAAACAGTA-CGT----------GACGGAGCTCGAG---AAAAAAAAGGATTGATT-------------TCTTTA--------ATC-----AAG---------CAAGGGGAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------GATT--------AATTTAGACCAACTTTGTAAGTATGTTCTTAGCATC--------GAAATAAAAAAGAGAATATCCAATTCGA-----ACAAGTT----------------AAAAAAAAAAAAGA-GAAGTTGAAATTGTTGG----AAATTGGTAAA-----AC-----------TGTTTCGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATATTTTATTTTT----------TATAAATT--------TTATAAAGAAA------CAAGGAAATATC-AAAAAAAGGTATGTTGCTTTCCTTTTAA-GAAGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTTAAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATGTC----AT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGACATTAA-----------------TAAGGATTT----TCCTTTGAACTTTC-----TAAAAATTATTAAAAAATGATTCAACTTGAGTAACGAGT--ATAAATGATA---------TTTTTTTCTGT-AAGGAGGAG----------GAAAAAGGATTCAATTC-GAATC-----------------------AGAGTCTAATT-AATGATT-----TTAAGAG-----TCTATTTTGC-------ATT-------------CTATA-CAAAATTCTATACAAAAAAAGTTGAATCATTTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG------------------------------------------------ACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGCCAATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCTT------------TGCTT------------ATATGTGTTATTTTGCGAAGAA-ATAG-------------------TTA-GGAAATAAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTCATTACTAA------------AT-ATTGAA------------------------TT-CTTTTCTTATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAAAATTCAGA-------------AATTTT-TGAATTCATA--------AATATTTT-----AAAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AAATTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TAGTTTAGTATATAGATAGGGTGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATACAAC----GTATTCACTTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGG------------------------------------------------------------- Machaerina_iridifolia ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGCTTTGGCGCGGCCGACCG-TC-GTGAAGC-AGTC-TTTTCACTCCTCCC-CCCG-TTGCGCTT-GTTTT--GCGG-GGAAGGGA----TGC--GTTGT-CGGTTGTCTGTGTGGTTCTACCCTTGCGG-GGAA-TAACA---TTA-TGTCCCATGAATGAAT---TTTT-GC-TCGCCCCGTCGATA--TTTTTTTAT-TGTCG-GGGC-AGCCGATATGT-TGGCTAAATG----CCT-GCGCTC-CAGC--GGGTGAAT----GCCCC-TACGCTCTGCGCTTGGATTT--TGGCCG-GCTCTCACGGATG-CCGTG----TCCATCGAGGA-------ACCCG-TCGGCCTCGGGTC-CCTGGGTTT-CCTCG--GG-AGGTCC---CTTGTAC----GGATCC-TTG-CTCC--GCCGCGC----------------------------TGCTATC-TTG-TCCCGGATGCTGGGA--TGTTGTAGCGG-CGCGCGCGGTG-CGTGGTC-CTGTGCA--TGCGAGATG-TTTGCCC----------GATT----GAAGGAG-CGA--CCGCCGGTTC---ATGTCGTGTGCGCGG-ACTCCTACTC--------------------GTTTAGGGTTCGCCGC-AACG--ATGTGTCGGCCCTCGTTT--AAGATGTGCTACCTGGTTGATCCTGCCA----------------------------------------AGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTACCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCGACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGATATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATACGATGCGGTAGATAAACTAGATAAAACGAACTAGAAAGATCCG--------------------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CCT----------GACGGAGCTCGAG---AAAAAAAAGGATTGCTT-------------TCTTT---------AAC-----AAG---------CAAGGGGAAGAATCTAGGGTTAGTGAAAATTAATATGATTTTATAT---------------------------GATT--------AATTTAGACCAACTTTGTAAGTATTTTCTTAGCATC--------GAAATCAAAAAGAGAATATCGAATCCGA-----ACAAGTTTC--------------AAAAAAAAAAAATA-AAAGTTGAAATTGTTGG----AAATTGGTAAA-----AC-----------TGTTTCGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATATTTTCTTTT-----------TATAAAGAA-------ATATAAAGAAA------GAAGGAAATAACAAAAAAAAGGTATGTTGCTTTCCTTTTAC-GAAGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTTCAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATGTC----AT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAACTCAAGACATTAAACA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATAAATGATA---------TTTTTTTCTGT-AAGGAGGAG----------AAAAAAGGATTCAATTC-GAATCAGAGTCTAATTCATAATC-----AGAGTCTAATT-CATGATT-----TTAAGAG-----TCTATTTTGC-------ATT-------------CTATA-CAAAAAC-------AAAAAAGTGAAATCATTTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTAATTAATC------------------ATTTTTTC----A-AAAGATTTAGCAAACTCTAT-------------------AATGAAT---------------TATTATATTACTAA------------AT-ATTGAA------------------------TT-CTTTTTTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTCAATT--------CATAAATTTG-TGAATTCATA--------AATATTGG-----AAAATTTGCTATTTCATAATCATTTAAAATTTAATAATAT----------AAATTGATCGTGA-T---TATGATTCAATCATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA------------CGTAGGGCGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTATTCAACTCTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Machaerina_juncea ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGCGCTTCGGCGCGGCCGACCG-TC-GTGAAGC-AGTT-TTTTCACTCGCCCT-CCCG-TTGCGCTT-GTTTT--GCGG-GGGAGGG-------GCGCGTTGTCGGCTGTCTGTG-GGTTCTACCCTTGTGG-GGAAGCAACG---TTC-TGTTCCGCGAATGAAT---TTTA-GC-TTGCCCCGTCGATG-TTTTTTTTAT-CGTCG-GAGC-AGCCGATTTGT-TGGCTAAATG----CTT-GCGCTC-CAGC--GGGCGAAT----GC-CC-TGCGCTCCGCGCTTGGATTC--T-GCCG-GCTCTCACGGATG-CCGTG----TCCATCGAGGA-------ATCCGTTGGCCCCTGG----TCTCGGTTTTCCTCG--GT-ATGTCC---CGTGTGC----GGATCA-TTG-CTCC--GCCGCGC----------------------------TGCCG-----------GATGCCGGGATGTTG{CG}{AG}GCGGCGCGCGCG----GCG-CGTGGTC--GGTGCA--TGCGAGATG-TTTGCCC----------GATT----GAATGAG-CGA--CCGCCGGTTC---ACGTCGTGCGAGCGGG-CTCCTGTTC--------------------ATTTAGGGTCCGCCGCA--CG--ATTTGCCGGCTCTCGTTT--AAGACGTGCTACCTGGTAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCTAAGGACACTACTTGAATGCGACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTA--------------------------------------------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GACGGAGCTCGAG---AAAAAAAAGGATTGCTT-------------TCTTT---------AAC-----AAG---------CAAGGGGAAGAATCTAGGGTTAGTGAAAATTAATATGATTTAGTAT---------------------------GATT--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------GAAATCAAAAAGAGAATATCGAATTCCA-----AAAAGTTTC----------------AAAAAAAAAATC-AAAGTTGAAATTTTTGG----AAATTGGTAAA-----AC-----------TGTTTCGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATATTTTATTTT-----------TATAAAGAA-------ATATAAAGAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTAC-GAAGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAAAGATTTCAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTTCAA----TTGTCTCAAC-----AATGTC----AT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGACATTAAACA----T--TAA----TAAG---------TCCTTTGAACTTTC-----TAAAAATC-----------ATTAAACTTGAGTCATGAGT--ATAAATGATA--------TTTTTTTTATGT-AAGGAGGAG----------AAAAAAGGATTCAATTC-GAATC-----------------------AGAATCTAATT-CATGATT-----TTAAGAG-----TCTATTTTGC-------ATT-------------CTATA-C-------------AAAAAAGTTGAATCATTTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTCGGG------------------------------------------------ACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATACTAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATTTATTAAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------AATTATT------------TGCTT------------ATATGTGTTATTTTTTAAAAAA-ATAG-------------------TTA-GGAAATCAAAGGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTAATTAATC------------------ATTTTTTC----A-AAAGATTTAGCAAACTCTAT-------------------AATGAAT---------------TATTAAATTACTAA------------AT-ATTGAA------------------------TT-CTTTTTTCATTGAACCTC-T---------------GT--CTGAATCAA-TTCACCATAAAAGAATTCATA-------------AATTTG-TGAATTCATC--------AATATTTT-----CAAATTTGCTATTTCATAATCATTTGAAATTTCATAATAG----------AAATTGATCATGA-T---TTTGAATC-AATATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA------------CGTAGGGCGGCTATTC-TTTCTCT-TA------TCTC--------GAT-AGAGA-----AAT-TCCACCT-----AT-CAATGCAAC----GTATTCAACTCTA-----TTCGTTAGAAAAGCTTCCATTGAGTCTCTGCACCTATCCT----------------------------------------------------------------------------------------------------- Machaerina_mariscoides ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGCTTTGGCGCGGCCGACCG-TC-GTGAAGC-TGTC-TTTTCACTCCTCCT-CCCG-TTGCGCTT-CTTTT--GCAG-GGGAGGGA----CGC--GTTGT-CGGCTGTCTGTGTGGTTCTACCCTTGCGG-GGAA-TAACA---TTC-TGTTCCAAGAGTTAAT---TTTT-GC-TTGCCCCGTCAATA---TTTTTTGT-TGTCG-GGGC-AGCCGAT-TGT-TGGCTAAATG----CTT-GCGCTC-CAGC--GGCTGAAT----GCCCC-TGTTCTCCGCGCTTGGATTT--T-GTCG-GCTCTCACGGATG-CCGTG----TCCATCGAGGA-------ATCTG-TTGGCCTCTGGTC-CC-GGGTTT-CCTAG--GG-AGGTCC---CTTGTAC----GGATCA-TTG-CTCT--GCCGCGC----------------------------TGCTATC-TTG-TCCCGGGTGCTGGGA--TGTTGTAGCGG-TGCGCGCGGGG-CGTGCTC-CTGTGCG--TGCGAGACG-TTTGCCC----------GATT----GAATGAG-CGA--CCGCCGGTTC---ACGTCTTGTGAGCGG-ACTCCTACTC--------------------ATTTAGGGTTCGCCGC-AACG--ATGTGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAAGTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATCAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCGACTGCAGCTACGTCTGAAGAAATGATAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATACGAGCCGGTAGATAAACTAGAT-------------------------CACCATTTTCTATTTCTAT-ACTAAT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CCT----------GACGGAGCTCGAG-AAAAAAAAAAGGATTGCTT-------------TCTTT---------AAC-----AAG---------CAAGGGGAAGAATCTAGGGTTAGTAAAAATTAATATGATTTAATAT---------------------------GATT--------AATTTAGACCAACTTTGTAAGTATGTTCTTAGCATC--------GAAATCAAAAAGAGAATATCAAATTCGA-----ACAAGTT-----------------------AAAAAAA-AAAGTTTAAATTGTTGG----AAATTGGTAAA-----AC-----------TGTTTCGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATATTTTATTTT-----------TATAAAGAA-------ATATAAAGAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTAC-GAAGAATAAAG-GTCCCC--------GAAGTAATGCATAAACCCAATGATTTAAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATGTC----AT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAAAGACAGCTCAAGACATTAAACA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TAAAAATTATTAA------ATTAAACTTGAGTCATGAGT--ATAAATGATA---------TTTTTTTCTGT-AAGGAGGAT----------AAAAAAGGATTCAATTT-GAATCAGAGTCTAATTCATAATA-----AGAGTCTAATT-CATGATT-----TTAAGAG-----TCTATTTTGC-------ATT-------------CTATA-C-------------AAAAAAGTTAAATCATTTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGGCC--ATTTATTGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATACTAATT-------AAAT-------------------------------------------AAAGGAACTAAAA-----GAAA-----------------AATTTATTCAA-AAAAATTGA-ATA-------------------------------------------TAG-GATAATGATATGGA-TTGGTCATGA-------TTTCATC-ATAGA----------------------------AATTCTT------------TGTTT------------ATATGTATTATTTTGTGAAGAA-ATAG-------------------TTA-GGAAATAAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTAATTAATC------------------ATTTTTTC----A-AAAGATTTAGCAAACTCTAT-------------------AATGGGT---------------AATTTTTTTACTAA------------AT-ATTGAA------------------------TT-CTTTTTTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAGAATTCATA-------------AATTTG-TGAATTCATC--------AATATTTG-----CAAATTTGCTATTTCATAATCATTTTAAATTTAATAATAT----------AAATTTATCGTGA-T---TATGATTCAAAAATTTGATTAATCGTT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA------------CGTAGGGCGGCTATTC-TTTCTCT-TA------TCTC--------G------GA-----AAT-TCCACCT-----AC-CAATGCAAC----GTATTCAACTCTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Machaerina_rubiginosa ------------------------------------------------------------------------------------------------------GATCATTGTCG---CTGGCTT-GCAA-AAACAC-GACCGTTGTGCACGTG-ATC---GAAAGCT-GCC--GGGGAGGCTCTGCCG-CCTCGGCCC--ACCGG-CC-CGGCCA-TCGCGCCCTC-----GGGTCGCGTTGGTCG-TG-TGCCG-------AATACGGCGTGGGTTGA--CG-CCAAGGAACACGAGA--TGCTGAGGC--GGTTGGCGGAGCGCTGAGGCG-CACGGCCCG-CCGCCGATGCA--------AAGGAA-----AAACT-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--CGC----CCACGATGCGGATATTGGCCCTCCGTGTC--TATAGACG-CGGTGGGCCT-AAGT-ACGTGGCCGTCGGGC--TGGGCTCATCCGCGGGAGCGGCGAGTGGTGGGCATTT-CTGCGCGCGCC-GCCCCGTG-CCCCC-TGTCGGC--------CT-TCC-GACCCCC-GAACG-AGGAGCCGACCGACGCAGCATCCT--GCCGCGCGGCATCTTCGGACCGATA-CCCCAG------------------------------------------CTGCGCTTCGGCGCGGCCAACCG-TC-GTGGAGC-TGTC-TTTTCACTCCTCCT-CCCG-TTGCGCTTTTTTTT---CGG-GGGAGGGA----CGC--ATTGT-CGGTTGTCTGTGTGGTTCTACCCTTGCGG-GGTA-TATCA---TTG-TGTTGCATGAATGAAT---TTTT-GC-TTGCCCCGTCGATA--TTTTTTTGT-TGTCG-GGGC-AGCCGAT-TGT-TGGCTAGATG----CTT-GCGCTC-CAGC--GGGCGAAT----GCCCCCTGTTCTCCGCGCTTGGATTT--TTGCCG-GCTCTCGCGGATG-CCGTG----TCCATCGAGGA-------ATCCG-TTGGCCTCTGG-C-CCCGGGTTT-CCTCG--GG-AGGTCC---CTTGCAC----GGATCA-TTG-CTCT--GCCGCGC----------------------------TGCTATC-TTG-TCCCGTGTGCTGGGA--TGTTGTGGCGG-TGCGTGCAGGG-TGTGCTC-TAGTGCA--TGCGAGATG-TTTGCCC----------GATT----GAATGAG-CGA--CCGCCGGTTT---GCGTCGTGCGAGCGG-ACTCCTACTT--------------------GTTTAGGGTTCGCCGC-AACG--GTGTGCCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCATAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTAACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCAGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTACCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTCTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCGACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCGATGCCAGGTGTTATTCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGATCTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGGCC--ATTTAT-GTGGATTACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATACTAATT-------AAAT-------------------------------------------AAAGTAACTAAAA-----TAAA-----------------AATTTATTCAA-AAAATTTGA-ATAGTCAATGT-----------------------------------TAA-GAAAATGATATGGA-TTGGTA-TGA-------TTTCATC-ATAGA----------------------------AATTCTT------------TGCTTA------------TATGTGGTATTTTCTGAAGAA-ATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAA-TCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTAATTAATATTCTCGTTTAATTAATCATTTTTTTT----CAAAAAATTTAGCAA-CTCTAT-------------------AATGAAT---------------TATTTTTTTACTAA------------AT-ATTGAA-------------------------TTCTTTTTTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCAT-AAAGAATTCATA-------------AATTTG-TGAATTCATC--------AATATTTT-----CAAATTTGCTATTT-ATAATCATTTGAAATTTAATAATAT----------AAATTGATCGTGA-T---TATGATTCAATCATTTGATTAATCAGT----GTATAT----ACGTAT-TC-----------------------TT-----TAGT-----------------------GGCGACTATTC-TTTCTCT-TA------TCT---------AAT-AGAGA-----AAT-TCTACCT-----AC-CGATGCAAC----GTATTAAACTTTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Mapania_cuspidata -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCGGAGTTAAAGATTACAAACTGACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTCACCCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTTCAAGGTCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGACGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGCTTCTGCTTCTGTGCTGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAGTCAAAGGACACTACTTGAATGCTACTGCAGGCACCTGTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGCTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAATACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAATAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGACTCCGTACTCCAATTTGGTGGAGGAACTCTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTGGCTTTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGGGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATAAACTAGAT-------------------------CATCATTTTC------TAT-AGTAAT-GAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGTAGCTCGAG----AAAAAAAGGATTGGTT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AAGTTAGACCAACTTTGTAAGTATATTTTTAGCATC--------GAAATTAAAAAGTGAAAATCCAATTCGA-----ACAAGCAAG--------TTTCAAAAAAAAGAAGGAG---ATAGTGCAATTGTTAG----AAATTGGTAAA-----AC-----------TTTTTTGATCA-------AAGGTGTAACGGGACTGAATCCTTTTTATTGTATT-------------TATAAA---------------------------GAAGGAAATAAC-AAAAAAGGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTTCAAAAAG-----AAAAGA-TAAA-AGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-------------------------------------------------------------------------TAAAAA------TA----GGTTAGAGATGAGATAAACAAAAGAGTTTAGAGACAGCTCAAG-------AAA----T--TAA----TAAGGATTT----TCCTTTGAACTTTG-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGAT-----------TTTTTTCTGT-AAAGAGGA-----------AAACGAGGACTCAATTC-AAATC-----------------------ATAGTCTAATT-CATAATT-----TTATGAA-----TCCA-TTTGC-------ATT-------------CTATA---------------CAGAAATTCGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGGCC--ATTTCTTGTGCATCACC-----CGAGTAAAA------TACTCGTATCTATG------TCTT-ATA---------------GATACGTCAATT------------------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAGTTGA----------GT-----------------------------------TAG-------GATATGGG-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTAT----TTGCGAAGAA-ATAC-------------------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTTAAAATCAACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ACTTTTTA----A-AAAGATGTAGCAAACTTTGT-------------------AATGAAT---------------AATTTGATTACAAA------------AT-ATTGAG------------------------TT-CTTCTTTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCACCA-----TAATTTAGA-------------ATTATT-TCAATTCATA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCATAATCTAAGAATAT----------AATTTCTTCGTGA-T---TATGATCA-ATCGGTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TTCAATATAATATA-CA-------------------GGGTTATTC-TTTCTCC-TA------TTTT--------GAT-AGAGA-----AAT-TCCACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCTATACCAAGGCTC---------- Mesomelaena_pseudostygia ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C-GCGCTTCGGCGCGGCCAGCCG-CC-GTGGGGC-GGCC-TCTTCACTTTTCCT--CCG-TTGCGCTC-TTTGT--GTCG-GGACGGAG-----ATCGCGCCGCGGTTTGTTTGTGCGTTTTACCCCGTGTAG-GAAC-CTTCA---CGG-GGTTTCGG--ATGGCC---TCT--GC-TTGCCCCGCCCATA---CTTGTTGT-CGGCG-GCGC-AGCTGTTATGTCCGGCTGACTC----GGT-GTGCGG-CGGT--T-GCGGAT----GCTGC-AGCGCGCCGCACTCGGGTTG--T-GCTTTGCTCTCATGGATG-CGGTG----CTCCGCTTGCT-------GTTCTGCGGGTTGTACTTGGCCCCAGAATGCTTTG--GG-TTGTCC---CGCGAGC--TGTGGCCG-TCG-CGGC---TCGTGC----------------------------CGC---------------------------ATAGCGGCGCGTGCG--GGCGGATGTGCCG-TAGCGCG--TGTGCGACGTCCCTTCC----------GACC----GAATGAG-CGA--TTGTCGGCGC---GTGCGGCCCGTTCGGT-CTCCC------------------------CCTTGGGGTGCACCCGGGGCG--GCGCGCC-GTTCTCGTCTAGAGGACGTGCTACCTGGTTGATCCTGCCA-----------------------------GCAGGGGTTAAAGATTACAAACTTACTTACTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACGACTGTTTGGACTGACGGACTTACCAGTCTTGATCGCTACAAAGGACGATGCTACCATATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATCCCCCCCGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACCGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGGCTACTTCTTCATATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACGGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTGGATAAACTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCCTAGTTCGACATGATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------CATGGAGCTCGAG-----AAAAAAGGCTTTATT-------------TTTAT---------ATA-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTAAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATTCTTAACATC--------GAAATCAAAGATAAAACATCTAACACGAATCGAACAAATTTCAA------------AAAAAAAAAGAAA------GTGAAATTGTTGG----AAACTGGTAAAATCAAAC-----------TATTTTGATCAT------AAGGTATAACGGGAGTGAATTTTTTGTATTTTTTT----------------------C------------ATACCGAAG--GAAAAAAGTAAATAAAAAAAGGTATGTTGCTTTCCTTTTGA-GAAAAAAA----ATCCCC--------GAAGTAATGTATAAACCCAATGATTC--AAAAA-----AAGATA-TAAA-AGATTCCGGAACAAGAAAACGCTAT--TTTCAA----TTGTCTCAAA-----AATGTAATTAAT---TGGAT-------------------------CATAAT-AC--------A---AATAAAAAAA----TA----CGTTAGAGATGAGACAAACAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAATAATTAATTATTT----TCCTTAGAACTTTCTCAAATCAAAAAT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA-------------TTTCTGT-AAGGAAGGG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAATCTAATT-CATAATTTTATGTTATGAGATGAATCCATTTTAC-------ATT-------------TTATA---------------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGAA-GAAAATCTCATATACGTTTCTGGGG---------------------------CGACC--ATTTCTTGTGAATC----------ACCTGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ACTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------CAG-GATAATGACATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------TATTCCT------------TGCTT------------ATATTTATTATTTTGCGAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTTAAAAATCGGCGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATT------------------ATTTTTTG----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTTTATATTTAATTTAAT-ATTAAA------------------------TT-CTTATCTCATTAAACTTC-T---------------ATAATTGAATCAA-TTCACCA-TAAAGAATTCAAA-------------AATTTT-TGAATTCATAA-------ATATTTCC-TTTCCGAATTTTTTATTTGATATTTAATAAAAATTCAATAATATTATTATTTTGAATTTGATCGTGA-T---TATCATTT--TCATTTAATTAATCAGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGTATGTCT-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGTAAC----GTAATCAACCCTG-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Mesomelaena_tetragona ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTACTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGCGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGCTACAAAGGACGATGCTACCATATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATCCCCCCCGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACCGCAGGTACATCCGAAGAAATGATCAAAAGGGCGGTATTTGCTAGAGAACTAGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGGCTACTTCTTCATATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACGGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATTTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATAAACTAGAT------------------------------------------------------------------------------TGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------CATGGAGCTCGAG-----AAAAAAGGCTTGATT-------------TTTTT---------ATA-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTAAAAATTAA----------TAT---------------------------AATT-------------AGACCAACTTTGTAAGTATATTTTTAACATC--------AAAATCAAAGATAAAACATCGAACACGAATCGAACAAATTTCAA------------AAAAAAAGAGAAA------GTGAAATTGTTGG----AAACTGGTAAAATCAAAC-----------TATTTTGATCAT------AAAGTGTAACGGGAGTGAATCTTTCGTATTTTATT----------------------C------------ATAAC------GAAGG---------AAAAAAGGTATGTTGCTTTCCTTTTGA-GAAAAAA-----ATCCCC--------GAAGTAATGTATAAACCCAATGATTC--AAAAA-----AAGATA-GAAA-ATATTCCGGAACAAGAAAACACTAT--TTTAAA----TTGTCTCAACAATGTAATGTAATTAAT---TGGAT-------------------------CATAATGAC--------G---AATGAAAAAAA---TA----TGTTAGAGATGAGACAAACAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAATAATTAATTATTT----TCCTTTGAACTTTCTCAAATCAAAATT-----------ATTCAACTTGAGTTATGAGT--AGAAATGATA-------------TTTCTGT-AAGGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAATCTAATT-CATAATTTTATGTTATGAGCTGATTTCGTTTTAC-------ATT-------------CTATA---------------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGAA-GAAAATCTCATATACGTTT--------------------------------------------CTTGTGAATC----------ACCTGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TCAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------CCG-GATAATGAGATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------TATTCCT------------TGCTT------------ATATTTATTATTTTGCGAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTG----A-AAAGATCTAGAAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTTAATATTTAATTTAAT-ATGAAA------------------------TT-CTTATCTCATTAAAGTTC-T---------------ATAATTGAATCAATTTCACCA-TAAAGAATTCCAA-------------AATTTT-GGAATTCATAA-------ATATTTCC-TTTCCGAATTTGTTATTTGATATTTTATAATCATTCAATAATATTATTATTTTGACTTTGATCGTGA-T---TATCATTT--TCATTTAATTAATCAGT----ATATAT----CCGTATGCC-----------------------TT-----TGGTATA-TA-------------------GGTATGTCT-TTTCTCT-TA------TTTT--------GAT-AGATA-----AAT-TCCACCT-----AC-CAATGTAAT----GTAATCAAACCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCT----------------------------------------------------------------------------------------------------- Morelotia_gahniiformis CGGGCG--TTGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA-CATTGTCG---TTGGCTC-GCGA-AAACAT-GACCGTTGCGCATGTG-ACC---AAACGCT-GCC--GGGGAGGCGCTGCCG-CCTCGGCCC--ATCGGACCCCGGCCC-CAGAGCCCGC-----CGGGCGCGCCGGTCG-GG-TGCCG-------AA-ACGGCGCGGGTTGG--CG-CCAAGGAACACGATA--TGCAGAGGC--GGCAGGCGGAGCGCTGAGGCG-CGAGGCCAG-CCGCCGATGCG--------AAGGAA---CAACACA-AGATGACTCTCGGCAACGGATATCTCGGCTCTC-CATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAG-AGCCCAACCACGCTCGG---TGC----CCCCGACGCGGATCTTGGCCCTCCGAGCC--TGCGGGCG-CGGTGGGCCC-AAGT-GTGCGGCCGCCGGAT--GGGG-------CCGGGTGCGG-GAGTGGTGGGT--TG-CTGCGCGCGCC-GTCCCGT--TCCCC-TCCCGGC------CCATGTCC-GACCCCC-GAACG-AGGAGCCGGCTGACGCAGCGTGCT--GCAGCACGGCATCTTCGGACCGATA-CCCCAGG-TC-GGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCAGGAGCTGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTGGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAGGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTTCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATCGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGAGGAATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATCTTTT--------------TTTTTTTT----TCAAAAATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG-------------------------TTCTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCACCAT-AAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATT-GCTATCTCATAATCATTCCCATTTTAAAAAGAA----------AATTTGATCGTGA-T---TATAATTC-ATCATTTGATTAATCAGT----ATATAT----ACGTATATA-----------------------TT-----TGATATA-TA-------------------TGGTTATCC-TTCCTCT--A------TTTC--------GAT-AGAGG-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTACCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAGGGCTCAATCCAATCA Neesenbeckia_punctoria ---------------------------------------GAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---CTGGCTT-GCGA-AAACAC-GACCGTTGTGCACGTGAATC---GAATGCT-GCC--GGGG-GGCGCTGCCT-CCCCGGCCC--ACCGG--CCCGGCCC-TCGCGCCTTC-----GGGGCGTGTTGGTCG-TG-TGCCG-------AATACGGCGCGGGTTGA--CG-CCAAGGAACACGAGA--CGCCGAGGC--GGCCGGCGGAGCGCTTAGGCG-C-CGGCCCG-CCGCCGACGCA---------AGGAAAAAAAAAACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACC-TCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGTG--CGC----CCCCGATG-GGATATTGGCCCTCCGTGCC--TAAAGGCG-CGGCGGGCCC-AAGT-ACGTGGCCGTCTGGT--AGGGCTCATCCCCGGGAGCGGCGAGTGGTGGTCATTT-CTGCGCGCGCC-GCCCCGTG-CCCCC-TGCCGGC--------TTCGCC-GACCCCC-GAACG-AGGAGCCGCTCGACGCAGCTTCGT--GTCGTGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAGCTGCGTTTATGCGCGGCCGACCG-TT-GTGAAGT-TGTC-TTTTCACTCCTCCCGCCCG--CTGCGTT-GTTTT--GCGG-GGGAGGAA----CGC--ATCGT-CGGTTGTCTGTGCGGTTCTACCCACGTGG-GGAA-TATCA---TGA-TGTTTCATGA-TGGAT---TTTT-GC-TTGCCCCGTCGATA----TTTTTAT-CGTCG-GCGC-AGTCGATTGGT-TGGCTAAATT----CTT-GTGCCG-CGGC--GGGTCAAT----GCCCC-GATACTCGGCGCTTGGATTT--T-TCCG-GCTCTCGCGGATG-CCGTG----TCCATCGAGGA-------ATCAG-TTGGCCTCCGGTC-CCTTGATTTACCTCGG-GG-GGGTCC---CTTGTAC----GGATCG-TTG-CTCC--GCCGCTC----------------------------TGCCATC-TTG-TCCGGTGTGATGGGA--TGTCGGAG----------CGGTG-CGTGGTACCCGTGCA--TGCGAGATG-TTCACCC----------GATT----GAATGAG-CGA--CTGCCGGTTCTCGTCGTCGTGCGAGTCGGACTCCTATTC--------------------ACTTAGGGTTCGCCGC-AACG--ACGTGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAG------TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTTCAAGGCCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACGAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTCTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTGCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCCGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTGTGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACGTAATTTGTTCTG-TTAGGTTGTTAG----------------TAAACAGTA-CAT----------GACGTAGCTCGAG---AAAAAAAAGGATTTATT-------------TCTTT---------ATC-----AAG---------CAAGGGGAAGAATCTAGGGTTAGTAAAAATTAA----------TAT---------------------------AATT--------AATTTAGAACAACTTTGTAAGTATGTTCTTAGCATC--------GAAATAAAAAAGAGAATATCTAATTTGA-----GCAAGTT---------------AAAAAAAAAAAAAAA-GAAGTTTAGATTGTTGG----AAATTGGTAAA-----AC-----------TGTTTCGATCAT------AAGGTATAACGGGAGTGAATCCTTCATATTTT----------------TATAAA--------------AAAAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTAA-GAAGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTTAAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAATACTAT--TTGCAA----TTGTCTCAAC-----AATGTC----AT---TGGAT-------------------------CATATTGAC--------G---AAT-AAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------ACA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATTATTCAAAAATTATTCAACTTGAGTCATGGGT--ATAAATGATA---------TTTTTTTCTGT-AAGGACGAG----------AAAAAAGCATTCAATTC-GAATCAGAGTCTT---------------AAATTATGATT-TTAAGAT-----TTAAGAG-----TCTATTCAAC-------ATT-------------CTATA-CA------------AAAAAAGTTGAATCATTTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG---------------------------------------TTGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGCTAATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-TATAATGATATGTA-TTGGTAATAA-------TTTCATT-ATAGG----------------------------GATTGTT------------TGCTT------------ATATGTGTTATTTTGCGAAGAATATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTATCGATATTGACATGTAGAGT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATT------------------ATTTTTTT----ATAAAGATCTAGCAAAGTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAA------------------------TT-CCTTTTTCATTGAACCTT-T---------------AT--TTGAATCAA-TTCACCA-TAAAGAATTCAGA-------------AATTTG-TGAATTCATA--------AATATTTT-----CAAATTTGCTATTTCATAATCATTCAC--------AACAT----------AAATTGATCGTGA-T---TATGATTT-ATCATTTGATTAATAAGT----GTATAT----ACGTATGTC-----------------------TT-----TAATATA-TA---------------------------------------------------------GAT-GGACA-----AAT-TCCACCT-----AC-CAATGCAAC----GTATTCAACTTTATTCGTTTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGG------------- Oreobolus_distichus TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGGAT---AACCGTTGGACATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGTCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCC-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGCCGTTGCA--------AAGGAA------CATA-TGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCATGCTCGGG--CTC----CCCTGATGTGGATCTTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCAGCGTTAT--GCTGTGCGGCATCCTCGAACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATAT----------------GTTGCGGCCAACTG-TC-ATGGGGC-GGTC-TTCTCAC-TTTTTCCTTTT-GCGTGCTC-CTTTT--GCG--GCGGGGGA----TGGTTGCGAC-TTGTTGTTTGTTTGGTTCTATCCCCACGG-GGAA-C-TAATTTTTG-GGCTTTGGGA-CGGTC---TTT--GC-TTGCCCCGTGGATA---CTTGCTAT-CTTGG-GTGC-AGCCATTTTAT-TGGGTGAGAA----CTT-GCGTCG-CAGT--GGTGGATT----GCTCC-TATGCT--TCACTTGTATTT--C-ATCG-TGTCTCATGGATG-CTGTG----CCCGTCGAGGA-------TTTCA-TGGGCCTCTGTTG-CCCTGATTT-TCTTG--GG-ATCTCTGGTTGTGCAT---TGGATCA-TTGCCCCC--ACGCCTT----------------------------CTGTATC-TTG-CTGTGGATGTTGGGC--TGTCGGTGTGT-TGCGTGCGGGGGCGTGTTCCAAGTGCATGTGTGAGATG-TTTTTCC----------GATT----CAATGTG-CAA--TTGTCGGTTC---ACGCCATGCGAGTGG-ATTCCC------------------------ATTTGGGG-TGCTCTCAAATG--ACGTGTCGTCTCTTGCTT--AGGACGGGCTACCTGGTTGATCCTGCCAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TATTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATTAAAAAAAAAAA-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAAAAAAAATGGACATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCAATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTTATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTTA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTT-CTTCCAAATTTGCTATTTCATAAAAATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGTTATCC-TTTATCT-TA------TTTC--------GAT-AAAAA-----TAT-TGCACTT-----AC-CTATGGAAC----GTAATCCATTATA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Oreobolus_kuekenthalii --------------------------------------------------------------------------------------------------------------TTG---TTGCCTT-GAAAAGAAT---AACCGTTGGACATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCCA-ACCGG-CACCGGCCT-TCGTGCCCAAT---CGGGGAGCGTTGGTCT-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CATA-TGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCATGCTCGGG--CTC----CCCTGATGTGGATCGTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTTTCT-GACCCCC-GAATG-AGGAGCCGGCTGATGCAGCGTTAT--GCTGTGCGGCATCCTCGGACC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAGGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCCGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAAGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGGAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TATTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATTAAAAAAAAAAA-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAAAAAAAATGGACATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCAATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTTATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTTA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTT-CTTCCAAATTTGCTATTTCATAAAAATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGTTATCC-TTTATCT-TA------TTTC--------GAT-AAAAA-----TAT-TGCACTT-----AC-CTATGGAAC----GTAATCCATTATA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Oreobolus_obtusangulus TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAAT---AACCGTTGGGCATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCACGCCTTAT---CGGGGAGCGTTGGTCC-TG-TGCTGG------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTGGGCCGAGCGCT-AGGCG-TGCGGCCCG-CCGTCGCTGCA--------AAGGAA------CATA-AGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATCCATGCTCGGG--CTC----TCCTGATGCGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACCGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGTTGATGCAGCGCTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGAGGCTACCCGCCGAGTTTAAGCATAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGTGTTGGTTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACAGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATT---TAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AAATTAGTCAAAAAAAATGGA-ATAGTAGATGT-----------------------------------TAG----------------------------------------------GATAATGATTCCTCATTATAGATATAATGATTCCTTACATATATGGATTCTTATATGGATTCTTATATGGATTTTTTTGCGAAGAA-AT-C-------------------TTATGGGATTCAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oreobolus_oligocephalus TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAAT---AACCGTCGGACATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGTCG-CCTCGGCCAA-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCT-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATGAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CATA-TGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCATGCTCGGG--CTC----CCCTGATGTGGATCTTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCGGCGTTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTAAT---TAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAAAGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TAAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAAAAATTCACAATTT-ATGATAT----------AACATCATTGTGA-T---TATCATGA-ATTATTTGATTAATAAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATTC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Oreobolus_pectinatus TGGTGGTTCGCCGCTCGTG-ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGCCTT-GAAAAGAAT---AACCGTTGGACATGTG-ATT---GAACCCT-GCC--GGGGAGGTGCTGCCG-CCTCGGCCAT-ACCGG-CACCGGCCT-TCATGCCCTAT---CGGGGAGCGTTGGTCC-TG-TGCTGA------AATACGGCGTGGATTGA--CG-CCAAGGAACATTAGA--TTTTGTGGT--GGTCGGCCGAGCGCT-AGGCG-AGCGGCCTG-CCGTCGTTGCA--------AAGGAA------CATA-TGAAGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACTTGCCCGAGGGCACACCTGCCTCATGGGCGTTAGAAGCCCATTCACGCTCGGG--CTC----CCCTGATGTGGATCCTGGCCCTCCGAGCC--TGTGGGCG-CGGTGGTCCG-AAGT-GTGATGCTGTCGGAT--GGGGC-------CGCGAGCGTCGAGTGGTGGGCACTGGCTGAGCGCT---GCCTCGTG-TCCCT-TGCCGAC------CTTTGTCC-GACCCCC-GAATG-AGGAGCCGGCTGACGCAGCGTTAT--GCTGTGCGGCATCCTCGGACCGATA-CCCCAGG-TCAGGTGGGGCTACCCGCCGAGTTTAAGCATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCCGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGGAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTAACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATAAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACGT-----TC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Pseudoschoenus_inanis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTGAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACTGGAGGATTCACTGCAAATACTAGTTTGGCTTATTATTGCCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAAACAAAATAGAAAGATCAA-----------------------------------------------------------------TTAGGTTGTCCG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG------------GTTTGATT-------------TTTTT---------ATC-----AAA---------CAAGGGAAAGAATCTAGGGTTAGTGAGAATTCAATT-------AAT------------------------TCTAATT--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------GAAATCAGAAA---AAAATCCAATTCGA-----ACAAG-----------------AAAAAAAAAAATAG---AAAGTGAAATTGTTGG----AAACTGGTAAA-----AC-----------TATTCTGATTTT------AAGGTGGAACGGGAATGAATCCTTCGTATTTCTTT-------------TATAAA---------------------------GAAGGAAAT--CAAAAAGAAGGGGTGTTGCTTTCCCTTTGA-AATGAATAAAG-GTCTCC--------AAAGTAATTTATAAACCTAAAGATTCCAAAAAG-----AAAAAA-GAAA-GGATTCCGGAACAAGAAAATACTTT--TTGAAA----TTATCTCAAC-----AGTGTA----AT---TGGAT-------------------------CAAATTGAC--------A--------AAA------AA----AGTTAGAGATAAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AAATTCTT--TCA----TAAGGATTTATTTTCCTTTGAATTTTC-----TAAAAATTTTTT-------ATTTAACTTGAGTCATGAGT--AAAAAAAATATTATGATA-TTTTTTTATAT-AACGAAGAG----------GAAAAAGCACTCTATTT-GAATC-----------------------ATAGTCTGATT-CATTATT-----TTCTAAG-----TCCATTTTGC-------ATT-------------CTATA---------------CAGAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGT-GAAAAT------------------------------------------------------------GTGAATCACA-----AGAGTAGAA------TACTCGTACCTATG-----CCCTT-GTA---------------TCTAGGTCAATT-------AAAT-------------------------------------------AATTGACCCCAAC-----AAAA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATG------------------------------------TTAAGATATTGATATTAA-TTGGTAATTA-------TTTCAAT-ATAGA----------------------------TATTCTT------------TGCATA---------TTTT-TAAAATCTTT---GAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTC-------TTTGATTTCTCATC---------------ATTTTTTC---------AATATAACAAACTCTAT-------------------AATGAAT-ATAATAAATATATTCAATTAATTACTCA------------AA-ATTGAG--------------------------TTTTTTTTCATTGAACTTCAT---------------ATT-TCGAATCAA-TTCACCAT-AAAGGATTCATTACTTTTTGACATAATTTTT-TGAATTCATC--------AAAATTTA-----TGAATTTGCTATTCCATAATGAATAGCAATTTACAAAAAT----------TATTTGATTGTTA-T---TATGATCA-ATCATTTGATTAATCAGTATGTATGTATATACACATACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTCT-TA------TCTC--------GAG-AGAAA-----AAT-TCT---------AG-CAACGCAAC----ATAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAATGATTTGGCTCAGGATTGCCCTTTTTTAATTCCAGGGTTTCTCTGAA--------------------------------------------------- Ptilothrix_deusta -----------------------------------------------------AGAGGAAGGAGAAGTTGTAACAAGTTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTG---TTGGCTT-GCGA-AAAGAC-GACTGTTGTGCGCGTG-ATC---GAATGCT-ATCCG{AC}A{AC}GGGGCGCCCATTGCCTTGCCCT--TCCAG-AGCCGACCCTTCGTGCCCCC-----CGAGAGCGCAGACCG-CG-TGTTG-------AACACGGCGCGGACTGG--CACCCAAGGAATACAAGA-ATGCAGAGGC--GGTCGGAC-----------CG-CACGGCCCA-CCGTTGGTGGA---------AGGAA------CACA-CGATGACTATCGGCAACGTATATCTCGGCTCTCGCATCGATGAATAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAATGCAAGTT-CGTCCGAGGGACCCGCCCAAAGGCACCCATGCT---TGGGCGTTAGAAGCCCATCCACGCTCGGC--ACC----CACTGATGCGGATCCTGGCCGTCTGAGCCTCTGATGGCA-TTGGAGGCCC-AAGT-GTGCGGTCG-CGGAT--AGGG-------CTGGGAGCGGCGAGTGGTTGAC--TG-CTGCGCGCGCC-TCTCCGTGGCCCCC-TGCCGGT------CTCCGCTCAGACCACT-GAACGAAGGTGCCGGCCAAC-------------------AGCATACTCGGACCGATA--CTTAGG-TCAGGCGAGGATACCCATCGAGTATAAGCATGTAAATAAGC-GCGCTTCGGCGCGGCCAGCCG-TC-GTGGGGC-GGTC-TCTTCACTTTTCCT-TCCG-CCGCCCTC-TCGGC--GCCG-GGACGGAG-----CACTAGCTGCGGGCTGT-TGTGCGGTTCTACCCTCGCAG-GGTA-CGAGT---TTC-GGCTTCCAG-ATGGTT---TCGG-CT-TTGCTCCGCCGATA------CTTGT-CGGCG-GCGC-AGCTGCTGTTTCCGGCTAAATC----AGT-GTGCGA-CGGT--T-GCGGAT----GCCCT-GCCGCGCCGCACTCGGATTTTGT-GCCGTGCTCTCACGGATG-CGGTG----CTCCATTTGCG-------GTTCTGCGGGTCGTAGTT--CCCCAGAACGCTTCG--GG-TTGTCC---CGCGTGC---AAAGCCG-TCG-CGGT----------------------------------------------------------------------------------------------CCC-TTTTGCG--TGCGTGATGTCCCATCC----------GACC----GAACGAG-CGA--TTGCCGGCGC---GCGTC---CGACCGGT-CTGC-------------------------CCTTTGGGTGTTCCGGGG-CG--GCGCGCTGGCTCTCGTCT-GAGGACGTGCTACCTGGTTGATCCTGCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTATTGTGAATC----------ACCTGAA-----ATACTCGTATCTATG-----TACGA-GTA---------------CCTATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------CAG-GATAATGAGATGAA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------TATTCCT------------TGCTT------------ATTTTTATTATTTTGCGAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCATCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTT----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTTAATATTCAATTTAAT-ATTAAA------------------------TT-CTTATCTCATTAAACTTC-T---------------ATAATTGAATCAA-TTCACCA-TAAAGAATTCAAA-------------AATTTT-TGAATTCATAA-------ATATTTCC-TTTCCGAATTTGTTATTTGATATTTTATAATCATTCAATATTATTATTATTTTGAATTTGATCGTGA-T---TATCATTT--TCATTTAATTAATCAGT----ATATAT----ACGTATGCC-----------------------TT-----TGGTATA-TA-------------------CGCATGTCT-TTTCTCT-TA------TTTT--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGTAAC----GTAATCAACCCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAATCACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Rhynchospora_rugosa_subsp._brownii ----------------------------------------------------------------------------------------------------------------------------------------GACCGGTGCACACGTG-ACC---GAAAGAT-GCC--GGGGAGGCGCTGCCG-CCTCGGCCC--AACGG-CCA-TGCCC-TCTCGCCCTGC-----GGGCGTTTGGGTC--TGGTGCCG-------AACACGGCGCGGGTTGA--CG-CCAAGGAAAACTGGACTTGCTGAGGC--GGGAGGCGGACCGCATACGCG-TTTCGCCTG-CTGCCGATGCG--------AAGGAA------CGCA-AGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--TTT----TCCCGATGCGGATCCTGGCCCTCCGAGCC--GCGAGGCG-CGGTGGGCCC-AAGT-GTGGGGCCGTCGTAT--GGGGC-------CGGGAGCGGCGAGTGGTGGGC--TA-CTGCGCGCGTC-ACCCCGAG-CCCCA-TGTCGGC------CCTTGGTT-GAACCCC-AAACG-AGGAGCCGGCTATCGCAGCGTCCC--GCTGTGCGGCATC-------------------------------------------------------------CTGCGCATCTGCGCGGCTGGCCG-AC-ATGGGGC-CGTC-TCTTCATTCTTCCTCCCGT-TAGGCGGCGCATATT-GCCT-CGGAGGGATGCGTGCAGTCGGCTT---TGCCTGTGTGGTTCTACCCTTGCGG-GGAA-C--TAACTCG--GTCCC-ATGA-CGGATGCGTTTGAGC-TTACCCTGTCGATC--ATTTATTTT-CGTCA-GGGC-AGCCGAATTGT-TGGCGAAACC----CTT-GTGCGT-TGCCACAGCGGAAT----GCTGGCGGTACC--GCACTCGAGCGT--C-GTCG-GCTCTTGCGGATG-CTGTG----CCCACGGCCAG-------TTCTG-CGGGCCTCTGG-C-CCGCAG---ACTTTG--GG-AG----------------------CG-TGG-CTCC--GTCGCTCGCTTGTTG--------------------TGTCGGGTTTCCC-----------------GATGCTGGAGCGTTGCG-------------------------AGGGACG-CCTCTCT----------GACC-GAACGAGTAG-CGA--TTGCCGGTTA---ACGTAGTGAGTAGGG-CCTCCCT-----------------------TCCGGGGCGGTGCCGGAAACA--ACGTGCCGTCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTTGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAACCTGTTGCTGGGGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGTCACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACCAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGCGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAACGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAATATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGACTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG----ATAAAAAGACTTTATT-------------TTTT----------ATC-----AAA---------CAGGGGAAAGAATCTAGGGTTAGTGAGAATTAATAT-------AAT------------------------TC-AATT--------AATTTAGACTAACTTTGTAAGTATATTTTTAGCATC--------GAAATCAAAAAGCGAAAATCCAATTCGA-----ACAAG-----------------TCAAAAAAAAATAG---AAAGTGAGATTGTTGG----AAACTGGTAAA-----AC-----------TCTTTTGATCAT------AAGGTGTAATGGGAGTGAATCCTTCGTATTTTATT-------------TATAAA---------------------GAAAA-GAAGGAAAT--CAAAAAGAAGGTATGTTGCTTTCCTTTTGA-TAGGAATAAAG-GTCTCC--------GAAGTAATGTATAAACCCAAAGATTCTAGAAAG-----AAAATA-TAAA-AGATTCCGGAACAAGAAAACACTAT--TTGAAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------GATATTGAC--------A---AATATAAA------TA----GGTTAGAGATAAGACAAGCAAAAGAGTTTAGAGACAGCTCAAG-------AAA----T--GAA----TAAGGATTT----TCCTTTGAACTTTC-----TTAAAAATATTATT-----ATTTAACTTGAGTCATGAGT--ATGAATGATA--------TTCTTTTTCTGT-AACGAGGG-----------AAAAAAGGAGTCCATTT-GAATT-----------------------ATAGTCTAATT-CATGATT-----TTTTGAG-----CTCATTTTTC-------ATT-------------CTATC---------------CATAAATTTGTATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGACC--ATTTTTTGTGGATCACC-----CGAGTAGAA------TACTCGTATCTATG-----CCCTT-GTA---------------CCTACGTCAATT-------AACT-------------------------------------------AATTGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATGGA-ATAGTCAATG------------------------------------TTAAGATAATGATA-TGA-TTGGTAATTA-------TTTCGTT-ATAGA----------------------------GATTCCT------------TGCTTA---------TATT-TTATATATTG---GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTTATCATC---------------AATTTTTCAAATGAAAAAATATAAAAAACTCTAT-------------------AATGAAT---------------AATTTGATTACTAA------------AA-ATGAAG-------------------------TTCTTTTCTTATTGAACTTC-T---------------AT--TCGAATCAA-TTCTCCAT-AAATAATTCAG--------------AATTTT-TCAATTCATA--------AAAATTTC-----AGAATTTGCTATTTCATAATCATTCACAATTTAAAAATGT----------TATTTGATCATGA-T---TATGATCA-ATCA--AAATGAATCAGTA---ATAT------ATATATGTC-----------------------TT-----TGGTATA-TA-------------------CGGCTATCC-TTTCTCT-TA------TTTC--------GATAAGAAA-----CAT-CCT---------AC-CAATGCAAC----A-AATCAATTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGAATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACTAAGGCTCAATCTAATCA Schoenus_bifidus --------------------------------------------------------------------------AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTTGTTCGAAAA-AAACAC-GACC-CTGTGCACGTA-ACC---TAATGTT-GTC--GTGGAGGCATCGCCT-CCTCGGCCC--ACCGG-CCACGGTCC-T------------------CACTCGGCCCG-TG-CGTCGGG-----AATACGGCGCGGTCTG---CG-CCAAGGAACACGATA--TGCTGAGGC--GGCTGGCGGAGCGCTCCGGTG-CACCGCCCT-CCGTCGATGCA--------AACTAA------AACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCTGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCATGCTCGG---TGC----TCCCGATGCGGATCATGGCCCTCCGAGCC--TGAAGGCG-CGGTGGGCCC-AAGT-GTGAGGCCGCCGGGA--GGAG-------CCGGGAGCGGCGAGTGGTGGAA--TG-CTGCGTACGCC-GCCTCGCG-CCCCT-TCGTGGC------CTTTGACC-GACCCTC-GAACG-AGGAGC--GTTG---CCGATTACC--ACGGCACGGCTCATTCGGAACGATACCCCCAGG-TCAGGCGGGGCTACCCGCTGAGTTTAAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTAAT-AAAGATGCTTTTGGCTCGACATAATTTGTTCTGT-----------------------------AAACAGTA-CATGATGTAGCTCGATGTAGCTCGAA---AAAAAAATGAATT-----------------TTTTT---------ATC-----AAG---------CAAAGAAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAATATATTCTTAGCATC--------GAAATCAAAAAGAGAACATCCAATTTGC-----AAAAGTTTC--------------------AGAAAAA------GTGAAATTTTTCG----AAAATGGAAAA----AAC-----------TATTTTGATCATA-----AAGATGTAACGGGAGTAAATACTTCCTTATTTTTT--------------AGATA----------------TTAAAGAAGGAAAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-ATCCCC--------GAAGTAATGTATAAACCCAATGATTCAAAAAAG-----AAAATA-AGAA-GGATTCTGGAACAAGAAAACACTAT--TTGTAA----TTGTCTCAATATC--AATA-ATATAAT---TGAAT-------------------------AATGATGAC--------G---AATAAGAA------TA----GTTTAGGCATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGTATTT----TACTTTGAACTTTC-----TCAAAATT-----------ATTCAACATGAGTCATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGGAGGA-----------GAAAAAGGATTCAATTC-TAATC-----------------------AGAGCTTCATT-CATGATT-----TTATGAG-----TCCATTTTGC-------ATT-------------CTATA---------------CAAAAATTTTTATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGG-----------------------------CGGCC--ATTTCTTGTGGATCGCC-----TGAGTAGAA------TATAAGTATCTGAA-----TCCTT-GTACCTACATCACTTGTACCTATATCAATT-------AAAT-------------------------------------------AAAGGAACTAAAA------CTCAATTTATTTCAAAAAAGAATTTATTCCA-AAAAATAGA-ATAGTCAATGT-----------------------------------TAG-TATAATGATATGGATTTAGTAGTGA-------TTTCGTT-CTAGA----------------------------GATTTTT------------TGCTTA-------GCTTATATGTATTTTTTTGGGAAGAA-AAAC-------------------GTA-GAAAATAAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGGTATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC------------------ATTTTTTC----A-AAAGAT---------------------------------------------------------TTTGATTATTCC------------AT-ATTGAA------------------------TT-CTTTTTTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATGAAAGAATTCCGA-------------ATTTAA-AAAATTCATA--------AATATTTC-----CGAGTTTGCTATTTCATAATCATTCCAAATTTAATAATAT----------AAATTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GAGCTATCC-TTTACCT-TA------TTTT--------GAT-AGAGATAAGAAAT-TCTATTC-----AC-CAATACAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATTAATTCCAGGGTTTCTCTGAAT-------------------------------------------------- Schoenus_caespititius ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTGCTTCGGTGCAGCCAACCG-CC-GTGGGGC-TGTC-TTTTCACTGTTCCT-CCCG-ATGCGCTTTTTTGT--GCGG-GGGAGGGG---TCGCTTGCTAT-CGGTGGTCTGTGTAGTTCTACCCTCGTGC-GGAA-CAAAA---GTG-GGTTTCATGA-TAGGT---TTCT-GC-CTGCGCCGTCGACA---CGTGCTGT-CATCG-GCGC-GGCTGATTTGT-TGGCATAATG----CTT-GTGCGG-CTGT--GGGCGCATGAATAGCTCCAGTACT--GTACACGCGTTG--T-GTCG-GCCCTCACGGATG-CGGTG----CGCAATGAGGA-------ATCCA-TGCGTCTTCGGTC-GC-TGGATTATTTCG--GG-ATGTCC---CTCGCAC----GGATTG-CCG-CTTC--GTTGCTT---------------------------------------------------------------------TGCTT-CGAGG-CGCGGTC-CTGTGCT--GGCGAGATG-GTTGCCC----------GGTT----GAAAGTG-CGA--TTGTCCGGTC---TCGTCGTGCAAAGGC-GCTCCC------------------------GTTGAGGGCGCGCCGGAAGCG--ACTTGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTT------TAT-ACTAAT-GAAGATGCTTTTGGCTCGACATAATTTGTTCTGT-----------------------------AAACAGTAACAT----------AATGTAGCTCGAA---AAAAAAAAGAATTGGT--------------TTTTT---------ATC-----AAG---------CAAAGAAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGATCAACTTTGTAAATATATTTTGAGCATC--------AAAATCAAAAAGAGAATATCCAATTAGA-----ATAAGTTTTTT-------------------AAAAAA------GTGAAATTGTTGG----AAAATGGAAAA----AACTATTTTGATTATTTTTTGATTATT-----AAGGTGTAATGGGAATAAATACTTCCTTTTTTTTT-------------AAGATA----------------TTAAA------GAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCT--------GAAGTAATTTATAAACCCAATGATTCAAAAAAG-----AAAATA-GGAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTTAACATC--AACA-ATATATT---TGAAT-------------------------CATAATGAT--------A---AATAAAAA------TA----GGTTAGGCATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TACTTTGAATTTTT-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA---------TCCTTTTCTGT-AAGGAGTA-----------GAAAAAGGATTCAATTC-TAATC-----------------------ATAATTTCATT-TATGATT-----TTATGAA-----TCTATTTTGC-------ATT-------------CTATA---------------CAATAATTTGTATCA-TTTTTCTTGAGCCGTATGAGGA-AAAAATCTCATATACGTTTCTGGG-----------------------------------ATTTCTTGTGGATTACC-----TGAGTAGAA------TACAAGTATCTAGA-----TCTTT-GTA---------------CCTACCTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAACGATTTATTCCAAAAAACAATTTATTCAA-AAAAATAGA-ATAGTCAATGT-----------------------------------TAG-AATAATGATATGGA-TTAGTAGTGA-------TTTCATT-CTAGA----------------------------GATTTCT------------TGCCTA-------GCTGATATGTATTCAGCTACGAAGAA-AAAC-------------------GTA-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGGCATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC------------------ATTTTTTC----A-AAATAT---------------------------------------------------------TGGGATTATTCA------------AT-ATTGAA------------------------TT-CTTTTCTTATTGAACTTC-T---------------AT--CTGAATCAA-CTCACCATTAAAGAATTCAGA-------------ATTGTTTTCAATTCATA--------AATATTTC-----CGAGTTTGCTATTTCAAAATCATTCCAAATTTAATAATAT----------AATTTGATCGTGA-T---TATGATTA-ATC------------AGT----GTATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------AAAATATCC-TTTCTATTTTCTATTATTTC--------GAT-AGAGA-AAGAAAT-TCTATTT-----AC-CAATGTAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATTAATTCCAGGG------------------------------------------------------------- Schoenus_curvifolius --------------------------------------------------------------------TGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TATGCTT-CCTA-AAACAT-GACCGTTGCGCATGTG-ACC---GAACGCT-GCC--GAATA--------------CGGCCC--ACCGG-CCCCGGCCC-A------------------CGTGCTGGCCG-GG-TGCCG-------AATACGGCGCGGGCTGG--CG-CCAAGGAACACGAGA--TGCTGAGGC--GGCCGGACGAGCGCCGAGGCG-CGCGTCCGG-CTGCCGACGCG--------AAGGAA---TAAAACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGC--CGC----CAACGACGCGGAGCTTGGCCCTCCGAGCC--GGATGGCG-CGGTGGGCCCTAAGT-GTGCGGCCGCCGGAT--GGGG-------CCGGGTGCGGCGAGTGGTGGGT--TG-CTGCGCGCGCC-GTCCCCTG-CCCCC-TCACGGC------CCTTGTCG-GACCCCC-AAACG-AGGAGCCGGCCGACGCAGCGTCCCAAGCTGTGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGCGCTACCCGCCGAATTTACGCATATCAATA--CTGTGCTTCGGCGCGGCCAACCG-TC-GTGGGGC-TGTC-TCTTCACTAATCAT-CCCG-CTCTGCTC-GTGCG--GGAC-GGGAGGAA----TGCTAGCTTG-CGGCTGTCTGTGCGGTTCTACCCTAGT---GGTA-CCTTG---TTA-GGCTTCTTGA-CGGAG---TTTTTGC-TTGCCCCGT-GATG---TTCATTAT-CATTG-GGGC-AGTCGATATGC-TGGCTTAATT----TGC-GTGCCG-TGGT--GGTCTAG-----GCCTCA-GCATT--GCGCGTGCTTTT--T-GTCG-GCTCTCACGGATG-CTGTG----ACCTTTGAGGA-------ATTCA-TGGGCCTTCGGAC-CC-TTGATTTC-GCG--GG-ATATGCCC-CTTGT--------------------------------------------------------------------------------------------------------------------TC-CGGAGCA--AGTGGGATG-TTTATCC----------GATT----CGATGAG-CGA--TTGCT-GTTC---TCGCGTTGTTCCATG-ATGCGG--------------------------------------------------AGACGGCTCTCGTTT--AGGACGTGTTACCTGGTTGATCCTGCCAGTAGTCA------------------------------------------------------------------------------------------------------------------------AGTTCCCCCCGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCGTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTCATGCATGACTACTTAACCGGGGGATTCACCGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAAGGTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG---AAAAAAAGGATTTTATT-------------TTTTT---------ATA-----AAA---------CAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------AATTTAGACCAACTTTGTAAATATATTCTTAGCATC--------GAAATCAAAAAGAGAACATTCAATTCGC-----GCAAGTTTC----------TAAAAAAAAAAGGAAAGA-AAAAGTGAAATTGGTGA-AAAAAACTCTTTTA-----AT-----------CTTTTTGATCATT-----AAGGTGTAATGGGAGTGAATCCTTCCTTTTTTATT-------------TAGAAA---------------------------GAAGGAAATAAC--AAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAGTAAAA-GTCCCC--------GAAGTAATGTTTAAACCCAAAGATCTAAAAAAG-----ACGATA-TAAA-GGATTCCGGAACAAGAAAATACTATA-TTGCAA----TTGTCTCAAC-----AATGTATGTCAT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----TTATAA----TAAGGATTT----TCCTTTTAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA---------TTTTTTTCTTT--AAGGGGGC----------AAAAAAGGATTCAATTC-----------------------------CAAATCGGATC-TAA-ATT-----TTATGAG-----TCCTTTTTATTTTGC--ATT-------------CTATAACAAAA---------TAAAAAATTGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGGGGTATTT----------------------C--ATTTCTTGTGGATCACC-----TAAGTAAAATAATG-TACTTGTATCT-----------------------------------ATTTCAAT-------------------------------------------------------AAAGGAACTCGAA-----TATC-----------------AATTTATTCCA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATT-ATAGAGATAAT----------------------GATTCCT------------TGCTTA-----------CTATGTATTTTTTTGCAAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATAAAAAGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGGAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAAA-------------------TTTTTTTC----A-AAAAATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATGGAACTTC-T---------------AT--TTGAATCGA-TTCACCA-TAAAAAATTCAGA-------------ATTTTT-GAAATTCATAAAATA---AATACTTC-----CGAATTTGCTATCTCACAATCA---------TAATAATAA----------AATTGGATCGTGA-T---TATGATTC-ATAATTTAATCAATCAGT----ATATAG----ACGTATGTA-----------------------TG-----TGATATA-CA-------------------TGGCTATCC-TTTCTCT-TA------TTCC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATAAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCCTTTTTAATTCCAGGGTTTCTCTGAA-TTGGAAGTTAA-CACT---------------------------------- Schoenus_efoliatus -------------------------------------------------------TGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTTGCCC-GGAA-AAACAC-GACCGTTGTGCACGTA-ACC---TAATGCT-GCC--GGGGAGGCGTCGCCGCCCCCGGCCC--ACCGG-CCGCGGTCC-T------------------CGATCGGGCCG-CG-TGCCGGG-----AATACGGCGCGGTCTG---CG-CCAAGGAACACGAGA--TGCTGAGGC--GGCCGGCGGAGCGCTCCGGCG-CACCGCCCG-CCGTCCATGCG--------AATGAA------AACA-CGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCGG---CGC----TCCCGATGCGGATCGTGGCCCTCCGAGCCTCTCACGGCG-CGGTGGGCCT-AAGT-GTGCGGCCGCCGGGA--GGAG-------CCGGGAGCGGCGAGTGGTGGAA--TG-CTGCGTACGCC-GCCCCGCG-CCCCT-TGTCGGC------CTTTGCCC-GTCCCTC-GAACG-GGGAGCC--------GTGCCTACC--ACGGCGCGGCGCCTTCGGATCGATA-CCCC--------------------------------------------CTGTGCTTCGGTGCAGCCAACCG-CC-GTGGAGC-TGTC-TTTTCACTGTTCCT-CCCG-ATGCGCTCTTTTGG--GCGG-GGGAGGGA---CTGCACGCTGT-CGGTGGTCTGTGTGGTTCTACCCTTGTGC-GGAA-CAAAA---GTG-GGCTTGATAA-TAGGC---TTCT-GC-TTGCGCTGTCGGCA---CGTGTTGT-CGTCG-GCGC-GGCTGATTTGT-TGGCATAATG----CTT-GTGCGG-CTGC--GGGCGTGTGAATGCCTCCGGTACT--GCACGCGCATTT--T-GTCG-GCTCTCACGGATG-CGGTG----CGCATTGAGGA-------ATCCA-TGCGTCTTCGGTC-GC-TGGATTACTTCG--GG-ATGTCC---CTTGCAC----GGGTTG-TCG-CTCC--GTTGCTT---------------------------------------------------------------------TGCTT-CGGGT-CGCGCTC-CCGTGCC--TGCGAGATG-CTTGCCC----------GGTT----GAAAGAGACGA--TTGCCTGATC---TCGTCGTGTGAAGGC-CT-------------------------------------------------------------------------------------------------------------------------------------------AGATTATAAACTAACCTATTATACTCCTGAGTACGAAACCAAAGACACCGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGATACAAGGGACGATGCTATCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTCTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCTCTACGAGCCCTACGCTTAGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATTCAATCTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAAGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCGGCTACATCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCCATTATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGCGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAATTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATCTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCCTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCCTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGGAATGAGATCATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCCGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTAGATAAAACGAAATAGAAAGATCAA----------TTTT------GAT-ACTAAT-GAAGATGCTTTTGGCTCGACATAATTTGTTCTGT-----------------------------AAACAGTAACAT----------GATGTAGCTCGAA---AAAAAAAAGAATTAGT--------------TTTTT---------ATC-----AAG---------CAAAGAAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTGAGATCAACTTTGTAAATATATTTTGAGCATC--------GAAATCAAAAAGAGAATATCCAATTTGA-----ACAAGTT---------------------AAAAAAAA------GTGAAATTTTTTT----AAAATGGAGAA----AAC-----------TATTTTGATTATT-----AAGGTGTAACGGGAATAAAGACTTCCTTTTTTTTT-------------AAGATA----------------TTAAA------GAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCT--------GAAGTAATTTATAAACCCAATGATTCAAAAAAG-----AAAATA-GGAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAACATC--AATA-ATATATT---TTCAT-------------------------CATAATGAT--------G---AATAAAAA------TA----GGTTAGGCATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAA-------AGA----T--TAA----TAAAGATTT----TACTTTGAATTTTT-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA---------TTCTTTTCTGT-AAGGAGTA-----------GAAAAAGGATTCAATTCATAATC-----------------------ATAATTGAATT-TATGATT-----TTATGAA-----TCTATTTTGC-------ATT-------------CTATA---------------CAATAATTTGAATCA-TTTTTCTTGAGCCGTATGAAGA-GAAAATCTCATATACGTTTCTGGG----------------------------------------TTGTGGATTACC-----TGAGTAGAA-------ACAAGGATCTAGA-----TCCTT-GTA---------------CCTACGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAACGATTTATTCCAAAAAACAATTTATTCCA-AAAAATAGA-ATAGTCAATGT-----------------------------------TAG-AATAATGATATGGA-TTAGTAGTGA-------TTTAATT-CTAGA----------------------------GATTTCT------------TGCTTA-------GCTGATATGTATTTTTTTACGAAGAA-AAAC-------------------GTA-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGGTATGGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC------------------ATTTTTTC----A-AAATAT---------------------------------------------------------TTGGATTATTCA------------AT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--CTGAATCAA-TTCACCATTAAAGAATTCAGA-------------ATTGTTTTCAATTCTGA--------AATATTTC-----AGAGTTTGCTATTTCATAATCATTCCAAATTTAAAAATAT----------AATTTGATCGTGA-T---TATGATTA-ATC------------AGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------AAGGTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-AATAAAT-TCTATTT-----AC-CAATGTAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTACTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAG------------------------------- Schoenus_grandiflorus -------------------------------------------------------------------TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGGCTT-GCAA-AAATGT-GACCGTTGCGCATGTG-ACT---GAATGCT-GCC--GAGGAGGCGCTGCCG-CCTTGGCCC--AACGGACCCCGGCCC-TCATGCCCTT-----CGGGAGTGAGAGTCG-GG-TGCCG-------AATACGGTGCTGCCTGG--CG-CCAAGGAACACGAGA--TGCTGAGGC--GGCAGGCGGAGCGCTGACGCG-CGAGGTCGG-CCGCCGATGCG--------AACGAA---AAACACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGG---TGC----CACCGTCGCGGATCTTGGCCCTCCGAGCC--TGCGGGCG-CGGTGGGCCC-AAGT-GTGCGGCCGCCGGAT--GGGG-------CCGGGTGCGGCGAGTGGTGGGT--TG-CTGCGCGCGTC-GTCCCGTG-CCCCC-T-CAGGA------CCTTGTCG-GACCCCC-GATCG-AGGAGCCGGCTGACGCAGTGAGCC--GCTGCGCGGCACCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATCAATAAGCGGTGTTTCGGCATCGCTAACCG-TT-GTGGCGC-GGTC-TTTTCAGCATGCCT-CCTG-TTGTGCCC-GCGCG--GCTC-GGGAGGAT----CAATTGTTTATTGGTCGTCTGTGTGGATCTACCCTAGTGC-GGAA-CGATG---TTT-GGTTCCATCA-TGGTT---TTTT-GT-TCGCCCCGTTGATA---TTCGTTAT-CATCG-GTGC-GACTGCGTTGT-GGGCTTAATT----CAT-GTGTTG-TTGA--GGGCGAGG----GCCTC-GTTGGT--GCATTTGGATTT--T-GTCG-GCTCTCACGGATG-CTGTA----CCGTTTGCGGA-------AGTCG-TGGGCTTTTGGAC-CC-CCGATTTTCACG--GG-ATGTCC---CTTGCGT---TGGATCA-TTG-CTCC--GTCGCTA----------------------------CGCGATC-TTG-TTGTGGGTGTTGGTA--TGTCGGCACGG-TGCGTGCGGGG-CGTGCTC-TTGTGCA--AGTGAGATG-TTTGTCC----------GTCT----GAAAGAG-CGA--TTGCC-GCTC---TCG--------CATC-ATTCCA----------------------------------------TAATG--ATGTGGCGGCTCTTGTTT--ATGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TAAT---------G-----TACTT-GTA---------------TTTATTTTAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAACTGA-ATAG-CAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATTTTTTTGCGAAGAA-ATAC-------------------TTA-GGCAA---------------AGAAGAAGT-ACTAGA---------------------CGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTATC-------------------TTTTTTTT----CAATAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTTAG-------------------------TTCTTTTCTCATTGAACTTC-TTTTCATTGAACTTCTAT--TTGAATCGA-TTCACCAC-AAAGAATTCAGA--------------TTTTT-TTAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCATTTTAAAAATAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATA-----ACGTATATA-----------------------TG-----TAATATA-TA---------------TGGCTGGCTATCT-TTTCTCT-TA------TTTC--------AAT-AGAGA-----AAT-TCCACCT-----AA-CAATGCAAC----GTATTCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTT-CCATACCAAG-------------- Schoenus_nigricans ---------------------------------------------------------------------------AGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCTG---CCGCCTA-GCGA-AAACAC-GACCGTTGCGCACGTG-ATC---GAGCTCC-GCC--GGGGAGGCGTCGCCC-CCCCGGACC--ACCGG--CCCGGCCC-TCGCGCCCCTTGT--CGAGCGCGCGGGCCG-TG-CGCCGGGAAAAAAATACGGCGCGGGCTGT--CG-CCAAGGAACACGATA--TGCTGAGGC--GGCCGGCGGAGCGCTTCGGCG-CGCCGCCTG-CCGTCGATGCA--------AAGGAT---ATTCACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--AGC----CCCCGATGCGGATCGTGGCCCTCCGAGCC--CTAGGGCG-CGGTGGGCCC-AAGT-GCGCGGCCGTCGGAA--GGAG-------CCGGGAGCGGCGAGTGGTGGAA--TG-CTGCGCGCGCC-GTCCCGGG-ACCCC-TGCCGGC------CTTTGACC-GACCCTC-GA-CG-AGGAGCCGCGT----CACCTTCGAAAGGAGTGCGGCATTCTCGGATCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCTGAGTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACCGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAAATAGAT-------------------------CACCATTTTC------TAT-AGCAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG--AAAAAAAAGGATTTATT-------------GCCTT---------ATC-----CAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------CATTTAGAAAAACTTTGTAAATATTTTCTTAGCATC--------GAAATCAAAAAAAGAATATCCAATTTGA-----ACAAGTTTCAA----------------AAAAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TATTTTGATCAT------AAGGTGTAACGGGAATAAATCCTTCGTATTTTCTT-------------TATAAAAAA-------------ATAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAA-GTCCCC--------GAAGTAATGTATAAACCTAATGATTCCAAAAAGAAAAAAAAATA-GAAA-AGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATTTA----AT---TGAAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAAAGATGGGATAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAAT---TAAAGATTT----TCTTTTGAACTTTC-----TCAAAA-T-----------ATTCAACTTGAGTTATGAGT--ATGAATGA-----------TTTTTTTTTGT-AAGGAGGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTAATT-CAGGATT-----TTATGAG-----TCCATTTTGCATTCTACATTGTATACAATAATTCTATA---------------CAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG-----------------------------------TTTCTTGTGGATCACC-----TGAGTAGAA------TACTCGTATCTATA-----CGCTT-GTACCTAT----------CCTATGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCCA-AAAGAATGG-AA--------------------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TACTT------------ATATGTATTCTTTTGC--AGAA-AAAA-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTGAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAGATTAAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------TT-ATTGAA------------------------TT-TTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTTACCA-AAAAAAATTTCGA-------------ATTTTT--CAATTCATA--------AATATTTC-----CGAATTTGCTATTTCATAATCATTCAAAATTTAATAATAT----------ATTTTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------CGGTTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGAAAAGAAAT-TATATTT-----AC-CAATGCAAC----GTAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Schoenus_nitens ------------------------------------------------------------------------------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTT-----GCGA-AAACAC-GACCGTTGTGCTCGTG-ATC---GAACGCT-GCG--GGGGCAGCTTTTGCCTGCCCGTCCC--A---------------------------------------------------------AAAAAATACGGCGCGGGTTG---CG-CCAAGGAACACGATA--TGCAGAGGC--GGCGGGCGGAGCGCTCTGGCG-TGACGTCCG-CCATTGATGCA--------AGAGAT---ATACACA-TTATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCGGG--AGCCTAGCCTCGATGTGGATCTTGGCCCTCCGAGCC--CCAGGGCG-CGGTGGGCCC-AAGT-GCGTGGCCGTCGGAA--GGAG-------CCGGGAGCGGCGAGTGGTGGAC--TG-CTGCGTTCGTC-GCCCTATG-CGCCT-TTCCGGCATATGGCTTTGCTC-GACCCTC-GA-CG-AGGAG-TTG-CGTCGCA-TTTTGT--TGCGCGCGGCAACTTCGGATCGATA-CCCCAGG-TCAGGCGAGGCTACCCGCTGAGTTTAAGCATAT-------CTGCACTTTGGTGCGGCCAACCG-CC-GTGGGGC-TGTC-TTTTCACTATTTCT-TCCG-CTGTGCCC-TATAA--GCCT-GGGAAGAA----TGCTCGGATT-CGGTCGCCTGTGTGGTTGTACCCTTGTGT-GGTA-TGTT----CTC-GTTGGACT---GTAAT--------GC-CTGTGTTGTTGCTT---GCTTCTAT-TGACAGGCGC-AGCTGTTTCGA-TGGCATAGTG----CAT-CTGCGG-TTTT--GGGCGAAT----GTCCTT-TTGTT--GCACACGCATTA--T-GTCA-GCTCTCATGGATT-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGTC--CTGTGGATTTCTTCG--GG-ATGTCC---CTTGTGC--GTGGATTCATTA-CTTT--GCTGCTC----------------------------CGCTCTCGTCT-TAACAAATGTTGGGA--TGTTTGAGCGGGTGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCGAGATG-CCTGTCCC-----ATTGAAA-----TAAAGGAGCGA--TTGTCGTATG---CCGTCGTTTGAAA-GCACACCCC-CGCCATGGTCTTTGTCACAGAGATGTGGGGTGTGCCGGAAGATG-GCGCGTCGACCCTCGTAT--AAGACGTGCTACCTGGTTGATCCTGCCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGT-------------------------------------------------------AAAT-------------------------------------------AAACGAACTCAAA-----TAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGTTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TT--GGAAATCCAAAGGGGTTGGGGAT-GAGGGGACT-GGACCCTCC-TGGATAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCA-TAAAGAATTTAGA-------------ATTTTT--CAATTC------------------------AGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAA----------AAATTGATCATAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATATAT--ACATATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AACCAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTT-CC---------------------- Schoenus_pennisetis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-TGTC-TCTTCACTGTTTCC-TCCG-TCGTGCTC-TGGAA--GCCG-GGGAGGAA----CGC-TGGAAT-CGGTTGCCTGTGCGGTTGTACCCTCGTGC-GGTA-TTTT----TCC-GTCCGACT--TGCGAT--------GC-TTGCGACGTCGATA---GCTTCTGT-CGACGGGCGC-GGCCGAGTTGA-CGGCACGGTA----CGT-GCGCGG-TTTC--GGGCGGAG----GCCCTG-TCGCC--GCGGGCGTATTT--T-GTCG-GCTCTCACGGATG-CGGTG----CCCATCGAGGA-------TTCCG-CGGGCCTATGGC--TTGCGGATTTCTTCG--GG-ACGTCC---GTTGCGC--GTGGACTG-TTG-CTCC--{GT}CTCTCT----------------------------CA-----------------TGAGAGGG--------AGTCGTTGCTGC{GT}-------------CTGC{GT}CG--CGCGAGATG-TTTGTCCCGTCGGACCGAACC----GAATGAG-CGA--CTGTCGTGCG---TCGCCTCGCGACG-GTGCTCCC--CTGTCCCCGTCTTTGGGCGCGGGCGCGGGGTGCGCCGGTCTCGGAGCGCGCCGGCTCTCGTTT--AGGACGTGCTACCTGGTTGATCCTGCC----------------------------------------------------------------------------------------------------------------------------------------------AAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTTTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCTTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAATTAGCCGCTGCT------------------------------------------------------------------------------------TTTTC------TAT-AGTAAT-GAAGATGCTCTTGATTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG--AAAAAAAAGGATTTCTT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAAAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAATAACTTTGTAAATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATTTCTAATTTCTT-------------TCGAAAAAT-------------AGAAA------GAAGGGAAGAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGCAATAAAG-ATCCCC--------GAAGTAATGTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAAGGGATTCCGGAACAAGAAAACACTAT--TTGCAA----TGGTCTCAATT----AATGGA----AT---TGAAT-------------------------TATAATGAC--------G----AAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTGAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGGTTT----TTATTTCCACTTTT-----TCCAAATT-----------ATACAACTTGAGTTATGAGT--ATGGGTTCTA----------TTTTTTTTGT-AAGGACC------------AAAAAGGGATTTAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT---------------------------------CTAGAAATTCAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGG---------------CTGAGCTATCCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------GTTATGTCAATT-------AACT-------------------------------------------AAAGGAATTCAAA--AAATAAG-----------------AATTTATTCCA-AA------------------------------------------------------TA-----AATGGTATG----------TGA-------TTTCATA-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGGATTATTTTGCAAAAAA-AAAT-------------------GGA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTCAAAAAATCGACGGATTTTCTTCTTACTAA-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------CTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTATTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT-GTTGAATTAA-TTCAACA-TAAAGAATTTCGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CAAATTTGCTATTTCATAATTATTCAAAAATTAATAATAT----------AATTTGATCATAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATATCTTGGTTAGTATATATCATATGTCTT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAATATAAGTAATCAACTGTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGT------------------------------------------ Schoenus_rigens ----GGTTCGCCGCCCGTG-ACTTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTTGCTC-GGAA-AAACAC-GACC-CTGTGCACGTA-ACC---TAATGCT-GCC--GGGGCGGCTTAGCGG-CCCCGGCCC--ACCGG-ACGCGGTCC-TCACG--------------------GGCCG-CG-CGCCGGG-----AATACGGCGCGGTATG---CG-CCAAGGAACACGAGA--TGCTGAGGC--GGCCGGCGGAGCGCTCCGGCG-CACCGCCTG-TCGTCGATGCA--------AAGTAA------TACA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCAAGGGCACGCCTGCC---TGGGCGTTAGAAGCCTATCCACGCTCG-G--TGC----TCCCGATGCGGATCATGGCCCTCCGAGTC--CTACGACG-CGGTGGGCCT-AAGT-GTGCGGCCGCTGGGA--GGAGC-------CGTGAGCGGCGAGTGGTGGAA--CG-CTGCGTACGCC-GCCTCGCG-CTCCT-TGTCGGC------CCTTGACA-GACCCTT-TAACG-AGGAGCCTT--------GCCTACC--AAGGCGTGGCACTTTCGGATCGATA-CCCCAGG-TCAGGCGGGGCTACCCGC----------------------------------GCAGCCAACCG-CC-GTGGAGC-TGTC-TTTTCACTGTTCCT-CCCG-ATGCATTCTTTTGG--GCAG-GGGAGGGA----TCGCTTGCTATCGGTGATCTGTGTGGTTCTACCCTTGTGC-GGAA-TAAAA---GTA-GGCTTGAA--ATAGGC---TTTT-GC-TTGCGCTGTCGGCA---CGTGTTGT-CGTCA-GCGC-GGCTGATTTGT-TGGCATAATG----CTT-GTGCTG-CTGT--GGGCCAATGATGGCTCC-AGTACT--GCACACGCGTTT--T-GTCG-GCTCTCAC-GATG-CGGTG----CGTAATGAGGA-------AATCCATGCGTCTTCGGT--CGCTGGATTACTTCG--GGAATGTCC---CTTGCAC----GGATTG-TCG-CTTC--GTTGCTT----------------------------TGCTT--------------------------------------CG----GGG-CGCTTTC-CTGTGC---TGCGAGATG-CTTGCCC----------G-TT----GAAAAAG-CGA--TTGCCTGATC---TTGTCGTGTGATGGCG-CTCTC------------------------ATTGAGGGTGTGCCGGAAGCG--ACTTGTCGGCTCTCGT---GAAGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGGCC--ATTTCTTGTGGATTACC-----TGAGTAGAA------TACAAATATCTAGA-----TCCTT-GTA---------------CCTACGTCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAACGATTTATTCAAAAAAT-AATTTATTCAA-AAAAATAGA-ATAGTCAATGT-----------------------------------TAG-AATAATGATATGGA-TTAGTAGTGA-------TTTAATT-CTAGA----------------------------GATTTCT------------TGCTTA-------GCTGATATGTATTCTTTTACGAAGAA-AAAC-------------------GTA-GAAAATCAAATGGCTTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTTTTGTCGGTATTGACATGTAGAAT-GGACTCTCTCTTTATTCTC--------CTTGATTAAT-------------------CATTTTTT----CAAAATAT---------------------------------------------------------TTTGATTATTCA------------AT-ATTGAA-------------------------TTCTTTTTTCATTGAACTTC-T---------------AT--CTGAATCAA-TTCACCAT-AAAGAATTCAGATAAAGAATTCAGAATTCTTTTCAATTCAG---------AATATTTC-----CGAGTTTGCTATTTCATAATCATTCCAAATTTAACAATAT----------AATTTGATCGTGA-T---TGTGATT-------------AATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------AAGGTATCC-TTTCT-T-TA------TTTC--------GAT-AGAGA-AAGAAAT-TCTATTT-----AC-CAATGTAAC----GTAATCAACTCTA-----TTCGTTAGAATAACTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Scleria_distans ----------------------------------------------------------------------------------CGTAGGTGAACCTGCGGAAGGATCATTGTCGGTTTTGACTC-GTGA-AAACAC-GATCGGAGCACACGTG-ATA---GAACGCT-GGT--GCGGAGGCGCT-CCG-CTCCAGCAA--ACCGG-CCACAGTCG-CCGTGCCCTCC-----GGGTGCGTTGGCTG-CC-TGGCAG------AATACGGCGCGGGCTGA--CG-CCAAGTAACCAGCGA--TGTGGAGGC------------ATACTGTAGTG-CTCC-TTTG-TGGCTGATGCC--------AATGAT------TTTG-ACATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCTAGGGACCTGCCCGAGGGCACGCCTGCCTCATGGGCGTAATTAGCCCATCAACGCTCATG--TGC----CACCGTAGCGGATGATGGCCCTCCGAGCC-TTGAGGGCAACGGCGGGCCC-AAGT-GTTTGCCGGTCGCAA--GTGTC-------TGGGAGCGGTGAGTTGTGGGA--AC-CTACATGCTCC-GCCCCGTG--CATC-TGCTGGC------TCGAATTC-GACCCC--GGTTG-AGGAGCTCGTTGTCGGTGCGTCCG--GCCATGAGGAACCCTCGGACCGATA-CCCCAGG-TCAGGCGGGGTTACCCGCCGAGTTTAAGCATA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGGGGTTAAAGATTACAAACTCACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGCTGGAGAAGACAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGCGCTTTACGGTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAACGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTAGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTATGGTAGAGCATGTTATGAATGTTTACGTGGTGGGCTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATTAAAAGAGCTGTATTTGCTAGAGAATTAGGAGTTCCTATTATAATGCATGACTACTTAACTGGAGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCATTCTGGTACAGTAGTAGGTAAACTAGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACTGAAATCTTTGGAGATGATTCTGTACTCCAGTTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAGCTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATATGATCCGGTAGATAAACTAGAT-----------------------------------------TAT-ACTAAT-GAAAATGCTCTTCACTCGACATAATTTGTTCTGCTTAGGTTGTCAG----------------TAAAGAGTA-CAT----------GATGAAGCTCGAG---AAAAAAAAGACTTGATT-------------TTTTTT--------ATC-----AAG---------CAAGGGAAAGATTCTAGGGTTTATGAAAAAAAATAG-------------------------------------AACA--------AATTTAGACCAACTTTGTAAATATATTCTTAGCATC--------GAAATCAAAAA----------------------------------------------------------------GTGAAATTTTTTT----AAAATGGTAAC-----AC-----------TTTTTTGATCAAAAA---AAGGTGGAACGGGAATGAATTCTTCCTCCTTCTTT-------------AAAAAGAA-------------------------GAAGG--------AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGATTAAAG-GTCCCC--------GAAGTAATGTATAAACCTAATGATTCAAAA--------AAAATA-GAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTTAAC-----AATTTA----TTAAATAAATTAATATTTAATTTATTACAATTTTATATTTTTAT--------A---AATTAAAA------TA----GATTAGACATGAGACAAACAAACGAGTTTAGAGACAGCTCAAA-------AGT----T--TCA----TGAAGATTT----TTCTTTGAACTTTA-----TCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATGAATGATA--------TTTTTTTTATGT-AAAAAAGGGTAAAAAACATAAAAAAGAACTCAATTA-GAATC-----------------------CTAGTCCAAGT-CAATTTT-----TTAGGAA-----TCCATATTTCTTCA---ATT-------------CCATA---------------CAGGAATTGAAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATTCCGGCT--ATTTTTTGTGGATTATC-----TGAGTAGAA------TA------------------TCTT-GTA---------------TCTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATA----------------------------TAATAGA----------------------------GATTCCT------------TCCTTA---------TTATATATATTCCTTGC-TTATAA-ATATTTAGGAAG-----------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTGAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCTATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAGTCAT---------------------------------TTTATAGCAAACTTTAT-------------------CATGAAT---------------GATTTGATTATTAA------------ATCATCAAT------------------------TCTTCTCTCTTATAGAACTTT-T---------------AT--TCGAATCAA-TTCATCATATAAGAATTCAAA---------------------TAATTCTTA--------ATTATTTT-----CAGATTTGCTATTTTCTAATCATTCACAATTGATAAAGAA----------AATTTCATTGTGATT---AATGATTA-AACATTTGAATAATCAAT----ATATATACATACGTATGTC-----------------------TT-----CGGTATA-TA-------------------GGATGACCC-TTTCTCTCTA------TATT--------TAATAGAGA-----AAT-TCTACT------TGCCAATGCAAC----GTAATAAATTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCCCTGAATTTGGAAGTTAA-CACTTAG-AAGTT------------------------- Tetraria_bolusii ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-T{AG}GAA--GCCG-GGGATGAA----TGCTTGAAAT-CGGTGGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TAGCATAGTA----CAT-GTGC{AG}G-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATAC{AG}TATTA--T-GTCG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-{CT}GGGCCTTTGGC--{CT}CGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTTGTCT-TGACCAAT{AG}TCAGGA--TGTTTGAGTGG-TGCTCGCGGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTTGTTTGAAA-GTACACCC--TCGTCTTAGTCATGTTACCGAGATG{CT}GGGGTGTGCCGAAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATA---------------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATC---AAAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAACGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATTTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G--AAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGGTA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Tetraria_capillaris ----------------------------------------------------------------------------AGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG---TTGGCTT-GCGA-AAACAC-GACCGTTGTGCATGTG-ATC---GAATGCT-GCC--GGGGAGGCGCTGCCT-TCTCGGCCC--ACCGG-CC-CGGCCC-TCGCGCC-TTC----GGGGCGCGTTGGTCG-TG-TGCCG-------AATACGGCGCGGGTTGA--CG-CCAAGGAACACGGTA--TGCTGAGGC--GGCTGGCGGAGCGCGAAGGCG-CACTGCCCG-CTGTCGATGCA--------AAGGAA----AAACCA-TGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCTGCCCGAGGGCACGCCTGCC---TGGGCGTTAGAAGCCCATCCACGCTCATG--CGC----CCCCGATGCGGATATTGGCCCTTCGTGCC--TGAAGGCG-CGGCGGGCCC-AAGT-ACGTGGCCGTCTGGT--TGGGCTCATACCCGGGAGCGGCGAGTGGTGGGAATTT-CTGCGCGCGCC-GCCCCGTG-TCCCC-AGTCGGC------CCTGCAAT-GAAACCCCAAACG-AGGAGCCGGCTGACGCAGCCTGGT--GCTGTGCGGCATCTTCGGACCGATA-CCCCAGG-TCAGGCGGGGCTACCCGCCGAGTTTAAGCATATAAATAAGCTGCGCTTCTGCGCGGCCAACCG-TC-GTGGAGT-TGTC-TTTTCACTCTTCCT-CCCG-TTTGCATTGCTGTT--GCGG-TTGAGGAA----TGC--GTTGT-CGGTTGCCTGTGTTGTTCTACCCATGCGG-GGAA-TACGG----AA-ATTTTCATGA-TGGAT---GTTT-GC-TTGCACCGTTGATA----TTTTTAT-CGTCG-GCGC-AGTCGATTGGT-TGGCTAAATC----CTT-GTGCCG-CAGC--GGGTCAAT-AATGCCTC-GATACTCGGCACTTGGATTT--T-ACCG-GCTCTCGCGGATG-CCGTG----TCCATCGAGGA-------ATCTG-TTGGCCTCTGGCC-ATTTGATTT-CCTCG--GG-AGGTCC---CATGTAC----GGATTT-TTG-CTCT--GCCGCTC----------------------------TGCTATC-TCG-TCTCCGGAATGATGGGATGT----------GTGAGCGGTG-CGTGCCC-CCGTGCA--TGCGAGATG-TTTGCCC----------GATTGATTGAATGAG-CGA--CTGCCGGTTC---TCGTCGTGTG-GGCG-ACTCCTATTC--------------------ATTTAGATTTTCCCGC-CAT--------------------------------------------------------------------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATTTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCTGCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCGCCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACGTCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACCAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGCAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGCCTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCTTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGCCCTGAACTAGCCGCTGCTTGTGAAGTGTGGAAAGCAATTAAATTTGAATTCGATCCGGTAGATAAACTTGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGGCC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTCGTATCTAGA-----TACGA-GTA---------------CCTATGCCAATT-------AAAT-------------------------------------------AAAGAAACTCAAA-----TAAC------------------ATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCTT------------TGCTTA------------TATGTGTTATTTTGTGAAGAA-ATAG-------------------TTA-AGAAATCAAATGGGCTTGGGGATA-AGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTA-----------------------------------AATATTCTAGCAA-GTCTAT-------------------AATGAAT---------------GATTTTATTACTAA------------AT-ATTGAG--------------------------TCCTTTCTCATTGAACCTC-T---------------AT--TTGAATCAA-TTCACCAT-AAAAAATTCAGA-------------AATTTG-TGAATTCATA--------AATATTTT-----CAAATTTGCTATTTCATA-TCATTCACAATTT-----CAT----------AAATTGATCGTGA-T---TATGATTA-ATAATTTGATTAATCAGT----GTATAT----ACGTATGTC-----------------------TT-----TAGTATA-TA--------------TAGGGCGGCTATTC-GTTCTCT-TA------TCTT--------GAT-AG-GA-----AAT-TCCACCT-----AC-CTATGCAAC----GTATTCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_compacta ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-TGGAA--GCCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-{AT}AGCATAGTA----CAT-GTGCGG-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACATATTA--T-GTCA-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGA{AT}CA-TTA-CTCT--GCTGCTT----------------------------CGCTCTT{AG}TCT-TGACCAATG{CT}CAGGA--TGTTTGAGTGG-TGCTCGCGGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----AGTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTTGTTTGAAA-GTACACCC--TCGTCTTAGTCATGTTACCGAGATGTGGGGTGTGCCGAAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTA--------------------------GCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGAT------------------------------------------------AAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATATAATTAA--------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATC---AAAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC-----------------CAAAAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAACGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAT-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATTTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATCAC--------G--AAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGGTA--GAATAAATTAAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGG-----------------CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTACAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Tetraria_compar -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C-AGTC-TTTTCACTATTTCT-TCCG-TTGTGCTC-TAGAA--GCCG-GGGATGAA----TGCTTCAGAT-CGGTTGCCTGTGCGGTTGTACCCTCGTGC-GGTA-TGTT----TTC-GGCGGACTCT-GTAAT--------GC-TTGTGCTGTTGCTA---GCTTCTAT-CGACAAGCGC-AACCGGTTTGA-TGGGATAGTA----CAT-GTGCGG-CTGT--GGGTGGAT----ACCCTG-TTGTT--GCATACGTATTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCTATCGAGGA-------TTCCG-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-ATGTCC---CTTGTGC--ATGGATCG-TTA-CTCC--GCTGCTT----------------------------CGCTCTCGTCT-TGACCAATGTCGGGA--TGTTTGAGCGG-TGCTCGCAGGG-CGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAAAT----GAATGAG-CGA--TTGCCGTATG---TCGTCGTGTGAAA-GTACACCC--CCATCTTAGTCTTGTTACCGAGATGTGGGGTGTGCCGGAAGATG-GCGCATCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------GCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTACTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATTTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGAACCGGTAGATAAATTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATA-----AAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAATGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GAATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G--AAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAAGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGATA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTT--------GAT-AGAGAAAAGAAAC-TCTACTT-----AC-CAATGCAAC----GTAATTAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Tetraria_crassa ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-TGGAA--GTCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TAGCATAGTA----CAT-GTGCGG-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACATATTA--T-GTCG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTTGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGCGGGG-TGTGCTC-TTGTGCA--TGTGAGATG-TTTGTCCC-----AGTGAATT----GAATGAG-CGA--TTGCCGTATG---TTGTTGTTCGAAA-GTACACCC--TCGTCTTAGTCATGTTACCGAGATGTGGGGTGTGCCGAAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------GCAGGGGTTAAAGATTACAAACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGTCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATC---AAAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------ATGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAACGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATTTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G-AAAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------ACAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGGTA--GAATAAATTAAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATTCCGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAT----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Tetraria_cuspidata ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCACTTCGGTGCGGCCAACCG-CCGTGGAAGC-AGTCTTTTTCACTATTTCT-TCCATTTGTGCTC-TGGAA--GTCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TAGCATAGTA----CAT-GTGCGG-AATT--GGGTGAAC----ACCCTA-TTGTT--GCATACATATTA--T-GTCG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTTGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGTGGGG-TGTGCTC-TTGTGCT--TGCGAGATG-TTTGTCCC-----AT--AATT----GAATG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATA--------------------------------CCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATC--AAAAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAACGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAA-GTCCCC--------GAAGTAATTTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G-AAAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTA----------T-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGGTA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTTTTT------------------CC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTTATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAAA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATTCAATCA Tetraria_exilis ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCA-TTGTGCTC-TGGAA--GTCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TAGCATAGTA----CAT-GTGCGG-CTGT--GGGTGAAC----ACCCTA-TTGTT--GCATACATATTA--T-GTTG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTACTT----------------------------CGCTCTTGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGCGGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----AGTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTTGTTTGAAA-GTACCCCC--TCGTCTTAGTCATGTTACCGAGATGTGGGGTGTGCCGAAAGATG-GCGCATCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGG{AG}GG{AG}TTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAA{CT}GG{CT}CTACTTCTTCACAT{CT}CACCG{CT}GCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCA{CT}TACGTATGTC{CT}GGTGGAGATCATATTCAC{GT}CTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATAT{CT}GAAAAAGATCGTAGTCG{CT}GGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCC{GT}GTGGCTTC{AT}GGAGG{AT}ATTCATGTTTGGCATATGCCTGCTTT{AG}AC{CT}GA{AG}ATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAAC{CT}TTAGG{AG}CA{CT}CCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATA--------------------------------CCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATC---AAAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAACGGGAGTAAATCCTTCTTAATTTCTTTATAAAAATAGTTTATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATTTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G-AAAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGGTA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTTTTT-----------------------------GTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACGATTAAAGAAT--------------------TTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-C---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATTCAATCA Tetraria_flexuosa ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTGCTTCGGCGCGGCTAACCG-TC-ATGGCGC-TGTC-TTTTCACTGTGTCT-TCCG-TTGTGCCC-GCGCG--GCCC-GGGAGGAA----TGCTCGTTTTTCGGTCGTCTGTGTGGTTCTACCCTGGTGT-GGTA-CGATA---TTC-GGTTCCATGA-CGGAT---ATTT-GC-TTGCCCCGTTGGTA---CTCGCTAC-CATCG-GTGC-AGCCGGGTTGC-GGGCTCAATT----CAT-GTGCTG-CAGC--GGGCGAAG----GCCTCG-GCGCT--GCACTTGGATTT--C-CCCA-GCTCTCACGGATG-CCGTG----CCCTTCGAGGA-------ACTCG-CGGGCCTCCAGA--CCCCCGATTCCCACG--GG-AAGTCC---CTTGCAT---TGGATCA-TTG-CTCC--GCCGCTC----------------------------TGCTCTT-TTG-TTGCGGGTGTTGGGA--TGTTGGCGCGG-TGCGTGCGGG--CGTGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GTTC----GAATGAG-CGA--TTGTCGCGCG---TCGTTCCTT-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA-------------------------------------------------TATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGACTTTGGCTTTTTATTGTCGTGATAACGGTATACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTTCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTGGATCCGGTAGATAAACTAG--------------------------CCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG---AAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------CATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATCAAAAAGAGAACATCCAATTCGC-----ACAAGTAAA------------AAAAAAAAAGAAAAGATTAAAGTGAAATTGATGA-AAAAAACTCTTTTG-----AT-----------CTTTTTGATTAT------AAGGTGTAACGGGAGTGAATCCTTCCTATTTTATT---------TAGTTAGAAA---------------------------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAA-GTCCCC--------GAAGTGATGTGTAAACCCAAAGATTCAAAAAAG-----ACGATATTAAA-GGATTCCGGAACAAGAAAACATTAT--TTGTAA----TTGTCTCAAC-----AATATATGTCAT---TGGAT-------------------------CATAATGAC--------A---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TAAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA----GATA-TTTTTTTCTGT--AAGGGGGC----------AAAAAAGTATTCAATT---------------------------------------------------------------------------------------------------CAAAA-CAA-----------AAAAAAATTGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGAGGCATTTTTTTT--------------------------------------------------ATAATG-TACTTGTATCTATT-----------------------------TCAATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATGGA-ATAGTAAATGT-----------------------------------TAG-GATAATGATATGAG-TTAGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAATAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-CTTTTCTCATTTAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATTC-TTTCCCT-TA------TTTC--------G------GA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTAAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_involucrata ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGCTTCGGCGCGGCTAACCG-TC-ATGGCGT-TGTC-TTTTCATTGTGCCA-CCCG-TTGTGCGC-GTGTG--GCCC-GGGAGGAA----CCCTCGTTTTTTGGTCGTCTGTGTGGTTCTACCCTTGTGC-GGTA-TGACA---TTC-GGTTCCATGA-CGGTT---ATTT-GC-TTGCCCCGTTGAAA---TTTGTTAT-CATCG-GTGC-AGCCGAGTTGC-GGACTTAATT----CAT-GTGCTG-AAGT--GGGCGAGG----GCCTCG-GTACT--GCACTTGGATTT--T-GTCG-GCTCTCACGGATG-CTGTG----CCCTTCGAGGA-------ACTCG-CGGGCCTCCGGTC-CCCCCGATTCCCACG--GG-ATGTCC---CTTGCAT---TGGATCT-TTG-GTCC--GTCGTTC----------------------------CGCTATA-TTG-TTGCGGGTGTTGGGA--TGTCGGCGCGG-TGCGTGCGGGT-CGAGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCCCG---TCGTTCCTC-AGC-GT------------------------------------------------------CGCGGCGACACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA--------------------------------AAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGAGTTTGTCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATAAACTAGAT------------------------CCACCATTTTC------GAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG-AAAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAGCAAGAGAAACAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATAAAAAAGAGAACATCAAATTCGC-----ACAAGTTTC--------------AAAAAAAGAAAAGATTAAAGTGAAATTGATGAAAAAAAACTCTTTTT-----AT-----------CTTTTTGATTAT------AAGGTGTAACGGGAGTAAATCCTTCCTATTTTATT-------------TAGAAA---------------------------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAA-GTCCCC--------GAAGTGATGTGTAAACCCAAAGATTCAAAAAAG-----ACGATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATATATGTCAT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TAAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA----GATATTTTTTTTCTTT--AAGGGGAC----------GAAAAAGGATTCAATT---------------------------------------------------------------------------------------------------CAAAA-CA------------AAAAAAATTGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGAGGCATTTTTTT----------------------------------------------------TAATG-TACTTGTATTT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAAGAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------TTTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCAGA-------------ATTTTT-GGAATTCATA--------AATACTTC-----CTAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAACTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_microstachys ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGCTTTGGCGCGGCTAACCG-TC-ATGACGC-TGTC-TTCTCACTGTGCCT-CCCG--TGTGCCC-GCGTG--GCCC-GGGAGGGT----CGCTCGTTTTTCGGTCGTCTGTGTGGTTCTACCCTAGTGCGGGTA-CGACA---TTC-GGTTTCATGA-TGGAT---ATTT-GC-TTGCCCCGTTGATA---TTCG-TAT-CATCG-GTGT-AGCCGACTTGC-GGGCTCAATT----CAT-GTGTTG-CAGT--GGGCGTGG----GCCTCG-GCACT--GCACTTGGATTT--T-GTCG-GCTCTCGCGGATG-CCGTG----TCCTTTGAGGA-------ACTT--TGGGCCTCCGGT--CCCTCCATTCCCACG--GG-AAGTCC---CTTGCAT---TGGATCA-TTA-CTCC--GCCGCTC----------------------------CGCTATC-TTG-TTGTGGGTGTTGGGA--TGTTGGCGCGG-TGCGTGCGGGG-CGTGCTC-TTGTGCA--AGTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCGCG---TCGTTCCAC-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA--------------------------------AAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTCTGTGCCGAAGCACTTTTTAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGAGTTTGTCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAAATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT------------------------CCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTTAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG---AAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATCAAAAAGAGAACATCCAATTCGC-----ACAAGTTTC--------------AAAAAAAGAAAAGATTAAAGTGAAATTGATGA-AAAAAACTCTTTTG-----AT-----------CTTTTTAATTAT------AAGGTGTAACGGGAGTGAATCCTTCCTATTTTATTTATAAAGAA----TAGAAA---------------------------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAA-ATCCCC--------GAAGTTATGTGTAAACCCAAAGATTCAAAAAAG-----ACGATA-TAAA-GGATTCCGGAACAAGAAAATACTAT--TTGCAA----TTGTCTCAAC-----AATATATGTCAT---TGGAT-------------------------TATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGATAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TAAAAATT-----------ATTCAACTTGAGTTATGAGT--ATTAATGATA----GATATTTTTTTTCTGT--AAGGGGGC----------GAAAAAGGATTTAATTC--AAAA--------------------------------------------------------------------------------------------CAAAA-CA------------AAAAAAATTGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGAGGCATTTTTT------------------CC--GTTTCTTGTGAATCACA-----AGAGTAGAATAATG-TACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TAAA-----------------AATTTATTCAA-AAAAATGGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAAGAATTACTTA-GGAAAT-AAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC---T--------------TTTTTTCC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------AATTTGATTATTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTTAATCGA-TTCATCA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATA-----------------------------------------------------------ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACTT-----AC-CAATCCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_nigrovaginata ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGCTTTGGCGCGGCTAACCG-TC-ATGGCGC-TGTC-TTTTCATTGTGTCC-CCCG-TGGTGCGC-GTGCG--GCCC-GGGAGGAT----CGCTCGTTTTTCGGTCGTCTGTGTGGTTCTACCCTAGTGC-GGTA-CGTCA---TTC-GGTTCAATGA-TGGAT---ATTT-GC-TTGCCTCGTTGATA--TTTCATTAT-CATCG-GTGT-AGCCGACTTGC-GGGCTTAATT----CAT-GTGTTG-CAGT--GGGCGTGG----GCCTCG-GTACT--GCACTTGGATTT--C-GTCG-GCTCTCACGGATG-CCGTG----TCCTTTGAGGA-------ACTT--TGGGCCTCCGGT--CCCTCGATTCCCACG--GG-AAGTCC---CTTGCAT---TGGATCA-TTA-CTCC--GCCGCTC----------------------------TGCAATC-TTG-TTGCGGGTGTTGGGA--TGTCGGCGCGG-TGCGTGCGGGG-CGTGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCGCG---TCGTTCCAC-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------------------------------------------------------------GATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGACCGCCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGACTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTATTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACATTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGGATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG----AAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATCAAAAAGAGAACATCCAATTCGC-----ACAAGTTTC------------AAAAAAAAAGAAAAGATTAAAGTGAAATTGATGA--AAAAACTCTTTTG-----AT-----------TTTTTTGATTAT------AAGGTGTAACGGGAGTTAATCTTTCCTATTTTATT-------------TAGAAA---------------------------AAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAA-GTCCCC--------GAAGTGATGTGTAAACCCAAAGATTCAAAAAAG-----ACGATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATATATGTCAT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA----GATATTTTTTTTCTGT--AAGGGATC----------AAAAAAGGATTCAATTC--AAAA--------------------------------------------------------------------------------------------CAAAA-CA------------AAAAAAATTGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGAGGCATTTTTTT-----------------CC--GTTTCTTGTGAATCACA-----AGAGTAGAATAATG-TACTTGTATCT-----------------------------------ATTTAAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------TTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAATAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTTATTAATC------------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCATA-------------ATTTTG-TGAATTCATA--------AATACTTA-----CGAATTTGCTATCTCATAATCATTCCCA--TT--AAAAAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCTACCT-----AC-CAATCCAAC----GTAATAAACTATA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_octandra ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTGGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTCAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATCGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGAGGAATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAGCCGGTAGATAAACTAGATAAGGCGAAATAGAAAGAT-------------------------------AT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG----AAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATAAAAAAGAGAACATCCAATTCGC-----ACAAGTTTC-------------AAAAAAAAGAAAAGA-GAAAGTGAAATTGATGA-AAAAAACTTTTTGA-----AT-----------CTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCCTATTTTATT-------------TAGAAA---------------------------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAA-GTCCCC--------GAAGTAATGTGTAAACCCAAAGATTCAAAAAAG-----ACGATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATGTATGTCAT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTATAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA----GATATTTTTTTTCTGT--AAGGGGGC----------GAAAAATGATTCAATTC-----------------------------AAATCAGCATC-AAA-ATT-----TTATGAG-----TCCATTTTATTTTGC--ATT-------------CTATA-CAAAACA-------AAAAAAATTAAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGG------------------------------C--ATTTCTTGTGGATCACC-----TGAGTAGAATAATA-TACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATACGGG-TTGGTAATGA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TTTTTCGAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--TT--------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCACCA-TAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATAATTC-ATCATTTGATTAATCAGT----ATATAT----ACGTATATA-----------------------TT-----TGATATA-TA-------------------TGGTTATCC-TTCCTCT-TA------TTTC--------GAT-AGAGG-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACT---------------------------------- Tetraria_picta ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCACCTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTAT-TCCA-TTGTGCTA-TAGAA--GTCG-GGGAAGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTCGCGC-GGTA-TGTTT---TTC-GGTGGACTCT-ATAAT--------GC-TTGTGCTGTTGCTA---GCTTCTAT-CAACAAGTGC-AATCGGTTTGA-TGGGATAGTA----CAT-GTGCGG-CTGT--GGGTGAAT----ACCCTA-TTGTT--GCATACGTATTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCA--GG-ATGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTCGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCAAGATG-TTTGTCCC-----ATTGAATT----GAATGAG-CGA--TTGCCATATG---TCGCCGTGTGAAA-GTACACCC--CCTTCTTAGTCTTGTTACTGAGATGTGGGGTGTGCC--AAGATG-GCGCATCAACACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA-----------------------------------------AACTTACCTATTATACTCCTGAGTACGAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTACTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATTTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAATTAGATAAGTAAGGCAAAATAAAAAGA---CCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGAACAACTTTGTAAATATTTCCTTAGCATA----AAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAATGGGAGTAAATCCTTCTTAATTTATT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GAATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G--AAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGAA----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGATA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTTTTT------------------CC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAGAATTAAG----------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTT--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGTCAC----GTAATTAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATTCAATCA Tetraria_sylvatica ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCACTTCGGTGCGGCCAACCG-CC-GTGGAGC-AGTC-TTTTCACTATTTCT-TCCG-TTGAGCTC-TAGGA--GCCG-GGGATGAA----TGCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTCGTGC-GGTA-TGTT----TTC-GGTTGACTCT-ATAAT--------GC-TTGTGCTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TGGGATAGTA----CAT-GTGCGG-CTGT--GGGTGAGT----ACCCTA-TCGTT--GCATACGTATTA--T-GTCG-GCTCTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-ATGTCC---CTTGTGC--ATGGATCA-TTA-CTCC--G{AC}TGCTT----------------------------CGCTCTCGCCT-CGACCGATGTCGGGA--TGTTTGAGTGG-TGCTCGCAGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----ATTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTCGTGTGAAA-GTACACCC--CCATCTTAGTCTTGCTACCGAGAAGTGGGGTGTGCCGGAAGATG-GCGCATCACCTCTCGTTT--AAAACGTGCTACCTGGTTGATCCTGCCAG------------------------------------------------------------------------------------------------------------AGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTCCTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTACTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATTTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGAACCGGTAGATAAATTAGATAAGTAGATAAATTAGATAAGG---CCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATA----AAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----ACTTTTTTGAT--TTTTTTGATCAT------AAAGTGTAATGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GAATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------G-AAAAAAAAAA------TA----AATTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTAATT-CACAATT-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGATA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTTTT-------------------CC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTGATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAAGAA-AAAT-------------------TTA-GGAAATTAAATGGGCTTGGGGATAGAGGG-ACCTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATT-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGATTCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAATTTAGA-------------ATTTTT--CAATTCAGA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATATCTTTGTTAGTATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTT--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATTAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATTCAATCA Tetraria_triangularis -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCTTCGGCGCGGCTAACCG-TC-ATGGCGC-TGTC-TTTTCACTGTGCTT-CTCG--TGTGCCA-GCTTG--GCCC-GGGAGGAA----TGCTCATTTTTCGGTCGTCTGTGTGGTTCTACCCTAGTGCGGGTA-CGACA---TTC-TATTCTATGA-TGGAT---ATTT-GT-TTGCCCCGTTGATA---CTCGTTAT-CATCG-GTGC-AGCTGATTTGC-GGGCTTAATT----CAT-GTGCTG-CCGT--GGGCGAGG----GCCTCG-GCACT--GCACTTGGATTT--T-GCCG-GCTCTCACGGATG-CCGTG----CCCTTCGAGGA-------ACTCG-CGGGCCTCCGGT--CCCCCGATTCCCACG--GG-AATTCC---CTTGCAT---TGGATCA-TTG-CTCC--GCCGCCT----------------------------CGCTATC-TTG-TTGCGGGTGTTGGGA--TGTCGGCGCGG-TGCGTGTGGGG-CGTGCTC-CTGTGCA--ATTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCGCG---TCGTTCCAT-AGC-GT------------------------------------------------------CGTGGCGGCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG--AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATCAAAAAGAGAACATCCAATTCGC-----ACAAGTTTC--------------AAAAAAAGAGAAGATTAAAGTGAAATTGATGACAAAAAACTCTTTTG-----AT-----------CTTTTTGATTAT------AAGGTGTAACGGGAGTGAATCCTTCCTATTTTATT-------------TAGAAA---------------------------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAA-GTCCCC--------GAAGTGATGTGTAAACCCAAAGATTCAAAAAAG-----ACGATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATATATGTCAT---TCGAT-------------------------CATACTGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGTATTT----TCTTTTGAACTTTC-----TAAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA----GATATTTTTTTTCTGT--AAGGGGAC----------GAAAAAGGATTCAATT---------------------------------------------------------------------------------------------------CAAAA-CA-----------------AAACGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGAGGCATTTTTTT----------------------------GTGAATCACA-----AGAGTAGAATAATG-TACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TATTTCGAAGAA-ATACTTAGGCAAAGAAGAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATCTTTT--------------TTTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCTACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTA-------------------------------- Tetraria_ustulata ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGCTTCGGCGCGGCCAACCG-CC-ATGGTGC-TGTC-TTTTCACTGTGCCT-CCCG-TCGTGCCC-TCGCG--GCCC-GGGAGGAA----CGTTCGTTTTACGGTCGTCTGTGTGGTTCTACCCTAGTGC-GGTA-CGACA---TTT-GGTTCCATGA-CGGAT---ATTT-GC-TTGCCCCGTTGATA---TTCGTTAT-CATCG-GTGC-AGCCGAGTTGC-GGGTTTAATT----CAT-GTGCTG-CAGT--GGGCGAGG----GCCTCT-GCACT--GCACTTGGATTT--C-GCCA-GCTCTCATGGATG-CCGTG----CCCTTCGGGGA-------ACTCG-CGGGCCTACGGG--CCCCCGATTCCCACG--AG-AAGTCC---CTTGCAT---TGGATCA-TTG-CTCT--GCCGCTC----------------------------CGCTATC-TTG-TTGCGGATGTTGGGA--TGTCGGCGCGGTTGCGTGCGGGG-CGTGCTC-CTGTGCA--AGTGAGATG-TTTGTCC----------GATC----GAATGAG-CGA--TTGTCGCCCG---TCGTTCCTC-AGC-GT------------------------------------------------------CGTGGCGGCACTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTCA--------------------------------AAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTATTCCGCAAAAAACTACGGTAGAGCATGTTATGAATGCTTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCCTTTTTGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACGAGTTTGTCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAGGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTCATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTAGAT------------------------CCACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG---AAAAAAAAGGATTTATT-------------TTTTT---------ATC-----AAG---------CAAGAGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAG---------------------------AATG--------AATTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATCAAAAAGAGAACATTCAATTCGC-----ACAAGTAAA-------------AAAAAAAAAAAAAGATTAAAGTGAAATTGATGA-AAAAAACTCTTTTG-----AT-----------CTTTTTGATTAT------AAGGTGTAACGGGAGTAAATCCTTCTTATTTTATT-------------TAGAAA---------------------------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTTA-GAGGAATAAAA-GTCCCC--------GAAGTGATGTGTAAACCCAAAGATTCAAAAAAG-----ACGATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGTAA----TTGTCTCAAC-----AATATATGTCAT---TGGAT-------------------------CATAATGAC--------A---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TAAAAATT-----------ATTCAACTTGAGTCATGAGT--ATTAATGATA----GATATTTTTTTTCTGT--AAGGGGGC----------AAAAAAGGATTCAATT---------------------------------------------------------------------------------------------------CAAAA-CA------------AAAAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGAT-GAAAATCTCATATACGTTTCTGGGGGAGGCATTTTTTTT----------------CG--GTTTCTTGTGAATCACA-----AGAGTAGAATAATG-TAATTGTATCT-----------------------------------TTTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATTA-------TTTCATC-ATAGA----------------------------GATTTCT------------TGCTTA-----------CTATATA---------GAAGAA-ATACTTAGGCAAAGAATAATTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCTAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATA------------------TTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCA-TAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTT-----CGAATTTGCTATCTCATAATCATTCCCATTTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTT-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATTC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Tetraria_variabilis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTGAAAT-CGGTTGCCTGTGCGGTTGTACCCTGGTGC-GGTA-TGTT----TTC-GGTGGACTCT-ATAAT--------GC-TTGTGTTGTTGCTA---GCTTCTAT-CAACAAGCGC-AGCCGGTTTGA-TGGCATAGTA----CAT-GTGCGG-A{AT}TT--GGGTGAAC----ACCCTA-TTGTT--GCATACGTATTA--T-GTCG-GCTTTCATGGATG-CGGTG----CCCATCGAGGA-------TTCCA-TGGGCCTTTGGC--CCGTGGATTTCTTCG--GG-AAGTCC---CTTGTGC--ATGGATCA-TTA-CTCT--GCTGCTT----------------------------CGCTCTTGTCT-TGACCAATGTCAGGA--TGTTTGAGTGG-TGCTCGTGGGG-TGTGCTC-TTGTGCA--TGCGAGATG-TTTGTCCC-----AGTGAATT----GAATGAG-CGA--TTGCCGTATG---TCGTTGTTTGAAA-GTACACCC--TCGTCTTAGTCATGTTACCGAGATGTGGGGTGTGCCGAAAGATG-GCGCGTCGGCTCTCGTTT--AAGACGTGCTACCTGGTTGATCCTGCCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTAGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTTTAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGGTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCCGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTGGCTTCTGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACTGAGATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGGCATCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGATTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAGG-AAAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TATAATTAATTAATAT--------------AATT--------AATTTAGAACAACTTTGTAAATATTTTCTTAGCATC--AAAAAAAAAATCAAAAAGAGAATATCCAATTTGATTTGAACAAGTTTC--------------------AAAAAAA------GTGAAATTGTTGG----AAACTGGAAAA-----AC-----------TTTTTTGATCAT------AAAGTGTAACGGGAGTAAATCCTTCTTAATTTCTT-------------TATAAAAAT-------------AGAAA------GAAGGGAATAACAAAAAAAAGGTATGTTGCTTTCCTTTTGA-AAGGAATAAAA-GTCCCC--------GAAGTAATTTATAAACCTAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAATT----AATGTA----AT---TGAAT-------------------------CATAATGAC--------GAAAAAAAAAAA------TA----AGTTAAAGATGAGACAAGCAAAAGAGTTTAAAGACAGCTCAAG-------AGA----T--TAA----TAAAGATTT----TTCTTTAAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGAAGGA-----------AAAAAAGGATTCAATTC-GAATA-----------------------AGAGTTTA----------T-----TTATGAA-----TCTATTTTTT-------ATT-------------CTATA------TTCGGTA--GAATAAATTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGG-----------------------------CGACC--ATTTCTTGTGGATCACC-----TGAGTAGAA------TACTTGTATCTATG-----CACTT-GTA---------------CCTAC-TCAATT-------AAAT-------------------------------------------AAAGGAACTCAAC-----AAAG-----------------AATTTATTCCA-AA------------------------------------------------------TAG-GATAATGATATGGA-TTTATAATGA-------TTTCATT-CTAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTCTTTTGCAAATAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTAAAAAAATCGACGGATTTTCTTCTTACTAT-AAATTTCATTGTTGTCAGTATTGACATGTAGAAC-GGACTCTCTCTTTATTCTCC-------TTTGATTAATC-------------------TTTTTTC----A-AAAAATATAGCAAACTCTAT----AATGAATGAATCTATAATGAAT---------------CATTTGATTACTCA------------TT-ATTGAA------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCATTAAAGAAT--------------------TTTT--CAATTCAAA--------AATATTTC-----CGAATTTGCTATTTCATAATTATTCAAAATTTAATAATAT----------AATTTGATCGTAA-T---TATGATTA-ATCATTTGATTAATTAGT----ATATAT----ACGTATGTCTTTGTTAATATATATCGTATGTATT-----TGGTATA-TA-------------------TGGTTATCC-TTTCTTT-TATTTCAATTTC--------GAT-AGAGAAAAGAAAT-TCTACTT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTTGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTATGAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACT---------------------------------- Trianoptiles_capensis ---------------------------------------------------------------------------------------------------------------CG---TTGTCTA-ACAA-AAACAT-GACCATTGCGCACGAA-GTCACAGAAAGCT-GCC--GGGGTGGCTTTGCCG-CTCCGGCCC--ACCGG-CACCGGCAC-TCTCCTCCTTC--GGGGGGTGTGTTGCCCG-TG-TGCCG-------AACACGGCGTGGGTTGA--CG-CCAAGGAACAATAGA--TGCTGAGGC--GGCCGGCGGAGCGCTTAGGTG-CCCCGCAGG-ACGCCGATGCG--------AATGAA------CACAACGATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCGCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATC-ACGCTCGAG---GC----CCCCGATGCGGAGCCTGGCTCTCCGAGCC--CCCGGGCA-CGGTGGGCCT-AAGA-GTACGGCCGTTGGGT--TGGGC-------CGGGAGCGGCGAGTGGTGGTC--TA-CTTCGCACGCC-GCCCCGCG-CCCAT-TGCCGGC------CCTTGTAC-GATCCCA-GAACG-AGGAGACGGCTGT-GCAGCGTACC--GCTGTGTGGCCACTTCGGACCGA---------------------------------------------------CTGTACTTCGGTGCGGCCAACCG-TC-ATGAGGC-TGTC-TTT-CATTCT-----CCCT-GCCTT-AC-ATTCT--GGCG-GGTAGGGA---CCCGATATTTGCCGGCTGCCTGTGTGGTTTTACCCGTGCGG-GGAT-CTTAAGTCGTG-ACGTT---------GT---CCAA-GC-TTGCCTCGTCG--G---CGTGTGGT-TGTGG-GGGC-AGTCGGAATGT-TGGCGGAATC----CTT-GTGTCGTCTGA--GGGCCAAT----GACCC-TATGCG--GCACTCGGATGC--T-GCCG-GCTCTCATGGATG-CGGTG----CGAAATAAAGG-------TTCTG-CGGGCCTC-GGT--CCCAGATTT-CCTCG--GG-AGTTCC---CTTGTAC----GGATTG-TTG-CTCC--GCTGCTT----------------------------CGCCCTC-ATA-CGGG-------------CGTCGGAGCGG-TTTGTG----------CTC-CCGTGCA--TGCGAGATG-TCTCTCC----------ATTC----TAGTGAG-CGA--CTGCCGGTTC---GGGTTGCGCTGATGG-CCTCCC------------------------TTCTCGGGCGTGCCG-AAGCG--TCGTGCCGGCTCTCGTTT--AGGATGTGCTACCTGGTTGATCCTGCCAGTAGTCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCACCATTTTC------TATCAGTAAT-GAAGATGCTCTTGACTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG---AAAAAGAAAGAGTTCTT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTAAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATGCTTAGCATC--------GAAATCAAAAAAAGAAAATCCAATTCGA-----ACAAGTTTC---------------------AAAAAGA-TAGGGTAAAATTGTTTG----AAACTTGTAAA-----AT-----------ATTTTTTATTTTCTTTTTAAGGTGTAACGGGTGTGAATCTTTC---TTTTATT-------------TAAAAA---------------------------GAAGGAAATT----AAAAAAGGTATGTTGCTTTCCTTTTTA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAAAGATTAAAAAAAA-----AATATA-TATA-TAATTCCGGAACAAGAAAACACTCTATTTGCAA----TAGTCTCAAC-----AATGTA----AT---TAAAT-------------------------CATAATGAC--------G---AATAAAAA------TA----AGTTAGAGATGAGACAAACAAAAGAGTATAGAGATAGCTCAAG-------AAA----T--TAA----TAAAGATTT----TCCTTTGAATTTTA-----TTCAAAAT-----------ATTTAACTTGAGTCGTAAGT--ATGAATGATA----------TTTTTTCTGGTAAAGAAGAT----------GAAAAAGGATTCAAATC-----------------------------ATAGTCTAATT-TATTATT-----TTATGAG-----TCTATTTTTC-------ATT-------------CTATA---------------CATAAATTTGAATCG-TTTTTCTTGAGCCGTATGAGGTAAAAAATCTCATATACGTTTCTGGGGGGAGCA----------CTGAGCTATCCCAACG--AGTTCTTGCGCATCACC-----TGAATATTC------TACTCAGGTCTATA-----TACTT-GTA---------------CTTGTATCAATA-------AAAT-------------------------------------------AAAAATACTCCAA--------T-----------------AAGAATA------------------------------------------------------------------------------------------------------------------------------------------------T------------TGGC-----------------------------GAAGAA-ATAT-------------------TTA-GAAAATAAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-CAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTCTTTCGTATTTTATAT-TTTGGTATT-----TGGTATA-TA-------------------GGGTCATCT-TTTCTCT-TA------TTTC--------GAT-AGAAA-----AAT-CCT---------AT-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTCATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTT------------------------- Tricostularia_pauciflora ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCGCTTTGGTGTGGCTAACCG-TC-TTGGGGC-TGTC-TTTTCACTGGGCCT-CCCG-TCGGGCTC-GTGTG--GCTC-GGGAGGCA-----CGCTTTCCTACGGTTGTCTGTGTGGGTCTACCCGTCTGC-GGTA-TGACG---TTC-GGTCTCATG-ACGGAT---CTCT-GC-TAGCCCCGTTGATA---TTCGCTAT-CAGCG-GGGC-AGCTGTTTTGC-TGGCACTATG----CAC-GTGCTG-TTGT--G-GCGAGG----GCCTC-GATCCT--GCGCGTGCATTT--T-GTCG-GCTCTCACGGATA-CCGTG----CCCTTGGAGGA-------ATTCTCGGGCCTACGAGT--CTCTTGATTTTCACG--GG-TTGTCC---CTTGCAC---TCGTTCA-GTG-CTCCGTGTCTCAT----------------------------TGCT------------GATGTGGCGATGTCGGCGCG-------------GGG-CGTACTG-CAGTGCA--GGTGAGATG-CTTATCC----------GATT----GGCCGAG-CGA--TTGCCGT----------------------------------------------------TCTCACGTTGTTCTCCAA-CG--ACGAGGCGGTTCTCGTTT---AGGCGCGCTACCTGGTTGATCCTGCCAGTAGTCATAAAGCAAGTGTTGGGTTAAAAGAAGGGGTTAAAGAGTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATATTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCTGAAGAAGCAGGAGCTGCCGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTCTTCGAAGAAGGTTCTGTTACTAATATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTTTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGACCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTATGGTAGAGCATGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCGGAAGCACTTTTTAAATCACAAGCGGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTTCATCTGAACAAATGATCAGAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCACGACTACCTAACCGGGGGGTTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAACGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATCGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCGGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACTTTAGGACACCCGTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAGTTTGAATTCGATCCGGTAGATAAACTATAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTGCTATCCCGACC--CTTTTTTGGGGATCACC-----TGAGGAGAATAATG-TACTTGTATCT-----------------------------------ATTTCAAT-------------------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAA-GATAATGATATGGG-TTGGTAATGA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATTATTTTGCGAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------CTTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCACCA-TAAAGAATTCAGA-------------ATTTTT-TCAATTCATA--------AATACTTC-----CGAATTTGCTATCT-ATAATCATTCCCA-TATAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTA-----------------------TT-----TGATACA-TA-------------------TGGTTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCTACCT-----AC-CAATGCAAC----GTAATCACCTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA ; END; BEGIN SETS; CHARSET trn (CHARACTERS = all_taxa_all_genes) = 4192-5476; CHARSET rbcl (CHARACTERS = all_taxa_all_genes) = 1558-2987; CHARSET rps (CHARACTERS = all_taxa_all_genes) = 2988-4191; CHARSET ets (CHARACTERS = all_taxa_all_genes) = 845-1557; CHARSET its (CHARACTERS = all_taxa_all_genes) = 1-844; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M18775] TITLE chloroplast; LINK TAXA = Taxa7; DIMENSIONS NCHAR=3919; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrostylis_aphylla -------------------------------------------------TATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAGCCTGTTATTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGATACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGTCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTACGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTTACAACCATTTATGCGTTGGAGAGACCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGCCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTGTCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAACGATATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGAACCGGTAGACAAACTAGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCGGCTATCCCGACC--ATTTATCTTGAATCACC-----TGAATAGAA------TACTCCTATCTATT-----CCCTT-GTA---------------TCTACGTCAATT-------AAATAATTGAA------------------------------------CATTGAGCCTAAC-----AAAA-----------------AATTGATTCAA-AAA-----A-AAAGTCAATGT-----------------------------------TAATAATATTGATA-TTA-TTGGTAATAA-------TATCACCAATAGA----------------------------GATTTTT------------TGCATA---------TGCT-TAGATTCTTT---GAAGAA-ATAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCC-------TTTAAATTATCATC---------------ATTTTTTC---------AATCTAAAAAACTCTAT-------------------GATTGATAAAATCAATTAAATTCAATTGATTATTCA------------AA-ATTGAA-------------------------TTCTTTTTTCATTGAACTGCAT---------------AT--TCGAATCAA-TTCACCAT-AAAGAATTCATTATTTTTTGATAGAATTTTT-TGAATTCATT--------AAAATTTAA----TGAATTTGCTATTCCATAATCAATAGCAATTTAATTCTAT----------TTTTTGATTTTTAATATATATGATTA-AACGTTGGATTAATCAGT----ATATATAA--ACGTACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTATCT-TA------TCTT--------GAG-AGATA-----AAT-TCA---------AG-CAATGCAAC----ACAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTAAATGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATGCA---- Becquerelia_cymosa TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGCGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACGAGCCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGCTGGGGAAGACAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGTGCTCTACGCTTGGAAGATTTGCGAATTCCACCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTTTTAGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCGTGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGCTCCTATTGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTAACCGAAATCTTTGGAGATGATTCCGTCCTCCAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGGAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTCAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTCGATCCGGTAGATAAACTAGAT---------------------------------------------AATAAT-GAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG----AAAAAAAGGATTAATT-------------TTTG----------ATC-----AAA---------CAAGGGAAAGAATCTAGGGTTAATGAAATTCAATAT-------------------------------------AATT--------AATTTAGACCAGCTTTGTAAGTATATTCTTAGCATC--------GAAATCAAAAAGTGAAAACCCAATTCGA-----ACAAGTA---------------AAAAAAAACAAGAA---AAAGTGAAATTGTTGG----AAAAAGGTAAA-----AC-----------GATTTTGATCAA------AAGGTGTAACGGGAGTTAACTCTTCTT---------------------TATAAA---------------------------GAAGGAA------AAAAAAGGATATGTTGCTTCCCTTTTGA-AAGGAGTAAAG-GTCCCT--------GAAGTAATGTATAAACCCAAAGATTTTAAAAAG-----AAAATC-TAAA-AGATTCCGGAACAAGAAAACACTAT--TTGCAAACGTCTCTCTCAAC-----ATTATA----AT---------------------------------TTTAATGAT--------A---AATAAAAA------TA----AGTTAGAGATGGGACAAACAAAAGAGTCTAGAGATAACTCAAG-------AAT----T--TCC----TAAAGATTT---TTCTTTTGAATTTTC-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAATGTAAA---AAACTATAAAAAAGAATTCAATTT-GAATC-----------------------ATAGTCTAAGT-CATTATT-----TTATGAC-----TTTATTTTTC-------ATT-------------CTATA---------------CAGAAATTTTTTTCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG------------------------------------------------ATC-----TGAGTAGAA------TACTGGTATCTATG-----CCCTT-GTA---------------CCTATGTCAATT-------AACTA------------------------------------------AATTGAGCTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATGGA-GTAGTCATGG----------------------------------------GATATTGATATGGC-TTGGTAATGA-------TTTCGTT-ATAGA----------------------------GATTTCT------------TGCTTA---------TTATATAAACTCCTTGCTGAAGAA-ATAC-------------------TTA-CGAAGTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAGAAATCGACGGATTTTCCTCTTACTAG-AAATTTCATTGTTGTCAATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAGTCAT-----------------TTTGT-C-----AAAAGATCTAGCAAATTCTAT-------------------CATGAAT---------------GATTTGGTTACTAA------------AT-ATGGAG------------------------TT-CTTCTCTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCACCAT-AAAAAATTATGA-------------ATTTTT-GGAATTCAAA----AATCAATATTTT-----CGAATTTGCTATTTCCTAATTATTCACAATTGAAA----------------ATTTGATTGTGATT---AATCATTA-CACATTTGACTAATCAAT----ATATAT----ACGTATGTC-----------------------TT-----TGGTGTA-TA-------------------GGGTCATCC-TTTTTCT-TATTTTT-TTTTATTTAATAGAA-AAAAA-----AATATCT---------AC-CAATACAAC----ATAATAAACTATA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGT------------------------------------------------------------ Calyptrocarya TAAGGCAAGTGTTGGGTTTAAAGCAGGGGTTAGAGATTACAAACTTACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTCTTGGAGAAGACAATCAATATATTTGTTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACCAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGCGCTCTACGCTTGGAAGATTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTTTTAGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTATGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGGTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGCGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Capeobolus_brevicaulis ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGTCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGCGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGAAGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAAAATCTAAGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATCCGA-----ACAACTTTC------------------AAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGTAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTTAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCCAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTTATGAGT--ATGAATAAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTTATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGACC------------AATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATATTAAAATTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAATGGA-ATAGTAGATGTTAGGATAATGATATGGATTGGTTATGATTACATTATAGAGATAATGATATGGA-TTGGTTATGA-------TTACATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGTATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTAATTAATCAGT----ATATAT----ACGTATGTT-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-ATTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Carex_magellanica TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCGGCAGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCCGAAAGAGATAAGTTGAACAAATATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTGTTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGCTTAAAAGAGCAGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAGCGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGAT---------------------------CCATTTTCT--TTATAG-AGTAAT-GAAAATGCTTTTGGTTCGACATAATTTGTTCTGT--------TCCG----------------TAAACAGTA-CAT----------GATGAAGCTCGAA------------GTTTGATT-------------TTTTTATTTGTTCTATC-----AAA---------TAAGGGAAAGAATCCAGGGTTAGTGAGAATTAACTTAAATTT-CAT------------------------TTTAATT--------AATTGAAAGAAACTTTGTCAGTATATTCTTAACATC--------GAGATCAAAAA----AAATCCAATTCAA-----ACAAGAAA------------AAAAAATAAAAGAGAG--TAAAGTGAAATTGTTGG----AAATTGGTAAA-----AC-----------TCTTTTGATTAT------AAGGTGGAATGGAAGTGAATTCTTCATATTTTATT-------------TATAAGTA-------------------------TCAGGAAAT--C-AGAAAAAGGGGTGTTGCTTTCCCTTTGACAAGAAATAAGG-ATTTCCAAAATAATGAAATAATGTATAAACCTAAAGATTCCAAAAAG-----AAAATA-TAAA-GAATTCCGGAACAAGAAAATACTTTG-TTGAAA----TTATCTCAAC-----AATGTA----AT---TGGAT-------------------------CATTTT---------------AATCTAAA------TATCTTTCTTAGAGATAAGACAAACAAAAGAGTTTATAGACAGCTCAAG-------AAATTTCT--TCA----TAAAGATTT----TCCTTTGAACTTCC-----TCAAAATT-----------TTTTAACTTGAGTCATGAGT--CAAAATGATA---------TTTTTCTCTAT-AACGAAAAGG---------AAAAAGGAACTCTTTTC--------------------------------------------------------------------------C-------ATT-------------CTATA---------------GATAAATTTAAATCA-TTTTTCTTGAGCCGTATGAGGT-GAAAATTTCACATACGTTTCTAGGG-AGGCTTTTTT---------GCTATCCCGACT--ATTTCTTGTGGATCACT-----CGAGTAGAA------TACTCGTACCTATG-----CCCTT-GT-----------------------CAATT-------AAAT-------------------------------------------AAAGGAGCTCAAATAAAATAAA-----------------AATTTATTCAA-AAAAATAGA-ATAATCAATGT-----------------------------------TTAAGATTATGATA-TGA-TTGGTAATGA-------TTTCATT-ATAGA-----------------------AGAATGATTCTT------------TGCATA---------TGCT-TAGGATCTTT---AAAGAG-ATTT-------------------TTT-GAAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTTATCATC---------------ATTTTTTC---------AATCTAACAAACTCTAT-------------------AATGAAT-TCCATAAATAGAATAAATTGATTATTAA------------AA-ATTGAG-------------------------TTTTTTTCTCATTAAATTTCAT---------------AT--TTGAATCAA-TTCACCAT-AAACAATTCATA-------------ATTTAT-GGAATTCATC--------GAAATTCC-----TGAATTTGCTATTCCATAATTATTGTTAATTTAATAATAT----------GATTTGATT-----T---TATGATTA-ATAATTTGATTAATTATT----ATATAT----ACGTACGTC-------------------TTTGTT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TTT---------AG-TATTGCAAC----ATAATAAATTCTA-----TTCGTTAGAAAAGCTTCCATCGAGTCTCTGCACCTATCTTAGAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Carpha_alpina TAAAGCTAGTGTTGGTTTTAAAGCAGGGGTTAAAGAGTATAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCGGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGCTCTGTTACTAATATGTTCACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTACTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCTTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTACTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGGGCTATCCCGACC--AGTTCTTGCGCATCCCC-----TGAGTATTT------TACTCAGGTCTATA-----TCCTT-GGG---------------CCTGGATCAATT-------TAAT-------------------------------------------AAAGGAACTCAAA--------C-----------------CATAATAAAAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGGAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCGTCC-TTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Carpha_capitellata_var._bracteosa ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTTGATAAGACGAAATAAAAAGATCAA--TCCACCATTTTC------TATCAGTAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG--AAAAAAGAAAGATTGATT-------------TTTTT---------ATCAAATCAAG---------CAAGGGAAAAAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATGCTTAGCATC--------GAAATCAAAAAACGAAAATCCAATTCGA-----ACAAATTTC-------------------AAAAAAAGA---GGGTAAAATTGTTTT----AAACTGGTAAA-----AT-----------TTTTTTTATTTT------AAGGTGTAACGGGAGTGAATCCTTC---TTTTATT-------------TCTAAA---------------------------GAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTTA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-TAAA-AAATTCCGGAACAAAAAAACACTATATTTGCAA----TAGTCTCAAC-----AATGTA----AT---TGGGT-------------------------CATAATGAC--------G---AATAAAAA------TA----AGTTAGAGATGAGATAAACAAAAGAGTATAGAGATAGCTCAAG-------AAA----T--TAA----TAAAGATTT----TCCTTTGAATTTTC-----TCAAAAAT-----------ATTCAACTTGAGTCGTAAGT--ATGAATGAGA----------TTTTTTCTGGTAAAGAAGAG----------GAAAAAGGATTCAAATC-----------------------------ATAGTCTAATT-CATGATT-----TTATGAG-----TCTATTTTTC-------ATT-------------CTATA---------------CATAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-AAAAATCTCATATACGTTTCTGGGGGGAGCATTTTTTT-----------------------TTCTTGCGCATCACC-----TGAGTATTC------TACTCAGGTCTATA-----TCCTT-GTA---------------CCTGTATCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA--------T-----------------AATAATAATAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGTAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCATCC-TTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACT---------------------------------- Carpha_glomerata -------------------------------AAAGATTATAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTAGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAAGAAGCGGGAGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGCTCTGTTACTAATATGTTCACCTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGTATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTACTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAATTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTCATAAAGCACAGGCCGAAACAGGGGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGACATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTTTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTTGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTCTGGCATATGCCTGCTTTGACAGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGGGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAACTAAATGGAGTCCTGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTTGATCCGGTAGATAAACTTGAT-------------------------------------------------------------CTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG--AAAAAAGAAAGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGACCAACTTTGTAAGTATATGCTTAGCATC--------GAAATCAAAAAACGAAAATCCAATTCGA-----ACAAGTTTC-------------------AAAAAGAGA---GGGTAAAATTGTTTT----AAACTGGTAAA-----AT-----------TTTTTTTATTTT------AAGGTGTAACGGGAGTGAATCCTTC---TTTTATT-------------TATAAA---------------------------GAAGGAAATA----AAAAAAGGTATGTTGCTTTCCTTTTTA-AAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAAAGATTCCAAAAAG-----AAAAT----------TTCCGGAACAAAAAAACACTATATTTGCAA----TAGTCTCAAC-----AATGTA----AT---TGGGT-------------------------CATAATGAC--------G---AATAAAAA------TA----AGTTAGAGATGAGATAAACAAAAGAGTATAGAGATAGCTCAAG-------AAA----T--TAA----TAAAGATTT----TCCTTTGAATTTTC-----TCAAAAAT-----------ATTCAACTTGAGTCGTAAGT--ATGAATGATA----------TTTTTTCTGGTAAAGAAGAG----------GAAAAAGGATTCAAATC-----------------------------ATAGTCTAATT-CATGATT-----TTATGAG-----TCTATTTTGC-------ATT-------------CTATA---------------CATAAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-AAAACTCTCATATACGTTTCTGGGGGGAGCATTTTTTTT--CTGAGCTATCCCGACC--AGTTCTTGCGCATCACC-----TGAGTATTC------TACTCAGGTCTATA-----TCCTT-GTA---------------CCTGTATCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA--------T-----------------AATAATAAAA--AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGAAATGGA-TTGGTAATGATTTCATTTTTCATT-ATAGA----------------------------GATTTCT------------TGGTT------------ATATGTATAATA----TAAGAA-ATAT-------------------TTA-GGAAATCCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTTAAAAATCGACGGATTTTCCTCTTACTTT-AAATTTCCTTGTTGTCGATATCGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACGATTAATCAGT----ATATAT----ACGTATGTC----------------TTTGGTATT-----TGGTATA-TA-------------------GGGTCATCCTTTTCTCT-GA------TTTC--------GAT-AGAAA-----AAT-CCT---------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCAGTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Caustis_dioica TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTACACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCTGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTACCATATCGAACCTGTTGCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAGCAGCTTTATAAAGCACAGGCCGAAACTGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGCTAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTAGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAACCACGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTAGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGGCGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATACGAGCCGGTAGATAAACTAGAT---------------------CATCCACCATTTTC------TAT-AG{AT}AAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTTTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG---AAAAAAAAGGATTGATT-------------TTTTT---------ATC-----AAC---------CAAGGGAAAGAATCTAGGGTTAGTGAAAATGAA----------TAT---------------------------AATT--------AATTTCGACCAACTTTGTAAGTATATTCTTAGCATC--------AAAATCAAAAAGAGAACACCCAATTTGA-----ACAAATTTC-------------------AAAAAAAGA---AAGTGAAATTTTTGG----AAATTGGTAAA-----AC-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCGTATTTTTTTT------------TCTGAA---------------------------GAAGGAAATAAC-AAAAAAAGGTATGTTGTTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AGAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGACAAAATAACG---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAGGGATTT----TCTTTTGAACTTTA-----TCAAAACT-----------ATTCAACTTGAGTCATGAGT--ATGAATGATA----------CTTTTTTTGT--AAAGAGAA----------GGAAAAGGATTCAATTC-GAATC-----------------------ATAGTCGAATTGAATCCTT-----TTATGAG-----TCCATTTCGC--------------------------------------------AAAAACTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGG------------------------------C--ATTTTTTGTGGATCACC-----TGAGTAGAA------TTCTCGTATCTATATAATGTACTT-GTA---------------CCTATGCCAATT-------AAAT-------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTAA-ATAGTCAATGT-----------------------------------TAG-GATAACGATATGGA-TTGGTAATGA-------TTTCATT-ATAAA----------------------------GATTCTT------------TGCTT------------ATATGTATTATTTTGCGAAGAA-ATAC-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTTATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTAAG------------------------TT-TTTTTCTCATTGAACTTC-T---------------AT--TTGAATCAA-TTCACCAT-AAATAATTCAGG-------------ATTTTT-TGAATTTAGA--------AATATTTC-----TGAGTTTGCTATTTCATAATCATTCACAATCAAAGAATAT----------AATTTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------CGGCGACCC-TTTCCCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGTAAC----GTATTCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTACCCATTTTTAATTCCAGGGTTTCTCTGAATT------------------------------------------------- Chrysitrix_capensis ---------TGTTGGATTTAAAGCCGGAGTTAAAGATTACAAACTGACTTATTATACTCCTGAGTATGAAACCAAAGATACTGATATTTTGGCAGCGTTCCGAGTCACCCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCGACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCTGTTGTTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGTTTGGAGGATTTGCGAATTCCCCCTGCTTATTTAAAAACTTTCCAAGGTCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAATTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCTGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTACTTAAACGCTACTGCAGGCACCTGTGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGCTTGTCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGAGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATAATTTTATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATCCCTGTGGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGACTCCGTACTTCAATTTGGTGGAGGAACTCTAGGACATCCTTGGGGAAATGCATCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTCCTCGGGAAGGTAATGAAATTATTCGAAGAGCAGCTAAATGGAGTACTGAACTAAGCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTCGATCCGGTAGATAAACTAGATAAGGCGAAATAGAAAAATAATCATCC-CCATTTTC------TAT-AGTAAT-GAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAAGTTGTCAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG----AAAAAAAGA-TTGATT-------------TTTTTT--------ATC-----AAT---------CAAGGGAAAGAATCTAGGGTTAGTGAAGATTAA----------TAT---------------------------AATT--------AAGTTAGACC-ACTTTGTAAATATATTCTTAGCATC--------GAAATCAAAAAGTGAAAATCCAATTTGA-----ACAAGCAAG--------T----AAAAGAAAAAAGAG---ATTGTGCAATTTTTAT----AAATTGGTAAA-----AC-----------TTTTTTGATCA-------AAGGTGTAACGGGAGTGAATCCTTTTTTTTTAATT-------------TATAAA---------------------------GAAGGAAATCGC-AAAAAAAGGTATGTTGTTTTCCTTTTGA-AAGAAATAAAG-GTCCCC--------GAAGTAATGTATAAACCTAATGATTTCAAAAAG-----AAAAGA-TAAA-AGATTCCGGAACAAGAAAATACTTT--TTGCAA----TTGTCTCAAG-----AATGTG----AT--CTTAAT---------------GCGAATAAGACTTAATGAC--------G---AATAAGAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AAA----T--TAA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTTAACTTGAGTTATGAGT--ATTAATGACT----------TTTTTTCTGT-AAGGAAGA-----------AAACAAGGACTCAATTC-AAATC-----------------------ATAGTCTAATT-CATAATT-----TTATAAG-----TCCA-TTTGC-------GTT-------------CTATA---------------CGGAAATTCAAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATGTACGTTTCT---------------------TGAGCTCTCCCGCCT----TTCTTGTG-ATTACC-----TAAGAAAAA------T-CTTATATCTATG-----TCCTT-ATA---------------CTTATGTTAATT------------------------------------------------------AAAGGAACTCAAT-----TAAA-----------------AATTTATTCAA-AAATTTTGA-ATAGTCAATG------------------------------------TTAGGATAATGATATGGG-TTGATAATCA-------TTTCATT-ATTTA----------------------------GAT-------------------------------------------------TATTAA-ATAC-------------------TTA-GGAAGTAAAATAGGCTTGGGGATAGAGGG-ACTTGA-CCCTCA-TGATTTTTAACATC-CCGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATCAC------------------TTTTTA-----AAAAGATCTAGCAAACTTTGT-------------------AATGAAT---------------AATTTGATTACAAA------------AT-ATTGAG-------------------------TTCTTCTTTCATTGACCTTC-T---------------AT--TCGAATCAA-TTCATCAT-----AATTTAG--------------AATTAT-TTAATT-ATA-----AAAAATATTTA-----AGAATTTGCTATTTCATAATCATTCAAAATCTAACAATAT----------AATTTGATCATAA-T---GAAAATCA-ATCAGTTGATTAATCAGT----ATAATT----ACGTATGTC-----------------------TT-----CGGTATATTA-------------------GAGCTATTC-TCTCTCT-TA------TCGA--------GATAAGAAA-----AAT-TCCACT------AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTAAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Cladium_mariscus ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTGCGAATTCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGCACATGTGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAACAAGATCGTAGTCGCGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATACCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTCCAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCCGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTCGAATTTGAGCCGGTAGATAAACTAGAT-------------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTGGCTCGACATAGTTTGTTCTGCTTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG---AAAAAAAAGGATTGATC-------------CTTTT---------ATC-----AAG---------CAAGGG-AAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AAGTTAGACCAACTTTGTAAGTATATTCTTAGCATC--------GAAATCAAAAAGTGAAAATCCAATTCGA-----ACAAGTT----------------AAAAAAAAAAAAGA-GAAATTCAAATTGTTGG----AAACTGGTAAA-----AC-----------TATTTTGATCAT------AAGGTGTAACGGGAATGAATCCTTCGTATTTTATT-------------TATAAA---------------------------GAAGGAAATAAA-AAAAAAAGGCATGTTGCTTTCCTTTTGA-AAGGAATAAAG-GTCCCC--------GGAGTTACGTATAAACCCAATGATTCTAAAAAG-----AAAATA-TAAA-GGATTCCGGAACAAGAAAACACTAT--TTGTAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATAAAAA------TA----GGTTAGAGATGAGACAAACAAAATAGTTTAGAGACAGCTCAAG-------AAA----T--TAA----TAAGGATTT----TCCTTTGAACTTTG-----TAAAAATT-----------ATTCAACTTGAGTCATGAGT--ATGAATGATA---------TTTTTTTCTGT-AAGGAAGAG----------AAAAAAGGACTCAATTC-GAATTATAGTCT-------------------GTCTAATT-CATAATT-----TTATAAG-----TCCATTTTGC-------ATT-------------CTATA---------------CAGGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGG-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGGCC--ATTTC-----GATCACC-----TGAGTAGAA------TACTTGTATCTATG-----------------------------------TCAATT------------------------------------------------------AAAGGAACTCAAA-----TAAC-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGA----------------------------GATTCCT------------TGCTT------------ATATGTATTA-TTTGCGAAGAA-ATAC-------------------TTA-GGAAGTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTA----A-AAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTAA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TCGAATCAA-TTCACCAT-AAATAATTCAGA-------------ATTATT-TGAATTCTGA--------AATATTTC-----CGAATTTGCTATTTCATAATCATTCACAATTTAAGAATAT----------AATTTGATCGTGA-T---TATGATTA-ATCATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----CGGTATA-TA-------------------GGGCCATCC-TTTCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-TAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCGTTGAGTCTCTGCACCTATCTTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGCATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCGAGGCTCAC-------- Costularia_arundinacea --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGGTATGCCCGCC--GGTTCTTGGGAATCACC-----AGAGTAGATACATGATACTTGTATCT-----------------------------------ATTTCAATT-------AAAT-------------------------------------------AAAGGAACTCGAA-----TACA-----------------AATTTATTCAA-AAAAATTGA-ATAGTCAATGT-----------------------------------TAG-GATAATGATATGGG-TTGGTAATGA-------TTTCATC-ATAGA----------------------------GATTCCT------------TGCTTA-----------CTATGTATT-TTTTTCGAAGAA-ATACTTAGGCAAAGAAGAAGTACTTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCGTTTGATTTTTGATTAATC--TT--------------TTTTTTTT----T-TAAGATCTAGCAAACTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAG------------------------TT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATCGA-TTCATCATTAAAGAATTCAGA-------------ATTTTT-TGAATTCATA--------AATACTTC-----CGAATTTGCTATCTCATAATCATTCCCA-TTTAAAAAGAA----------AATTTGATCGTGA-T---TATGATTC-ATCATTTGATTAATCAGT----ATATAT----ACGT-------------------------------------ATATA-TA-------------------TGGCTATCC-TTCCTCT-TA------TTTC--------GAT-AGAGA-----AAT-TCCACCT-----AC-CAATGCAAC----GTAATCAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGTAAGTTTCCATACCAAGGCTCAATCCAATCA Costularia_fragilis TAAAGCTTTTGTTGGTTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGACC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Costularia_laxa ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCT------------------------------------------------------TCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATATT---ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGG------------------------------------------------------------- Costularia_leucocarpa_Lar0140 -----------------------------------------AACTTAATTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACTAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGATAAGACGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------GATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTAAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC----------AAAAAAAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGGA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATGAATGAGA---------TTCTTTTTTGT-AATGAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTTAATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTTA-----------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA-----ATTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTT------------------------------------------------------------------------ Costularia_natalensis ------------------------------------TTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATGAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCATAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC--------------AAAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGGA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATGAATGAGA---------TTCTTTTTTGT-AATGAGGAA----------CAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAAGAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGAATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTAAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA-----ATTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Costularia_nervosa --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCAA-AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Costularia_pantopoda -----------------------------------------AACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGCTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA-------------CT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC----------AAAAAAAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------TTTAAACTTGAGTTATGAGT--ATAAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTTTGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATT----------------------------------------------------------------------------G-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATTA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTT------------------------------------------------- Costularia_pantopoda_var._baronii -----------------------------------------------------------------------------ATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA--TCCACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC---------------AAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTTATGAGT--ATAAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTT----------------------------------------CT-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACT---------------------------------- Costularia_sp_Lar0153 -----------------------------------------------------ATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA--TCCACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC---------------AAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTTATGAGT--ATAAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTTT---------------------------------------------------AAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTTG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATTATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGAT--------------------------------------------------- Costularia_sp_Lar0219 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATCCACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGTATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC----------------AAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTAAACTTGAGTCATGAGT--ATGAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTTT--------------------------------------ACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATCAATTTAAAAAT---GAAAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATT-------------------------------------------------- Costularia_sp_Lar0249 --------------------------------------------------------------------------------------------------------------------CCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTATTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATGAAAAGAGCCATATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCACGTAATGAAGGACGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGATTTCGATCCGGTAGATAAACTAGATAAGACGAAATAGAAAGATCAA-ATCCACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTTAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAGAATCTAAGGTTAGTGAAAATTAA----------TAG---------------------------AATT--------AATTAAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATTCGA-----ACAACTTTC--------------AAAAAAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATCCTTCATTTTTTCTT-------------TATAAA----------------GAAAA------GAAGGAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTCAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCAAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------CTTAAACTTGAGTCATGAGT--ATGAATGAGA--------TTTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTGATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGGGTATTT-------------------------------------------------------------------------------------------------------------AGTCATTT-------AAATAATAAATTTAAAAAT---GAGAAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTCA--AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTTCATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATATGGATTCTT------------ATATGGATTTTTTTGCGAAGAA-ATAC-------------------TTATGGGATTTCAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCA-TGATTTCAAGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-TGAATTCATA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTC-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTC--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTT------------------------------------------------- Cyathochaeta_avenacea ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAACCTGTTATCGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCACGGCATCCAATCTGAAAGAGATAAGTTAAACAAGTACGGCCGTCCTCTATTGGGATGTACCATTAAACCAAAATTGGGATTA-TCCGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAATGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAATCACAGGCTGAAACAGGTGAAATAAAAGGACACTACTTGAATGCTACTGCAGCTACATCTGAAGAAATGATCAAAAGAGCGGTATTTGCTAGAGAATTAGGAGTTCCTATTGTAATGCATGATTACTTAACCGGAGGATTCACCGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTACTTCTTCATATCCACCGTGCAATGCACGCAGTTATTGATAGACAGAAAAACCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTTTCTATGCCAGGTGTTATTCCTGTGGCTTCGGGAGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGAGTCGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGAATTCGATCCGGTAGATAAACTAGATAAGACA-------------------CACCATTTTC------TAT-AGTAAT-GAAGATGCTCTTAGCTCGACATAATTTGTTCTGTCTAGGTTGTGAG----------------TAAACAGTA-CAT----------GATGGAGCTCGAG-----AAAAAAGGCTTGATTT------------TTTTT---------ATA-----AAG---------CAAGGGGAAGAATCTAGGGTTAGTGAAAATTAA----------TAT---------------------------AATT--------AATTTAGATCAACTTTGTAAGTATATTCGTAGCATC--------GAAATCAAAAATAAAACATTCAATTCGAATTGAACAAGTTAAAATTGAACAAGTTAAAAAAAACATAAA------GTGAATTTATTGG----AAACTGGTAAA--AAAAC-----------TATTTTGATCAT------AAGGTGTAACGGGAATGAATCCTTCATATTTTATT----------------------CAGAAATTCATAAATAAA------TAAGGAAGT-----AAAAAAGGTATGTTGCTTGCCTTTTGA-GGATAAAAAGG-ATCCCC--------GAAGTAATGTATAAACCCAACGATTCCAAAAAG-----AAAATA-AAAA-GCATTCCGAAACAAGAAAACACTAT--TTCCAA----TTGTCTTAAC-----AATG----TGAT---TGGAT-------------------------CATAATGAC--------G---AATCAAAATACATTTA----CATTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAG-------AGA----T--TAA----TAAGCATTT----TCCTTTGAACTTTC-----TACAAATT-----------ATTTAACTTGAGTTATGAGT--ATGAATGATA---------TTTTTCTCTGT-AAGGGGGA---------------AAGGATTCAATTT-GAATTAGAGTCTAATTCATTATTTTATTAGAGTCTAATT-CATTATT-----TTATGAGATGAGTCCATTTTAC-------ATT-------------CTATA---------------GAAGAGTTTGAATTA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGGGGAGCATTTT------------------------------------------------------------ATATTCGTATTTATG-----TACGA-GTA---------------TCTATATCAATT-------AAAT-------------------------------------------AAAGGAATTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATAAA-ATAGTCAATGT-------------------------------------------ATGGTATGAA-TTGGGAATGA-------TTTCATT-AAAGA----------------------------AA----------------------------------ATATG-----------GAAGAA-GTAT-------------------TTA-GGAAATCAAACGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCATTTTACTAT-AAATTTCATTCTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATT--------------------------------------------------------------------------------------------------AT-ATTAAA------------------------TTACTTTTCTTATTGAATTTC---------------------------------------------------------------------------------------------------------------------------------------AAGAATATGGATAATATTAATTTGATCGTGA-T---TATCATTT-ATCATTTGATTAATTAGT----ATATAT----ACGTATGCT-----------------------CT-----TGGTATA-TA-------------------CGTCTATCT-TTTCTCT-TA------TTTC--------GAT-AGATA-----AAT-TCCA------------AATGCAAC----GTAATCAACTGTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTACCCATTTTTAATTCC----------------------------------------------------------------- Cyathochaeta_diandra --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGCTATCCCGACC--ATTTCAGGCGGATC----------ACCTGAA-----ATATTCGTATTTATG-----TACGA-GTA---------------TCTATATCAATT-------AAAT-------------------------------------------AAAGGAATTCAAA-----TAAA-----------------AATT-ATTCAA-AAAAATAAA-ATAGTCAATGT-------------------------------------------ATGGTATGAA-TTGGTAATGA-------TTTCATT-AAAGA----------------------------AA----------------------------------ATATG-----------GAAGAA-ATAT-------------------TTA-GGAAATCAAACGGGCTTGGGGATAGAGGG-ATTTGAACCCTCA-TGATTTCAAAAATCGACGGATTTTCATTTTACTATAAAATTTCATTCTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATT--------------------------------------------------------------------------------------------------AT-ATTAAA------------------------TTACTTATCTTATTGAATTTC---------------------------------------------------------------------------------------------------------------------------------------AAGAATATGGATAATATTAATTTGATCGTGA-T---TATCATTT-ATCATTTGATTAATCAGT----ATATAT----ACGTATGCT-----------------------CT-----TGGTATA-TA-------------------CGTCTATCT-TTTCTCT-TA------TTTC--------GAT-AGATA-----GAT-TCCA------------AATGCAAC----GTAATCAACTGTA-----TTCGTTAGAATAGCTTCCATTGAGTCTCTGCACCTATCCTTCAAGATTTGGCTCAGGATTACCCATTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTCAATCCAATCA Cyathocoma_hexandra ----------------------GCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCCGGAGTTCCCCCCGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCTGTTGTTGGAGAAGAAAATCAATATATTGCCTATGTAGCTTATCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTGTTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGATTTACGAATCCCCCCTGCTTACTCAAAAACTTTCCAAGGCCCACCTCATGGGATCCAATCTGAAAGAGATAAGTTGAACAAATATGGCCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCCGCAAAAAACTACGGTAGAGCGTGTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACCGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGTCTGCTTCTTCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGCATGCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGGGAACGTGAGATGACTTTAGGTTTTGTTGATTTATTACGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATTCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTCGGAGATGATTCCGTACTTCAATTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGCGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGAAGTGATCTTGCTCGCGAAGGTAATGAGATTATTCGAGCAGCAGCTAAATGGAGTCCTGAACTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGACTTCGATCCGGTAGATAAACTAGAT-------------------------CACCATTTTCT-----TAT-AGAAAT-GAAGATGCTCTTGGCTCGACATAATTTGTTCTG-TTAGGTTGTCAG----------------TAAACAGTA-CAT----------GATGAAGCTCGAG-----------AGATTGATT-------------TTTTT---------ATC-----AAG---------CAAGGGAAAAAATCTAAGGTTAGTGAAAATTAA----------TAT---------------------------AATG--------AATTTAGACCTACTTTGTAAGTATATTCTTAGCATC--------GAA----------GAACATTCAATCCGA-----ACAACTTTC------------------AAAAAAAAGA-GAGAGTGAAATTGTTGG----AAACTAGTAAA-----GT-----------TTTTTTGATCAT------AAGGTGTAACGGGAGTGAATTTTTCATTTTTTCTT-------------TATTAA---------------AGAAAA------GAAGTAAATAAC-AAAAAAAGGTATGTTGCTTTCCTTTTGA-GAGGAATAAAG-GTCCCC--------GAAGTAATGTATAAACCCAATGATTCCAAAAAG-----AAAATA-AAAA-GGATTCCGGAACAAGAAAACACTCT--TTGCAA----TTGTCTTAAC-----AATGTA----AT---TGGAT-------------------------CATAATGAC--------G---AATCCAAA------TA----GGTTAGAGATGAGACAAACAAAAGAGTTTAGAGACAGCTCAAGATATTA-ATA----A--GGA----TAAGGATTT----TCCTTTGAACTTTC-----TCAAAATT-----------ATTCAACTTGAGTCATGAGT--ATGAATGAGA---------TTTTTTTTTGT-AATGAGGAG----------GAAAAAGGATTCAATTC-GAATT-----------------------AGAGTCTAATT-CCTTATT-----AGACGAG-----TCCTTTTTGC-------ATT-------------CTATA-CAAAA---------CAAGAATTTGAATCA-TTTTTCTTGAGCCGTATGAGGA-GAAAATCTCATATACGTTTCTGGGG----------------CTGAGCTATCCCGACC--ATTTCTTTTTGATCACC-----TGAGTAAAA------TACTCGTATCTATG-----TACTT-ATA---------------GATAAGTCATTT-------AAATAATAAAATTATTATT---TAATAATT-----------------AAAGGAACTCAAA-----TAAC-----------------AATTTAGTGAA-AAAAATGGA-ATAGTAGATGT-----------------------------------TAG-GATAATGATATGGA-TTGGTAATGA-------TTACATT-ATAGAGATAATGATTCCTCATTATAGAGATAATGATTCCTTACATATAAGGATTCTT------------ATATGGATTTTTTTGCGAAAAA-ATAC-------------------TTATGGGATTCAAATGG---------------------------------------AGAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTAGAAT-GGACTCTCTCTTTATTCTCG-------TTTGATTAATC------------------ATTTTTTC----A-AAAGATCTAGCAAATTCTAT-------------------AATGAAT---------------GATTTGATTACTCA------------AT-ATTGAA------------------------GT-CTTTTCTCATTGAACTTC-T---------------AT--TTGAATTAA-TTCACAA-TAAATAATTCAGA-------------ATTTTT-AGAATTCAGA--------AATATTTC-CTTCCAAATTTGCTATTTCATAATCATTCACAATTT-ATGATAT----------AACATGATTGTGA-T---TATCATGA-ATTATTTGATTAATCAGT----ATATAT----ACGTATGTT-----------------------TT-----TGGTATA-TA-------------------GGGCTATCC-TTTATCT-TA------TTTT--------GAT-AAAGA-----TAT-TGCACTT-----AC-CAATGGAAC----GTAATCAATTCTA----TTACGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTAAAGATTTGGCTCAGGATTGCCCATTTTTAATTCCAGGGTTTCTCTGATTTTGGAAGTTAA-CACTTAGCAAGTTTCCATACCAAGGCTC---------- Cyperus_rigidifolius ------------TGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTCCCTCCTGAAGAAGCAGGAGCTGCAGTAGCGGCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCATATCGAACCTGTTGCTGGAGAAGAAAATCAATATATTGCCTATATAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTACGCTTGGAAGACTTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCACGGTATCCAAGCTGAAAGAGATAAATTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCATCAACCTTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCTATTTATAAAGCACAAGCCGAAACAGGTGAAATCAAAGGGCACTACTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCAGTATTTGCTAGAGAATTAGGAGTTCCTATCATCATGCATGACTACATAACTGGGGGATTCACTGCAAATACTAGTTTGTCTTTTTATTGCCGTGATAATGGTCTACTTCTGCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAACCATGGTATTCATTTCCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACAGTAGTAGGTAAACTGGAAGGTGAGCGTGAGATGACTTTAGGTTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGATCGTAGCCGTGGTATCTTTTTCACTCAAGATTGGGTCTCTATGCCTGGTGTTATACCTGTGGCTTCAGGGGGTATCCATGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGAGATGATTCTGTACTTCAATTTGGTGGCGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAACAGGGTGGCTTTAGAAGCGTGCGTACAAGCTCGTAATGAAGGACGTGATTTTGCTCGTGAAGGTAATGAAATTATTCGCGCAGCAGCTAAATGGAGTCCAGAATTAGCCGCTGCTTGTGAAGTATGGAAAGCAATCAAATTTGACTTCGATCCGGTAGATAAACTAGAT---------------------CATCCACCATTTTCT--TTCTAT-AGTAAT-GAAAATGCTCTTGGCTCGACATAATTTGTTCTGTTTAGGTTGTCCG----------------TAAACAGTA-CAT----------GATGGAGCTCGAA------------GTTTGATT-------------TTTTT---------ATC-----AAA---------CAAGGGAAAGAATCTAGGGTTAGTGATAATTCAATT-------AAT------------------------TCTAATT--------AATTTAGACCAATTTTGTAAGTATA-TCTTAGTATC--------AGAATCAGAAA---AAAATACAATTCGA-----ACAAG-------------------AAAAAAAAATAT---AAAGTGAAATTCTTGG----AAACTGGTAAA-----AC-----------TATTCTGATTTT------AAGGTGGAACGGGAATGAATCCTTCGTATTTATTT-------------TATAAA---------------------------GAAGGAAAT--CAAAAAGAAGGGGTGTTGCTTTCCCTTTGA-AAGGAATAAAG-GTCTTC--------AAAATAATTTCTAAACCTAAAGATTCCAAAAAG-----AAAAAA-GAAA-GGATTCCGGAACAAGAAAATACTTT--TTTAAA----TTATCTCAAC-----AGTGTA----AT---TCGAT-------------------------CAAATTGAC--------A---AATCTAAA------AA----GGTTAGAGATAAAACAAACAAAAGAGTTTAGAGATAGCTCAAG-------AAATTCTT--TCA----TAAGGATTT--------ATGAACTTTC-----TAAAAATTTTTT-------ATTTAACTTGAGTCATGAGT--AAAAAAAATATTATGATA-TTTTTTTATAT-AACGAAAAG----------AAAAAAGGACTCTATTT-GAATC-----------------------ATAGTATAATT-CATGATT-----TTATGAG-----TCCATTTTGC-------ATT-------------CTATA---------------CAGAAATTTGAATTA-TTTTTCTTGAGCCGTATGAGAT-GAAAATTTCATATACGTTTCTAGGG-AGACTTTTTTT----CTGAGCTATCCCGGGC-----------------------------------------------------------------TA---------------TCCTCAATGTTT------------------------------------------------------------------------AAAA-----------------TATTTAT-----ATTAATTGG-TAA-------------------------------------------TATTAATATTAATAATAA-TTGGTAATTA-------TTTCAAT-ATAGA----------------------------GATTCTT------------TGCCTA---------TGCT-TAGATTCTTT---GAAGAA-AAAT-------------------TTA-GGAAATCAAATGGGCTTGGGGATAGAGGG-ACTTGAACCCTCACTGATTTAAAAAATCGACGGATTTTCCTCTTACTAT-AAATTTCATTGTTGTCGATATTGACATGTGAAATGGGACTCTCTCTTTATTCTTC-------TTGGATTTATCATC---------------ATTTTTTC------TTCATAATAAAAAACTCTAT-------------------ATATAAT---TAATAATATATTCAATTTATTACTCA------------AA-ATTGAG-------------------------TTTTTTTTTCATTGAACTTCAT---------------AT--TCGAATCAA-TTCACCAT-AAAGGATTCATT-------------ATTTTT-TGAATTCATC--------AAAATTTA-----GGAATTTGCTATTCCATAATCAATAGCAATTTAA-AATAT----------TATTTGATTGTTA-T---TATGATTA-ATCATTTGATTAATCAGT----ATAT------ACGTACGTC-----------------------TT-----TGGTATA-GA-------------------CGGCTATCC-TTTCTTT-TATTTCG-TCTC--------GAG-AGAGA-----AAT-TCT---------AG-CAATGCAAC----ATAATAAACTCTA-----TTCGTTAGAATAGCTTCCATCGAGTCTCTGCACCTATCCTTATAGATTTGGCTCAGGATTGCCCTTTTTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAA-CACTTAGCAAGA-TCCATACCAAGGCTCA-TCCAA--- Diplacrum TAAAACTAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACAGATATCTTGGCAGCGTTTCGAGTAACTCCTCAACCCGGTGTCCCCCCTGAAGAAGCAGGAGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACGAGCCTTGATCGTTACAAAGGACGATGCTATCATATCGAGCCTGTTGCTGGAGAAGACAATCAATATATTGCCTATGTAGCTTATCCTTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGTTTTAAAGCCCTACGTGCTCTACGCTTGGAAGATTTGCGAATTCCACCTGCTTATTCAAAAACTTTCCAAGGCCCACCTCATGGCATCCAATCTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTCTATTAGGATGTACTATTAAACCAAAATTGGGATTA-TCTGCAAAGAACTACGGTAGAGCATGTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTCTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGACACTATTTGAATGCTACTGCAGGTACATCTGAAGAAATGATCAAAAGAGCCGTATTTGCTAGAGAATTGGGAGCTCCAATTATCATGCATGACTACTTAACTGGGGGATTCACTGCAAATACTAGTTTGGCTTTTTATTGTCGTGATAATGGCCTACTTCTTCACATCCACCGCGCAATGCATGCAGTTAT