#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:52 GMT TreeBASE (cc) 1994-2008 Study reference: Sysouphanthong P. 2013. Lepiota (Agaricaceae) in northern Thailand–3. Lepiota section Lilaceae. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14814] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=80; TAXLABELS Echinoderma_asperum_AY176354 Lepiota_castaneidisca_AF391054 Lepiota_castaneidisca_AF391055 Lepiota_castaneidisca_AF391056 Lepiota_castaneidisca_AF391057 Lepiota_castaneidisca_AF391058 Lepiota_castaneidisca_AF391059 Lepiota_castaneidisca_AF391060 Lepiota_castaneidisca_AF391061 Lepiota_castaneidisca_AF391062 Lepiota_castaneidisca_AF391063 Lepiota_castaneidisca_AF391064 Lepiota_castaneidisca_AF391065 Lepiota_cf._cristata_ecv2714_GQ203807 'Lepiota cf. fraterna PS-2011 JN224822' 'Lepiota cf. fraterna PS-2011 JN224823' Lepiota_cristata_AF391027 Lepiota_cristata_AF391040 Lepiota_cristata_AF391041 Lepiota_cristata_AF391042 Lepiota_cristata_AF391043 Lepiota_cristata_AF391044 Lepiota_cristata_AF391045 Lepiota_cristata_AF391046 Lepiota_cristata_AF391047 Lepiota_cristata_AF391048 Lepiota_cristata_AF391049 Lepiota_cristata_AF391050 Lepiota_cristata_AF391051 Lepiota_cristata_EU081935 Lepiota_cristata_EU081936 Lepiota_cristata_EU081937 Lepiota_cristata_EU081938 Lepiota_cristata_EU081939 Lepiota_cristata_EU081940 Lepiota_cristata_EU081941 Lepiota_cristata_EU081942 Lepiota_cristata_EU081943 Lepiota_cristata_EU081944 Lepiota_cristata_EU081945 Lepiota_cristata_EU081946 Lepiota_cristata_EU081947 Lepiota_cristata_EU081948 Lepiota_cristata_EU081949 Lepiota_cristata_EU081950 Lepiota_cristata_EU081951 Lepiota_cristata_EU081952 Lepiota_cristata_EU081953 Lepiota_cristata_EU081954 Lepiota_cristata_EU081955 Lepiota_cristata_EU081956 Lepiota_cristata_EU081957 Lepiota_cristata_EU081958 Lepiota_cristata_EU081959 Lepiota_cristata_EU081960 Lepiota_cristata_EU081961 Lepiota_cristata_EU081962 Lepiota_cristata_EU081963 Lepiota_cristata_EU081964 Lepiota_cristata_EU081965 Lepiota_cristata_EU081967 Lepiota_cristata_EU081969 Lepiota_cristata_EU081970 Lepiota_cristata_EU081971 Lepiota_cristata_EU081972 Lepiota_cristata_EU081973 Lepiota_cristata_EU081974 Lepiota_cristata_EU826488 Lepiota_cristata_EU826489 Lepiota_cristata_EU826490 Lepiota_cristata_EU826491 Lepiota_cristata_EU826492 Lepiota_cristata_EU826493 Lepiota_cristata_GQ203806 Lepiota_cristata_GQ203814 Lepiota_cristata_GQ203815 Lepiota_cristata_LCU85327 Lepiota_sp._Vellinga_2515_AF391052 Lepiota_sp._Vellinga_2542_AF391053 Lepiota_sp._Vellinga_2677_AY176466 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M19762] TITLE Lepiota_section_Lilaceae; LINK TAXA = Taxa1; DIMENSIONS NCHAR=653; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Echinoderma_asperum_AY176354 CCTTGGAGCATGTGCACGCTCATCATCTTTATCCATCCACCTGTGCACTCTTTGTAGTCTTGGGAGAGAGGAG-GGACTG--TGCTCTGTCGGGTCA---CAAGCC---CGGATATGAGGACTGCTGTGCGACACTGTACAG-CTTTACTTCTATGTGCGCCTTCTTCTGCCTAGGTCTATGTAGTTTC--ATACACCCCAATAGCATGTCATAGAATGTATTCAATGGG-CCTATGTGCCTATATAAAACTATATACAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAACATATCAA-CCCTTCCAGCTTCTTTGGAGGCTGGTTTGTGGCTTGGATGCTGGGGGTATCTTTGCTGGCC----TCTCAAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGGGTCTGT-CACTGGTGTGATAATTATCTGCGCCAAAGATGGACG-TGCTCTCTGTCTGTTCAGCTTACAATAATCCTGTTTACTTGGACAACTTAAT-TAATGCTTGGCCTCAAATC Lepiota_castaneidisca_AF391054 CTTCGGAGTATGTGCACGCCCGCCATATTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTG---TAGTCTTT-CGGATGTGAGGGATGCTGTGCGACA--GTACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CCAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTCGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCAAAGACGAAGGCTGCTCTCTGTTTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391055 CTTCGGAGTATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTG---TAGTCTTT-CGGATGTGAGGGATGCTGTGCGACA--GTACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CCAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTCGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCAAAGACGAAGGCTGCTCTCTGTTTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391056 CTTCGGAGTATGTGCACGCCCGCCATATTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTG---CAGTCTTT-CGGATGTGAGGGATGCTGTGCGACA--GTACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CCAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGTATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTCGAGGTCGGCTCCCCTGAAATGCATTAACGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCAAAGACGAAGGCTGCTCTCTGTATGTTCAACTTCTAACTGTCCC--TTGC--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391057 CTTCGGAGTATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTG---TAGTCTTT-CGGATGTGAGGGATGCTGTGCGACA--GTACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CCAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTCGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCAAAGACGAAGGCTGCTCTCTGTTTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391058 CTTCGGAGTATGTGCACGCCCGCCATATTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTG---TAGTCTTT-CGGATGTGAGGGATGCTGTGCGACA--GTACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CCAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTCGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCAAAGACGAAGGCTGCTCTCTGTTTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391059 ?????????????????????????????????????????????CACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTC---TAGTCTTT-CGGATGTGAGGGATGCTGTGCAACA--GCACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTTGAGGTCGGCTCCCCTGAAACGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACACCAAAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--TTGT--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391060 CTTCGGAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAAAG-CGGCTGATTCCTCGAAAGGCTTC---TAGCCTTT-CGGATGTGAGGGATGCTGTGCAACA--GCACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTATCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACACCAAAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--TTGT--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391061 CTTCGGAGTATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTG---TAGTCTTT-CGGATGTGAGGGATGCTGTGCGACA--GTACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CCAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGTATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTCGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCAAAGACGAAGGCTGCTCTCTGTTTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391062 CTTCGGAGTATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTG---TAGTCTTT-CGGATGTGAGGGATGCTGTGCGACA--GTACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CCAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTCGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCAAAGACGAAGGCTGCTCTCTGTTTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391063 CTTCGGAGTATGTGCACGCCCGCCATATTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAGAG-CGGCTGATTCCTCGAAAGGCTTG---TAGTCTTT-CGGATGTGAGGGATGCTGTGCGACA--GTACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CCAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTCGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCAAAGACGAAGGCTGCTCTCTGTTTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391064 CTTCGGAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAAAG-CGGCTGATTCCTCGAAAGGCTTC---TAGCCTTT-CGGATGTGAGGGATGCTGTGCAACA--GCACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACACCAAAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--TTGT--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_castaneidisca_AF391065 CTTCGGAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACACTTTGTAGTCTTGGAGGATAAAAG-CGGCTGATTCCTCGAAAGGCTTC---TAGCCTTT-CGGATGTGAGGGATGCTGTGCAACA--GCACGG-CTCTCCTCAACAGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCT-ATACACCACA-TAGTATGTTGTAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACACAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAAACCACTCTAGCTTTTGTGG---CTAGCT-GTGGTCTGGATGTTGGGGGTTTCT--GCGGGCCTC--TGTTGAGGTCGGCTCCCCTGAAACGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACACCAAAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--TTGT--GGACAACTTT-T-GAATGTTTGACCTCAAATC Lepiota_cf._cristata_ecv2714_GQ203807 TTTCGAAGCATGTGCACGCCGGCCATCTTTATCCATCCACCTGTGCACTTTTTGTAGTCTTGGAGGACAAGAGTGGGCCGACTCCTCGAATAGCTTC---TAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCATCTCAATGGCTCGCAATTTCCT--TTAGGTCTATGTCTTTTC--ATACACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCTACGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAA-CCACTCTAGCTTTTGTGG---CTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTC--TTCTGAGGTCGGCTCCCCTAAAATGCATTAGTGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTATACCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTC-T-GAATATTTGACCTCAAATC 'Lepiota cf. fraterna PS-2011 JN224822' TTTCGAAGCATGTGCACGCCCGCCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGTGGGCCGACTCCTCGAATGGCTTC---TAGCCTTT-CGGACGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTCACAATTTCCT--CTAGGTCTATGTATTTTCC-ATACACCACA-TAGTATGTTGTAGAATGTAATATATGGG-CCTCTGTGCCTATAAAACTCTATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAA-CCACTTTAGCTTTTGTGG---CTAGAC-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTC--TCTGGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CGCAGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCCAACTGTCCC--TTGC--GGACAATTTCCT-GAATGTTTGACCTCAAATC 'Lepiota cf. fraterna PS-2011 JN224823' ????GAAGCATGTGCACGCCCGCCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGTGGGCCGACTCCTCGAATGGCTTC---TAGCCTTT-CGGACGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTCACAATTTCCT--CTAGGTCTATGTATTTTCC-ATACACCACA-TAGTATGTTGTAGAATGTAATATATGGG-CCTCTGTGCCTATAAAAATCTATA--CAACTTTCAGCAACGGATCTCT-TG?CTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAA-CCACTTTAGCTTTTGTGG---CTAGAC-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTC--TCTGGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACCGTTTGCGG-TCTGTACGCAGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGT?????????????????????????????????????????????????????????????? Lepiota_cristata_AF391027 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGTGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACTGTTTGCGG-TCAGT-CACCGGTGTGATAATTATCTACGCCCAAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTT--GAACGTTTGACCTCAAATC Lepiota_cristata_AF391040 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGTGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTATGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391041 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGTGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTATGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391042 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGTGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GTGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTT--GAACGTTTGACCTCAAATC Lepiota_cristata_AF391043 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTA-ATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTATGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391044 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTT---GAACGTTTGACCTCAAATC Lepiota_cristata_AF391045 TTTCGAAGCATGTGCACGCTCGCCATATTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAAAGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATAGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391046 TTTCGAAGCATGTGCACGCTCGCCATATTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAAAGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATAGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAAGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391047 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCAAATGGCTTCTTCTAGCCTTT-TGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTGGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAACCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCCGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391048 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGTGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTA-ATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTATGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391049 TTTCGAAGCATGTGCACGCCTACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGTGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTATGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391050 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAATAGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCTATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_AF391051 TTTCGAAGCATGTGCACGCCTGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGGGCTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTTTGAACGTTTGACCTCAAATC Lepiota_cristata_EU081935 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCGATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081936 TTTCGAAGCATGTGCACGCCTGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGGGCTGACTCCTCGAATGGCTTCTTCTAGCCTTTTCGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAAAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAAAACGCACCGAAATGCGATAAGTAATGTGAATTGCAAAATTCAGGGAATCATCGAATCTTTGAACCCACCTTGCGCTCCTTGGTATTCCAAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTACGCCGTAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081937 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGA-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTC????? Lepiota_cristata_EU081938 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081939 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081940 ????????????????????????ATCTTTATCCGTCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTGTATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCATTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTT-GACCTCAAATC Lepiota_cristata_EU081941 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAAAATGCATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGTGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGTGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081942 TTTCGAAGCATGTGCACGCCTGCCATCTTTATACATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGAGAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTC????? Lepiota_cristata_EU081943 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081944 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG---TTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081945 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCCCATATACCACA-TAGTATGTTGTAGAATGTATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCAACTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGATAATTATCTATGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081946 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081947 TTTCAAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGTGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAAAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAATGTTTGACCTCAAATC Lepiota_cristata_EU081948 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCCCATATACCACA-TAGTATGTTGTAAAATGTATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCAACTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081949 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCCCATATACCACA-TAGTATGTTGTAGAATGTATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCAACTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081950 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCAAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081951 ??????????????CACGCCTGTCATCTTTATAAATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGGATGGCTTT---CAGCCTTT-CGGACATGAGGGATGCTGTGCGAAA--GCGCGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTACC-ATATACCACA-TTGTATATTATAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACTCTATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-ATCCAGCTTTTGTGG--CT-GGAT-GTGGCTTGGATGTTGGGGGTTTTT--GCGGGCTTC--TTTTGAGGTCGGCTCTCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CACCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTATAACTGTCCT--TTGT--GGACAACTTATC-GAATGTTTGACCTCAAATC Lepiota_cristata_EU081952 TTTCGAAGCATGTGCACGCCTGTCATCTTTATACATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGGATGGCTTTT--CAGCCTTT-CGGACATGAGGGATGCTGTGCGAAA--GCGCGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTACC-ATATACCACA-TTGTATATTATAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACTCTATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCTTTTGTGG--CT-GGAT-GTGGCTTGGATGTTGGGGGTTTTT--GCGGGCTTC--TTTTGAGGTCGGCTCTCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CACCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTATAACTGTCCT--TTGT--GGACAACTTATC-GAATGTTTGACCTCAAATC Lepiota_cristata_EU081953 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCAAAA--TCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACACCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081954 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCCCATATACCACA-TAGTATGTTGTAGAATGTATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCAACTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081955 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGACTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081956 TTTCGAAGCATGTGCACGCCCGCTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACAG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTGTATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCATTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081957 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAAAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAAAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CACCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081958 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGGGCCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTT-GACCTCAAATC Lepiota_cristata_EU081959 TTTCGAAGCATGTGCACGCCCGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCATGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCCCATATACCACA-TAGTATGTTGTAGAATGTATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAAAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCAACTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU081960 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCCAATC Lepiota_cristata_EU081961 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAAAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCA-TG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lepiota_cristata_EU081962 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTTGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCAA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lepiota_cristata_EU081963 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCGATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCAATGGCTATGAC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lepiota_cristata_EU081964 TTTCAAAGCATGTGCACGCCTGTCATCTTTATAAATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGGATGGCTTT---CAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCGCGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTACC-ATATACCACA-TTGTATATTATAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACTCTATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCAG-------------------------------------------------------------------------------------------GTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCTTTTGTGG--CT-GGAT-GTGGCTTGGATGTTGGGGGTTTTT--GCGGGCTTC--TTTTGAGGTCGGCTCTCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CACCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTATAACTGTCCT--TTGT--GGACAACTTATC-GAATGT????????????? Lepiota_cristata_EU081965 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTCGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTC--TTTCGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACCGT??????????????????????????????????????????? Lepiota_cristata_EU081967 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CACCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTT???????????? Lepiota_cristata_EU081969 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGAG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lepiota_cristata_EU081970 TTTCGAAGCATGTGCACGCCTGTCATCTTTATAAATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGGATGGCTTT---CAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCGCGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTACC-ATATACCACA-TTGTATATTATAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACTCTATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTC---------------------------------------------------------------------------------------TCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCTTTTGTGG--CT-GGAT-GTGGCTTGGATGTTGGGGGTTTTT--GCGGGCTTC--TTTTGAGGTCGGCTCTCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CACCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTATAACTGTCCT--TTG??????????????????????????????????? Lepiota_cristata_EU081971 ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACTGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTT-GACCTCAAATC Lepiota_cristata_EU081972 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCGATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lepiota_cristata_EU081973 ???????GCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lepiota_cristata_EU081974 TTTCGAAGCATGTGCACGCCCACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Lepiota_cristata_EU826488 ??????????????????????????????????????????GTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGGATGGCTTT---CAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCGCGG-CTCTCCTCAATGGCTTGCAATTTCCT--CTAGGT{CG}TATGTCTTTACC-ATATACCACA-TTGTATATTATAGAATGCATTACATGGG-CCTCTGTGCCTATAAAACTCTATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCACAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCTTTTGTGG--CT-GGAT-GTGGCTTGGATGTTGGGGGTTTTT--GCGGGCTTC--TTTTGAGGTCGGCTCTCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCTGT-CACCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTATAACTGTCCT--TTGT--GGACAACTTATC-GAATGTTTGACCTCAAATC Lepiota_cristata_EU826489 ????????CATGTGCACGCCCACCATCTTTATCTATCC-CCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTC{AG}ATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAG{CT}ATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGC{CG}G--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TC{CT}GT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU826490 TTTCGAAGCATGTGCACGCCCACCATCTTTATCTATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTC{AG}ATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-C{AG}CCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU826491 ????????????????????????????????????????CTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAG{AG}CCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TC{CT}GT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU826492 TTTCGAAGCATGTGCACGCCCGCCATCTTTATC{AC}-TCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTCT-CGGATGTGAGGGATGCTGTGCGAAA--GCATGGGCTCTCCTCAATGGCTTGCAATTTCCT--CTAGGTCTATGTCTTTTCCCATATACCACA-TAGTATGTTGTAGAATGTATCATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCAACTCCAGCCTTTGCAG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCAG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CAGT--GGACAACTTTCT-GAACGTTTGACCTCAAATC Lepiota_cristata_EU826493 TTTCGAAGCATGTGCACGCC{CG}ACCATCTTTATCTATC{AC}-CCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATATGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTC{AG}ATGGCTCGCAATTTTCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCAGGCCTCTCTTTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAA{CT}GTTTGACCTCAAATC Lepiota_cristata_GQ203806 TTTCGAAGCATGTGCACGCCTACTATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCGG-CTGACTCCTCGAACGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGTGAAA--GCACGG-CTCTCCTCAATGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCCATGTGCCTATCAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTATGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_GQ203814 TTTCGAAGCATGTGCACGCTCGCCATATTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAAAGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATAGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_GQ203815 TTTCGAAGCATGTGCACGCTCGCCATATTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATGGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAAAGGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATAGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_cristata_LCU85327 TTTCGAAGCATGTGCACGCCCGCCATATTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGCAG-CTGACTCCTCGAATCGCTTCTTCTAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCTCCTCAAATGCTCGCAATTTCCT--CTAGGTCTATGTCTTTTCC-ATATACCACA-TAGTATGTTGTAGAATGCATTATATAGG-CCCATGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTATATTCTCAACCA-CTCCAGCCTTTGCGG--GTTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACCGTTTGCGG-TCCGT-CGCCGGTGTGATAATTATCTACGCCATAGACGAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--CTGT--GGACAACTTTTT-GAACGTTTGACCTCAAATC Lepiota_sp._Vellinga_2515_AF391052 TTTCGAAGCATGTGCACGCCGGCCATCTTTATCCATCCACCTGTGCACTTTTTGTAGTCTTGGAGGACAAGAGTGGGCCGACTCCTCGAATAGCTTC---TAGCCTTT-CGGATGTGAGGGATGCTGTGCGAAA--GCACGG-CTCATCTCAATGGCTCGCAATTTCCT--TTAGGTCTATGTCTTTTC--ATACACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCTACGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAA-CCACTCTAGCTTTTGTGG---CTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTC--TTCTGAGGTCGGCTCCCCTAAAATGCATTAGTGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTATACCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--TTGT--GGACAACTTC-T-GAATATTTGACCTCAAATC Lepiota_sp._Vellinga_2542_AF391053 TTTCGAAGCATGTGCACGCTGGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGTGGGCCGACTCCTCGAATAGCTTC---TAGCCTTT-CGGATGTGAGGGATGCTGTGCGAGA--GCACGG-CTCATCTCAATGGCTCGCAATTTCCT--TTAGGTCTATGTCTTTTC--ATACACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCTACGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAA-CCACTCTAGCTTTTGTGG---CTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTC--TTCTGAGGTCGGCTCCCCTAAAATGCATTAGTGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTACACCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--TTGT--GGACAACTTC-T-GAATATTTGACCTCAAATC Lepiota_sp._Vellinga_2677_AY176466 TTTCGAAGCATGTGCACGCTGGCCATCTTTATCCATCCACCTGTGCACCCTTTGTAGTCTTGGAGGACAAGAGTGGGCCGACTCCTCGAATAGCTTC---TAGCCTTT-CGGATGTGAGGGATGCTGTGCGAGA--GCACGG-CTCATCTCAATGGCTCGCAATTTCCT--TTAGGTCTATGTCTTTTC--ATACACCACA-TAGTATGTTGTAGAATGCATTATATGGG-CCTACGTGCCTATAAAACTCAATA--CAACTTTCAGCAACGGATCTCT-TGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCACTAAATTCTCAA-CCACTCTAGCTTTTGTGG---CTGGAT-GTGGCTTGGATGTTGGGGGTTTCT--GCGGGCCTC--TTCTGAGGTCGGCTCCCCTAAAATGCATTAGTGGAACCGTTTGCGG-TCTGT-CGCCGGTGTGATAATTATCTATACCATAGACAAAGGCTGCTCTCTGTCTGTTCAGCTTCTAACTGTCCC--TTGC--GGACAACTTC-T-GAATATTTGACCTCAAATC ; END; BEGIN TREES; TITLE Lepiota_section_Lilaceae_gibbpnytest; LINK TAXA = Taxa1; TRANSLATE 1 Lepiota_cristata_AF391027, 2 Lepiota_cristata_AF391040, 3 Lepiota_cristata_AF391041, 4 Lepiota_cristata_AF391042, 5 Lepiota_cristata_AF391043, 6 Lepiota_cristata_AF391044, 7 Lepiota_cristata_AF391045, 8 Lepiota_cristata_AF391046, 9 Lepiota_cristata_AF391047, 10 Lepiota_cristata_AF391048, 11 Lepiota_cristata_AF391049, 12 Lepiota_cristata_AF391050, 13 Lepiota_cristata_AF391051, 14 Lepiota_sp._Vellinga_2515_AF391052, 15 Lepiota_sp._Vellinga_2542_AF391053, 16 Lepiota_castaneidisca_AF391054, 17 Lepiota_castaneidisca_AF391055, 18 Lepiota_castaneidisca_AF391056, 19 Lepiota_castaneidisca_AF391057, 20 Lepiota_castaneidisca_AF391058, 21 Lepiota_castaneidisca_AF391059, 22 Lepiota_castaneidisca_AF391060, 23 Lepiota_castaneidisca_AF391061, 24 Lepiota_castaneidisca_AF391062, 25 Lepiota_castaneidisca_AF391063, 26 Lepiota_castaneidisca_AF391064, 27 Lepiota_castaneidisca_AF391065, 28 Echinoderma_asperum_AY176354, 29 Lepiota_sp._Vellinga_2677_AY176466, 30 Lepiota_cristata_EU081935, 31 Lepiota_cristata_EU081936, 32 Lepiota_cristata_EU081937, 33 Lepiota_cristata_EU081938, 34 Lepiota_cristata_EU081939, 35 Lepiota_cristata_EU081940, 36 Lepiota_cristata_EU081941, 37 Lepiota_cristata_EU081942, 38 Lepiota_cristata_EU081943, 39 Lepiota_cristata_EU081944, 40 Lepiota_cristata_EU081945, 41 Lepiota_cristata_EU081946, 42 Lepiota_cristata_EU081947, 43 Lepiota_cristata_EU081948, 44 Lepiota_cristata_EU081949, 45 Lepiota_cristata_EU081950, 46 Lepiota_cristata_EU081951, 47 Lepiota_cristata_EU081952, 48 Lepiota_cristata_EU081953, 49 Lepiota_cristata_EU081954, 50 Lepiota_cristata_EU081955, 51 Lepiota_cristata_EU081956, 52 Lepiota_cristata_EU081957, 53 Lepiota_cristata_EU081958, 54 Lepiota_cristata_EU081959, 55 Lepiota_cristata_EU081960, 56 Lepiota_cristata_EU081961, 57 Lepiota_cristata_EU081962, 58 Lepiota_cristata_EU081963, 59 Lepiota_cristata_EU081964, 60 Lepiota_cristata_EU081965, 61 Lepiota_cristata_EU081967, 62 Lepiota_cristata_EU081969, 63 Lepiota_cristata_EU081970, 64 Lepiota_cristata_EU081971, 65 Lepiota_cristata_EU081972, 66 Lepiota_cristata_EU081973, 67 Lepiota_cristata_EU081974, 68 Lepiota_cristata_EU826488, 69 Lepiota_cristata_EU826489, 70 Lepiota_cristata_EU826490, 71 Lepiota_cristata_EU826491, 72 Lepiota_cristata_EU826492, 73 Lepiota_cristata_EU826493, 74 Lepiota_cristata_GQ203806, 75 Lepiota_cf._cristata_ecv2714_GQ203807, 76 Lepiota_cristata_GQ203814, 77 Lepiota_cristata_GQ203815, 78 'Lepiota cf. fraterna PS-2011 JN224822', 79 'Lepiota cf. fraterna PS-2011 JN224823', 80 Lepiota_cristata_LCU85327; TREE BrInd = [&R] ((((((((((((3:100.0,2:100.0)0.0,(74:100.0,11:100.0)59.0)37.0,(10:100.0,5:100.0)8.0)47.0,((4:100.0,1:100.0)26.0,((48:100.0,53:100.0)29.0,(((38:100.0,33:100.0,55:100.0,32:100.0)1.0,64:100.0)28.0,(67:100.0,62:100.0)48.0)39.0)4.0)27.0)4.0,(51:100.0,35:100.0)74.0)21.0,(((((30:100.0,65:100.0)15.0,73:100.0)2.0,70:100.0)1.0,39:100.0,45:100.0,(42:100.0,((52:100.0,61:100.0)32.0,56:100.0)8.0)32.0)0.0,((58:100.0,(66:100.0,57:100.0)12.0)21.0,(41:100.0,(((6:100.0,34:100.0)0.0,69:100.0)0.0,71:100.0)30.0)14.0)2.0)79.0)32.0,((((76:100.0,77:100.0,7:100.0,8:100.0)63.0,80:100.0)94.0,12:100.0)1.0,13:100.0)22.0)16.0,((((((44:100.0,40:100.0,54:100.0,72:100.0,49:100.0)2.0,43:100.0)88.0,50:100.0)53.0,36:100.0)3.0,37:100.0)80.0,60:100.0)12.0)27.0,(9:100.0,31:100.0)29.0)86.0,(((79:100.0,78:100.0)100.0,((15:100.0,29:100.0)63.0,(14:100.0,75:100.0)78.0)100.0)68.0,((((22:100.0,26:100.0)0.0,27:100.0)45.0,21:100.0)87.0,((((20:100.0,16:100.0,25:100.0)10.0,18:100.0)44.0,23:100.0)5.0,(17:100.0,24:100.0,19:100.0)0.0)95.0)89.0)34.0)58.0,((63:100.0,59:100.0,68:100.0)0.0,(46:100.0,47:100.0)43.0)100.0)100.0,28:0.0)0; TREE BrLen = [&R] (28:0.11540648,(((46:0.00177145,47:0.0015756):0.00149706,(59:0.00544486,63:1.0E-8,68:7.779E-8):0.00186922):0.03228276,((((78:1.0E-8,79:0.00184758):0.03261075,((14:1.0E-8,75:0.00164906):0.00386852,(15:0.00118519,29:0.00212446):0.00327278):0.02056811):0.00479043,((21:1.0E-8,(27:1.0E-8,(22:0.00163829,26:1.0E-8):0.00163788):0.00331104):0.00577247,((17:1.0E-8,19:1.0E-8,24:1.0E-8):1.0E-8,(23:0.00164094,(18:0.00831543,(16:1.0E-8,20:1.0E-8,25:1.0E-8):1.905E-7):0.00164536):1.932E-7):0.01450494):0.0447537):0.00853666,((9:0.00992539,31:0.01503204):0.00167986,((60:0.01439116,(37:0.0049185,(36:0.00486756,(50:0.00163287,(43:0.00160827,(40:0.00160892,44:1.0E-8,49:1.0E-8,54:0.00160821,72:1.0E-8):1.0E-8):0.00487893):0.00160079):1.0E-8):0.00979308):0.0,((13:0.00161253,(12:0.00487959,(80:0.00331193,(7:1.0E-8,8:0.00161838,76:1.0E-8,77:1.0E-8):0.00158151):0.00660931):1.0E-8):0.00163301,((((58:0.01299586,(57:0.00637841,66:1.0E-8):0.0):0.00316633,(41:1.0E-8,(71:1.0E-8,(69:1.0E-8,(6:1.0E-8,34:1.0E-8):1.0E-8):1.0E-8):0.0016184):1.461E-5):0.00160395,(39:1.0E-8,45:0.00161702,(70:1.0E-8,(73:1.0E-8,(30:1.0E-8,65:1.0E-8):0.00160015):0.0):1.71E-5,(42:0.004919,(56:0.00328877,(52:1.0E-8,61:1.0E-8):0.0):0.00326895):0.00161001):1.0E-8):0.0082139,((35:0.00171116,51:0.0058785):0.00391689,(((5:1.0E-8,10:0.00162626):1.0E-8,((2:1.0E-8,3:1.0E-8):1.0E-8,(11:1.0E-8,74:0.00162221):0.00161897):0.00161764):0.00162458,((1:0.00831185,4:0.00166676):0.00160271,((48:0.00654973,53:0.00163796):0.00162337,((62:0.0031839,67:1.0E-8):0.00318542,(64:1.0E-8,(32:0.00162672,33:1.0E-8,38:1.0E-8,55:0.00162091):1.0E-8):0.0):0.0048566):0.0):0.00163722):0.0):0.00162578):0.00325567):0.00161482):0.00152255):0.01016854):0.01693598):0.11540648); END;