#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 20:03 GMT TreeBASE (cc) 1994-2008 Study reference: Arias T., Beilstein M., Tang M., Mckain M., & Pires J.C. 2013. Diversification Times Among Brassica Crops Suggest Hybrid Formation After Twenty Million Years of Divergence. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14830] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=101; TAXLABELS Alliaria_petiolata Ammosperma_cinerea Arabidopsis_thaliana Brassica_barrelieri Brassica_carinata Brassica_cretica Brassica_desnottesii Brassica_elongata Brassica_fruticulosa Brassica_gravinae Brassica_incana Brassica_juncea Brassica_macrocarpa Brassica_maurorum Brassica_montana Brassica_napus Brassica_nigra Brassica_oleracea Brassica_oleracea_var._alboglabra Brassica_oleracea_var._botrytis Brassica_oleracea_var._gemmifera Brassica_oleracea_var._gongylodes Brassica_oleracea_var._sabadua Brassica_oleracea_var._viridis Brassica_oxyrrhina Brassica_procumbens Brassica_rapa Brassica_rapa_var._chinensis Brassica_repanda Brassica_spinescens Brassica_spinescens1 Brassica_villosa Cakile_lanceolata Cakile_maritima Calepina_irregularis 'Capsella bursa-pastoris' Carrichtera_annua Caulanthus_amplexicaulis Caulanthus_inflatus Ceratocnemum_rapistroides Coincya_longirostra Coringia_planisiliqua Crambe_filiformis Crambe_hispanica Crambe_hispanica_var._abyssinica Didesmus_bipinnatus Diplotaxis_erucoides Diplotaxis_harra Diplotaxis_virgata Enarthrocarpus_lyratus Eremophyton_chevallieri Eruca_pinnatifida Eruca_vesicaria_var._sativa Erucaria_erucarioides Erucastrum_canariense Erucastrum_elatum Erucastrum_gallicum Erucastrum_ifniense Erucastrum_littoreum Erucastrum_nasturtiifolium Erucastrum_palustre Erucastrum_virgatum Eutrema_halophilum Eutrema_parvulum Fezia_pterocarpa Foleyola_billotii Guiraoa_arvensis Henophyton_deserti Henophyton_deserti1 Henophyton_zygarrhenum Hirschfeldia_incana Isatis_canescens Isatis_tinctoria Isatis_tinctoria2 Kremeriella_cordylocarpus Moricandia_arvensis Moricandia_foetida Morisia_monanthos Myagrum_perfoliatum Physorhynchus_chamaerapistrum Pseuderucaria_teretifolia Pseudofortuynia_esfandiarii Raffenaldia_primuloides Raphanus_raphanistrum Savignya_parviflora Schouwia_purpurea Sinapidendron_angustifolium Sinapis_alba Sinapis_flexuosa Sinapis_pubescens Sisymbrium_irio Sisymbrium_officinale Stanleya_bipinnata Streptanthus_drepanoides Streptanthus_drepanoides1 Thlaspi_arvense Trachystoma_labasii Vella_anremerica Vella_bourgaeana Vella_spinosa Zilla_macroptera ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M19724] TITLE Brassiceae_Final_Alignment_090312; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3250; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alliaria_petiolata TTTAGGTTAGTCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACATTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TATGAATTTCTATTTCGATAATAGATAAGGATTCGATTAGAAGTTCTTCCTTTTTCTCTGTGAATTGGCTA------------TCAAAAAAAGAACGAAGAATT------CAAAGAATGGTTCACAAAAAAG-AAATGGCAGAAAAAAGTCG----------------TATATATATATTATGAATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTAAAT-----AATATAATTATATTA---------------------TTTCAAT-TAAAGTTTTTGGTTATTTTGGCTAGATGAATCTTA-CGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAATTTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGGCTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTACATGCCCTT-ATGTATCTGTAAAAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAATTTCTTTCTCACATACACCTTCGATCACATTACATTGTCATTTCG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATGA-TTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGAT----ATT-----------------------AATTTGGAA-TAAGACTTTCTTTCTCTAATTCTCTAGGCAGGAACACA--ATATATTTCCTATGAAATATATCGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAAACTT----AAAAACAA---------A-TTTTTTAAAATACATATAAA----------------------------------------------------------------------------------------------------------------------AAA----------AGGGGGGGGTTCTTAATTTTCCCCATCACTAAC------------------------TTT--AT-GCAATATTA-----AA---TAAAGATCTTG-------TATTTCCTCTG-------AACGAGGAAATACAAGATCTTTAAACGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTGAAA--------------------------------------------------------ATTTCTAAGGA----------TTTT--------------------------------------------------GGAGAAGTTT-------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------TT--------------------------------------------TTTAG------------------------AAAAACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATT--------TTTTTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGGTAATAATAAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGTCGGCAA-ATTTTTTTAAGA-TTTTTTTTTCGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTCTAT---------TT-----TTATATCAGGGTTTACACTGTTAACCATTCATGGGGTAACCCCTTTTCAAAATCTGAAGAAGTTTCCATCGAATTCGGATTATCTGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTGACATT--TCTAAAG-AAAAAGAGAGA-TATGCGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Ammosperma_cinerea TTTAGGTTAGCTCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAA{AG}AAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATCTAA-------------TCTGCATCACTACTTT-TGTGAATTTCTATT-------TA{AG}ATAACGATTCGATTA{AG}AAGTTCTTCCTTTTTATCTGTGAAATGGCTG--AAAAAAATGATCAAAAAAAGAAGGAAGGATT-AAAAGAAAAGAATGGTTCACAAAAAAT-AAACGGCATAAAAAAGTTG------------------TATATATATTATGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTATTTCAAAATAGAATTCTATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTGATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTATATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTA{CG}AACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAC---------A-TTTTTTAGAATACATAT{AC}AA-----AAAATCAA-TCAGAACA{AC}AAAGAAAAAAAAAAAAGAAAA{AT}AT----------AT{AT}TATAAAA{AG}AAAGG----------------TTCC{AG}AT{GT}GATTTTTTTAT{AT}TCTATTC{CT}AAAA-----------{AG}GGGGGGGTTATTATTTT-CCCCCTCA----------------------------------A{AT}-AAAA{AT}AAAA----------AAAA{AT}ATCTGG--------ATTTCC{CT}CTT-------AAC{AT}AGGAAATACAA{AG}AT{AT}TTTAAGCGCA--------------------------------------ATCAATAGGTTCT{GT}GA----AATTAATT---------T----------------AAGTCAAAA--AGTTTTCACT-------TTAT---------------{AC}CCTT-TA-{AG}AAT{AT}ATTATTTC-CTGAA----TTC---TTAT--ATTCTTT------------ACT{GT}G-----GAATCAAAGTTATA-----AAAG----CT---------------------CACCCTAG-AATATA{AG}AT--AATAA---------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TATTTTTTTTTTTTTTTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTA-----GACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGCC-AA----TTA-----GTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAATTAGAAA-------------TTGGATTTATGTTTTGTTTTATTGCCTCATTTGAGAT---------TT-----TTATATCAGGGTTTACACCCTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATGATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGCATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAAATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Arabidopsis_thaliana TTTAGGTTAGCCCAAT------T-AATTATAG--AATAGTTGGTTTACATTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGCCTAGGTATATA-TGAGTTAAAGATCTATATAATCTGAA-------TCTGCTCTACTATTTT-TGTGAATTTCTATTTAGAT-TTAGATAGGGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG---AAAAAATGAT-AAAAAAAGAACGAAGAATT------CAAAGAATGGTTCATAAAAA---AAATGGCATAAAAAAGTCG------------------TATATATATTATGGATTTTTAAAAATCCCGCGGATAGGAACTACTATCAAAGTAATTCTTATGATTCAAT-----AATTTTATTATATTATTTCATA--------------TTTCAAT-TAAAGTTTTTGGTTTTTTTGGCTGGATTAATCTTAGCGATTACTTAATTAGAATTACGTCCTAA---TTTCTCGCGCACT-GCCCCATAAAATGGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATTTTTGATTTTATTGGTCCTTA------CTTAGGTAAACGGATCAACTCAATTTGTTTCTTCCTTGCTAT--------------TAGTTTATTAATAAGTA---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTATTCAGATAA---AGAATAAAGAACTTTTTTTTTTCTTTTTTGCGTGTATTAAATACTTGTCTATTAAATACTATAGTATCAACTATTGTTATTTTCCTTTTATACCCTTTTTTTAGTTGACGGGTTGAAGCAAAAAGGGAACTTTTAA--TA-TTTTTTTCTATTTTCTTTGATATCT-ATATGTACATGCCCTT-ATGTATCTGTC-AAAAAA-GGGGAAAATTTCT------TATTTATATTTAATTC-----AATATTTA--------AATAAAATTATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCGATCACATTACATTGTCATCTCG-GATGCATCAATATGGAAATATTTAATTGATATCTGAAGCCATGA-TTATGATTCGATTTTTGTTTATTTTT-AATACAA-ATTGATTCTTAATACAA---AGAGAA-TGTAGGATCTTGTTATGTTCTCGAATCAAAA-AAAATATTGAAACGCCCTTTTAGTT----ATT-----------------------ACTTTGCAA-AAATACTCTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--ACAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTAATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTGTACAGCA-AAATAAAT----AAAAAACACTATAATAATTA-------GAATTAGCCTAA-CTT----AAAAACCA---------A-TTTGTTTAAATACATCTAAA-----AAAAA----TAGGAAGCAAAAGAAGAAAAAAAGACAATATAT---AGATAAAATATATAAAAAATAAAGG--------------TTCGCATTTTTTT----------AGTTCCAAA------------AAGGGGATTCGTATTGT-TCCCATCACTACC------------------------TTG--AG-ACAATAATA-----AA---AAAAGATCTTT-------TATTTCCTCTT-------AATGAGGAAATAAAAGATCTTGAAATTAATTACTTTAAGTGAGCAAAAAATCTTATGTTTGTACAATATAAAAAGATACATCAAAAAAAATATTTTGATAATTTTTTTGATTTCTCTTGAGCAATTAGGA--AAATCTAATT-------TTATTTAAAATTGCTAAGGATTTTGAAGAAGTTTTTATTTTTCGAAAAAGCATTTTTTTATCAATTTTTTT-----------TCATATAAATGAAAAAAAATGATA-----AAGAGCATTTAGAGTTTTGTCTTTGGGTTGAAGTTCCAACTACTTTAAT---TTAGTTACATTTTTCATTGTATTCTCGAAAAAAATATAAAGGACAA-AAAGTCAATTGAAATAATTTTAAA-------------------------------------------------------------------------AATCAATTGGAAATTTTAATA----AATTGGCTTCTTTA--------------------------------------------TTTAAATTTTAATCTCGACGATTGAATC-AAAACTT--------GTTAATATTGTTTTGAACAAGTTGCCGCTATGGTGAAATTGGTAGACACGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGGTTCGAGTCCGAGTAGCGGCATAAGATCTTCTAAAAGAGATATTATAAG--TTTTATAATCAAAATAATACCCGACTTT-----TTT---CTAAAATCGGGTAAAACCTAGTATTAATTTATTAATTTTTAACAAATTTTTTATGATTTTTTAGAAGTGGACTCTAGAAATACTTCTAATTGCGGTAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTCGTTTTCTAGACCGTTCGGCAA-TTTTTTTGAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTA-----TGTTTTATTGACTCAGTTTCTAT---------TT-----TTATATCAGGGTTTACACGGTTAACCATTCATGGGGTAACCCC-TTTCGAAATCTGAAGAAGCTTCCATCGAATTGGGATTATCTGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATATATATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTGACGTT--TATAAAG-AAAAAGAGAGA-TATAGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTA--GGACCCCTTAAGA Brassica_barrelieri TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACTTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTCGGTATATA---AGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAGTT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATAA{AG}AACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTTAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTACTTAGTCTTAGTTAAACGCATCAACTCAATTTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAAAAGGGAAAATTTCT------TATTTATATCTAATTCAATAGAATATTTA--------AATAAAATAATAGCAAACTGTAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAACAAA-TCTACTCTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCCTGATTCGACGGGTTTGTACAACA-AAATAAATAAATAAAAACCACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAAATTTTTTATA-TTTTTTAGAATACATATAAA-TAAAGAAATCAA-TAGGAACCAAAAGAGAAAAAAAAGAAAATAGAT----------ATATATATAAGAAAGA----------------TTCCTATTGATTTTGTA------AATAAAAAA--------------GGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCGT-------TAAGAGGAAATACAAGATCTTTAAGCGCA--------------------------------------ATCAACAGGTTCTTTA----AATGAATT---------T----------------CAGTCAAAT--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTT{CT}T{CT}TGAA----TT{CT}---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCC{AC}CAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-TAA------TTAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA----------TTTTTTTT--------------------------------------------TTTTAGT-----------------GGTC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------ATAGA--TATTTTAAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCGTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTATAGACCGGCCGGCAAGTTTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTATTTTATTGAATCATTTTATTT---------TT-----TTATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATGA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTACGGTAGAAAGAGATCTCTTTCTACCGTACTAGCGGGCCCCTTAGGA Brassica_carinata TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAACGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATAT-TATATTATGCATTTTTCAAAATCCCGCGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTGATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TCTTTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCCTTTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCAATATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------ATTTTTTCT-----------------------------------------------------------------------------------------------------------------------------ATTTCTAAA----------AGGGGGGGATTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTGCTA-----AAAA-CATCT---------------------ATCCATAA-TACGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCGTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTGAAGA-TTTTTTTTTAGAAA--------------------TTGGGTTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTTTA-----TTTACATTTATATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCGCCTTAGGA Brassica_cretica TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGAT{AC}AAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATG{CT}ATTTTT{AC}AAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATATATATATACGAAATATACGAAAGA------------------TTCCTATTGATTTTGTAA----------AAAA--------AAGGGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCT{AC}{GT}T-------{AT}A{AC}{GT}AGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAG{GT}TATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_desnottesii TTTAGGTTAGCCCAAC------T-----ATAG--AATAGTTGGTTTACGTTATGTAA{AG}AAACACTTGTATATG-------TGATATTTGATATTGACTATATATATA-TGAGTTAAAGATCTATATAA-------------TTTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG-AAAAAAAACGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAATAATGGTTGACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATACCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCTATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTCTTTCTTCCTTGCTAT--------------TAGTTTAGTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGCTATCT-AGATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAATTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATCTTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAATATTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGTATTAATTAATTTGGAATTAGGTATTAA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCGATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AA{AG}AAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCAAAAGAAAAAAAAAAAGATAA-------------TATATATATATAAAGA-----------------TTCCTATTGATTTTGTA------AATTAAAAA--------AAA{AG}GGGGGGGTTATTTT----CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAGGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATAAATAGGTTCTTGA----AATTAATT---------T----------------AAGTAAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGGTATTATTATTTCTCTTAA----TTA---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-----------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA--------------TTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTGTACAATACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAAATAGATATATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTATTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGGTTTAGTTTTCTAGATTGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATTT---------TTTTATATTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTTGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCTTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTCCATCCATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAAA-TA----TGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_elongata TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTGTT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAGTTGGCTG--AAAAAAACGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAATGGTTCAAAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGGATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTCTTTCTTTCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAAATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAAAATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTCGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTAATGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAATA---AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCAAAAAAAAAAAAAAAGATAATATAT----------ATATATAAAA{AG}AAAT{AT}----------------TTCCTATTAATTTTGTA------AATTAAAAA------------A{AG}GGGGGTTATTATTTT-CCCCATCA----------------------------------A{AT}-AAAATAA{AT}A-----AA---{AT}AAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTCA----AATTAATT---------T----------------AAGTAAAAA--AAATTTTACT-------TTAT---------------ACCTT-TAGGTATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA---AGTGAAT--ATTAGA--------------------------------------TAA-TAA-------GAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----GAAAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGGCTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATTAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGACCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTT-----TTGTTTTATTGACTCATTTTATTT---------TT-----TTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCAAAATATCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTCATATTCTATTTCTATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAG-GGGACCCTTAGGA Brassica_fruticulosa TTTAGGTTAGCCCAAT------T-----ATAG--AATA{GT}TTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAATGATTCGATTAGAAGTCCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACG----------------------GTTCACAAAAAAG-AAACGGCATAAAAAAGTCG------------------TATATATATTATGCATTTTTCAAACTCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTGCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAAAAGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGCAATATTTGATTGATATTTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTTATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGTAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCG--------TTCTCTAGGCAGGAACGCA--ATATATTTACTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACTAAAAGAGAAAAAAAAAAAGATAATA-----TATATATATATAAAAGAAAGG----------------TTCCTATTGATTTTTTT------ATTTATAAA-----------AGGGGGGATTTTTGTTTT-CCCCATTA----------------------------------AT-AAAATAATA-----AA---AAAAGATCTTG-------TATTTCCTAGT-------TAATAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACCTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----TAATCAAAGTTATA-----AAAA-TATCT---------------------ATCCACAA-TACGTGAAT--ATGAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TACTGTGAC-AA----TTA-----TTAT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACCCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCAGCCTGCAA--TTTTTTTAAGA---TTTGTTTAGAAA--------------------TTGGGTTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCACGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTACATCGAATTCGGATTATCCGTATTAAATGGCTC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTTATGTTCTATAT-AATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-GATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_gravinae TTGAGGTTAGCCCAAC------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TTTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAAAGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTGACAAAAAAT-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATACCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGTTGGATGAATCTTAGCTATAACTTAATTATAATTAAGTACTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTCTTTCTTCCTTGCTAT--------------TAGTTTAGTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGCTATCT-AGATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCGCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGTATTAATT------------------AATTTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCTGAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCGATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAACT----AAAAAACATTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAAACATAT---AATTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCAAAAGATAAAAAAAAAAAAAGATAA-------TATATATATATAAGAAAGA----------------TTCCTATTGATTTTGTA------------AAA-----------AAAGGGGGTTATTTT----CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATAACTAGGTTCTTGA----AATTAATT---------T----------------AAGTAAAAA--ATTTTTCACT-------GTAT---------------ACCTT-TAGGTATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCC{AC}CAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGTAATATTATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAAATAGATATATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTATTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGGTTTAGTTTTCTAGATCGGCCGGCAATTTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATTT---------TTTTATATTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCTTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTCCATCCATTTC---------AT--ATTCTATATTA----------ATTTCTA-----TTTACATT--TATAAAG-AAAAAGAGAAA-TATGGATGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_incana TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATAAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATA---------TATATATACGAAATATACGAAAGA---------TTCCTATTGATTTTGTAA-----------AAA---------AAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_juncea TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTTAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAACCAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTGTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAAGATAATAT-ATATACGAAATATACGAAAGA--------------------TTCCTATTGATTTTGTA------------AAA--------AAAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------ATAAAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATTTAAGTCAAAT----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTTTTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAAATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_macrocarpa TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGAT{CT}AAAAAAAGAACG{AC}AGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------TATATATATATAT{AT}TATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGA{CT}GACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAAACTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TT-TTTTTTTCTATTTTATTTGATATCT-ACATATCCATGCCGGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATAAAATATTTA--------AATAAAAGAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTGATTCTG-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTTTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATTAA----------------AA---AATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAATTAAAGAAATCAA-TAGGAACCAAAAGAGAAAAAAAAAAAAAGATAA---TATATATATATATATAA{AG}AAAGA----------------TTCCTATTGATTTTGTAA---------AAAAA--------A{AG}GGGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCATT-------TTAT---------------ACCTT-TAGAAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------AGCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGGAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTT{AC}GTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCG{AG}AT{AT}CGGATTATCCGTATT{AC}{AG}ATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTCATATTCTATAT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_maurorum TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAATGATTCGATTAGAAGTCCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACG----------------------GTTCACAAAAAAG-AAACGGCATAAAAAAGTCG------------------TATATATATTATGCATTTTTCAAACTCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTGCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGCAATATTTGATTGATATTTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTTATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGTAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCG--------TTCTCTAGGCAGGAACGCA--ATATATTTACTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACTAAAAGAGAAAAAAAAAGATAATA-----------TATATATAAAAGAAAGG----------------TTCCTATTGATTTTTTT------ATTTATAAA-----------AGGGGGGATTTTTGTTTT-CCCCATTA----------------------------------AT-AAAATAATA-----AA---AAAAGATCTTG-------TATTTCCTATTAACTAGGAAATAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACGTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----TAATCAAAGTTATA-----AAAA-TATCT---------------------ATCCACAA-TACGTGAAT--ATGAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TACTGTGAC-AA----TTA-----TTAT----TTTT---A--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACCCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCAGCCTGCAA--TTTTTTTAAGA---TTTGTTTAGAAA--------------------TTGGGTTTATTTTTTGTTTTAGTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCACGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGCTC-AAACAAACAAATGAAATTCAGAAAGTATGTACATACATTTTATGTTCTATAT-AATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-GATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_montana TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAAGGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATTAA----------------AA---AATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTATCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACAAAAAAAAAAAAAAAAAA{AG}A{AT}AATAT--------ATATATATAC{AG}AAATATA-------CGAAAGA--TTCCTATTGATTTTG{AT}A------------AAA--------AAAGGGGGGGGTT{AT}TTACTTT-CCCC{AC}CCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAACGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_napus TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAAAAAAAAAAAAAAAA{AG}ATAATATATATATATAC{AG}AAATATAC{AG}AAAGA----------------TTCCTATTGATTTTGTA------------AAA--------AAA{AG}GGGGGGGTTATTACTTT-CCCCATCA----------------------------------A{AT}-AAAAAAATA-----AA---{AT}AAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACGATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_nigra TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAACGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATAT-TATATTATGCATTTTTCAAAATCCCGCGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTGATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TCTTTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCCTTTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCAATATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------ATTTTTTCT-----------------------------------------------------------------------------------------------------------------------------ATTTCTAAA----------AGGGGGGGATTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTGCTA-----AAAA-CATCT---------------------ATCCATAA-TACGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCGTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTGAAGA-TTTTTTTTTAGAAA--------------------TTGGGTTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTTTA-----TTTACATTTATATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCGCCTTAGGA Brassica_oleracea TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATAAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATA---------TATATATACGAAATATACGAAAGA---------TTCCTATTGATTTTGTAA-----------AAA---------AAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_oleracea_var._alboglabra TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATAAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATATATATATACGAAATATACGAAAGA------------------TTCCTATTGATTTTGTAA-----------AAA---------AAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA---------------TTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT------------------------------------------------CTT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_oleracea_var._botrytis TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATAAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGT-TTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGG-TTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATA---------TATATATACGAAATATACGAAAGA---------TTCCTATTGATTTTGTAA-----------AAA---------AAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_oleracea_var._gemmifera TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATAAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTGT{AT}A{AG}GCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATATATATATACGAAATATACGAAAGA------------------TTCCTATTGATTTTGTA------------AAA--------AAAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_oleracea_var._gongylodes TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATAAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATA---------TATATATACGAAATATACGAAAGA---------TTCCTATTGATTTTGTAA-----------AAA---------AAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_oleracea_var._sabadua TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATAAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGG-TTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATATATATATACGAAATATACGAAAGA------------------TTCCTATTGATTTTGTAA-----------AAA---------AAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGG- Brassica_oleracea_var._viridis TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATATTAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATAAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTTTTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGG-TTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAGATAATATATATATATACGAAATATACGAAAGA------------------TTCCTATTGATTTTGTAA-----------AAA---------AAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_oxyrrhina TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACTTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTCGGTATATA---AGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAGTT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATAA{AG}AACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTTAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTACTTAGTCTTAGTTAAACGCATCAACTCAATTTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGTA------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATAGAATATTTA--------AATAAAATAATAGCAAACTGTAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAACAAA-TCTACTCTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCCTGATTCGACGGGTTTGTACAACA-AAATAAATAAATAAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAAATTTTTTATA-TTTTTTAGAATACATATAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TA-----AA-----------------------------------------------------------------GAA--------------------------------------ATCAATAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------GAACCAAAA-GAGA-----AAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAGAAA-----------------------------------ATA------------------------------------------------------------------------GATATATATA-TAAGA--------------------------------------------------------------------------------------------------------------------AGAAGTGGACTCTAGAAGTACTCGTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTATAGACCGGCCGGCAAGTTTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTATTTTATTGAATCATTTTATTT---------TT-----TTATATCA{AG}AGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATGA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTACGGTAGAAAGAGATCTCTTTCTACCGTACTAGCGGGCCCCTTAGGA Brassica_procumbens TTTAGGTTACCCCAAT------T-----ATCG--AATA{GT}TTGGTTTACATTATGTAA{AG}AAACATTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGA{GT}TTAAA{AG}ATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TC{AG}ATAAC{AG}ATTCGATTA{AG}AA{GT}TTCTTCCTTTTTATCTGTGAATTGGCTG-AAAAAAAGCGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG------------TATATATATATATATTATGCATTTTTCAAAATCCCATGGATAGGAACTAATATAAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTAGAATTAAGTCCTAAGTCTTTCTAGCGCACT-GCCCCATAAAATTAAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTTCTTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAG--------------TAGTTTATTA------A---------------------------------------------TAAGTCGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC--TTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATAAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAA-----------------------------------------------------------TTGGAC-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT---AAAAAATATGAAATAAAAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTA-------GAATTAGCCTAA-CGG----AAAAACCA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGTAACCTTTCTTTTATATATATATATTTTTT---TTATCTTTTGG----------------------------GTCCTATTGGTTTTAAAA-----ATTTATAAA----------AAGGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCCATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--TTTTTTCACT-------TTAT---------------ACTTT-TAGGAATTTTTCTTTCTATAAA----TTC---TTAT--ATTTTTT------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCC{AC}CAA-TAAGTGAAT--ATGAGA--------------------------------------TAATAAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA----------TTTTTTTT--------------------------------------------TTTTAGT-----------------GATC-AAAAAAT--------CTTAGGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGAACGGCCGGCAG-TTTTTTTTAATA--TTTTTTTTAGAAA--------------------TTGGATTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATTTAATATGGATTATCCGTATTAAATGGATCAAAAAAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA-----ATTTAATTTTTA-----TTTTTTTT--TCTAAAGAAAAAAGAGAGA-TATGGGTGGATTCCTTTATATTCAGATCTTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_rapa TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTTAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAACCAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTGTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAAGATAATAT-ATATACGAAATATACGAAAGA--------------------TTCCTATTGATTTTGTA------------AAA--------AAAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------ATAAAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATTTAAGTCAAAT----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTTTTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAAATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_rapa_var._chinensis TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTTAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATT------------------AA-AAAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAACCAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTGTAGAATACATATAAATTAAAAAAATCTA-TAGGAACCAAAATAAAAAAAAAAAAGATAATAT----------ATATACGAAATATACGAAAGA-----------TTCCTATTGATTTTGTA------------AAA--------AAAAGGGGGGGTTATTACTTT-CCCCATCA----------------------------------ATAAAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATTTAAGTCAAAT----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTTTTT---------TT-----TGATATCA{AG}AGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAAATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_repanda TTTAGGTTAGCCCAAC------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGATATATA-TGAGTTAAAGATCTATATAA-------------TTTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG-AAAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAATAATGGTTGACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATACCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCTATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATGGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTCTTTCTTCCTTGCTAT--------------TAGTTTAGTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGCTATCT-AGATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAATTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATCTTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAATATTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCGATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCAAAAGAAAAAAAAAAAAGATAATAT---------TATATATATAAGAAAGA----------------TTCCTATTGATTTTGTA------AATTAAAAA--------AAAAGGGGGGGTTATTTT----CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------A{AT}AAATAGGTTCTTGA----AATTAATT---------T----------------AAGTAAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGGTATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-----------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA--------------TTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTGTACAATACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAAATAGATATATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTATTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGGTTT{AG}GTTTTCTAGATCGGCCGGCAA-TTTTTTTTAA{GT}A-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATTT---------TTTTATATTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCTTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTCCATCCATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAAA-TATGGATGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_spinescens TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAATGATTCGATTAGAAGTCCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACG----------------------GTTCACAAAAAAG-AAACGGCATAAAAAAGTCG------------------TATATATATTATGCATTTTTCAAACTCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTGCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGT-TTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTTTATTAAT---------------------------------------------TAAGTAGTTGAATCTAAATAATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTAAATAAAATAATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGCAATATTTGATTGATATTTGAAACCATTATTTATGATTCGA--TTTTTTAATTCTT-AATACAA-TTTTATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGTAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCG--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACTAAAAGAGAAAAAAAAAGATAATATA---------TATATATAAAAGAAAGG----------------TTCCTATTGATTTTTTT------ATTTATAAA----------AGTGGGGGATTTTTGTTTT-CCCCATTA----------------------------------AT-AAAATAATA-----AA---AAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACGTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----TAATCAAAGTTATA-----AAAA-TATCT---------------------ATCCACAA-TACGTGAAT--ATGAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TACTGTGAC-AA----TTA-----TTAT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACCCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCAGCCTGCAA--TTTTTTTAAGA---TTTGTTTAGAAA--------------------TTGGGTTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCACGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGCTC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTTATGTTCTATAT-AATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-GATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_spinescens1 TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAATGATTCGATTAGAAGTCCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACG----------------------GTTCACAAAAAAG-AAACGGCATAAAAAAGTCG------------------TATATATATTATGCATTTTTCAAACTCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTGCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGT-TTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTTTATTAAT---------------------------------------------TAAGTAGTTGAATCTAAATAATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTAAATAAAATAATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGCAATATTTGATTGATATTTGAAACCATTATTTATGATTCGA--TTTTTTAATTCTT-AATACAA-TTTTATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGTAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCG--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACTAAAAGAGAAAAAAAAAGATAATATA---------TATATATAAAAGAAAGG----------------TTCCTATTGATTTTTTT------ATTTATAAA----------AGTGGGGGATTTTTGTTTT-CCCCATTA----------------------------------AT-AAAATAATA-----AA---AAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACGTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----TAATCAAAGTTATA-----AAAA-TATCT---------------------ATCCACAA-TACGTGAAT--ATGAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TACTGTGAC-AA----TTA-----TTAT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACCCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCAGCCTGCAA--TTTTTTTAAGA---TTTGTTTAGAAA--------------------TTGGGTTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCACGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGCTC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTTATGTTCTATAT-AATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-GATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Brassica_villosa TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATTAAAAAAAGAACGCAGAATT-AAAAGA----AATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------TATATATATATATTTATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGACGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAAACTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTT{GT}ATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTC{AG}AATTGTTTCTTCCTTGCTAT--------------TAGTTT{AC}TTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGA{CT}T{CT}-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--T{CT}TTTTTTT{CT}{CT}{AT}{AT}TTTT{AC}TTTGATATCT-ACAT{AG}TCCATGCC{CG}{GT}TAATGTATCTGT--AAAAAAAGGGGAAAATTTCT------TATTTATATCTAATTCAATA{AC}AATATTTA--------AATAAAA{GT}AATAG{CG}AAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTT{AG}-TA{AT}{AT}CATCAATATGGAAATATTTGATTGATATCTGAAGCCATT{AC}TTTATGATTCGATTTTTTTTGATTCT{GT}-AATACAATTTTGATTCTT-ATACAA--CATAGAATTTTAGG{AC}TCTT{GT}TTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTT{AT}{AG}GT----ATTAA----------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--{AT}TATATTT{CT}CTATGAAATATAT-GAAACAAGAAGATTC{AC}AATAAGAGATAT{CT}GAC{AG}GATTTCC{GT}AAT--AAAAAAATAT{AG}AAAT--AAAA{AC}AAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGG-TTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------TAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAATTAAAGAAATCAA-TAGGAACCAAAAGAAAAAAAAGATAA----------------TATATATATAAGAAGGA----------------TTCCTATTGATTTTGTA------AATAAAAAA--------------AGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---GAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT--------------------------------------------------------------CATAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTCGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGGATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTCATATTCTATAT---TTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Cakile_lanceolata TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATCTAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATACCGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGTTG--AAAAAAAGGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAT-AAACGGCATAAAAAAGTCA----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATCCGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTAGATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAACGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCCCT-GCCCCATAAATTTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TACTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCTAACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-AGACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTCGAATCAAAACAAGATATTGAAATGCCCTTTTAGGT----AGT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--CAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATTGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATATATATATA------------------------------------------------------------------------------------------------------------------TTCTAAA---------AAGGGGGGGGTTATTATTTTCCCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAATATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATATTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--AATTTTTACTTTATACCTTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTTTA-----AAAG-CATCT---------------------ATACACAA-TAAGTGAAT--ATTAGA----------------------TAATAA----------TAATTAT-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----GTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAATAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTTAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Cakile_maritima TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATCTAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATACCGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGTTG--AAAAAAAGGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAT-AAACGGCATAAAAAAGTCA----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATCCGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTAGATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAACGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCCCT-GCCCCATAAATTTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TACTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCTAACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-AGACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTCGAATCAAAACAAGATATTGAAATGCCCTTTTAGGT----AGT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--CAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATTGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATATATATATA------------------------------------------------------------------------------------------------------------------TTCTAAA--------AAGGGGGGGGGTTATTATTTTCCCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAATATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATATTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--AATTTTTACTTTATACCTTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTTTA-----AAAG-CATCT---------------------ATACACAA-TAAGTGAAT--ATTAGA----------------------TAATAA----------TAATTAT-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----GTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAATAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTTAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Calepina_irregularis TTTAGGTTAGCCCAAT------T-----ATAG--AAGAGTTGGTTTACATTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTACCCCACT------TGTGAATTTAGATT-------TAGATAAGGATTCGATTAGAAGTTCTTACTTTTTATCTGTGAATTGGCTG---AAAAAACGATCAAAAAAAGAACGAAGAATT------CAAAGAATGGTTCACAAAAAAG-AAATGGCATAAAAAAGTCG----------------TATATATATATTATGAATTTTTTAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATTATTCAAT-----AATAGAATTATATTA---------------------TTTCAATAGAAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGTGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAATTTTGTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTACATGCCCTT-ATGTATCTGT--AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCTAGGCAGGAGCGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT-------------------AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-TTA----AAAAACAAATTTTTTAGAATTTTTTATAATACATATAAA----ATAAAAAAAATAGGAACCAAAAGAAAAAAAAAATATAATATAT-----------------------------------------------------------------AAATAAAAAAGAAAGGGGTGGGGGGGGATTCTTAATTTTCCCTATCACTAACTTGA-------------------------AT-ACAATAATA-----AA---TAAGGATCTTG-------TATTGCCTCGT-------TAAGAGGCAATACAAGATCTTTAAGCGAA--------------------------------------ATCCATAGGTTCTTGA----AATTAATT---------T----------------AAGTTAAAA--ATTTTGCACT-------TTAT---------------ACCTTATAGAAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCTAAGTTATAATTATAAAAGCATCT---------------------ATCCACAA-TAAGTGAATAAATGAAA--------------------------------------TCAATTG-------TAAATTCCATTGAA----------------------------------------------------------------------------------------TTG----------------GCTTC--------------------------------------------TTTAA---------------------------------------TTTAAATTTG--------AAT------C{CT}{CT}------------------------------------------------------------------------{CG}{AG}{AC}C{AG}{AT}T{AT}A{AC}CTAAAA-------------------------AC------------TTGT----TAGT------------------------------------------------ATT-----------GTTAGAAGCGGACTCTAGAAGTACTCCTAATTGCGGTAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGTCATAAA-ATTTTTTTAAGA--TTTTTTTTA------------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTCTAT---------TT-----TTATATCAGGGTTTACACCGTTAAACATTCATGGGGTAACGCCTTTTCGAAATCTGAAGAAGTTTCCATCAAATTCGGATTATCTGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACAGACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTGACATT--TAAAAAG-AAAAAGAGAGATTATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA 'Capsella bursa-pastoris' TTTAGGTTAGTCCAAT------T-----ATAG--AATAGTTAGTTTACGTTATGTAAGAAAAACTTGTATATG-------TGATATTTGATATTGCCTAGGTATATA-TGAGTTAAAGATCTATATAAGTTGAATCTGCTCTCTGCTCTACTGCTTT-TGTGAATTTCTATT-------GAGATAGGGATTTGCTTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG---AAAAAACGATAAAAAAAAGAACGAAGAATT------CAAAGAAGGGTTCACAAAAAAT-AAATGGCATAAAAAAGTCG------------------TATATATATTATGGATTTAAAAAAATCCCGTGGATAGGATCTACTATCAAAGTAATTCTTATGATTCACT----------AATTGTATTA---------------------TTTCAAT-TCGAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATTACTTAATTAGAATTCCGTCCTAAGTCTTTCTCGCGCACTGGCCCCATAAAATTAAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCACCAACTCAATTTGTTTCTTCCTTGCTAT--------------TAGTTTATTAATAAGTA---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTATTCAGATAA---AGA---------CATTTTGTTTCTTTTTTGCGGGTATTAAATACTTGTCTATTAAATACTATAGTATCAACTGTTGTTAGTTTCCTTTTATACCCTGTTTTTAGTTGACGGGTTGAAGCAAAAAGGGAACTTTGAATATT-TTTTTTTTTATTTTTTTTGATATCT-ATATGTACATGCTCTT-ATGGATCTGT--AAAAAAAGGGGGAAATTTCTT-----AATTTATATTTAATTCACTACAATATTTA--------AATAAAATTATAGGAAACTGTAAATGAGAGTTTCTTTCTCACAGACACCTTCGATCACATTACATTGTCATCTCG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATGA-TTATGATTCGATTTTTGTTTATTTTG-AATATAA-ATTGATTCTT-ATACAA---AGAGAA-TTTAGTATCTTGTTATGTTCTCGAATCAAAA-AAAATATTGAAACGCCCTTTTAGTT----ATT-----------------------ACTTTGAAA-TAAGACTTCCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--ACAAAAATATGAAAT--AAAAAAAA-TATACTGTTTCAA---------TTTAATCTCTATCGAATTTGAATATCAGAATAGTGGCTATAGTCATGATTCGATGGGTTTGTACAGCA-AAATAAAT----AAAAAACACTATAATAATTT------AAAATTAGCTTAA-CTA----AAAAACCA---------A-TTTTTAAAAATACATATAAA--------ACTAAATAGGAACCAAAAGAAGAAAAAAAGACAA--------------TATATAGGTAAAAAGG-----------------TTCACATTTTTTT----------AGTTCCAAA------------AAGGGGATTCGTATGTT-CCCCATCACTACCATCACTACCTTGATACAATAATAAATAAGAT-ACAATAATA-----AA---TAAAGATCTTT-------TATTTCCTCTT-------AATGAGGAAATAAAAGATCTTTAAATTAATTACTTTAAGTGATCAAAAAATCTTATGTTTGTACAATATAAAAATATACATAAA---AAATATTTTGATAATTTT-----TTTCTCTTGAGCAATTAAGA--AAATCTTATT-------TTATTTAAAATTTCTAAGGGTTTTGAAGAAGTTTTTATTTTTCGAAAAAGCTTT---TTTT--ATCATAT------------AAACG----AAAAAAAAAATGATA-----AAGAGCATTTAGAATTTTGTCTTTGGGTTGAAGTTCCAACTACTTTAATTTAGTTACATTTTTCAATGATTGTATTCTAGAAAAAATAGAAAGGACAA-AAAGTGAATTTAAATAATTTTAAATAACTTAGATAAAAAAAAAGATCTTAATTGAATTAAAACCCCAATACCTATTTCAAAAAGTTTTAATTGATTTAATCAATTGGAAATTTGAATC----AATTGGCTTCTTTA--------------------------------------------TTTCAATTTTAATCTCGACGATTGAATC-AAAACTT--------GTTAATATTGTTTTGAACAAGTTGCCGCTATGGTGAAATTGGTAGACACGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGGTTCGAGTCCGAGTAGCGGCATAAGATCTTCTAAAAGAGATATTATAAG--TTTTATAATCAAAATAATACCCAACTTT----TTTT---CTAAAATCGGGTAAAACCGAGTATTAATTTATTAATTTTTAACAAATTTTTTATGATTTTTTAGAAGTGGACTCTAGAAATACTTCTAATTGCGGTAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTCGTTTTCTAGACCGTTCGGCAA-TTTTTTTGAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTA-----TGTTTTATTGACTCAGTTTCTAT---------TT-----TTATATCAGGGTTTACACGGTTAACCATTCATGGGGTAACCCC-TTTCGAAATCTGAAGAAGCTTCCATCGAATTGGGATTATCTGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATATATATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTGACGTT--TATAAAG-AAAAAGAGAGA-TATAGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTA--GGACCCCTTAAGA Carrichtera_annua TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTATTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTTAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTCTTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTCTTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCC-TTTAGGT----ATTAA----------------AA---AATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAACCAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTAC{AT}ACA-AAATAAAT----AAG{AC}{AT}ACACTA{AG}AATCA{GT}TA-------{ACG}AATT{AC}{CG}CCTAA-CG{CT}----AAAAACCA---------{AT}-TTTTGTAGAATAC{AC}TATAAATTA{AG}{AC}AAAATCTA-TAGGAACCAAAATAA{AG}AAAAAAAAAGATAATAT----------ATATACGAAATATACGAAAGA-----------TTCCTATTGATTTTGTA------------AAA--------{AG}AA{AC}GGGGGGGTTATTACTTT-CCCCATCA----------------------------------ATAAAAAAAATA-----AA---TAAAGA{CT}CTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATTTAAGTCAAAT----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAC-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGC-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTG-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTTTTT---------TT-----TGATATCA{AG}AGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAA{AG}A{AG}AGA-TATGGGTGGATTCCTTTATATTAAAATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Caulanthus_amplexicaulis TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAA{AG}AAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCTCGCTACTTT-TGTGAATTTCAATT-------TA{AG}ATAAGGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-CAAAGAAAAGAATGGTTCACAAAAAAT-AAATGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTAAAAATCCCGTGGATAGGAACTAATATC---------------------------AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTTGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTCTTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTACATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATTATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGATTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATTAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--AAAAAAAA-TCGACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAAAACA-----AATTTTTTAGAATACATAGAAA-----------AAATAGGAACCAAAAGAGAAAAAAAAGAAAAGATAA---------TATATAGATAAAAAAGAAAGG------------TTCCTATTTTTTTCT--------ATTTTCAAA-----------ACGGGGGATTCTTATTTT-CCCCACCA----------------------------------CT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGAAATTAATTAATT---------T----------------AAGTGAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TT{CT}---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTATT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------{CT}TTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTATTATTTTTT----TTTT---C--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATATTTTTATATCTT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAATAAATAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATAAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Caulanthus_inflatus TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCTCGCTACTTT-TGTGAATTTCGATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAATAATT-CAAAGAAAAGAATGGTTCACAAAAAAT-AAATGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTAAAAATCCCGTGGATAGGAA----TATCAAAGGAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTACATGCCCTTAATGTATCTGT--AAAAAA-GGGTAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATTATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGATTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATTAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--AAAAAAAA-TCGACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTAGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAAAACA-----AATTTTTTACAATACATAGAAA-----AAAA-----TAGGAACCAAAAGAAAAAAAAAAAAAAGATAAT----------ATATAGATAAAAAAGAA{AG}GG------------TTCCTATTTTTTTCT--------ATTTTCAAA-----------ACGGGGGATTCTTATTTT-CCCCAACA----------------------------------CT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT--------AAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGAAATTAATTAATT---------T----------------AAGTGAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTATA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTATT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTA-----TTAT----TTTTTTTC--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATATTTTTATATCTT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATTGAATTCGGATTATCCGTATTAAATGGATC-AAACAAATAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTATAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATAAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Ceratocnemum_rapistroides TTTAGCTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGTTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAACGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTAAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTGTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA---------------------------------------------------------AGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCGATGCCTGT-------------AAAAAA-AGGGAAAATTTTT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTTATTCTTAATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATAAA-TAGGAACCAAAGGAGAAAAAAAAAGATAATATA---------TATATATAAAAGAAAGG----------------TTCCTATTTATTTTTTTA-----ATTTCTAAA----------AGGGGGCGATTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCCATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------CCTTG-----GAATCAAAGTTATA-----AAAA-TATCT---------------------ATCCACAA-TACGTTAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------AGT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCTGCAA---TTTTTTAAGA-TTTTTTTTTAGAAATTGGATTTATTTTTTGTTTTTTGGATTTATTTTTTGTTTTATTGACTCATTTTCTAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-----AAACAAATGAAATTGAGAAAGTCTGTACATACATTTC---------AT--ATTCTAT-TTAATTCTATTTAATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Coincya_longirostra TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACAGCATAAAAAAGCCG--------TATATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATAAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTTATTTAATTGGT{GT}TCGAAGATCAAAATATTTGATTTTATCGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTA{GT}TA------A---------------------------------------------TAAGTAGTTGAATCTA{AG}ATCATGAATTGTCGGATTACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATT{CG}AATACAATATTTA--------AATAAAATAATAG{CG}AAACTGT{AG}AATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGAT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAA---AAAAAACTATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGAATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGC----AAAAACAA---------A-TTTTTTAGAATACATATAAA------AAATCAA-TAGGAACCAAAAGAGAAAAAAAAAGATAA-------------TATATATATAAAACGAAGGG-------------TTCCTATTGATTTTTAAA-----ATTTCTAAA---------AGGGGGGGGATTCTTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAACAGGTTCTTGA----AATTCATT----------------------------------T--AATTTGCACG---------------------------------AGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATGAGA-------------------------TAA----------TAA-AAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------TATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------ATAGA--TATTTTAAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGGAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTTTAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGA-GTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGAAATTTCACTTGTAGCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Coringia_planisiliqua TTTAGGTTA{CG}CCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAC{AG}AAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCGATT-------TA{AG}ATAAGGATTCTATTAGAAGTTCTTCCTTTTTATCTGTAAATTGACTG--AAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-CAAAGAAAAGAATGGTTCACAAAAAA{AG}-AAATGGTAT-AAAAAGTCG----------TATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGTAACTAATATCAAAGTAATTCTTATGATTCAATAATA-AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAA?TCC?A?GTCTTTCGCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGAGAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AAATTT-TTTTTGTCTATTTTCTTTGATATCT-ACATGTACATGCCCTT-ATGTATCTGT--AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTAAATCACATTACATTGTCATCTTG-TATGCATCAATATCGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCT-TTTAGGT----ATT-----------------------AATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATTGACGGATTTCCTAAT---AAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTGATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCAGGATTCAATGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACCA---------A-TTTTTTAGAATACATCTAAA-----AAAATAAA-TAGGAACCTAAAGAGGAAAAAAAAAAAAATATA--------ATATATAGATAAAAAAGAAAGG------------TTCCTATTTATTTTTTT------ATTTCCAAA-----------AGGGGGGATTCTAATTTT-CCCCATCACCACC------------------------TTG--AT-GCAATAATA-----AA---CAAAGATCTTG-------TATTTCTTCGT-------TAAGAGGAAATACAAGATCTTGAAGCGAA--------------------------------------ATCAATAGATTCTTGCA---AATTAATT---------T----------------AAGTGCAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTTA-----------ATTTG-----GAATCAAAATTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAATAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTATT--------------------------------------------TTTAAAT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------GTAGA--TATTTTGAT-AA----TTA-----TTAT----TTTT---T--------------------------------------------GTT------CATTTCTCAGAAGTGGACTCTAGAAGTACTCCGAATTGCGCTAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTTGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTG---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGG-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGG Crambe_filiformis TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTGTGTGAATTTCTATT-------TAGATACCGATTCAATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAATGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGATTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATGAAGTCCTAAGTCTTTCTGGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------ATTAAGTAATGTTTATTAATTAAGTAATGTTTATTAATTAAGTAATTAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-GTTTTTTCTATTTTCTTTGATATCT-ACATGTCCAGGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT---AAAAAATATGAAT---AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCTTTCTTTTATATATATTATCTTTTTTTTCTCTTTTGG------------------------------TTCCTATTGATTTTTAAA-----ATTTCTAAA------------AGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCGTGA----AATTAATT--------GT----------------AAGTCAAAA--ATTT-------------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATTT---------------------ACCCACAA-TAAGTGAAT--ATGAGA----------------------TTATAATAATAATAAGTAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----GACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCAGTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCATATTAAAGGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Crambe_hispanica TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTGTGTGAATTTCTATT-------TAGATACCGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATCAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGATTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATGAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A--------------------------------------------TTAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-GTTTTTTCTATTTTCTTTGATATCT-ACACGTCCAGGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAAAAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT---AAAAAATATGAATA--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACCA-----------ATTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCTTTCTTTTATATATATTATCTTTTTTTTTCTCTTTTGG-----------------------------TTCCTATTGATTTTTAAA-----ATTTCTAAA------------AGGGGGGTTATTATTTT-CCCCATGA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCGTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATTT---------------------ACCCACAA-TAAGTTAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----GACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TTTATTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAAGGGATC-AAACAAACAAATGAAATTGAGAAAGTATGGACATCCATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Crambe_hispanica_var._abyssinica TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTGTGTGAATTTCTATT-------TAGATACCGATTCAATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAATGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGATTATTTTGGCTGGATGAATCTTAGCGCTGACTTAATTATAATGAAGTCCTAAGTCTTTCTGGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTAATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A-----------------------------------TTAAGTAATTTAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-GTTTTTTCTATTTTCTTTGATATCT-ACATGTCCAGGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT---AAAAAATATGAAT---AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATCAA-----AAAATCAA-TAGGAACCTTTCTTTTATATATATTATCTTTTTTTTCTCTTTTGG------------------------------TTCCTATTGATTTTTAAA-----ATTTCTAAA------------AGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCGTGA----AATTAATT---------T----------------AAGTCAAAA--ATTT-------------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATTT---------------------ACCCACAA-TAAGTGAAT--ATGAGA----------------------TTATAATAATAATAAGTAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAAT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCATATTAAAGGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Didesmus_bipinnatus TTTAGGTTAGCCCAAT------{AT}-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTG{CT}ATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATCTAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATACCGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGTTG--AAAAAAAGGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAT-AAACGGCATAAAAAAGTCA----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATCCGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTAGATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAACGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCCCT-GCCCCATAAATTTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAA{AG}ATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCT{CT}CCTTGCTAT--------------TACTTTATTA------A---------------------------------------------TAA{CG}{CT}A{GT}TTGAATCTAA{AT}TCA{AT}GAATTGTCGGATGACTC-ATTACTCA{AG}ATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCTAACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-AGACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTCGAATCAAAACAAGATATTGAAATGCCCTTTTAGGT----AGT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--CAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATTGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATATATATATA------------------------------------------------------------------------------------------------------------------TTCTAAA--------AAGGGGGGGGGTTATTATTTTCCCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAATATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATATTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--AATTTTTACTTTATACCTTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTTTA-----AAAG-CATCT---------------------ATACACAA-TAAGTGAAT--ATTAGA----------------------TAATAA----------TAATTAT-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----GTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAATAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTTAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Diplotaxis_erucoides TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGACGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTAAAAATCCCGTGGATAGGAACTAAGATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTTTTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTATCGCGTACT-GCCCCATAAAATTGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGTATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATTT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAATAAATAAAAAACACTAGAATCATTA-------GAATTAGCCTAACCGT----AAAAACAA---------A-TTTTTTAGAATACATATAAATTAAAGAAATCAATTAGGAACCAAAAGAAAAAAAAAAAAAATAATAT----------ATATATATAA{AG}A{AT}AGA----------------TTCCTATTGATTTTGTA------AA{AT}AAAAAA--------------{AG}GGGGGTTTTATTTT-CCCCATCA----------------------------------A{AT}-AAAAAAA{AT}A-----AA---TAAAGATCTTG-------TATTTCCTA{GT}T-------TAA{AG}AGGAAATACAA{AG}ATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTTACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCT{CT}TTAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAATTAAGTGAAT--ATT{AC}GA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TG-------------TTTTT--------------------------------------------T{AT}TAAGT-----------------GATCAAAAAAAT--------ATTATGTTTG-----T{AG}CAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAACTTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTCTTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAAATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGATAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Diplotaxis_harra TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTCCGTTATGTAAGAAACATTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTGAAAAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------TATATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATGAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCACGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATGTGATATCT-ACGTGTCCATGCCGGT-------------AAAAAA-GGGGGAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTCCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTTTTTATGATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAACT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-TAAAAAAATCAA-TCGGAACCAAAAGAGAAAAAAAGATAATA-------------TATATATAAAAGAAAGA----------------TTCCTATTGATTTTGTAA-----ATTTAAAAA------------AGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCCCT-------TTAT---------------ACCTT-TATTAATTATTATTTCT{CT}TGAA----TT{CT}---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-TATCT---------------------ATCC{AC}CAA-TAAGCGAAT--AGTAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA---------TTTTTTTTT--------------------------------------------TTTAAGT-----------------TATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-GA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTA----------------------------CTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGACAA-TTTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTCACTCATTTTATTT---------TT-----TTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTCTATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCCTAGGA Diplotaxis_virgata TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAAGACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTTTGTGAATTTATATT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAAGGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAATGGCATCAAAAAGTCG------------------TATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAACTAGAATGATATTATTTCAAT-TCAAGTTTTTCGGTATTTTGGCTGGATGAATCTTAACGATGACTTAATTATAATTAAGTCCTAAGTCT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTTA-------------------------------------------------------------------------------------------------------------------------------------GATTCGA--TTTTTTGATTCTT-AATACAA--TTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCT{CT}TAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAT-CGT----AAAAACAA---------A-TTATTTAGAATACATATAAA------AAATCAA-TAGGAACCTTTCTTTTATATATATTATCTTTTT---TTCTCTTTTGG----------------------------TTCCTATTGATTTTTAAA-----ATTTCTAAAAG{AT}AAA{AG}TAAAAGGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGAGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTAACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----TAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCACAA-TAAGTGAAT--ATGAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATAT---------------------------------------------------------------------------------------------TA--------------------------------------------------------------CTTAAGT-----------------GATC-AAAAAAT--------ATTATATTTT-----AACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATG--------TCTCTTAGAAGTGGACTCTAGAAGTACTTCTAATTGCGATAATAATCAAACTCTATCAACCTGTATAAA-TTGGTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTT--TTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATAGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGAGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Enarthrocarpus_lyratus TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTC--AAAAAAACGTTCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAACGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------TATATATATATATATATTATGCATTTTGCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCTTT-----AGGATTTAATTTAATTGGTTTCGAAGATAAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCA{AC}ATTGTTTCTTCCTTGCTAT--------------TA{CG}TTTATTA------A---------------------------------------------TAAGTAGTT{GT}AATCTAAATCATGAATTGTC{AG}{AG}ATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------A{AG}TAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTTAATCACATTACATTGTCATCTTG-TAAGCATCAATATGAAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTATAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAAGT----ATT------------------AA-TTAATTTAGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAATAAATAAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----TAAATAAA-TAGTAACCAAAAGCGAAAAAAAAGATAATATAT--------ATATATATATAAGAAAGA----------------TTCCTATTGATTTTGTA------AATAAAAAA-------------AGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAACAATA-----AA---TAAAGATCTTGTATTTCCTATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAACAGGTTCTTGA----AATTAATT---------T----------------AAATCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGATTTATTATTTCTCTGAA----TTC---GTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGACGGCAA--TTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TTATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTCATATTCTATATTAATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Eremophyton_chevallieri TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATCTAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCA--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTAGATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATAAATCTTAGCGATGACTTAATTATAATTAAGGCCTAAGTCTTTCTCGCGCCCT-GCCCCATAAAATTGAACCCTT-----AG----{AT}C{AT}TTTAATTGGTT{GT}C{GT}AA{CG}ATCAAAATATTTGATTTTATTGGTCCTTA------CTTA{CG}GTAAACGCATCAACTCA{AC}ATTGTTTCTTCCTTGCTAT--------------TACTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAA{AC}TCATGAATTGTCGGATGACTC-ATTACTCA{CG}ATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCC{AG}TGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCT{CT}GAATCAAAACAAGATATTGAAAT{CG}CCCTTTTAGGT----AGT------------------A{AC}-{CT}TAATTTGGAA-TAAGACTTTCT--------TT{CT}T{AC}TAGGCAGGAACGCA--ATATATTTCCT{AC}TGAA--ATATACAAACAAGAAGATTA-AATA{AC}GAGATATCGACAGATTTCCGAAT--CAAAAAATATGAAAT--AAAAAAAA-T{CT}TA{AC}TGTTTCAA---------TTTTATCT{CG}TAT{CT}GAATTTGAATATCAGAATAGTGGATATAGTCATGATT{CG}GACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTC-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AT-AAAAAAATC-----AA---TAAATATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATATTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTCATT---------T----------------AAGTCAAAA--AAATTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA----------------------TAATAA----------TAA-TAA-------TAAGTAACAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCATTGAAA--------ATAGA--TATTTTGAC-AA----TTA-----GTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGGCGGCAA-TTTTTTTGAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTCTGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCATATTAAATGGATC-AAACAACCAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAAGTATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATTTCTTTCTACCATACTAGCGGGCCCCTTAGGA Eruca_pinnatifida TTTAGGTTAGCCCAAT------T-----AGAG--AATAGTTGGTTTACGTTATGTAAGAAACATTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTATATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATTTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCAGAAAAAAG-AAACGGCATAAAAAAGTCC--TATATATATATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCAATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCCTGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-GGGGGAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTAAATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGTATTAATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-TAAAAAAATCAA-TAGGAACCAAAAGAGAAAAAAAAGATAATATAT----------ATATATAAAAGAAAGA----------------GTCCTATTAATTTTGTA------AATAAAAAA---------AAAAAGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---{AT}AAGGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAA{AG}ATCTTTAA{CG}CGAA--------------------------------------ATAAA{AT}AGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTGACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGCGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTAAGT-----------------TATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGG{CG}TAGTATGGTAGAAAGAGATATCTTT{CT}TACCATACTAGCGGGCCCCTTAGGA Eruca_vesicaria_var._sativa TTTAGGTTAGCCCAAT------T-----AGAG--AATAGTTGGTTTACGTTATATAAGAAACATTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTATATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGT-------------AAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCAGAAAAAAG-AAACGGGATAAAAAAGTCC----------------TATATATATATTATGCATTTTTCAAAATCCCGTGTATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-GGGGGAAATTTCT------TATTTATATCTAATTCAATACACTATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAG-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-TAAAAAAATCAA-TAGAAACCAAAAGAGAAAAAAAAAAGATAATATATATATATATATATATAAAAGAAAGA----------------GTCCTATTAATTTTGTA------AATAAAAAA--------AAAAAGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAGGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTGACT-------TTAT---------------CCCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGCGAAT--ATTATA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGT-----------------TATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATTT---------TT-----TTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAACGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Erucaria_erucarioides TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATCTAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCA--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTAGATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATAAATCTTAGCGATGACTTAATTATAATTAAGGCCTAAGTCTTTCTCGCGCCCT-GCCCCATAAAATTGAACCCTT-----AG----TCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TACTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTCGAATCAAAACAAGATATTGAAATGCCCTTTTAGGT----AGT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATACAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--CAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATTGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTC-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AT-AAAAAAATC-----AA---TAAATATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATATTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTCATT---------T----------------AAGTCAAAA--AAATTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA----------------------TAATAA----------TAA-TAA-------TAAGTAACAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAC------ATA------------------------------------------------------------------------AAAAGATGCATTGAAA--------ATAGA--TATTTTGAC-AA----TTA-----GTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGGCGGCAA-TTTTTTTGAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTCTGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCATATTAAATGGATC-AAACAACCAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAAGTATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATTTCTTTCTACCATACTAGCGGGCCCCTTAGGA Erucastrum_canariense TTTAGTTTAGCC-----------------------ATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTTGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAT-AAACGGCATCAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGCGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TAAAGTTTTTCGTTATTTTGGCTGGATGAATCTTAACGATGACTTAATTATAATTAAGTTCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTAATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTTAATTACTCA{AG}ATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTAGTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCA-----ATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTGGATTTTTATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTTAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTCCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAT-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA------AAATCAA-TAGGAACCTTTCTTTTCTATATATTATTTTTTT---TTCTTTTGG------------------------------TTCCTTTTGATTTTTTAT-----ATTTCTAAA-----------AGGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTAAAAA--TTTTTTCACT-------TTAT---------------ACCTT-TAGGACTTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAA-AATCT---------------------ATCCACAA-TAAGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAAA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTTAAAATTGCGATAATAATCAAACTCTATCAACCTGTATCAATTTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAAGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-----AAACAAATGAAATTTAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAAATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGAT{CT}TCTTT{CT}TACCATACTAGCGGGCCCCTTAGGA Erucastrum_elatum TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAATTCTTCCTTTTTATCTGCGAATTGGCTGAAAAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAACAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGACGACTTAATTATAATTAAGCCCTAAGTCTTTCTAGCGCACT-GCCCCATAAAATTAAACCCTT-----AAAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTT-TTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATAGAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCGTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATATAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAATTAGAC------------------------------------------------------------TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT---AAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAACT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAATAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCTTTCTTTTATATATATATATTATTTTTTTCTTTTTTGG-----------------------------GTCCTATTGATTTTTAAA-----ATTTCTAAA---------AAAGGGGGGGTTATTTTTTT-CGCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCCTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCCATAGGTTCGTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----GTA---TTAT--ATTTTTG------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCATAA-TAAGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTTAAT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAATATGTA-TGAAA--------AGAAA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAG-TTTTTTTTAAGATTTT--TT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATATT--TCTAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATCTTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Erucastrum_gallicum TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------TATATATATATATATATTATGCATTTTTAAAAATCCCGTGGATAGGAACTAAGATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTATCGCGTACT-GCCCCATAAAATTTAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGTATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTG------------------------------------------------------------------------------------ATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTGGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAATAAAAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCTA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAACCGT----AAAAACAA---------A-TTTTTTAGAATACATATAAATTAAAGAAAGCAATTAGGAACCAAAAGAAAAAAAAAAGATAATATAT----------ATATATATAAGATAGA----------------TTCCTATTGATTTTGTA------AATTAAAAA------------AGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---AAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTTAGCGAA--------------------------------------ATCAACAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATCAAAAAAAT--------ATTCTGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGC--TATTTGGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TTTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATTAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTGTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTCTTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TCTAAAG-AAAAAGAGAGA-TATGAGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Erucastrum_ifniense TTTAGGTT-GCCCAAT------T-----------AATAGTTGGTTTAC{CG}TTATGTA{AG}GAAACACTTGTATA{AT}G-------{GT}GATATTTGAT{AC}T{CT}GACT{AC}GGTATATA-TGAGT{AT}AAAGATCTATATAA-------------TC{CT}GCCCC{AC}CTACTTT-TGTGAATTT{CT}T{AT}TT-------TCGATAACGATTCGA{AT}{AT}AGAAGTTCTTCCTTTTTATCTGTGAAT{GT}GGCTG--AAAAAAATGATCAAAAAAAGAACGAA-AATT-AAAAGAAAAGAATGGTTCACAAAAAAT-A{AC}ACGGCATC{AC}AAAAGTCG--------TATCTATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATATAATTATATTATTTCAAAATA-AATGATATTATTTCAAT-TCAAGTTTTTCGTTATTTTGGCTGGATGAATCTTAACGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGA-----ATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA---------------------------------------------------------AGTTGAATCTAAATCATGAATTGTCGGATGACTTAATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTAGTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCTTATTTATATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATGTGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGTAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCGGAAT--AAAAAAATATGAAAA--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTGT-CGT----AAAAACAA---------A-TTTTTTCGACTACATATAAA-----------------------------------------------------------------------------------------------------------------------------------AAGGGGGGATTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTACGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT--------------------------AAAGTAAAATTTTTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCACAA-TAAGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGC--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTTAAAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCGAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTTAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Erucastrum_littoreum TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAAC----------------------GGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG------------------TATATATATTATGCATTTTTCAAACTCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTTTTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTAATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAGGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTTAAATACAA-TTTGATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCT-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCTTTCG----TTCTCTAGGCAGGAACGCA--ATATATTTCCTATAAA--ATATAGAAATAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAATAAAAAAAAAAATCTACTGTTTCAA---------TTTTATCTCGATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGACTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA----------------------------------------------------------------------------------------------------------------------------------AAGGGGGGGATTATTATTTT-CCCCATTA----------------------------------AT-AAAATAATA-----AA---AAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACGTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----TAATCAAAGTTATA-----AAAA-TATCT---------------------ATCCACAA-TACGCGAAT--ATGAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA--------------TTTT--------------------------------------------TTTTAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------CGAGA--TACTTTGAC-AA----TTA-----TTAT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAA-----------TGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCAGCCTGCAATTTTTTTTTTAGA---TTTTTTGAGAAA--------------------TTGGATTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATCGGATAACCCCTTTTAGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGCTC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTCATATTCTATAT-AATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGC-GATGGG-GGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Erucastrum_nasturtiifolium TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAATACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA-TAAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TAGATAATGATTCGAGTATAAGTTCTTACTTTTGATCTGTGAATTGGCTG----AAAAAAGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAATGGTTCACAAAAAAA{AG}AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTAAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTA{AG}AATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATGGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A--------------------------------------------TTAAGTAGTTGAATCTAAATCATGAATTGTCAGACGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AC--TATTTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAACTATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAATATTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAAAATACATATAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAACAGGTTCTTTA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------CGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTTTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAT--------------------TTGGATTT?TGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TTATATCA?AGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATTTAATTCGGATTATCC?TATTAAATGGATC-AAACAAACAAATGAAATTGA?AAAGTATGTAC?TACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTAC?TT--TATAAAG-AAAAAGA????-???GGGTGGATTCCTTTA?A????GATATTTC?CTTGTATCTTTAA?C?TTA-------C??AA??G???G??????AGAAAA?AA????TT?A???????C?T?AAT?C????????A Erucastrum_palustre TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAATGATTCGATTATAAGTCCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACG----------------------GTTCACAAAAAAG-AAACGGCATAAAAAAGTCG------------------TATATATATTATGCATTTTTCAAACTCCCGTGGATAGGAACTAATATCAAAGTAATTATTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTGCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----ATAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAAAAGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGCAATATTTGATTGATATTTTAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTTATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGTAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCG--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTATAATACATATAAA-----AAAATCAA-TAGGAACTAAAAGAGAAAAAAAAAGATAATATA---------TATATATAAAAGAAAGG----------------TTCCTATTGATTTTTTT------ATTTATAAA----------AGGGGGGGATTTTTGTTTT-CCCCATTA----------------------------------AT-AAAATAATA-----AA---AAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACGTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAAGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----TAATCAAAGTTATA-----AAAA-TATCT---------------------ATCCACAA-TACGGGAAT--ATGAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTTAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TACTGTGACGAA----TTA-----TTAT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACCCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCAGCCTGCAA--TTTTTTTAAGA---TTTGTTTAGAAA--------------------TTGGGTTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCACGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGCTC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTTATGTTCTATAT-AATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-GATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Erucastrum_virgatum TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGCTAACGATTCGATTAGAAATTCTTCCTTTTTATCTGCGAATTGGCTG-AAAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAACAGAATGGTTCACAAAAAA{AG}-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGACGACTTAATTATAATTAAGCCCTAAGTCTTTCTAGCGCACT-GCCCCATAAAATTAAACCCTT-----AAAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTT-TTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATAGAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCGTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATATAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAATTAGAC------------------------------------------------------------TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT---AAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAACT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGG----AAAAATAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCTTTCTTTTATATATATATATTATTT---TTTTCTTTTTTGG--------------------------GTCCTATTGATTTTTAAA-----ATTTCTAAA---------AAAGGGGGGGTTATTTTTTT-CGCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCCTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCCATAGGTTCGTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----GTA---TTAT--ATTTTTG------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCATAA-TAAGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAATATGTA-TGAAA--------AGAAA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAG-TTTTTTTTAAGA----TTTTTTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATATT--TCTAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATCTTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Eutrema_halophilum TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTCTGTAAGAAACATTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TTTGAATTTCGATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCGTTTTATATAT----------------------------------------ATT---------------------------------------------------------------------ATGTATTATGAATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGGAATTCTTAT-----------------------------------------------------------AAGTTTTTGGTTGTTTTGGCTGGATGAATCTTATTGATGACTTAATTAGAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTAGTGGTCCTTA------CTTAGGTAAACGCATCAACTCAATTTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAATTGAATCGAAATCATAAATTGTCGGATGACTC-ATTACTCAGATAA---AGC-----------------------------------------------------------------------------------------------------------------------------------AATCTT-TTTTTTTCTATTTTCTTTGATATCT-ACATGTACATGCC{CT}{GT}T-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCACTACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCGATCACATTACATTGTCATCTCA-TATGCATCAATATGGAAATATTTGATTGAGAT{CT}TGAAGCCA----------------------TGATTCTT-AATATAA-TTTGATTCTT-CTACAA---ATCGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TT{AT}ATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCAGAGGAA??ATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--?AAAAAAACTCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTGTACAACA-AAATAAAT----AAAA--------------TA---------------------------AAAAACAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATAAAA-----AA---------------------------------------AAAAAAGAAA--------------------------------------------------------------------------------------------------------------------AAAA--AATTTACACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTCAA----TTC---TTAT--ATTCGTT------------ACTTG-----GAATACAAGTTATAA----AACGACGGTT-------------------------------------------------------------------------------------TAATCAA---------------AACTTA----------------------------------------------------------------------------------------TTAGTA-------------TTGTT--------------------------------------------TTGA-------------------------ACAAGTT--------GCCGCTATGG-----TGAAATTGGTAGACA------------------CGCTGCTCTTAGGAAGCAGTGCGAGAGCATCTCGGTTCGAGTCCGAGTAGCGGCATAAGATCTTATAAAAGAGATATTATAAG--TTTTAGAATCAAATTAATAACTTTTTTT----TTTT---CTAAAATCGGGTAAAACCTAGTATTAATTTATTAATTTTTAACAAATTTTTTATGATTTTTTAGAAGTGGACTCTAGAAATACTCCTAATTGCGGTAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTATAGACCGGTCGGCAA-TTCTTTTTAAGA--TTTTTTTTCGAAA--------------------TTGGATTTATGTTTTATTTTATTGACTCATTTTCTAT---------TT-----TTATATCCGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTGAAGAAGTTTCCATCAACTTCGGATTATCTGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTATAT-TGA----------ATTTATA-----TTGACATT--TATAAAG-AAAAAGAGAAA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTATATCTTTATACATTACAATAACCATAATGAA{CT}AGTATGGTAGAAAGATATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Eutrema_parvulum TATTCGTTTT{CT}CCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCGATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCTTTTTATCTATGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-CAAAGAAAAGAATGATTCACAAAAAAG-AAATGGTATAAAAAAGTC{AG}------------??TATATATATATATTATGCATTTTTCAAAATCCCGCGGATAGGAACTAATATCAAAGTAATTTTTATGATT----------------------------------------------------------{CT}TTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTTAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TT-TTTTTTTCTATTTTCTTTGATATCT-ACATGTATATGCCCTT-------------ATAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATTACATTACATTGTCATCTTG-TATGCATCAACATGGAAATATTTGATTGATATCTGAAGCCATGATTTATCATTCGA--TTTTTTTATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAA---------TGAAATGT--------------------------------------------------TAAGACTTTTT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGAGTC-AATAAGAGATATCGACGGAGTTCCTAAT--AAAAAAATCTGAAAT--AAAAAAAA-TTTACTGCTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTGTACAACA-AAATAAAT----AAAAAATACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAA---------A-TTCTTTAGAATACATCAAAA-------------------------------AAAAAAAAGATAAT{AT}T--------------------------------------------------------------------------------------------------------------------------------------------------ACTGCAATAAAA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGCGCTTCA----AATTCATT----------------------------ATGAAAT--TTTTTTCACT-------TTAT---------------ACCGT-TAGGAATTATTATTTCTTTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAATAAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------T???{AT}ACTAATATA-------------------------------------------TGATTCTTATTTTATTTTAAATTTCGAAGGATTTTGGAGAAGTTTTAATTTTTAGAAAAAGCATTTTTTTATTAATGAAATCAATTGAAAATTCCATTGACTTGGCTGCTTTATTTAAATTTGAATCTCGACGATTGAGTA-AAAACTT--------GTTACTATTGTTTTGAACAAGTTGCCGCTATGGTGAAATTGGTAGACACGCTGCTCTTAGGAAGCAGTGCTAAAGCATCTCGGTTCGAGTCCGAGTAGCGGCATAAGATCTTATAAAAGAGATATTATAAG--TTTTATAATCAAATTAATACCCGACTTT----TTTT???CTAAAATCGGGTAAAACCTAGTATTAATTTATTAATTTTTAACAAATTTTTTATGATTTTTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTAGAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTGAAGAAGTTTCCATTTCATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTCT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Fezia_pterocarpa TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTTTATT-------TAGATAACGATTCGATTATAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG-------TTATATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTACAATACAAT-----AATATCAGTCTATTATTTTCAAATAGAATGATATTCTTTCAAT-TAAAGTTTTTGATTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTAAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATAGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT-------TAGTTTATAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TCTTTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAACATGACAATATTTAATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTTAATACAA---ATATAA-TTTAGGATCTTGTTATGTTCTGGAATTAAAACAAGATATTGAAATGCCC-TTTAGGT----ATTCA----------------AA---AATTTTGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCTTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--CAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGATTATCAGAATAGTGGATAGAGTCATGATTCGACGGGTTTATACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGAAACCCTTCTTTTCTATATATTATCTTTTT---TTTCTCTTTTGG---------------------------TTCCTATTGATTTTTTTC-----ATTTTTAAA--------AAGGGTGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAAAAATC-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATGAATT---------T----------------AAGTAACAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTTTT-TTTCTCTGAA----TTCTTATTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTCTA-----AAAAGCATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------GTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAACATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---G--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTATTTCTAATTGCAATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAATTTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTAGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGAGAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCG---------TATTAAATGGATC-AAATAAACAAATGAAATTGAGAAAGTATGTACATATATTTC---------AT--ATTCTAT-TTT----------ATTTATAA----ATTAAA----TAGAAAT-TAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGAT{AC}TC{CT}TTCTACCATACTAGCGGGCCCCTTAGGA Foleyola_billotii TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTATGTGAATTTAGATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCCTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAT-AAATGGCATAAAAAAGTCG----------------TATATATATACTATGCATTTTTCAAAATACCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTTAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTAGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTTATTAAAGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAATTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTTAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTTTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAA---------A-TTTTTTAGAATCCATATAAA------AAATAAA-TAGAAACCAAAAGAGTAAAAAAAAAAAGATAAT----------ATATATAG------------------------TTCCTATTGATTTTTTTA-----ATTTCTAAA-----------AGGGGGGATTTTTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATATAAGATCTTTAAGCGAA--------------------------------------CTCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------GCTTC-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAATTAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA--------------TTTT--------------------------------------------TTTAAGT-----------------GATA-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATAAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGAAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGGTTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGGTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAA{AG}ATATTTCACTTGTATCTTTATACATTACAATAACCACAATCGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCGTAGGA Guiraoa_arvensis TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAACGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TAAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGAT{AC}TCT-ACATGTCCATGCCTGT-------------{AC}AAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTTGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCCTTTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-AAGGAACCAAACGAGAAAAACAAAAAGATAATA-----TATATATATATAAAATAAAGG----------------TTCCTATTTATTTTTTTA-----ATTTCTAAA-----------AGGGGGGATTCTTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCATT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TGC---TTAT--ATTCTTTA-----------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCACAA-TACGTGAAT--ATAAGA-------------------TAATAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTGAAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-CGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATTTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTT----------ATTTTTA-----TTTACATTTATATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Henophyton_deserti TTT{AT}{GT}{GT}TT{AT}TCCCAAT------T-----ATAC--AATA{GT}TTGGTTTACGTTATGTAAGAAACACTTGTAT{AG}{GT}G-------TGATATT{GT}G{AG}{GT}ATTGACTAGG{AT}ATA{AT}A-{AT}GAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTG{AT}GTGAATTTCAATT-------TAGATACCGATTC{AG}A{GT}TA{GT}AAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAA{AG}T{CG}G--------------TATATATATATATTAGGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATT{AC}TATTA---------------------TTTCAAT-TCAAGTTTTTGATTTTTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATGAAGTC{AC}TAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTATATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTAGAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAC---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TCAGAACAAAAAGAAAAAAAAAAAAGAAAA{AT}A{AT}----------ATATATAAAA{AG}AAAGG----------------TTCC{AG}AT{GT}GATTTTTTTAT{AT}T{CG}TATTCTAAAA-----------{AG}GGGGGGGTTATTATTTTCCCCCATCA----------------------------------AA-AAAATAAAA-----AA---AAAA{AT}ATCTGG-------{AT}ATTTCC{CT}CTT-------AAC{AT}AGGAAATACAA{AG}ATATTTAAGCGCA--------------------------------------ATCAATAGGTTCT{GT}GA----AATTAATT---------T----------------AAGTCAAAA--AGTTTTCACT-------TTAT---------------ACCTT-TA{AG}AAATTATTATTTC{CT}CTGAA----TTC---TTAT--ATTCTTT------------ACT{GT}G-----GAATCAAAGTTATA-----AAAG-CATCA------------------------CCCAA-TAAG{GT}GAAT--ATTA{AG}A----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA--TTTTTTTTTTTTTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTA-----GACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGCC-AA----TTA-----GTGT----TTTT---C--------------------------------------------ATT--------TCTC{GT}{CT}AGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Henophyton_deserti1 TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTGTGTGAATTTCTATT-------TAGATACCGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTAGGCATTTTTCAAAATCCCGTGGATAC{AG}AACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGATTTTTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATGAAGTCCTAAGTCTTTCTCGCGCACT-GC{AC}{AC}CATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTT-ATTACACAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTATATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTATAATAATTC-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATATTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTCATT---------T----------------AAGTCAAAA--AAATTTC{AT}CT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA----------------------TAATAA----------TAA-TAA-------TAAGTAACAAT{AT}TA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------{CT}TTATG{GT}TTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGC{AC}TTGAAA--------ATAGA--TATTTTGAC-AA----TTA-----GTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Henophyton_zygarrhenum TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTGTGTGAATTTCTATT-------TA{AG}ATACCGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAATGGTTCACAAAAAA{AG}-AAACGGCATAAAAAAGTCG--------------TATATATATATATTAGGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGATTTTTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATGAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTATATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-GTTTTGA-----------------------------------------------------------------------------------------------------------------------------ATTTCTAAA-----------AAGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCCTG-------TATTTCCTCTT-------A{AC}CTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTCT---------------ACCTT-TAGGAATTCTTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCCAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAGGATGCA-TGAAA--------ATAGC--TATTTTGCC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TCTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Hirschfeldia_incana TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAA{AG}AAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAATTCTTCCGTTTTATCTGCGAATTGGCTG-AAAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAACAGAA{GT}GGTTCACAAAAAA{AG}-AAACGGCATAAAAAAGTCG------------TATATATATATATATTATGCATTTTTCAAAATCCCG{GT}GGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAAAATTATATTA---------------------TTTCAAT-TC--GTTTTTGGTTATTTTGGCGGGATGAA--CTACCGAC-ACTT-ATTA-AATTAA--CCCCAATCTTTCTAGCGCACT-GCCCCATAAAATTAAACCCTT-----AAAATTTCATTTAATTGGTTTCGAAGATCAAAATATTT-TTTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATAGAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCGTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATATAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAATTAGAC------------------------------------------------------------TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT---AAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAACT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGG----AAAAATCA---------A-TTTTTTAGAATACATATAAA-----AAAATAAA-TAGGAACCTTTCTTTTATATATATATATTATTT---TTTTCTTTTTTGG--------------------------GTCCTATTTATTTTTAAA-----ATTTCTAAA----------AAAGGGGGGTTATTTTTTT-CGCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCCATAGGTTCGTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTTAA----GTA---TTAT--ATTTTTG------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCATAA-TAAGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAAT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAATATGTA-TGAAA--------AGAAA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGGCTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATTAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGACCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTT-----TTGTTTTATTGACTCATTTTATTT---------TT-----TTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCAAAATATCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTCATATTCTATTTCTATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAG-GGGACCCTTAGGA Isatis_canescens TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACCCTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCGATT-------TA{AG}ATAAGGATTCGATTAAAAGTTCTTCCTTTTTATCTGTAAATTGACTG--AAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-CAAAGAAAAGAATGGTTCACAAAAAAG-AAATGGCAT-AAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAATAATA-AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTATCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCGCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AAAAATTTTTTTGTCTATTTTCTTTGATATCT-ACATGTACATGCCCTT-ATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGTATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTAGA--TTTTTTAATTCTT-AATACAA-TTTGATTCTT-ATACAAGTTATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATC{GT}TGAAATGCCT-TTTAGGT----ATT-----------------------AATTTGGAA-TAAGACTTTCT--------TTATCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGAT{CT}C-AATAAGAGATATTGACGTATTTCCTAAT---AAAAAAAATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTGATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTGTACAACA-AAATAAAT----AAAAAACATTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACCA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCTTTCTTTTTTATCTATATATTATCTTTTTTTTCCTCTTTTTTTCCTCTTTTGG--------------TTCCTATTGATTTTTTT------ATTTCCAAA------------AGGGGGATTCTAATTTT-CCCCATCACCACCTTG--------------------------AT-GCAATAATA-----AA---CAAAGATCTTG-------TATTTCTTCGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGATTC---------ATTAATT---------T----------------AAGTGCAAA--ATTTTGCACT-------TTAT---------------ATCTT-TAGGAATTATTATTTCT{CT}TGAA----TTC---TTTT--ATTCTTTA-----------ACTTG-----GAATCAAAATTATA-----AAAG-CATCT---------------------ATCCACAA-CAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAATAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTATT--------------------------------------------TTTAAAC-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------GTAGA--TATTTTGAT-AA----TTA-----TTAT----TATT------------------------------------------------TTTTTTTTTCATTTCTCAGAAGTGGACTCTAGAAGTACGCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACGGGCCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTGGCGGGCCCCTTAGGG Isatis_tinctoria TTTAGGTTAGCCCAAT------T-----ATA{AG}--AATAGTTGGTTTACGTTATGTAA{AG}AAACCCTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCGATT-------TA{AG}ATAAGGATTCGATTAAAAGTTCTTCCTTTTTATCTGTAAATTGACTG--AAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-CAAAGAAAAGAATGGTTCACAAAAAA{AG}-AAATGGCAT-AAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAATAATA-AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTATCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCGCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATAAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AAAAATTTTTTTGTCTATTTTCTTTGATATCT-ACATGTACATGCCCTT-ATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGTATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTAGA--TTTTTTAATTCTT-AATACAA-TTTGATTCTT-ATACAAGTTATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATCTTGAAATGCCT-TTTAGGT----ATT-----------------------AATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATTGACGTATTTCCTAAT---AAAAAAAATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTGATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTGTCCAACA-AAATAAAT----AAAAAACATTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACCA---------A-TTTTTTAGAATACATATAAA-----AAAATAAA-TAGGAACCTTTCTTTTTTATCTATATATTATCTTTTTTTTCCTCTTTTTTTCCTCTTTTGG--------------TTCCTATTTATTTTTTT------ATTTCCAAA------------AGGGGGATTCTAATTTT-CCCCATCACCACCTTG--------------------------AT-GCAATAATA-----AA---CAAAGATCTTG-------TATTTCTTCGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGATTC---------ATTAATT---------T----------------AAGTGCAAA--ATTTTGCACT-------TTAT---------------ATCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTTT--ATTCTTTA-----------ACTTG-----GAATCAAAATTATA-----AAAG-CATCT---------------------ATCCACAA-CAAGTGAAT--ATTAGA-------------------------TAA----------TAA-GAA-------TAAATAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTATT--------------------------------------------TTTAAAT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------GTAGA--TATTTTGAG-AA----TTA-----TTATTATTTTTT------------------------------------------------TTT-----TCATTTCTCAGAAGTGGACTCTAGAAGTACGCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACGGGCCGGCAA--TTTTTTTAAGA--TTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAAAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTAACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTGGCGGGCCCCTTAGGG Isatis_tinctoria2 TTTAGGTTAGCCCAATTCCAATT-----ATAGAAAATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCGATT-------TAGATAAGGATTCGATTAAAAGTTCTTCCTTTTTATCTGTAAATTGACTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-CAAAGAAAAGAATGCTTCACAAAAAAG-AAATGTCAT-AAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCTGTGGATAGGAACTAATATAAAAGTAATTCTTATGATTCAATAAAA-AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTATCGATGACTTAATTATAATTAAGTCTTAAGTCTTTCGCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTTTTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAAAGCAAA-----------------------------------------------------------------------------------------------------------------------------------AA--TT-TTTTTGTCTATTTTCTTTGATATCT-ACATGTACATGCCCTT-ATGTATCTGT--AAAAAG-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATACCT-TTTAGGT----ATT-----------------------AATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATTGACGTATTTCCTAAT---AAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTGATCTCTATCGAATTTTAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTGTACAACA-AAATAAAT----AAAAAAAACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACCA---------A-TTTTTTAGAATACATATAAA-----AAAATAAA-TAGGAACCTTTATTTTTTATCTATATATTATCTTTTTTTACTCTTTTTTTTCTCTTTTGG---------------TTCCTATTTATTTTTTT------ATTTCAAAA------------AGGGGGATTCTAATTTT-CCCCATCACCACCTTG--------------------------AT-GCAAGAATA-----AA---CAAAGATCTTG-------TATTTCTTCGT------TTAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGATTCTTGCA---AATTAATT---------T----------------AAGTGCAAA--ATTTTTCACT-------TTAT---------------ATTTT-TAGGAATTATTATTTCT{CT}TGAA----TT{CT}---TTCT--ATTCTTTA-----------ACTTG-----GAATCAAAATT{AT}TA-----AAAG-CATCT---------------------ATCCACAA-CAAGTGAAT--ATTAGA-------------------------TAA----------TAA-AAA-------TAAATAATAATATA----------------------------------------------------------------------------------------TGA-T{AT}-------------TTATT--------------------------------------------TTTAAAT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-CGAAA--------GTAGA--TATTTTGAT-AA----TTA-----TTAT----TATT-------------------------------------------------TT--------TTTTTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACGGGCCGGCAA-CTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTGGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAA-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAACATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTGGCGGGCCCCTTAGGG Kremeriella_cordylocarpus TTTAGGTTAGCCCAAGCCCAATT-----ATAG--AATAGTTGGTTTACATTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTATTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAACGGTTCACAAAAAAG-AAACGGCATAAAAAGGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------AAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCAAATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTTATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT--------------------ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------ATTTTTTTA-----------------------------------------------------------------------------------------------------------------------------ATTTCTAAA----------AGGGGGGGGTTCTTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCACAA-TACGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAACGATGTA-TGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCTGCAA-TTTTTTTT------------TTAGAAA--------------------TTTGATTTATTTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTAATTCTATTTCATTTTTA-----GTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGACCCCTTAGGA Moricandia_arvensis TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTAC{CG}TTATGTAA{AG}AAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGA{AG}TTAAA{AG}ATCTATACAA-------------TCTGCCCAACTACTTT-TG{GT}GAATTTCTATT-------TA{AG}ATAACGATTC{CG}ATTATAAGTTCTTACTTTTTATCTG{GT}GAATTGGCTG--AAAAAAACGATCAAAAAAA{AG}AACGAA{AG}AATT-AAAA{AG}AAAAGAGTGGTTCACAAAAAA{AG}-AAACGGCAT-AAAAAGTCG------------TATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGGGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTTTTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTACGAATAAAAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTATTTAGAATACATATAAA-----AAAATAAA-TAGGAACTAAAAGAGAAAAAAAAAGATAATA-----------TATATATATAAGAAAGA----------------TTCCTATTGATTTTGTA------AATTAAAAA----------AAAAGGGGGTT{AT}TT{AT}TTT{CT}-CCCCA{CT}CA----------------------------------A{AT}-AAAATAATA-----AA---{AT}AAAGATCT{GT}G-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGTGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTAGTATTTCTCGGAA----TTC---TTAG--ATTCTTT------------ACTTG-----GAATGAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTCTTT---------TT-----TTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCAAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATTAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACAGT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATGTTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Moricandia_foetida TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATACAA-------------TCTGCCCAACTACTTT-TGTGAATTTCTATT-------TA{AG}ATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAGTGGTTCACAAAAAAG-AAACGGCAT-AAAAAGTCG------------TATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGGGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTTTTTGATATCT-ACATGTCCATGCCGGT-------------AAA{AG}AA-AGGGAAAATTTC{GT}------TA{AT}TTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGA{AG}AG{GT}TTCTTTCTCAC{AT}TAC{AT}CCTTCAATCACATTACATTG{CT}CATCTTG-TA{AG}GCATCA{AT}TATGGAAATATTTGATTGATATCTGA-GCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATAC{AG}A-TT{CT}GATTCTT-ATACAA---{CG}TAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-{AT}TTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TT{AC}TCT{AC}GGCAGGAACGC{AT}--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATAT{CT}GACAGATTTA{AC}GA{AT}TAAAAAAAAATATGAAAT--AAAAAAAA-T{AC}TACTGTTTCAA---------TTTTATCT{CG}TAT{ACT}GAATT{AT}GAATATCAGAATAGTGGATAT{AG}GTC{AG}{GT}GATTGGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTATTTAGAATACATATAAA-----AAAATAAA-TAGGAACTAAAAGAGAAAAAAAAAGATAATA-----------TATATATATAAGAAAGA----------------TTCCTATTGATTTTGTA------AATTAAAAA----------AAAAAGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGTGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTAGTATTTCTCGGAA----TTC---TTAG--ATTCTTT------------ACTTG-----GAATGAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAATTTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTCTTT---------TT-----TTATATCAGGGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCAAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATTAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACAGT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATGTTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Morisia_monanthos TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTGGGTATATA-TAAGTTAAAGATCTATATA--------------TCTGCCCCACTACTTT-TGTGAATTACTATT-------TAGATAACGATTCGATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-CAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTCCAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TCTTTTTTTTCTATTTTATTTGATATCT-ACT--------------------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGATTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAATAAGAAGATTA-AATAAGAAATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAATAAATAAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-TAAAGAAATCAA-TAGGAACCAAAAGAGAAAAAAAAAAAGATAATA-------TATATATATATAAGAAGGA----------------TTCCTATTGATTTTGTA------AATAAAAAA------------AGGGGATTTATTATTTT-CCCCATCA----------------------------------AT-AAAAAAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAACAGATTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTT---TTAT--ATTCTTT------------ACTGG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA----------------------TAATAA----------TAAGTAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----CTAT----TTGT----TTTT---C--------------------------------------------ATT--------TCTTTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTTTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATTT---------TT-----TTATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATTTAATACGTATAATCCGAATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTAGATTAAGATATTTCACTTGTATCTTTATGCATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Myagrum_perfoliatum TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------CCTGCCCCACTACTTT-TATGAATTTCGATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCTTTTTATCTGTAAATTGACTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-CAAAGAAAAGAATGGTTCACAAAAAAG-AAATGGCAT-AAAAAGTCG------------------TATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAATAATA-AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCGCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AAA-----------------------------------------------------------------------------------------------------------------------------------AA-----TTTTTTTCTATTTTCTTTGATATCT-ACATGTACATGCCCTT-ATGTATCTGT--AAAAAA-GGGGAAAATTTTT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCCCATTACATTGTCATCTTG-TATGC---------GAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCT-TTTAGGT----ATT-----------------------AATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATTGACGGATTTCCTAAT---AAAAAATATGAAAT--CAAAAAAA-TCTACTGTTTCAA---------TTTGATCTCTATCGAATTTGAATATCAGAATAGTAGATATAGTCATAATTCGATGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACCT---------A-TTTTTTAGAATACATATAAA------AAAAGAAATAGGAACCTTTCTTTTTTATCTATATATTCTCTTTTTTTCCTCTTTTGG--------------------------TTCCTATTTCTTTTTTT------ATTTCCAAA-----------AGAGGGGATTCTAATTTT-CCCCATTATCACCTTG--------------------------AT-GCAATAATA-----AC---CAAAGATCTTG-------TATTTTTTCGT-------TAAGAGGAAATACAAGATCTTTAAAGGAA--------------------------------------ATCAATAGATTCTTGCA---AATTCATT---------T----------------AAGTTAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTTA-----------ACTTG-----GAATCAAAATTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTAAAT--ATTCGA-------------------------TAA----------TAA-TAA-------TAAATAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTATT--------------------------------------------TTTAAAT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATACA-TGAAA--------GTAGA--TATTTTGAT-AA----TTATTATTTTAT---TTTTT---C--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTGAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACTCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGTATC-----AAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGG-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCCTAGGG Physorhynchus_chamaerapistrum TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTATGTGAATTTAGATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCCTTTTATCTGTGAATTGGATG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAATGGCATAAAAAAGTCG----------------TATATATATACTATGCATTTTTCAAAATACCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTAGCTGGATGAATCTTAGTGATGACTTAATTATAATTAAGTCCGAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTTATTAAAGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAATTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT---AAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTTTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAA---------A-TTTTTTAGAATCCATATAAA------AAATAAA-TAGAAACCAAAAGAGTAAAAAAAAAAAGATAAT----------ATATAG--------------------------TTCCTATTGATTTTTTTA-----ATTTCTAAA-----------AGGGGGGATTTTTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATATAAGATCTTTAAGCGAA--------------------------------------CTCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTAAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGTAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------GCTTC-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA--------------TTTT--------------------------------------------TTTAAGT-----------------GATA-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGGTTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGGTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTTAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCACAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCGTAGGA Pseuderucaria_teretifolia TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGTTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTATGTGAATTTTTATT-------TAGATAACGATTCGATTATAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG-----------TTATATATATATATATTATGCATTTTTTAAAATCTCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAATACAATAATAGAATTCTATTATTTTAAAATAGAATGATATTCTTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTATATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTATACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------CAATTAGCCTAA-CGG----AAAAACAA---------ATTTTTTTAGAATACATCTAAA-----AAAATCAA-TAGGAACCTTTCTTTTCTATATATATATTATCTTTTTTTTTCTTTTTG---------------------------TTCCTATTGATTTTTTGA-----ATTTCTAAA--AATCTAAAAAGGGCGTGTTATTATTTT-ACCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTAAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTTTTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATTCACGA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------GTA-TA-------------TTTTT--------------------------------------------GTTAAGT-----------------GATC-AAAACAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------ATAGA--TATTTTAAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTTCTAATTGCAATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTGCTAGACCGGCCGGCAA-ATTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGAATTTATGTTTTGTTTTATTGACTCATTTTCTAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCACGAGGTTTCCATCGAATTCG---------TATTAAATGGATC-AAACAAACAAATGAAATTGATAAAGTATGTACATATATTTC---------AT--ATTCTAT-TTA----------ATTTTTA-----GTTACATT--TATAAAT-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATCTTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Pseudofortuynia_esfandiarii TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCTCGCTACTTT-TGTGAATTTCGATT-------TAGATAAGGATTTGATTAGAAGTTCTTCCTTTTTATCTGTGAATGTG-----AAAAAAAGGATCAAAAAAAGAACGAAGAATT-CAAAGAAAAGAATGGTTCACAAAAAAT-AAATGGCATAAAAAAGTCG--GTCGGT{CT}{AG}TATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTATATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTTAAAAAAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAA-----TAGGAACCAAAAGAAAAAAAAAAAGAAACGATA--------ATATATAGATAAAAAAAAAGG-------------TTCCTATTTTTTTTTA-------ATTTCCAAA-----------ACGGGGGATTCTTTTTTT-CCCCACCA----------------------------------CT-AAAATAATT----AAA---TAAAGATCTTG-------TATTTCCTCTT--------AAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGAAATTAATTAATT---------T----------------AAGTGAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAAGATA----------------------------------------------------------------------------------------TTA-TA-------------TATTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTATT---TTTT----TTTT---C--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTCCTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAATAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATATTTACTTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTACTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTACGGTAGAAAGAGGTCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Raffenaldia_primuloides TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG-AAAAAAAATGATCAAAAAAAGAACGAATAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTAATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A--------------------------------------TAAGTATTAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TCTTTTTTTTCTATTTTCTTTGATATAT-ACATGTCCATGCCTCT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCACTCACATTACATTGTCATCTTG-TATGCATCAATATGTAAATATTTGATTGATATATGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGTAATCAAAACAAGATATTGAAATGCCC-TTTAGGTATTAATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAAAGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAA-TGTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATAAA-AAGGAACCTTTTTTTTATATATATATTATCTTT---TTTTTTTCTTTTGG-------------------------TTCCTGTTTATTTTTAAA-----ATTTCTAAA-----------AGGGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTATT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATTAATAGGTTCTTTA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTAACT-------TTAT---------------ACCTT-TAGGAATTATTATTTATCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATTCACAA-TAAGTTAAT--ATGAG-------------------------ATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAATATAAAAATA------------------------------------------------------------------------AAAAGATGTA-TAAAA--------AGATA--TATTTTGAC-AA----TTA-----TTTT---TTTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTTCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-ATTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTTGATTTATTTTTTGTTTTATTTACTCATTTGATAT---------TT-----TTATATCAGGGTTTA-ACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTAGCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTCTATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Raphanus_raphanistrum TTTAGGTTAGCCCAAT------T-----ATCG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TCATATTTGATATTGACTAGGTATATA---AGTTAAAGATCCATATAA-------------TCTGCCCCACTACTTT-{CT}GTGAATTTCTATT-------TAGATAACGATTCAATTATAAGTTCTTACTTTTTATCTGTGAATTGGCTG--AAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGACA{AT}AAAAAAGTCG------------TATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTA----------------------------------------------------------TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCTTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTTATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTATTTGATATCT-ACATGTCCATGCCGGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TAAGCATCAATATGGAAATATTTGATTGATATCTGAAGCAATTATTTATTATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---CTAGAA-TTTAGGCTCTTGTTATGTTCTGGAATCAAAACAAGATGTTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--GTATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT-AAAAAAAATATGAAAT--AAAACAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAATA---AAAAAACACTAGAATCATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-TAAAGAAATCAA-T{AC}GGAACGAAAAGAGAAAAAAAGATAA---------------TATATATATAAGAAAGA----------------CTCCTATTGATTTTGTA------AATAAAAAA------------AGGGGTATTATTATTTT-CCCCATCA----------------------------------AT-----AAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAACAGATTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTT{GT}CACT-------TTTT---------------ACCTT-TAGGAATTATTATTTCGCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CAT{CT}T---------------------ATCCACAA-TAAGGGAAT--ATTAGA--------------------------------------TAA-TAA-------{AT}AAATAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATAAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTA{AC}TA--TTTTTTTTATAAA--------------------TTGGATTTA-----TGTTTTATTGACTCATTTTATTT---------TT-----TTATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Savignya_parviflora TTTAGGTTAGCCCAAT------TATAGAATAG--AATAGTTGGTTTACGTTATATAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCAGCCCGACTACTTT-TGTGAATTTCTATT-------TAGCTAACGATTCGACTATAAGTTCTTACTTTTTATCTGTGAATTGACTG---AAAAAATGATCAAAAAAAGAACGAAGAATTAAAAAAAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG----------TATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTACAATACAAT-----AATAGAATTATATTAGTTTAAAATA-AATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTCTAATTAAGTCCTAAGTCTTTCTCGCGCGCT-GCCCCATAAAATCGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTTATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCAGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTATATTTTATTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTTTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATGAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAATTAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATTAA--CTATAGAAACAAGAAGAGTA-ACTAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATTGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-GGT----AAAAACAA---------A-TTTTTGA-----------------------------------------------------------------------------------------------------------------------------ATTTCTAAA--------A-------AGGTTTTTTTTTTTCCCCATCA----------------------------------AT-AAA----------------TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCACAA--ATTTTTCACT-------TTAT---------------ACCTTATAGGAATTATTATTTCTCTGAA----GTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCTACAA-TAAGTGAAT--GTTCGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTTTT--------------------------------------------GTTAAGC-----------------GATC-CAAAAAT--------CTTATATTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGC--TATTTTAAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------AGT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTTTCTTTATACATTACAATAACCACAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Schouwia_purpurea TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTAGATT-------TAGATAAGGATTCAATTAGAAGTTCTTCCTTTTTATCTGTGAATTGACTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAATGGCATAAAAAAGTCG------------TATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAGCTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTCCTTG------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAATTGAATCTAAATCATGAAGTGTCGGATGACTC-ATTACTCCGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGACAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTTTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAA---------A-TTTTTTAGAATCCATATAAA------AAATCAA-TAGAACCCAAAAGAGTAAAAAAAAAAAAAAAA{AG}---A{AT}AATATATCG----------------------------TTCCTATTGATTTTAAAA-----ATTTCTAAA---------AGGGGGGGGATTATTATTTT-CCCTATCA----------------------------------A{AT}-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------CTCAATAGGTTCTTGA----AATTAATT---------T----------------TAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGGAATTATTTTTTCTCTGAA----TTC---TTCT--ATTCTTTT-------CTTTACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTTTCTTTATACATTACAATAACCACAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Sinapidendron_angustifolium TTTAGGTTAGCCCAAT------T-----ATAC--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTCTT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAT-AAACGGCATCAAAAAGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTCGTTATTTTGGCTGGATGAATCTTAACGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----A{GT}A-----ATTTAATTGGTTTC{AG}AAGATCAAAATATTTTATTTTATTGGTCCTTA------CTTA{GT}GTAAA{CT}G{AC}{AT}TC{CG}A{CT}TCA{AT}{AT}TTGTTTCTTC{AC}{AT}TGC{AT}AT--------------T{AT}{CG}{AT}TT{AT}TT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATA{CT}AA---{AG}TAGAA-TTTAGGATCTTGTTATGTT{CT}TGGAATCAAAAC{AC}AGATATTGAAATGCCC-{CT}TTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TT{CT}TCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAAT{CT}TACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATT{CT}GACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAT-CGT----AAAAACAA---------A-TTTTTTATA----------------------------------------------------------------------------------------------------TTTCT------------------ATTTCTAAA-----------A{AG}GGGGGGTTATTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATATAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTAAAAA--TTTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAA-TATCT---------------------ATCCACAA-TAAGTGAAT--ATGAGA----------------------TAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAAA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTTAAAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAG-TTTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTTAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTTTA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATCCTAGCGGGCCCCTTAGGA Sinapis_alba TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACCTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTATTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAACGGTTCACAAAAAAG-AAACGGCATAAAAAGGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAATGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------AAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCTTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCAAATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CAT----AAAAACAA---------A-TTTTTTAGAATACATATAAA------AAATAAA-TAGGAACCTTTCTTTTATATATATATATTATCT---TTTTTTTTTTCTCTTTTTTGG------------------TTCCTATTTATTTTTAAA-----ATTTCT{AT}AA--------A{AG}GGGGGGGGGTTCTTATTTT-TCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCACAA-TACGTGAAT--ATGAGATAATAATAATAATAATAATAAGTAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGT-----------------GATC-TAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAACGATGTA-TGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCTGCAA-TTTTTTTT------------TTAGAAA--------------------TTTGATTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTAATTCTATTTCATTTTTA-----GTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCTTTAGGA Sinapis_flexuosa TTTAGGTTAGCCCAAGCCCAATT-----ATAG--AATAGTTGGTTTACATTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTATTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAACGGTTCACAAAAAAG-AAACGGCATAAAAAGGTCG--------------TATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTATTTCAAAATAGAACGATATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------AAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCAAATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTATTTATGATTCGA--TTTTTTGATTCTT--------------------ATACAA---ATAAAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGTATTAATT------------------AA-TTAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT--AAAAAAATATGAAATAAAAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACCA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAATCAAAAGAAAAAAAAAAAAAAAATAAT------ATATAT{AT}TATAAAA{AG}AA{AG}GG----------------TTCCTATTGATTTTTTTA-----ATTTC{AT}AAA----------AGGGGGGGGTTCTTTTTTT-CCCCATCA----------------------------------A{AT}-AAAA{AT}AA{AT}A-----AA---{AT}AAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAA-AATCT---------------------ATCCACAA-TACGTGAAT--ATGAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA------------TTTTTT--------------------------------------------TTTAAGT-----------------GATC-CAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAACGATGTA-TGAAA--------AGAGA--TATTTTGAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCTGCAA-------------TTTTTTTTTTAGAAA--------------------TTTGATTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTAATTCTATTTCATTTTTA-----GTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGACCCCTTAGGA Sinapis_pubescens TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACATTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCTATT-------TCGATAACGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTGAAAAAAAAACGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCA----------------TATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATAAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTCTAATTAAGTCCTAAGTCTTTCTAGCGCACT-GCCCCATAAAATTAAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTTCTTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAG--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC--TTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGCAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAACCATTTTTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATATAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAA-----------------------------------------------------------TTGGAC-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAA--ATATAGAAACAAGAAGATTA-AATAAGAGATATCGACAGATTTCCGAAT---AAAAAATATGAAAT--AAAAAAAAATCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATCTAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGG----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-TAGGAACCTTTCTTTTATATATATATATTATTT---TTTTATCTTTTGG--------------------------TTCCTATTGATTTTTAAA-----ATTTCTAAA---------AGGGGAGGGATTATTATTTC-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGTGAA--------------------------------------ATCCATAGGTTCTTGA----ACTTAATT---------T----------------AAGTCAAAA--ATTTTGCACT-------TTAT---------------ACCTT-TAGTAATTTTTATTTCTATGAA----TTC---TTAT--ATTTTTG------------ACTTG-----GAATCAAAGTTATA-----AAAA-CATCT---------------------ATCCACAA-TAAGTGAAT--ATGAGA--------------------------------------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-----------TTTTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTAGGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------AGAGA--TATTTTTAC-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGAACGGCCGGCAGTTTTTTTTTAATA--TTTTTTGTAGAAA--------------------TTGGATTTATTTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGAGTTTACACCGTTAACCATTCATGGGATAACCCCTTTTCGAAATCTCAAGAGGTTTCCATTTAATACGGATTATCCGTATTAAATGGATC-AAAAAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA-----TTTTTATTTATA-----TTTATATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATT{AC}A{AG}ATCTTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCA{AT}ACTAGCGGGCCCCTTAGGA Sisymbrium_irio TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAA{AG}AAACACTTGTATATGTGATATTTGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCTCGCTACTTT-TGTGAATTTCGATT-------TA{AG}ATAAGGATTTGATTAGAAGTTCTTCCTTTTTATCTGTGAAGTGGCTG--AAAAAAATGATCAAAAAAAGAACGAA{AG}AATT-CAAAGAAAAGAATGGTTCACAAAAAAT-AAATGGCATAAAAAAGTCGGTCGTATATATATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTAGAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTAATATCT-ACATGTATATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGCGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTATTATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGGTTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAATAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT-AAAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTA----AAAAAAAA------------TTTTTAGAATACATATAAA-----AAAA-----TAGGAACCAAAAGAAAAAAAAAGAAACGATAAT----------ATATAGATAAAA-----------AAAAGGAACCTTTTTTTTA-------------ATTTCCAAA-----------ACGGGGGATTCTTATTTT-CCCCACCA----------------------------------CT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCT--------TAAGAGGAAATACAAGATCTTTAAACGAA--------------------------------------ATCAATAGGTTCTTGAAATTAATTAATT---------T----------------AAGTGAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATTT---------------------ATCCACAA-TAAGTGAAT--ATTAG-------------------------ATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTATT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTAC----TTTT----TTTT---T--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAGCCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCAAATTCGGATTATCCGTATTAAATGGATC-AAACAAATAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATATTTACTTTACATT--TATAAAT-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTACGGTAGAAAGAGGTCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Sisymbrium_officinale TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCTCGCTACTTT-TGTGAATTTCGATT-------TAGATAAGGATTTAATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-CAAAGAAAAGAATGGTTCACAAAAAAT-AAATGGCATAAAAAAGTCG--GTCGTATATATATATATATATATATTATGCATTTTTAAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTTTTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTAATAAGTA---------------------------------------------TAAGTAGTTGAATCTAAATCA{GT}GAATTG{GT}CGGATGACTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AATCTTTTTTTTTTCTATTTTCTTTGA{GT}ATCT-AC{AC}TGTATATGCCCTTAA{GT}GTATC{GT}GT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAA{GT}AGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGAAATCAAAACAAGATATTGAAGTGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTTAAA-AAAAACAA---------A-TTTTTTAT----------------------------------------------------------------------------------------------------------------------------ATTTCCAAA-----------ACGGGGGATTCTTTTTTT-CCCCACCA----------------------------------CT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT--------AAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGAAATTAATTAATT---------T----------------AAGTGAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCGCTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTGATA-----AAAG-CATAT---------------------ATCCACAA-TAAGTTAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTATT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTA-----TTTT----TTTT---C--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGA--TTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTCTAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAATAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTTTAT-TTC----------ATTTATATTTACTTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTACTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTACGGTAGAAAGAGGTCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Stanleya_bipinnata TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAA{AG}AAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCGATATAA-------------TCTGCCTCGCTACTTT-TGTGAATTTCGATT-------TA{AG}ATAAGGATTCGATTA{AG}AAGTTCTTTCTTTTTATCTGTGAATTGGCTG---CTAAAATGATCAAAAAAAGAACGAA{AG}AATT-CAAAGAAAAGAATGGTTCACAAAAAAT-AAATGGCCTAAAAAAATCG------TATATATATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTATCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTATATTTTCTTTGATATCT-ACATGTACATGCCCTT-ATGTATCTGT--AAAAAAAGGGGAAAATTTAT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCATATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATATAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT---AAAAAAA-TCGACTGTTTCAATTTTATCTCTTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAAAAAAAACAA---ATTTTTTTAGAATACATAGAAA-----AAAA-----TAGGAACCAAAAGAAACAAAAAGAAAAGAGACT----------ATATAGATAAAAAAGAAAGG------------TTCCTATTTTTTTCT--------ATTTTCAAA-----------ATGGGGGATTCTTATTTT-CCCCACCA----------------------------------CT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGAAATTAATTAATT---------T----------------AAGTGAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTATGAA----TTC---TTCT--ATTCTTTACTCTATTCTTTACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TTATTA-------------TTATT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGTA-TGAAA--------ATAAA--TATTTTGAT-AATTATTTA-----TT------TTTT---C--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCCGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTCTATTTTTATATCTT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAATAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGAGGGCCCCTTAGGA Streptanthus_drepanoides TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTTACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCTCGCTACTTT-TGTGAATTTCGATT-------TA{AG}ATAAGGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATTAAAAAAAGAACGAA{AG}AATT-CAAAGAAAAGAATGGTTCACAAAAAAT-AAA{AT}GGCATAAAAAAGTCG------------TATATATATATATATTATGCATTTTTCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATAGTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTC{AC}TAAGTCTTTCTCGCGCACT-ACCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTCCTTA------CTTAGGTAAACGCATCCACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A--------------------------------------------TTAAGTAGTTGAATCTAAATCATGAATTGTTGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTACATGCCCTTAATGTATCTGTAAAAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTCTGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATATAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCG--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--AAAAAAAA-TCGACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATATTTA-------GAATTAGCCTAA-CTT----AAAAAAAAAAAAAACAAA-TTTTTTAGAATACATATAAA-----AAAA-----TAGGAACCAAAAGA{AG}AAAAAAAAAAAAAAAAAA------{AT}AATAT{AT}TAGATAAAA-----------A{AT}AA{AG}GG--TTCCTTTTTTTCT----------{AT}TTTCCAAA-----------ACGG{GT}GGATTCTTATTTT-CCCCACCA----------------------------------CT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTCTTGAAATTAATTAATT---------T----------------AAGTAAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGTAATTATTATTTCTTTGAA----TTT---TT{CT}T--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCC{AC}CAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-TAA-------TAATAAGTAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTATT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------{CT}TTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AATT{CT}TTTT-----TTTT----TTTT---C--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATATTTTTATATCTT-----TTATATCAGGGTTTACACCGTTAACCATTCATGAGGTAACCCCTTTTCGAAATCTCAATAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAATAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Streptanthus_drepanoides1 TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCTCGCTACTTT-TGTGAATTTCAATT-------TA{AG}ATAAGGATTCGATTAGAAGTTCTTACTTTTTATCTGTGAATTGTCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-CAAAGAAAAGAATGGTTCACAAAAAAT-AAATGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTTTTAAATCCCGTGGATAGGAACTAATATCAAAGGAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TTTTTTTTTTCTATTTTCTTTGATATCT-ACATGTACATGCCCTTAATGTATCTGT--AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATTATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGATTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATTAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--AAAAAAAA-TCGACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAAAACA-----AATTTTTTAGAATACATAGAAA-----AAAA-----TAGGAACCAAAAGAGAAAAAAAAAAAAGATAAT----------ATATAGATAAAAAAGAAAGG------------TACCTATTTTTTTCT--------ATTTTCAAA-----------ACGGGGGATTCTTATTTT-CCCCACCA----------------------------------CT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAG-TTCTTGAAATTAATTAATT---------T----------------AAGTGAAAA--ATTTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------CAAGTAATAATATA----------------------------------------------------------------------------------------TTA-TA-------------TTATT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTA-----TTAT----TTTTTTTC--------------------------------------------ATT----------TCTCAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAGGTTGTTTTAGTTTTCTAGACCGGCCGGCAA--TTTTTTTAAGATTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATATTTTTATATCTT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAATAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTC----------ATTTATA-----TTTACATT--TAAAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATAAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGAA Thlaspi_arvense {AT}{AT}TTCGTTAGCCCAAT------T-----GTAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTCTATAA-------------TCTGCCCCACTACTTT-TATGAATTTCGAGA--------------------------------------------------------------------------------------------------------------------------------AAAAAAGTCG----------------TATATATAT??TATGAATTTTTCAAAATCCCGTGGATAGGAACTAATATCCAAGTAATTCTTATGAT---------------------------------------------------------------------TTTTGGCTATATTAATCTTAGCCATGACTTAATTATAATTAAGTCCTAAGT-TTTATCGCGCACT-ACCCCATAAAATTTAACCCTT-----AGAATTCCATTTAATTGGTTTCGAAGATCAAAAAATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAATTTGTTTCTTCCTTGCTAT--------------TTGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTACATACCGT{ACT}-------------AAAAAA-AGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACACACACCTTCGATCACATTACATTGTCATCTCG-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCA--TGATTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTAATTCTT-ATACAA---ATAGAA-TTTAGGATTTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCT-CTTAGATAT{AT}TATT-----------------------AATTTGGAATTAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATCAAAACAAGAAGATTC-AATAAGAGATATCG----------------AACAAAATATGAAAT--AAAAAAAA-TATACTGTTTCAA---------TTTTATCTATATCGAATTTGAATATCAGAATAGTGAATATAGTCATGATTCGATGGGTTTGTACAACA-AAATAAAT----AAAAAATACTCGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTAAATAAAA-----AA---------------------------------------AAAAAAGAGA---------------------------------------------------------------------------------------------------------------AAG--------------CACT-------TTAT---------------ACCTT-TAGGAATTGTTATTTCCCTGAA----TTC---------CTTCTTT------------ATTTA------------AA?TTTA----------AATCT-------------------------------------------------------------------------------------CGACGAT-------TGCATAAAAACTTG----------------------------------------------------------------------------------------TTAGTA-------------TTGTT--------------------------------------------TTGA-------------------------ACAAGTT--------GCCGCTATGG-----TGAAATTGGTAGACA------------------CGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGGTTCGAGTCCGAGTAGCGGCATAAGATCTTATAAAAGAGATATTATAAG--TTTTATAATCAAATTAATA-------------CTTA---ATAAAATGGGGTAAAACCTAGTATTAATTTATTAATTTTTAACAAATTTTTTATGATTTTTTAGAAGCGGACTCTAGAAGTACTACTAATTGCGGTAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGTCGGCAA-ATTTTTTTAATA-TTTT-----------------------------------TTTATTTTTTGTTTTATTGACTCATTTTCTAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTGAAGAAGTTTACATCAAATTCGGATTATCTGTATTAAATGGATC-{AG}A{AT}CAAACAAATGAAATTGAGAAAGTATGTACATACATTTA---------AT--ATTCTAT-TTA----------ATTTATA-----TTGACATT--TCTAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATAGTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGG Trachystoma_labasii TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTGTGTGAATTTCTATT-------TAGATACCGATTCGATTAGAAGTTCTTCCTTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAACGGCATAAAAAAGTCG--------------TATATATATATATTAGGCATTTTTCAAAATCCCGTGGATACGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGATTTTTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATGAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATTAAAATATTTGATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A---------------------------------------------TAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTT-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TC-TTTTTTTCTATTTTCTTTGATATCT-ACATGTATATGCCCTTAATGTATCTGT--AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTCTCACATACACCTTCAATCACATTACATTGTCATCTTA-TATGCATCAATATGGAAATATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGGT----ATT------------------AA-TGAATTTGGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTTCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATAAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAAAA-AAATAAAT----AAAAAACACTAGAATAATTA-------GAATTAGCCTAA-CGT----AAAAACAA---------A-TTTTTTAGAATACATATAAA-----AAAATCAA-AAGGAACCAAAAGAAAAAAAAAAAGATAATATA---TATATATATATATATA{AG}AAAGA-----------------TTCCTATTGATTTTGTA------AATAAAAAA------------AAGGGGGTTATTATTTT-CCCCATCA----------------------------------A{AT}-AAAA{AT}AA{AT}A-----AA---{AT}AAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGTGAA--------------------------------------ATCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--ATTTTTAACT-------TTAT---------------ACCTT-TATAAATTATTATTTCTCTGAA----TTC---TTAT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA--------------------------------------TAA-TAA------TTAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTTTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------ATTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAAATGCA-TGAAA--------ATAGA--TATTTTGAC-AATTATTTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAA{AG}A-TCTTTTTTTAAAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATTT---------TT-----TGATATCAGAGTTTATACCGTTAACCATTCATGGGATAACCCCCTTTCGAAATCTCAAGAGGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGA{AG}AAAGTATGTACATAGATTTC---------AT--ATTCTATATTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGA{AG}AGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGCGGGCCCCTTAGGA Vella_anremerica TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCAATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCTTTTTATCTGTAAATTGGATC--AAAAAAAGGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATAGTTCACAAAAAAG-AAATGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTCCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTTCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A--------------------------------------------TTAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAAGGGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTATCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAACTATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGGATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGAG----ATT------------------AA-TTAATTTTGAA-TAAAACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATAAA--ATATAGAAACAAGAAGATTC-AATACGAGATATCGACGGATTTCCGAAT--AAAAAAATATGAAAT---AAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTTAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT-----AAAAATACTAGAAAAATTA-------GAATTAGCCTAA-CTT----AAAAACAA---------A-TTTTTT------------------------------------------------------------------------------------------------------------------------------ATTTCTAAA----------AGTGGGGTATTATTATTTT-CCCCACCA----------------------------------AT-AAAATAATA-----AATTTTAAAGATCTTG-------TATTTCCTAGT-------TAAGAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTTTTGA----AATTCATT---------G----------------AAGTCAAAA--ATTTTTCACT-------TTAT---------------AGCTT-TAGGAATTATTATTTATCTTAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTGTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCG-TGAAA--------ATAGC--TATTTTGAT-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCCGCTGGCAA-TTTTTTTTAAGACTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-----AAACAAATGAAATTTATAAAGTATGTAC----ATTTC---------AT--ATTCTAT-TTA----------ATTAAAA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCAATTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAAATTTCTTTCTACCATACTAGCGGGCCCCTTAGGA Vella_bourgaeana TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCAATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCTTTTTATCTGTAAATTGGATG---AAAAAAGGATCAAAAAAAGAACGAAGAATT-AAAAGAAAATAATAGTTCACAAAAAAG-AAATGGCATAAAAAAGTCG----------------TATATATATATTATGCATTTTCCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAG-GGGGAAAATTTCT------{CT}ATTTATATCT{AC}ATTC{AT}{AC}TACAATATTTA--------AATAAAATAA{AT}AGGAAAC{AT}GTGAATGAGAGTTTCTTTATCACATACACC{CT}TC{AT}{AC}TCACATTACATTGT{CG}ATCTTG-TATGCGTCA{AC}TATGG{AG}ACTATTTGA{GT}TGAGATCTGA{AG}GCC{AC}{CT}TA-TTATGA{GT}{AT}C{GT}A--TTTTTTGATCT{CT}A-AACA----{AC}TTGA-TCT{CT}-ATACAA----TA{GT}AA-TT---GATGTTGTT---------------GACAAAGAATTGA--TGCCC-T{GT}{GT}AGAG----ATT------------------AA-TTAATTT{AT}GAA-TAAAACTTTCT--------TTCT{CG}T{AC}GGCAGGA{AC}CGCA--ATATATTTCCTATAAA--ATAT{AG}GAA{AC}CA{AG}GA{AG}GATTC-AATAAGAGATAT{CG}GACGGATTTCCGAAT--AAAAAAATATGAAAT---AAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGATGGGTTTG{CT}{AT}CAA{CG}AGAAAT{AG}AATAAA{AC}AATAATTA{CT}{CT}A{AG}AA{AT}A{AG}{CT}TATTTTCACG{AC}AT{CT}{AT}T{CT}{CT}TA{AT}-A{CT}T{GT}TACAAA{AC}A{CT}A----------A{AG}ATTTTTT{AG}ATCACTTAAAAA----CAATATCAT----------------------------------------------------------------------------ATATTATTTCTTT----------ACTTA{AT}{AT}A{GT}------------TGGGGTATTATTATT{AT}TC{CT}{AC}{AC}TA{AT}{CT}C----------------------------------A{AC}TAAAATAATATTGTG{AG}ATTTTA{AG}A{GT}{AG}{CT}{CT}TT{GT}ATAACTTT{AG}{AT}TT{AC}CTAG{CT}-------{AT}A{AG}{GT}A{AG}{AG}{AG}AATA{CG}AAGATC{AT}TTAAG{AC}{GT}AA--------------------------------------ATCAATA{AG}{GT}T{CT}{CT}TTGA----AA{GT}{CT}{AT}AT{AT}---------T----------------AAGT{CG}AAAA--ATTTTT{CG}ACT-------TTAT---------------AGCTT-TAGGAATTATTATTT{AC}TC{AT}{AT}AA----{AT}{CT}C---TTCT--ATT{AC}TT{GT}------------A{CT}TT{CG}-----G{AC}{AT}T{AC}AA{AG}{AG}T{CT}{AT}TA-----AAAG-{CT}AT{CT}T---------------------{AC}{CT}{CT}C{AT}{CT}AA-{CT}{AT}AGT{AG}AAT--A{CT}{AT}AGA-------------------T{AC}{AT}T{AT}ATAA----------TAA-TAA-------TAAGTAA{AT}AAT{AT}TA----------------------------------------------------------------------------------------T{GT}A-TA-------------TTGTT--------------------------------------------TTT{AT}A{GT}T-----------------G{AG}T{CG}G{AG}{AG}AAAATAATAATACC{CT}{CT}A{CT}{GT}TTT{AG}-----T{AG}{AC}AAT------A{AT}A------------------------------------------------------------------------AAA{AT}{GT}{AT}{GT}{GT}{CT}{GT}-T{GT}AA{AG}--------{AT}TAG{CG}AT{AT}ATT{CT}TGAT-AA----TT{AT}-----TT{CG}TAGTATTTT---{CT}--------------------------------------------ATT--------T{AC}T{CT}TTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCCGCTGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-----AAACAAATAAAATTTATAAAGTATGTAC----ATTTC---------AT--ATTCTAT-TTA----------ATTAAAA-----TTTACATT--TATAAAA-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCAATTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAAATTTCTTTCTACCATACTAGCGGGCCCCTTAGGA Vella_spinosa TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTT-TGTGAATTTCAATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCTTTTTATCTGTAAATTGGATG--AAAAAAAGGATCAAAAAAAGAACGAA{AG}AATT-AAAAGAAAAGAATAGTTCACAAAAAAG-AAATGGCATAAAAAAGTCG--------------TATATATATATATTATGCATTTTCCAAAATCCCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTCTATTATTTCAAAATAGAATTCTATTATTTCAAT-TCAAGTTTTTGGTTATTTTGGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTT-----AGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTTCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTAT--------------TAGTTTATTA------A--------------------------------------------TTAAGTAGTTGAATCTAAATCATGAATTGTCGGATGATTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTCTATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAAGGGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCTTTATCACATACACCTTCAATCACATTACATTGTCATCTTG-TATGCATCAATATGGAACTATTTGATTGATATCTGAAGCCATTATTTATGATTCGA--TTTTTTGATTCTT-AATACAA-TTTGATTCTT-ATACAA---ATAGAA-TTTAGAATCTTGTTATGTTCTGGAATCAAAACAAGATATTGAAATGCCC-TTTAGAG----ATT------------------AA-TTAATTTTGAA-TAAGACTTTCT--------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATAAA--ATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCGAAT--AAAAAAATATGAAAT---AAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTTAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTGTACAACA-AAATAAAT-----AAAAATACTAGAATAATTA-------GAATTAGCCTAA-CTT----AAAAACAA---------A-TTTTTT------------------------------------------------------------------------------------------------------------------------------ATTTCTAAA----------AGTGGGGTATTATTATTTT-CCCCACCA----------------------------------AT-AAAATAATA-----AATTTTAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATACAAGATCTTTAAGCGAA--------------------------------------ATCAATAGGTTTTTGA----AATTAATT---------T----------------AAGTCCAAA--ATTTTTCACT-------TTAT---------------AGCTT-TAGGAATTATTATTTATCTTAA----TTC---TTCT--ATTCTTT------------ACTTG-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------TAATAATAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA-------------TTGTT--------------------------------------------TTTAAGT-----------------GATC-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCG-TGAAA--------ATAAC--TATTTTGAT-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCCGCTGGCAA-TTTTTTTTAAGACTTTTTTTTTAGAAA--------------------TTGGATTTATGTTTTGTTTTATTGACTCATTTTATAT---------TT-----TTATATCAGGGTTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAAGAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-----AAACAAATGAAATTTATAAAGTATGTAC----ATTTC---------AT--ATTCTAT-TTA----------ATTAAAA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCAATTGTATCTTTATACATTACAATAACCATAATGGCTAGTATGGTAGAAAGAAATTTCTTTCTACCATACTAGCGGGCCCCTTAGGA Zilla_macroptera TTTAGGTTAGCCCAAT------T-----ATAG--AATAGTTGGTTTACGTTATGTAAGAAACACTTGTATATG-------TGATATTTGATATTGACTAGGTATATA-TGAGTTAAAGATCTATATAA-------------TCTGCCCCACTACTTTATGTGAATTTAGATT-------TAGATAAGGATTCGATTAGAAGTTCTTCCCTTTTATCTGTGAATTGGCTG--AAAAAAATGATCAAAAAAAGAACGAAGAATT-AAAAGAAAAGAATGGTTCACAAAAAAG-AAATGGCATAAAAAAGTCG----------------TATATATATACTATGCATTTTTCAAAATACCGTGGATAGGAACTAATATCAAAGTAATTCTTATGATTCAAT-----AATAGAATTATATTA---------------------TTTCAAT-TCAAGTTTTTGGTTATTTTAGCTGGATGAATCTTAGCGATGACTTAATTATAATTAAGTCCTAAGTCTTTCTCGCGCACT-GCCCCATAAAATTGAACCCTTATTAAAGAATTTCATTTAATTGGTTTCGAAGATCAAAAT-----ATTTTATTGGTCCTTA------CTTAGGTAAACGCATCAACTCAAATTGTTTCTTCCTTGCTATTTCTTCCTTGCTATTAGTTTATTA------A---------------------------------------------TAAGTAATTGAATCTAAATCATGAATTGTCGGATGACTC-ATTACTCAGATAA---AGA-----------------------------------------------------------------------------------------------------------------------------------AA--TA-TTTTTTTATATTTTCTTTGATATCT-ACATGTCCATGCCTGT-------------AAAAAA-GGGGAAAATTTCT------TATTTATATCTAATTCAATACAATATTTA--------AATAAAATAATAGGAAACTGTAAATGAGAGTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCTCTAGGCAGGAACGCA--ATATATTTCCTATGAAATATATAGAAACAAGAAGATTC-AATAAGAGATATCGACGGATTTCCTAAT--AAAAAAATATGAAAT--AAAAAAAA-TCTACTGTTTCAA---------TTTTATCTCTATCGAATTTGAATATCAGAATAGTGGATATAGTCATGATTCGACGGGTTTTTACAACA-AAATAAAT----AAAAAACACTAGAATAATTA-------TAATTAGCCTAA-CTT----AAAAACAA---------A-TTTTTTAGAATCCATATAAA------AAATAAA-TAGAAACCAAAAGAGTAAAAAAAAAAAGATAAT----------ATATATAG------------------------TTCCTATTGATTTTTTTA-----ATTTCTAAA-----------AGGGGGGATTTTTATTTT-CCCCATCA----------------------------------AT-AAAATAATA-----AA---TAAAGATCTTG-------TATTTCCTCTT-------AACTAGGAAATATAAGATCTTTAAGCGAA--------------------------------------CTCAATAGGTTCTTGA----AATTAATT---------T----------------AAGTCAAAA--AATTTTCACT-------TTAT---------------ACCTT-TAGGAATTATTATTTCTCTGAA----TTC---TTCT--ATTCTTT------------GCTTC-----GAATCAAAGTTATA-----AAAG-CATCT---------------------ATCCACAA-TAAGTGAAT--ATTAGA-------------------------TAA----------TAA-TAA-------TAAGTAATAATATA----------------------------------------------------------------------------------------TGA-TA--------------TTTT--------------------------------------------TTTAAGT-----------------GATA-AAAAAAT--------CTTATGTTTG-----TACAAT------ATA------------------------------------------------------------------------AAAAGATGCA-TGAAA--------ATAGA--TATTTTGAT-AA----TTA-----TTGT----TTTT---C--------------------------------------------ATT--------TCTCTTAGAAGTGGACTCTAGAAGTACTCCTAATTGCGATAATAATCAAACTCTATCAACCTGTATCAA-TTGTTTTAGTTTTCTAGACCGGCCGGCAA-TTTTTTTTAAGA-TTTTTTTTTAGAAA--------------------TTGGGTTTA-----TGTTTTATTGACTCATTTGATAT---------TT-----TTATATCAGGGGTTACACCGTTAACCATTCATGGGGTAACCCCTTTTCGAAATCTCAATAAGTTTCCATCGAATTCGGATTATCCGTATTAAATGGATC-AAACAAACAAATGAAATTGAGAAAGTATGTACATACATTTC---------AT--ATTCTAT-TTA----------ATTTATA-----TTTACATT--TATAAAG-AAAAAGAGAGA-TATGGGTGGATTCCTTTATATTAAGATATTTCACTTGTATCTTTATACATTACAATAACCACAATCGCTAGTATGGTAGAAAGAGATCTCTTTCTACCATACTAGGGGGCCCCGTAGGA ; END; BEGIN TREES; TITLE PAUP_rat_best; LINK TAXA = Taxa1; TRANSLATE 1 Alliaria_petiolata, 2 Calepina_irregularis, 3 Thlaspi_arvense, 4 Eutrema_halophilum, 5 Eutrema_parvulum, 6 Arabidopsis_thaliana, 7 'Capsella bursa-pastoris', 8 Coringia_planisiliqua, 9 Myagrum_perfoliatum, 10 Isatis_tinctoria2, 11 Isatis_canescens, 12 Isatis_tinctoria, 13 Savignya_parviflora, 14 Fezia_pterocarpa, 15 Erucastrum_ifniense, 16 Brassica_procumbens, 17 Diplotaxis_virgata, 18 Didesmus_bipinnatus, 19 Cakile_lanceolata, 20 Cakile_maritima, 21 Eremophyton_chevallieri, 22 Erucaria_erucarioides, 23 Sinapidendron_angustifolium, 24 Erucastrum_canariense, 25 Coincya_longirostra, 26 Sinapis_pubescens, 27 Hirschfeldia_incana, 28 Erucastrum_elatum, 29 Erucastrum_virgatum, 30 Erucastrum_littoreum, 31 Erucastrum_palustre, 32 Brassica_spinescens, 33 Brassica_spinescens1, 34 Vella_bourgaeana, 35 Brassica_maurorum, 36 Brassica_fruticulosa, 37 Crambe_hispanica, 38 Crambe_hispanica_var._abyssinica, 39 Crambe_filiformis, 40 Raffenaldia_primuloides, 41 Ceratocnemum_rapistroides, 42 Sinapis_alba, 43 Kremeriella_cordylocarpus, 44 Sinapis_flexuosa, 45 Brassica_carinata, 46 Brassica_nigra, 47 Guiraoa_arvensis, 48 Ammosperma_cinerea, 49 Streptanthus_drepanoides, 50 Sisymbrium_irio, 51 Pseudofortuynia_esfandiarii, 52 Sisymbrium_officinale, 53 Stanleya_bipinnata, 54 Caulanthus_inflatus, 55 Caulanthus_amplexicaulis, 56 Streptanthus_drepanoides1, 57 Pseuderucaria_teretifolia, 58 Henophyton_deserti, 59 Henophyton_deserti1, 60 Henophyton_zygarrhenum, 61 Trachystoma_labasii, 62 Vella_anremerica, 63 Vella_spinosa, 64 Schouwia_purpurea, 65 Foleyola_billotii, 66 Physorhynchus_chamaerapistrum, 67 Zilla_macroptera, 68 Erucastrum_nasturtiifolium, 69 Moricandia_arvensis, 70 Moricandia_foetida, 71 Brassica_elongata, 72 Brassica_gravinae, 73 Brassica_desnottesii, 74 Brassica_repanda, 75 Brassica_villosa, 76 Morisia_monanthos, 77 Enarthrocarpus_lyratus, 78 Diplotaxis_erucoides, 79 Erucastrum_gallicum, 80 Raphanus_raphanistrum, 81 Brassica_barrelieri, 82 Brassica_oxyrrhina, 83 Brassica_macrocarpa, 84 Carrichtera_annua, 85 Brassica_montana, 86 Brassica_napus, 87 Brassica_rapa_var._chinensis, 88 Brassica_juncea, 89 Brassica_rapa, 90 Brassica_cretica, 91 Brassica_oleracea_var._gemmifera, 92 Brassica_oleracea_var._alboglabra, 93 Brassica_oleracea_var._botrytis, 94 Brassica_incana, 95 Brassica_oleracea, 96 Brassica_oleracea_var._gongylodes, 97 Brassica_oleracea_var._viridis, 98 Brassica_oleracea_var._sabadua, 99 Diplotaxis_harra, 100 Eruca_pinnatifida, 101 Eruca_vesicaria_var._sativa; TREE PAUP_1 = [&R] ((6:0.03526235,7:0.05406751):0.068143495,(2:0.08124882,((1:0.04275586,(3:0.07977975,4:0.06191803):0.02692671):0.00844762,(5:0.06125645,((8:0.01855565,(9:0.02500678,(10:0.02089885,(11:0.00318561,12:0.00454211):0.01240851):0.0112896):0.02242435):0.02165495,(((50:0.01925432,(51:0.01150093,52:0.01071117):0.00420954):0.00745809,(49:0.02020874,(53:0.01872642,(54:0.00762324,(55:0.00681402,56:0.00882205):9.1833E-4):0.00598247):0.00238811):0.00185558):0.01429833,((63:0.00355019,(34:0.04055613,62:0.00412563):0.00475698):0.04293753,((64:0.0188773,(66:0.00550593,(65:0.00484576,67:0.00326482):0.00103772):0.01754603):0.00781518,(((60:0.00818631,61:0.01623127):2.1506E-4,(59:0.01081487,(48:0.02980254,58:0.00323497):0.01615396):0.00521635):0.02161052,((25:0.02440142,((47:0.01295789,((45:1.0E-8,46:1.0E-8):0.0097772,((43:0.00569507,44:0.0044321):0.01084914,(41:0.01433142,(30:0.01926335,((32:1.0E-8,33:1.0E-8):0.00372702,(31:0.00505156,(35:0.00366669,36:0.00432477):0.00211947):1.0E-8):0.01571219):0.0100442):0.00176099):0.00177824):4.762E-7):0.00640702,(((40:0.03009525,42:0.01796955):0.00405148,((16:0.03252773,26:0.01349935):0.01116103,(27:0.01819627,(28:0.00555074,29:8.5427E-4):0.00139846):0.02297209):0.01103027):0.00138502,((15:0.01497975,(17:0.03021868,(23:0.00861579,24:0.01297955):0.00665212):0.00483806):0.00947144,((14:0.04246631,57:0.03971893):0.01474787,((37:0.01013343,(38:0.0078616,39:0.00150177):0.0128554):0.01365542,((21:1.0E-8,22:8.3121E-4):0.0173966,(20:1.0E-8,(18:1.0E-8,19:7.8257E-4):0.003958):0.01355282):0.01157685):0.00391241):0.00859433):0.00261461):0.02072285):0.0134531):0.00411399,(13:0.04245899,((71:0.02569643,(72:0.01522016,(73:0.00979853,74:0.00210152):0.00545765):0.01761214):0.00763764,((69:1.0E-8,70:0.00147527):0.01850682,((99:0.02281151,(100:0.00749009,101:0.00909593):0.00736857):0.0045498,((77:0.02004611,((81:0.00214905,82:0.01887088):0.02386828,((76:0.02242836,80:0.01634195):0.00152046,(78:0.00973591,79:0.01280593):0.00756694):7.3787E-4):0.0032335):5.6925E-4,(68:0.02769769,(83:0.01020243,(75:0.0152288,((86:0.00770116,(89:1.0E-8,(88:1.0E-8,(84:7.2033E-4,87:1.0E-8):8.7819E-4):0.0):0.01273522):6.6918E-4,(85:0.00899915,(95:1.0E-8,(94:1.0E-8,(93:1.0E-8,(96:1.0E-8,(90:0.00143875,91:1.0E-8,92:7.2201E-4,97:1.0E-8,98:1.0E-8):0.00236759):0.0):0.0):0.0):0.00710167):0.00556423):0.01878152):4.729E-7):0.00838209):8.6112E-4):0.01003611):0.00216044):0.00198839):0.01009217):0.00590509):0.00624805):0.01217503):8.0894E-4):0.01731644):0.00532135):0.0414815):0.01431306):0.00356394):0.068143495); END;