#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 16:55 GMT TreeBASE (cc) 1994-2008 Study reference: Matsuzawa T., Takaki G.C., Yaguchi T., Okada K., Abliz P., Gonoi T., & Horie Y. 2013. Aspergillus arcoverdensis, a new species of Aspergillus section Fumigati isolated from caatinga soil in Pernembuco state, Brazil. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14915] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=58; TAXLABELS Aspergillus_arucoverdensis_59923 Aspergillus_arucoverdensis_61334T Aspergillus_arucoverdensis_61337 Aspergillus_arucoverdensis_61338 Aspergillus_arucoverdensis_61339 Aspergillus_arucoverdensis_61340 Aspergillus_arucoverdensis_61345 Aspergillus_arucoverdensis_61346 Aspergillus_arucoverdensis_61349 Aspergillus_arucoverdensis_61362 Aspergillus_arucoverdensis_61905 'Aspergillus brevipes CBS_118_53T' 'Aspergillus caatingaensis IFM_61335T' 'Aspergillus clavatus CBS_514_65' 'Aspergillus duricaulis CBS_481_65T' 'Aspergillus felis CMF_ISB_2162_IFM_60852' 'Aspergillus fumigatiaffinis IBT_12703T' 'Aspergillus fumigatus CBS_545_65' 'Aspergillus fumisynnematus IFM_42277T' 'Aspergillus huiyaniae IFM_57847T_A159' Aspergillus_lentulus_FH5T 'Aspergillus marvanovae CCM_8003T' 'Aspergillus novofumigatus IBT_16806T' 'Aspergillus pernambucoensis IFM_61342T' 'Aspergillus siamensis KUFC_6349T' 'Aspergillus turcosus KACC_42091T' 'Aspergillus unilateralis CBS_126_56T' 'Aspergillus viridinutans CBS_127_56T' 'Aspergillus waksmanii NRRL_179T' 'Aspergillus wyomingensis CCF_4417T' 'Neosartorya assulata KACC_41691T' 'Neosartorya aurata CBS_466_65T' 'Neosartorya aureola CBS_105_55T' 'Neosartorya australensis CBS_112_55T' 'Neosartorya coreana KACC_41659T' 'Neosartorya denticulata CBS_652_73T' 'Neosartorya fennelliae CBS_598_74T' 'Neosartorya fischeri CBS_544_65T' 'Neosartorya galapagensis CBS_117522T' 'Neosartorya glabra CBS_111_55T' 'Neosartorya hiratsukae IFM_47035T' 'Neosartorya multiplicata IFM_46955T' 'Neosartorya nishimurae CBS_116047' 'Neosartorya papuensis CBS_841_96T' 'Neosartorya paulistensis CBM_FAspergillus_690T' 'Neosartorya pseudofischeri CBS_208_92T' 'Neosartorya quadricincta CBS_135_52T' 'Neosartorya shendaweii IFM_57611T' 'Neosartorya spathulata IFM_47038T' 'Neosartorya spinosa CBS_483_65T' 'Neosartorya stramenia CBS_498_65T' 'Neosartorya sublevispora IFM_53598T' 'Neosartorya takakii CBM_FAspergillus_884T' 'Neosartorya tatenoi CBM_FAspergillus_22T' 'Neosartorya tsunodae IFM_57609T' 'Neosartorya tsurutae CBM_FAspergillus_933T' 'Neosartorya udagawae CBM_FAspergillus_702T' 'Neosartorya warcupii NRRL_35723T' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=24; TAXLABELS 'Aspergillus arucoverdensis IFM_59923' 'Aspergillus arucoverdensis IFM_61334T' 'Aspergillus arucoverdensis IFM_61337' 'Aspergillus arucoverdensis IFM_61338' 'Aspergillus arucoverdensis IFM_61339' 'Aspergillus arucoverdensis IFM_61340' 'Aspergillus arucoverdensis IFM_61345' 'Aspergillus arucoverdensis IFM_61346' 'Aspergillus arucoverdensis IFM_61349' 'Aspergillus arucoverdensis IFM_61362' 'Aspergillus arucoverdensis IFM_61905' 'Aspergillus clavatus CBS_514_65' 'Aspergillus felis CMF_ISB_2162_IFM_60852' 'Aspergillus fumigatiaffinis IBT_12703T' 'Aspergillus fumigatus CBS_545_65' 'Aspergillus fumisynnematus IFM_42277T' Aspergillus_lentulus_FH5T 'Aspergillus novofumigatus IBT_16806T' 'Aspergillus siamensis KUFC_6349T' 'Aspergillus viridinutans CBS_127_56T' 'Aspergillus wyomingensis CMF_ISB_2494T' 'Neosartorya aureola CBS_105_55T' 'Neosartorya fischeri CBS_544_65T' 'Neosartorya udagawae CBM_FAspergillus_702T' ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=24; TAXLABELS 'Aspergillus arucoverdensis IFM_59923' 'Aspergillus arucoverdensis IFM_61334T' 'Aspergillus arucoverdensis IFM_61337' 'Aspergillus arucoverdensis IFM_61338' 'Aspergillus arucoverdensis IFM_61339' 'Aspergillus arucoverdensis IFM_61340' 'Aspergillus arucoverdensis IFM_61345' 'Aspergillus arucoverdensis IFM_61346' 'Aspergillus arucoverdensis IFM_61349' 'Aspergillus arucoverdensis IFM_61362' 'Aspergillus arucoverdensis IFM_61905' 'Aspergillus clavatus CBS_514_65' 'Aspergillus felis CMF_ISB_2162_IFM_60852' 'Aspergillus fumigatiaffinis IBT_12703T' 'Aspergillus fumigatus CBS_545_65' 'Aspergillus fumisynnematus IFM_42277T' Aspergillus_lentulus_FH5T 'Aspergillus novofumigatus IBT_16806T' 'Aspergillus siamensis KUFC_6349T' 'Aspergillus viridinutans CBS_127_56T' 'Aspergillus wyomingensis CMF_ISB_2494T' 'Neosartorya aureola CBS_105_55T' 'Neosartorya fischeri CBS_544_65T' 'Neosartorya udagawae CBM_FAspergillus_702T' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42921] TITLE Aspergillus_acro_calmodulin; LINK TAXA = Taxa2; DIMENSIONS NCHAR=531; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Aspergillus arucoverdensis IFM_59923' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTCCAATATCC-----GGAAATGA-CCCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGGCTGCATCTGGCGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGATACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61334T' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGGCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61337' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGTCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61338' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGTCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61339' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGGCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61340' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGGCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61345' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGTCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61346' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGTCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61349' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGTCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61362' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGTCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus arucoverdensis IFM_61905' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAGTGTACGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTCT--CCGCTCCTCGAACGTCGGCGTC-CGTGCGATCATGTTCAAATGTCG--ACTTACAATATCC-----GGAAATGA-CTCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGTCTGCATCTGGTGTGACCCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus clavatus CBS_514_65' GCCTAATTCTCGAATGGTCTATGAGTGAAATTCGGGCTATGTTATGTTCTTGAAGGCATTCACTTACATGGGATTCTCCGATCTGTACAGGACAAGGATGGTGATGGTTAGTTCGGCCTTCTCT------TCCAAGAAC--CACCTTC-TATGCGACTACTTCCGGCCACCGATATTTCTATTCTCCGTAAAGGAAGCGA-TCCATGTTTGCTGATG-TATTTCTCGTCGACCT-GCAGGCCAGATCACCACCAAGGAGTTGGGTACCGTTATGCGCTCTCTGGGCCAGAACCCTTCCGAGTCGGAGCTCCAGGACATGATCAATGAGGTTGATGCCGACAACAACGGCACCATTGATTTTCCCGGTATGCG-ATACTTCCCACCCGA-ATCACTCAGAGAGATGAATAT--------ATATTGACCCGCGTTCAGAGTTCCTCACCATGATGGCTCGGAAGATGAAGGATACCGACTCTGAGGAGGAAATCCGAGAGGCTTTCAAGGTTTT---CGATCGTGACAACAAC 'Aspergillus felis CMF_ISB_2162_IFM_60852' TTTAAGCCCCTAGTCGTTGCATAAGAGAAATTTCCACAATA--------TTGAGAGTGTGCGCTCACGCGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTCTT--CCGCTCCTCGAACGTCGGATTC-CTCGCGATCATGTTCAAATGCCG--ACTTACAATATCC-----GGAAATGA-CCCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGGATGCATCTAGCGTGA-CCCCGGGAGGGAGGTGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATCCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus fumigatiaffinis IBT_12703T' TCCAAGTCCCTAGTCGTTGCATAAGAGGAATTTCCTCAATA--------TTGAGGGTGTGCGCTCACACGAGATT---CGACCTGT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTTT--TCGCTCCTCGAACGTCGGCTTC-CGTGCGATCATGTTCCAAAGCCG--ACTTACAATATCC-----GGAAATGA-TCCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACTAAGGAATTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAACGGCACCATCGATTTCCCTGGTATGCG-ATGCATTTGGTGTGA-CCTCGGGAGGGAGGAGAATAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATCCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAATAAC 'Aspergillus fumigatus CBS_545_65' TCCAAGTCCCTGGTCGTTGTATAGGAGGGATCTCCAGAATA--------TTGAGGGTGTGCGCTGACACGAGATT---TGACGTAT--AGGACAAGGATGGTGATGGTTAGT--GACCCTTTTT--CCACTCCTCGAACTTCGGCTTC-CATGCGATCATGTTCAAACGCCG--ACTCACAATATCC-----GGAAATGA-CCCTTCAGTACTGATAATATCTATGTTTGACTA-TCAGGCCAGATCACCACCAAGGAATTGGGCACTGTAATGCGCTCTCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAACGGCACCATCGATTTCCCCGGTATGTG-ATACTTTCGGTATGA-ACTCGGGAGGGGAGAGAACAA--------TCATTAACTTGTAATCAGAATTCCTTACCATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATTCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus fumisynnematus IFM_42277T' TCCCC-TCCCTAGTCGTCGCAGAAGAGGAATTCC--CAATC--------TTGAGGGTATGCGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTTT--CCGCTCCTCGAACGTCCACTTG-CATACGACCATGTTCGAATGCCG--ACTTACACTATCC-----GTAAATGA-TCCATAAATACTGATAATGTCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAATTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCGGAATCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAACGGCACCATCGATTTCCCTGGTATGCG-ATGCATTGGGTGTGA-CCTCGGGAGAGAGGGGAACAATCATTAACTCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATCCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC Aspergillus_lentulus_FH5T TCCACCTCACTAGTCGTCGCAGAAGAGGAATTTCCACAACC--------TTGAGGGTGTGCGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTTT--CCGCTCCTCGAACGACTGCTTG-CATGCGACCATGTTCAAATGCCG--ACGCACAATACCC-----GGAAATGA-TCCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAATTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCTGAATCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAACGGCACCATCGATTTCCCTGGTATGCG-ATGCATTTGGTGTGA-CCTCGGGAGGGAGGAGAACAATCATTAACTCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCTGAAGAGGAAATCAGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus novofumigatus IBT_16806T' TCCAAGTCCCTAGTCGTTGCATAAGAGGAATTTCCTCAATA--------TTGAGGGTGTGCGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTTT--TCGCTCCCCGAACGTCGGCTTC-CGTGCGATCATGTTCAAATGCCG--ACTTGCAATGTCC-----GGAAATGA-TCCATCAATACTGATAATATCTATGTTTGACTATTTAGGCCAGATCACCACCAAGGAATTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAACGGCACCATCGATTTCCCTGGTATGCG-ATGCATTTGGTGTGA-CCTTGGGAGAGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATCCGGGAAGCTTTCAAGGTCTTCGACGACCGCGACAACAAC 'Aspergillus siamensis KUFC_6349T' TCCAAGTCCCTAGTCGTTGCATATGAGGAATCTCC-CAATA--------TTGAGAGTTTGCGCTCACACGAGATT---CGACCGAT--AGGACAAGGATGGCGATGGTTAGT--GACCTTTTTTCTCCGCTCCTCGAACGTCGGATTC-CGTGCGATCATGTTCAAATGCCA--ACTTACAATATCC-----GGAAATGA-CCCATCAAAACTGATGATATCTATGTTTGACTG-TTAGGCCAGATCACCACCAAGGAATTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTACGCGGATGCATCTAGCGTGA--CCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATACAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATCCGGGAAGCTTTTAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus viridinutans CBS_127_56T' TTTTAGTCCCTAGTCGTTGCATAAGAGGAATTTCCACAATA--------TTGAGAG--TGCGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTTT--CCGCTTCTCGAACGTCGGCTTC-CGTGTGATCATGTTCAAATGCCG--ACTTACAATATCC-----GGAAATGA-CCCATCAATACTGATAATATCTACGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTATGCGGATGCATCTGGC-TGACCCCCGGGAGGGAGGAGCACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCTGAAGAGGAAATCCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Aspergillus wyomingensis CMF_ISB_2494T' TTTTAGTCCCTGGTCGTTGCATAAGAGGAATTTCCATAATA--------TTGAGAGTTTGCGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTTTTCCCGCTCCTCGAACGTCGGATTC-CGTGCGATCATGTTCAAATGCCA--CCTTACAACATCC-----GGGAATGA-CCCATCAATACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACTACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTACGCGGATGCATCTAGCGTGA-CCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAGGAGGAAATCCGGGAAGCTTTTAAGGTCTT---CGACCGCGACAACAAC 'Neosartorya aureola CBS_105_55T' T-TTAGTCCCTAGTCGCTGCATAAGAGGAATTTCCGCAATA--------TTGAGAGTTTGCGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTTT--CCACTCCTCAAACGTCGGATTC-CATGCGATCATGTTCAAATGCCA--ACTTACAATATCC-----GTGAATGACCCCATCAATACTGATAATATCTATGTTTGACT--TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTACAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTACGCGGTTGCATCTAGCGTGA-CCCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATACAGAATTCCTCACAATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATCCGGGAAGCTTTTAAGGTCTT---CGACCGCGACAACAAC 'Neosartorya fischeri CBS_544_65T' TCCAAGTCCCTAGTCGTTGCATAGGAGGGATCTACTCCATA--------TTGAGGGTGTGCGCTCACACGAGATT---CGACCTAT--AGGACAAGGATGGTGATGGTTAGT--GACCCTTTTT--CCGCTCCTCGAACTTCGGCTTCAAATGCGATCATGTTCAAACGCCG--ACTTACATTATCC-----GGAAATGA-CCCGTCAGTACTGATAATATCTATGTTTGACTA-TTAGGCCAGATCACCACTAAGGAATTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTACAAGATATGATCAACGAGGTGGATGCTGACAACAACGGCACCATCGATTTCCCTGGTATGCG-ATGCATTTGGTATGA-CCTCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATTCAGAATTCCTTACTATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATCCGGGAAGCTTTCAAGGTCTT---CGACCGCGACAACAAC 'Neosartorya udagawae CBM_FAspergillus_702T' TTTTAGTCCCTAGTCGTTGTATAAGAAGAATTTCCACAATA--------TTGAGAGTTTGCGCTCACACGAGATT---CGACGTAT--AGGACAAGGATGGTGATGGTTAGT--GACCTTTTTT-TCCGCTCCTCGAACGTCGGATTC-TGTGCGATCATGTTCAAATGCCA--ACTTACAATATCC-----GAGAATGGCCCCATCAATACTGATAAAATCTATGTTTGACTA-TTAGGCCAGATCACCACCAAGGAACTGGGCACTGTGATGCGCTCCCTGGGCCAGAACCCTTCCGAGTCAGAGCTGCAAGATATGATCAACGAGGTGGATGCTGACAACAATGGCACCATCGATTTCCCTGGTACGCGGATGCATCTAGCGTGA--CCCGGGAGGGAGGAGAACAA--------TCATTAACTCGTATACAGAATTCCTTACAATGATGGCTCGGAAGATGAAGGACACCGACTCCGAAGAGGAAATCCGGGAAGCTTTTAAGGTCTT---CGACCGCGACAACAAC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42920] TITLE 'Aspergillus acro beta-tubulin'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=468; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aspergillus_arucoverdensis_59923 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61334T TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61337 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61338 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61339 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61340 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61345 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61346 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61349 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61362 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_arucoverdensis_61905 TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGCTGTCCTCCC-TGGGTTCAGCTTCGCTGTCATGGGTATCGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACA--AA-AGGCAAAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGGAACTCTCGACTCT-----ACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAGCGGCGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus brevipes CBS_118_53T' TATGTCTCGACCTCAACGCTCGGATGATGGAAGATTAGGACCAGT--CAGCTCAGCAGGCGGTTCTCCA-TCGGTTCTGGTTTGCTGTCATGGGCATCAGCTGACAAAACTTATAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCAACCTTTATCC-TCCCAATTGAGAGAGCCGAGGA-ACCGCGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGCATGAAACTCTCGACCCTACACTACTTC-GGCAAC-ATCTCACGAT-CTGAATCGCCATTAGGCCAACGGCGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus caatingaensis IFM_61335T' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGT--CATCTCATCAGGCTGTCCTTAA-TGGGTTCCG--TCGCCGTCATGAGTATCAGCTAAC-CAACTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTCATCC-TCCTAATTGAGAAAGCGGGGAA-AACACGAA-AGGC-AAGCAGGAAGAGGATGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTTTACTTCAACGAGGTGTGTGAATGAAACTCTCAATTCT-AACCACTGC-CGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTCCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus clavatus CBS_514_65' AATGCATTGATGTTGATGTT--GATGATGGAAGATTCAGAGCCATACAATCTCAATTGGCAATTCGCCTGGGGGTTGTGGTTCCAGTTCGTGGATATGGGCTGAC-AGATTTATAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TGCAACCTTTTA---TTCCGATCGATATGGCGGAAGGAAATATGAGGAGG--ATTACAACACTGAGCATGGATCTGAT-GGAAATGATAGCTACAATGGCACCTCCGATCTCCAGCTCGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGG-TGGGATTCCGTA--------TGCTTC-GACAAAACCTTCACGATCCTAACTCCCTGCCAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCTGGT-CCATTCGGCGA 'Aspergillus duricaulis CBS_481_65T' TATGTCTCGACCTCAATGATTCGATGATGGAAAATCAGGACCAGT--CAGCTCAGCAGGCTGTTCTCCA-TCACTTCTGG-CTGCTGTCATGGTCATCAGCTGAC-AAACTTATAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCAACCTTTGTCC-TCCCAATTGAGAAACCGGGGGA-GCCACGAA-AGGC-AAGCAGGAAGAGAACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTACACTACTTC-GGCAAC-ACCCAACAAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTGGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus felis CMF_ISB_2162_IFM_60852' TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGATCTGT--CACATTAGCGGGCTGTCCTCCA-TGGATTGAGCTTCGCTGTCATGGGTACCAGCTAAC-AGATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCA---------ACGAA-AGGC-AAGCACGAAGAGGACGCGTATCTGATCCGATATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTACATTACTTC-GGCAAA-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCTTTCGGCGA 'Aspergillus fumigatiaffinis IBT_12703T' TATGTCTCGACCTCAATGCTTGGATGATGGGAGATAGGAACCTGT--CATCTTAGCAGGCTGTCCTCCA-TGGGTTCAGCTTCGCTGTCATGGGTATCAGCTAAC-AAATCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACAC-AA-AGGC-AAGGAAGAAGAGGACGCGTGTCTGAT-TGGCATAATAGCTACAATGGCTCCTCCGACCTTCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTTGATGAAACTTTCGACTCTACACTACTTC-GGCAAT-TTCTCACGAT-CTAACTCGCT-CTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus fumigatus CBS_545_65' TATGTCTTGACCTCAAAGCTTGGATGACGGGTGATTGGGATCTCT--CATCTTAGCAGGCTA-CCTCCA-TGGGTTCAGCCTCACTGTCATGGGTATCAGCTAAC-AAATCTACAGGCAGACCATCTCTGGTGAGCATGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTATATCC-TCCCAATTGAGAAAGCGGCGGA-AACACGGA-AAAC-AAGGAAGAAGCGGACGCGTGTCTGATGGGAAATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGTGTGGATGAAACTCTTGA-TTTATACTATTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCTGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus fumisynnematus IFM_42277T' TATGTCTCGACCTCAATGCTAGGATGATGGGAGATTGGGACCTGT--CATCTTAGCAGGCCGTCCTCCA-TGTGTTCAGCTTCGCTGTCATGAGTTTCAGCTAAC-AATGCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTATATCC-TCCCAGTTGAGAAAGCGGCGGA-AACACGAA-ATGC-AAGAAAGAAGAGGAGGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTGCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACCCTACACTCCTTT-GACAAC-ATCCCACGGT-CTGACTCGCTACTAGGCCAACGGCGACAAGTATGTTCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus huiyaniae IFM_57847T_A159' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGT--CAGCTCAGCAGGCTATTCTCCA-TCGGTTTTTTGTCGCCATCATGTGTACCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTGTCC-TCGCAATTGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCGGGAAAAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGATCTTCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTTT--AATACTGC-GGCAAC-ATCTCACGAT-CTGACTCGCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA Aspergillus_lentulus_FH5T TATGTCTCCACCTCAATGCTAGGATGATGGGAGACTGGGACCTGT--CATCTTAGCAGGCTGTCC-CCA-TGTGTTCAGCTTCGCTGTCATGAGTATCAGCTAAC-AAATCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTATATCC-TCCCAATCGAGAAAGCGGCGGA-AACACGTA-AGGC-AAGGAAGAAGAGGACGCGTGTCTGAC-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTACACTCCTTT-GACAAC-ATCTCACGGT-CTGACTCGCTACTAGGCCAACGGCGACAAGTATGTTCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus marvanovae CCM_8003T' TATGTCTCGACCTCAATGCTTGGGTGATGGAATATTAGGACCGGT--CATCTCAGCAGGCTGTCCTACA-TGGGTTCTGG-TCGCTGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTGC-CGCAAC-ATCTCACGAT-CTTACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus novofumigatus IBT_16806T' TAAGTCTCGACCTCAATGCTTGGATGATGGGAGACTGGGACCTGT--CATCTTAGCAGGCTGTCCTCCATTGGGATCAGCTTCGCTGTCATAGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGGAAGAAGAGGACGCGTGTCTGAT-TGGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTTGATGAAACTCTCGACTCTGCACTACTTC-GGCAAT-TTCTCACGAT-CTAACTTGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus pernambucoensis IFM_61342T' TATGTCTCGACCTCACTGCTTGGATGATGGAAGATTAGGACCGGT--CATCTCAGCAGGCTCTTCTCCA-TGAATTCTGG-TCGCCGTCATGAGTATCAGCTAAC-AAATCTACAGGCAGACCATCTCTGGTGAGCACGGTCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TC--AATTGAGAAAGCGGGCAA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGAATCTCTCAATTCT-AACCACTGC-CGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTCCCTCGTGCCGTCCTGGTCGATCTCGAGCCTGGTACCATGGATGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus siamensis KUFC_6349T' TATGCCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCTTAGCAGGCTGTCCTCTA-TGGGTTCAGCTTCGCTGTCATGGGTATCAGTTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTAATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT-GAGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGAATGAAACTC--GACTCTACGCTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus turcosus KACC_42091T' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCGGT--CATCTCAGCAGGCTGTCCTCCA-TGGGTTCTGG-TCGTCGTCATGGGTATCAGCTAAC-AAATATACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTGATCC-TCCCAATCGAGAAAGCGGGGGA-AACACGAATCGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACGCT-AACTACTGC-CGCAAC-ATCTCACGAT-CTGACCCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGC-CCCTTCGGCGA 'Aspergillus unilateralis CBS_126_56T' TATGTCTCGACCTCAATGCTTGGATGATAGGACATTAGGACCGGT--CAGCTCAGCAGGCTGTCCTTCA-TGGATTCTGG-TCGCCGTCATGATTATCAGCTAAC-AAATTTACAGGCAGACTATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-ACGC-GAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCAACTCT-TACTACTGG-CGCAAC-ATCTCACGAC-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Aspergillus viridinutans CBS_127_56T' TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCATAGCAGGC----CTCCA-TGGGTTCAGCTTCGCTGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGTGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTACACCACTTT-GGCAAC-ATCTCACGAT-CTGACTCG?TACTAGGCCAACGGAGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGG?GA 'Aspergillus waksmanii NRRL_179T' TATGTCTCGACCTCAATGCTTGGGTGATGGAAGATTAGGACCGGT--CATCTCAGCAGGCTGTCCTACA-TGGGTTCTGG-TCGCTGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGTCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTGATCC-TCCCAATCGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTGC-CGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTTCGTGCCGGT-CCCTTCGGCGA 'Aspergillus wyomingensis CCF_4417T' TATGCCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACATGT--CATCTTAGCAGGCTGTCCTCCA-CGGGTTCAGCTTCCCTGTCATGAGTATCAGCTTAC-AATTTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATGC-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTCTCTGAT-GAGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTC--GACTCTACACTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya assulata KACC_41691T' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCGGT--CATCTCAGCAGGCTGTCCTCCA-TGGGTTCTGG-TCGCCGTCATGGGTATCAGCTAAC-AAATATACAGGCAGACCATCTCCGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCGATTGAGAAAGCGCGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGTTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTGC-CGGAAC-ATCTCAGAAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya aurata CBS_466_65T' TATGTCTCGACCTCAATGCTTTGATGATGGAAGATTAGAACCAGT--CATCTCAGCAGGCTGT-CTCCG-TGGGCTCTGG-TCGCCGCCATAGGTATCAGCTAAC-AAATTTACAGGCAGACAATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-CCTTGATTGAGAAAGCGGGGGGCAACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAGCTCTCGACCCT-AATTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGG?-CCCTTCGGCGA 'Neosartorya aureola CBS_105_55T' TATGC?TCAACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCCTAGCAGGCTGTCCTCTA-TGATTTCAGCGTCGCTGTAATGGGTATCAGCTAAC-AAGTTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATCGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGG-CGCGTGTCTGAT-GAGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTC--GACTCTACACTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya australensis CBS_112_55T' TATGTCTCGACCTCAA---TTGAATGATGGAAGATGAGGACCAGT--CAGCTCGGCAGGCTGTTCTCGA-TCGGTTCTAG-TTGCTGTCATGGGTAT-AGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCGCAAT---GAAAGCGGGGA--AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTGC-CGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya coreana KACC_41659T' TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCTTAGCAGGCTGTCCTCCA-TGGGTTCAGCTTCGCTGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCGATTGAGAAAGCGGCGGA-AACACGAA-ATGC-AAGGAAGAAGAGGACGCGTGTCTGAT-CGGAATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGTTAAAACTCTCGACTCTACACTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya denticulata CBS_652_73T' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGT--CAGCTCAGCAGGCTATTCTCCA-TCGGTTTTTTGTCGCCGTCGTGTGTACTGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCGCAATTGAGAAAGCGGGGGA-AACATGAAAAGGC-AAGCGGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGAGACTCTCGACTCT--AATACTGC-GGCAAC-ATCTCACGAT-CTGACTCTCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya fennelliae CBS_598_74T' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGT--CAGCTCAGCAGGCTATTTTCCA-TCGGTTTTTCGTCGCCGTCATGTGTACCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGAAAACACGAA-AGGC-AAGCGGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTTGATGAAACTCTCGACTTT--AATACTGC-TGCAAC-ATCTCACAAT-CTGACTCGCTGTTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya fischeri CBS_544_65T' TATGTCT?GACCTCAATTCTTGGATGACGGGAGATTGGGACCTGT-----CTTAGCAGGCTGTCCTCCA-TGGGTTCAGCTTCGCTGTCATGGGTATCAGCTAAC-AAATCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTATATCC-TCCCAATTGAGAAAGCGGCGGA-AACACGAA-AGG--AAGGAAGAAGAGGACGCGTGTCTGAT-GGGGTTAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGTGTGGATGAAACTCTCGACTCT--ACTATTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCTGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya galapagensis CBS_117522T' TATGTCTCGACCTCAATGCTTAGATGATCGGAGATTAGGACCCGT--CATCTCAGCAGGCTGTCCTCCA-TGGGTTCTGG-TCGCTGTCATGAGTATCAGCTAAC-AAATTTATAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAACGCGGGGGA-AGCACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGCATGAAACTCTCGACTCT-AACTACTGC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya glabra CBS_111_55T' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGT--CAGCTCAGCTGGCTGTCCTCCA-TGGGTTCTGG-TCGTCGTCGTGGGTAT-AGCTAAC-AGATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTCTATCC-TCCCAATTGAGAAAGCGGGGA--AACACAAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACATTAAACTACT---GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTTGGCGA 'Neosartorya hiratsukae IFM_47035T' TATGTCTCGACCTCAATGCTTGGATGATGGAATATTAGGACCAGC--CAGC----------ATCCTCGA-TCGGTTCTAG-TTGCTGTCATGGGTAT-AGCTAAC-AAATTTCCAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGAACGCGTCTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTTAACTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGC-CCCTTCGGCGA 'Neosartorya multiplicata IFM_46955T' TATGTCTCGACCTCAATGCTTAGATGATGGAAGACTAGGACCTGT--CATCTCAGCAGGCTGTCC-CCA-TGGGTTCTGG-TCGCCGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCCGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGCCTGAT--GGGATAATAGCTACAATGGCACCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTACGTGAATGAAACTCT--------AACTACTGC-CGCAAC-ATTTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTTGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya nishimurae CBS_116047' TATGTCTCGACCTCGATGCTTGGGTGATGGAATATTAGGACCGGG--CATCTCAGCAGGCTGTCCTACA-TGGGTTCAGG-TCGCTGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTGATCC-TCCCAATCGAGAAGGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGCATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACGCT-AACTACTGC-CGCAAC-ATCTCACGAT-CTGACTCGCTGCTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya papuensis CBS_841_96T' TATGTCTCGACCTCAA---TTGGATGATGGAAGATTAGGACCAGT--CAGCTCAGCAGGCTGTCCTTCA-TGGGTTCTGG-TCGCCGTCATGAGTATCAGCTAAC-AAATCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGATGGCTCTGGCCAGTAAGTTTCGACCTTTATCC-TCCCGATTGAGAAAGC-GGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTGC-CGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTAGGCGA 'Neosartorya paulistensis CBM_FAspergillus_690T' TATGTCTCGACCTCAATGC?TGGATGATGGGAGTTTAGGACCTGT--CATCTTAGCAGGCTGTCCTCCA-TGGGTTCAGCTTCGCTGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACCCGAA-ATGC-AAGGAAGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGACACTC--GACTCTACACTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya pseudofischeri CBS_208_92T' TATGTCTTGATCTCAATGCTCGGATGATGGAAGATGAGGACC--------------AGGCTGTCCTCCA-TGGGCTCTGGTTCGCTGTCATGGGTATCAGCTGAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTCGACGGCTCTGGCCAGTAAG-TTCGACCTTTGTCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACCCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCCGGTCGACGCTATTTCGGGCAAC-ATCTCATGAT-CTGACTTGCTACCAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya quadricincta CBS_135_52T' TACGTCTCGACCTCAACGCTCGGATGATGGAAGTTTAAGACCGGC--CGTCTCAGCAGGCTGTTCTCCA-TCGGTTCTGGTTTGCTGTCATGGGTATCAGCTGAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCAACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-ACCACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT-GGGTATAACAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGGGTGGATGAAACTCTCGACTCTACACTACTTC-GGCAACAATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya shendaweii IFM_57611T' TATGTCTCGACCTCAA---TTGGATGATGGAAGAATAGGATCTGT--CATCTCAGCAGGCTGTCTTCCA-TGGGTTCTAGTTCGCCGTCATGAGTATCAGCTAAT-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGAGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGGTGAAACTCTCGACTCT-AACTACGTT-GGCAAC-ATCTCACGAT-CTGACTCGCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya spathulata IFM_47038T' TATGTCTCGACCTCGATGCTTGGATGATGGAAGATTAGGACCAGT--CAGTTCGGCAGGCTGTCCTCCA-TCGGTTACGCTTCGCTGTCATGGGCATCAGCTAAC-AGGTTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCCATCCCAAACGAGACAGCGGGGAA-ACCCCGAA-AAGC-AAGCAGGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGCATGAAACTCTCGACTCTACAATACTTG-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTCCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTTCGTGCCGGT-CCCTTCGGCGA 'Neosartorya spinosa CBS_483_65T' TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCTTAGCAGGCTGTCCTCCA-TGGGTTCAGCTTCGCTGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-ATGC-AAGGAAGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGACACTCTCGACTCTACACTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya stramenia CBS_498_65T' TATGTCTCGACCTCAATGCTTTGATGATGGAAGATTAGAACCGGT--CATCTCAGCAGGCTGTCCTCCG-TGGGTTCTGG-TCGCCGTCATAGGTATCAGCTAAC-ATATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-CCCCGATTGAGAAAGCGGGGGGCAACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAGCTCTCGACCCT-AATTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCCCTTCGGCGA 'Neosartorya sublevispora IFM_53598T' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCAGT--CAGCTCAGCAGGCTATTCTCCA-TCGGTTTTTTGTCGCCGTCGTGTGTACTGGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCATTATCC-TCGCAATTGAGAAAGCGGGGGA-AACATGAAAAGGC-AAGCCTGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGAGACTCTCGACTCT--AATACTGC-GGCAAC-ATCTCACGAT-CTGACTCTCTATTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya takakii CBM_FAspergillus_884T' TATGTCTCGACCTCAATGCTTGGATGATGGGAGATTAGGACCTGT--CATCTTAGCAGGCTGTCCTCCA-TGGGTTTCGCTTCGCTGTCATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACCCGAA-ATGC-AAGGAAGAAGAGGACGCGTGTCTGAT-GGGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGACACTC--GACTCTACACTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya tatenoi CBM_FAspergillus_22T' TATGTCTCGACCTCAATGCTTGGATGATGGAAGATTAGGACCGGT--CATCTCAGCAGGCTGTCCTCCA-TGGGTTCTGG-TCGCCGTTATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTGATCT-TCCCAATTGAGAAAGCGGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTCTCGACTCTAAACTACTTC-GGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCTGGT-CCCTTCGGCGA 'Neosartorya tsunodae IFM_57609T' TATGTCTCAACCTCAATGCTTGGATGATGGAAGACTAGGACCTGT--CATCTCAGCAGGCTGTCCTCCA-TGGGTTCTGG-TCGCCGTCACGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGATCTTTATCC-TCCCAATTGAGAAAGCCGGGGA-AACACGAA-AGGC-AAGCAGGAAGAGGACGCGTGCCTGAC--GGGATAATAGCTACAATGGCACCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGAATGCAACTCT--------AGCTACTGC-CGCAAC-ATTTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya tsurutae CBM_FAspergillus_933T' TATGTCTT--CTACAACGCTCGGATGATGGAAGTTTAGGACGGGC--CATCTCAGCAGGCTGTTCTCCA-TCGGTTCTGGTTTGCTGTCATGGGTATCGGCTGAC-AACTTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCAACCT-TATCC-TCCCAATTGAGAAAGCGGGGGA-ACCACGAA-AGGC-AAGCAGGAAGAGGACGCGTGTCTGAT-GGGGTTAACAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGGGTGGATGAAACTCTCGACTCTACACTACTTC-GGCAACAATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCTGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya udagawae CBM_FAspergillus_702T' TATGCCTCGACCTCAATGCTTGAATGATGGGAGATTAGGACCTGT--CATCCTAGCAGGCTTTCCTCCA-TGGTTTCAGCGTCGCTTTGATGGGTATCAGCTAAC-AAATTTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACGCGAA-AGGC-AAGCAGGAAGAGGGCGCGTGTCTGAT-GAGGATAATAGCTACAATGGCTCCTCCGATCTCCAGCTGGAGCGTATGAACGTCTATTTCAACGAGGTGCGTGGATGAAACTC--GACTCTACACTACTTC-GGCAAC-ATATCACGAT-CTGACTCGCTACTAGGCCAACGGCGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA 'Neosartorya warcupii NRRL_35723T' TATGTCTCGACCTCAATGCTTGGATGATAGGAGAT-AGGACCAGT--CAGCTCAGCAGGCTCTCCTTCA-TGGGTTCTGG-TCGCCGTCATGGGTATCAGCTAAC-AAATCTACAGGCAGACCATCTCTGGTGAGCACGGCCTTGACGGCTCTGGCCAGTAAG-TTCGACCTTTATCC-TCCCAATTGAGAAAGCGGGGGA-AACACGA--AGAC-AAGCGGGAACAGGACGCGTGTCTGAT--GGGATAATAGCTACAATGGCTCCTCCGACCTCCAGCTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTGGATGAAACTCTCGACTCT-AACTACTAC-CGCAAC-ATCTCACGAT-CTGACTCGCTACTAGGCCAACGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGT-CCCTTCGGCGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42919] TITLE Aspergillus_acro_actin; LINK TAXA = Taxa3; DIMENSIONS NCHAR=419; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Aspergillus arucoverdensis IFM_59923' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACACCCCCC----CCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61334T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGTCAACCAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATGAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACCCCC-------CCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61337' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACACCCCCCCTTTCCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61338' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGTCAACCAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATGAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACCCCC-------CCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61339' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGTCAACCAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATGAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACCCCC-------CCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61340' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAATGACAACCCCCC------CCCTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61345' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACACCCCCCCTTTCCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-ACATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61346' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACACCCCCCCTTTCCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCAAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61349' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACACCCCCCCTTTCCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61362' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGTCAACCAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATGAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACCCCC-------CCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus arucoverdensis IFM_61905' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCTG-AGTCAACCCCTCCTACCATATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCACCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACGTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACACCCCCCCTTTCCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus clavatus CBS_514_65' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CAAAACCTTCCATCTTTATGAAGGGTATAAAAAAAAAA------AATCGACCCCTCCTGTCATATGTCATCCCGCT--TGGTGATGGTCAGGATAATCGTCACTTGTGG-ATGTGCCAATCGTTGCCCTTGCGT-CGGGTGGCTCACTCCTTG--TGGCG-GTTACCCCT-------TTATCATACGACAAAG--TCAATTATCTCGAATTGATCACTAACTTGCGAAAATAGCTTCCATTGTCGGTCGTCCCCGTCACCATGGGTAATT---AGTCCCCT------CCTTTTCT----CTGGTCTTATTTGGGCTAGGTAAAGAGAATGGTCACTGACCGCTGTTGCGCAG-TATCATGATTGGT 'Aspergillus felis CMF_ISB_2162_IFM_60852' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCCCCATAATGCT------------------------AGACA--TCG-AGTCAACCCCTCCTACCATGTGTCATCCCTTGAATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTGTTCCCTAC--TGGCG-GCTTCCTCTCCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACTTGCG-ACATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---AACCCCC-------TTTTTGCTAATTTTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAATGCAA-TATCATGATTGGT 'Aspergillus fumigatiaffinis IBT_12703T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGTT------------------------AAACA-TTTG-ATTCAACCCCTCCTACCACATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAACCGTTTCCCTTGCGT-CGGGTGGCTATTCCCCTA-CTGGCG-GTTTCCTCTCCCTGAATCATCGTGCGCGACAGC-TTAATTTGAACA-ATCAAACGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---AATTCCC-------CCTTTCCTAATTCTCAGCT--GTTGCGATAGCTCGAG-TCGTGGTCGCTGACGACTCCAACGCAG-TATCATGATTGGT 'Aspergillus fumigatus CBS_545_65' CGGTGATGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGTT------------------------AAACA-TCCG-AGTGAACCCCCTCTGCCCCATATCATCCCTTG-ATGTCACTGTGCAGA----TTGTCGCCAGGGGAATGTGTCAACCGTTGCCCTTGCGTCCGGTTGGATAATCCAATACCTGGCGTGTTTCCTCTCCCTGAATCATCATGCGCGACAGC-TTAATCTGGACA-ATGAAACGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGCCCCCGTCACCATGGGTAAAT---TTTCCCC-------CCTTTCCTCATCCTGAGCT--GTTACGCTAGCTCGAA-TCATGGTCGCTGACGATTCCAACACAGCTATCATGATTGGT 'Aspergillus fumisynnematus IFM_42277T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AAACA-TTTG-AGTCAACCCCTCCTACCACATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGG--ATGTGTCAACCGTTGCCCTTGCGT-CGGGTGGCTATTCCCCTA-CTGGCG-GTTTCCTCTCCCTGAATCATCGTGCGCGACAGC-TTAAATTGAACA-ATTAAACGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---AATTCCC-------CCTTTCCTAGTTCTGAGCT--GTTGCGCTAGCTCGAG-TCATGGTCGCTGACGATTCCAACGCAG-TATCATGATTGGT Aspergillus_lentulus_FH5T CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CGACCCCTCACCC-CATAATCCT------------------------AAACATTTTG-AGGGAACCCCTCCTACCACATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAACCGTTGCCCTTGCGT-CGGGTGGCTATTCCCCTA-CTGGCG-GTTTCCTCTCCCTGAATCATCGTGCGCGACAGCTTTAAGTTGAACA-ATTAAACGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---TATTCCC-------CCTTTCCTAATTCTCAGCT--GTTGCGCTAGCTCGAG-TCATGGTCGCTGACGATTCCAACGCAG-TATCATGATTGGT 'Aspergillus novofumigatus IBT_16806T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AAACA-TTCG-AGTCTACCCCTCCTACCACATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGAG-ATGTGTCAACCGTTGCCCTTGCGT-CGGGTGGCTATTCCCCTA-CTGGCG-GTTTCCTCTCCCTGAATCATCGTGCACGACAGC-TTAATTTGGACA-ATTAAACGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---AATTCCC-------CCTTTCCTAATTCTCGGCT--GTTGCGCTAGCTCGAG-TCATGGTCGCTGACGATTCCAACGCAG-TATCATGATTGGT 'Aspergillus siamensis KUFC_6349T' CGGTGACGACGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCCG-AGTCAACCCCTCCTATCATGTGCCATCCCTTG-ATGTCACTCTGCCCG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTGCCTAC--TGGCG-GTTTCCTCTCCCTGAATCATTGTGCGCGACAGC-TTAATTTGGATAAATTAACCGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---ACCCCCTTA-----CCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus viridinutans CBS_127_56T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCCG-AATCAACCCCTCCTACCATATGTCGTCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GTTTCCTCTCCCTGAATCATCGTGCGCGACAGC-TTAATTTG-ATAAATTAAATGCTAACTTACG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---GACCCC--------TCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTTGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Aspergillus wyomingensis CMF_ISB_2494T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGACA-TCCGATGTCAACCCCTCCTACCATGTGTCATCCCTTG-ATGTCACTCTGCGCG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--AGGCG-GTTTCCTCTTCCTGAATCATCGTGCGCGACAGC-TTGACTTGGATAAATTAAACGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---AACCCCCC------CTTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGCTTCCAACGCAG-TATCATGATTGGT 'Neosartorya aureola CBS_105_55T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATACTGCT------------------------AGATA-TCCG-AGTCAACCCCTCCTACCATGTGTCATCCCTTG-ATGTCACTCTGCAGG----TTGTCGCCAGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTATTCCCTAC--TGGCG-GCTTCCTCTCCCTGAATCATCTTGCGCGACAGC-TTAATTTGGATATATTAAATGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---AACCCC--------CCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATGGTCGCTGACGTTTCCAACGCAG-TATCATGATTGGT 'Neosartorya fischeri CBS_544_65T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAACGCT------------------------AAACA-TCTG-AGTCAACCTCTTCTACCCCATGTCATCCCTTG-ATGTCACTGTGCAGG----TTGTCGCCAGGGG-ATGTGTCAACCGTTGCCCTTGCGTCCGGCTGGCTATTCCGTAC-CTGACG-GTTTCCTCTTTTTGAATCATCGTGCGCGGCAGC-GTAATCTGGACA-ATTAAACGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---AATTCCC-------CCTTTCCTAATTCTGAGCT--GTTGCGCTAGCTCGAATTCATGGTCGCTGACGATTCCAACGCAG-TATCATGATTGGT 'Neosartorya udagawae CBM_FAspergillus_702T' CGGTGACGATGCTCCCCGTGCTGTCTTCCGTAAGT----CAACCCCTCACCC-CATAATGCT------------------------AGATA-TCCGAAGTCAACCCCTCCTACCATGTGTCATCCCTTG-ATGTCACTCTGCAGG----ATGTCGCCGGGGG-ATGTGTCAATTGTTGCCCTTGCGT-CGGGTGGCTACTCCCTAC--TGGCG-GCTTCCTCTCCCTGAATCATCTTGCGCGACAGC-TTAATTTGAGTAAATTAAATGCTAACTTGCG-AGATAGCCTCCATTGTCGGTCGTCCCCGTCACCATGGGTAAAT---AACCCC--------CCTTTTCTAATTCTGAGCT--GTTGCGCTAGCTCGAA-TCATTGTTGCTGACGTTTTCAACGCAG-TATCATGATTGGT ; END; BEGIN TREES; TITLE Aspergillus_acro_calmodulin; LINK TAXA = Taxa2; TRANSLATE 1 'Aspergillus clavatus CBS_514_65', 2 'Aspergillus fumigatus CBS_545_65', 3 'Aspergillus fumisynnematus IFM_42277T', 4 Aspergillus_lentulus_FH5T, 5 'Aspergillus siamensis KUFC_6349T', 6 'Aspergillus wyomingensis CMF_ISB_2494T', 7 'Neosartorya aureola CBS_105_55T', 8 'Neosartorya udagawae CBM_FAspergillus_702T', 9 'Aspergillus felis CMF_ISB_2162_IFM_60852', 10 'Aspergillus viridinutans CBS_127_56T', 11 'Aspergillus arucoverdensis IFM_59923', 12 'Aspergillus arucoverdensis IFM_61334T', 13 'Aspergillus arucoverdensis IFM_61339', 14 'Aspergillus arucoverdensis IFM_61340', 15 'Aspergillus arucoverdensis IFM_61349', 16 'Aspergillus arucoverdensis IFM_61345', 17 'Aspergillus arucoverdensis IFM_61337', 18 'Aspergillus arucoverdensis IFM_61338', 19 'Aspergillus arucoverdensis IFM_61346', 20 'Aspergillus arucoverdensis IFM_61362', 21 'Aspergillus arucoverdensis IFM_61905', 22 'Neosartorya fischeri CBS_544_65T', 23 'Aspergillus fumigatiaffinis IBT_12703T', 24 'Aspergillus novofumigatus IBT_16806T'; TREE PAUP_1 = [&R] (1:0.203088,(2:0.034571,(22:0.0164,(((3:0.031841,4:0.020444):0.021746,(23:0.012685,24:0.010435):0.004049):0.001528,((9:0.016984,(6:0.015109,(5:0.026586,(7:0.019053,8:0.014428):0.002665):0.002499):0.01024):0.00406,(10:0.010462,(11:0.004147,((14:0.0,(12:0.0,13:0.0):0.0):0.0,(15:0.0,(16:0.0,(17:0.0,(18:0.0,(19:0.0,(20:0.0,21:0.0):0.0):0.0):0.0):0.0):0.0):0.002047):0.004082):0.012543):0.0):0.020229):0.019914):0.020908):0.203088); END; BEGIN TREES; TITLE 'Aspergillus acro beta-tubulin'; LINK TAXA = Taxa1; TRANSLATE 1 'Aspergillus clavatus CBS_514_65', 2 'Aspergillus duricaulis CBS_481_65T', 3 'Neosartorya spathulata IFM_47038T', 4 'Neosartorya pseudofischeri CBS_208_92T', 5 'Aspergillus brevipes CBS_118_53T', 6 'Aspergillus caatingaensis IFM_61335T', 7 'Aspergillus pernambucoensis IFM_61342T', 8 'Aspergillus fumisynnematus IFM_42277T', 9 Aspergillus_lentulus_FH5T, 10 'Neosartorya denticulata CBS_652_73T', 11 'Neosartorya sublevispora IFM_53598T', 12 'Neosartorya fennelliae CBS_598_74T', 13 'Aspergillus huiyaniae IFM_57847T_A159', 14 'Neosartorya quadricincta CBS_135_52T', 15 'Neosartorya tsurutae CBM_FAspergillus_933T', 16 'Aspergillus fumigatus CBS_545_65', 17 'Aspergillus felis CMF_ISB_2162_IFM_60852', 18 'Neosartorya aurata CBS_466_65T', 19 'Neosartorya stramenia CBS_498_65T', 20 'Neosartorya aureola CBS_105_55T', 21 'Neosartorya udagawae CBM_FAspergillus_702T', 22 'Aspergillus fumigatiaffinis IBT_12703T', 23 'Aspergillus novofumigatus IBT_16806T', 24 'Neosartorya fischeri CBS_544_65T', 25 'Aspergillus wyomingensis CCF_4417T', 26 'Aspergillus viridinutans CBS_127_56T', 27 Aspergillus_arucoverdensis_61338, 28 Aspergillus_arucoverdensis_61339, 29 Aspergillus_arucoverdensis_61346, 30 Aspergillus_arucoverdensis_61340, 31 Aspergillus_arucoverdensis_61345, 32 Aspergillus_arucoverdensis_59923, 33 Aspergillus_arucoverdensis_61349, 34 Aspergillus_arucoverdensis_61334T, 35 Aspergillus_arucoverdensis_61337, 36 Aspergillus_arucoverdensis_61362, 37 Aspergillus_arucoverdensis_61905, 38 'Aspergillus siamensis KUFC_6349T', 39 'Neosartorya coreana KACC_41659T', 40 'Neosartorya takakii CBM_FAspergillus_884T', 41 'Neosartorya paulistensis CBM_FAspergillus_690T', 42 'Neosartorya spinosa CBS_483_65T', 43 'Aspergillus unilateralis CBS_126_56T', 44 'Neosartorya shendaweii IFM_57611T', 45 'Neosartorya hiratsukae IFM_47035T', 46 'Neosartorya australensis CBS_112_55T', 47 'Neosartorya multiplicata IFM_46955T', 48 'Neosartorya tsunodae IFM_57609T', 49 'Neosartorya glabra CBS_111_55T', 50 'Neosartorya galapagensis CBS_117522T', 51 'Neosartorya assulata KACC_41691T', 52 'Neosartorya tatenoi CBM_FAspergillus_22T', 53 'Neosartorya warcupii NRRL_35723T', 54 'Neosartorya papuensis CBS_841_96T', 55 'Aspergillus turcosus KACC_42091T', 56 'Neosartorya nishimurae CBS_116047', 57 'Aspergillus waksmanii NRRL_179T', 58 'Aspergillus marvanovae CCM_8003T'; TREE PAUP_1 = [&R] (1:0.168666,(4:0.0325,(((2:0.046443,5:0.030315):0.010365,(14:0.009154,15:0.018731):0.010637):0.015981,(3:0.058731,((52:0.009362,(((18:0.013956,19:0.002324):0.032233,(49:0.026417,((45:0.019147,46:0.020622):0.010059,(12:0.014061,(13:0.009564,(10:0.0,11:0.00685):0.018561):0.002721):0.029428):0.005001):0.00578):0.0,(44:0.031166,(50:0.026118,(((51:0.016391,55:0.01974):0.002342,(58:0.00642,(56:0.020918,57:0.005168):0.004562):0.007488):1.0501E-6,((47:0.006945,48:0.014599):0.019756,((6:0.027144,7:0.028272):0.017389,(43:0.028832,(53:0.018526,54:0.010308):0.004129):0.004029):0.003326):0.0):0.002479):0.00255):0.001782):0.002746):0.004842,(17:0.045089,((((8:0.026364,9:0.011382):0.021483,(16:0.045536,24:0.007005):0.01029):0.009269,((22:0.013916,23:0.016256):0.013909,(39:0.013756,(42:0.0,(40:0.004536,41:0.002267):0.002264):0.004514):0.002486):0.002148):0.004847,(((20:0.012492,21:0.016991):0.012482,(25:0.018663,38:0.013693):0.0):0.004551,(26:0.007942,(27:0.0,(28:0.0,(29:0.0,(30:0.0,(31:0.0,(32:0.0,(33:0.0,(34:0.0,(35:0.0,(36:0.0,37:0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.0):0.01095):0.006588):0.0):0.0):0.01142):0.0):0.004037):0.010957):0.168666); END; BEGIN TREES; TITLE Aspergillus_acro_actin; LINK TAXA = Taxa3; TRANSLATE 1 'Aspergillus clavatus CBS_514_65', 2 'Aspergillus fumigatus CBS_545_65', 3 'Neosartorya fischeri CBS_544_65T', 4 'Aspergillus fumigatiaffinis IBT_12703T', 5 'Aspergillus novofumigatus IBT_16806T', 6 Aspergillus_lentulus_FH5T, 7 'Aspergillus fumisynnematus IFM_42277T', 8 'Aspergillus wyomingensis CMF_ISB_2494T', 9 'Aspergillus siamensis KUFC_6349T', 10 'Aspergillus felis CMF_ISB_2162_IFM_60852', 11 'Aspergillus viridinutans CBS_127_56T', 12 'Aspergillus arucoverdensis IFM_61362', 13 'Aspergillus arucoverdensis IFM_61339', 14 'Aspergillus arucoverdensis IFM_61334T', 15 'Aspergillus arucoverdensis IFM_61338', 16 'Aspergillus arucoverdensis IFM_61340', 17 'Aspergillus arucoverdensis IFM_61346', 18 'Aspergillus arucoverdensis IFM_61345', 19 'Aspergillus arucoverdensis IFM_59923', 20 'Aspergillus arucoverdensis IFM_61337', 21 'Aspergillus arucoverdensis IFM_61349', 22 'Aspergillus arucoverdensis IFM_61905', 23 'Neosartorya aureola CBS_105_55T', 24 'Neosartorya udagawae CBM_FAspergillus_702T'; TREE PAUP_1 = [&R] (1:0.155263,(((2:0.068093,3:0.036255):0.01249,(5:0.012122,(7:0.008399,(4:0.020162,6:0.017287):0.0):0.005029):0.012815):0.003162,((10:0.02874,((8:0.022553,9:0.030569):0.006727,(23:0.005775,24:0.023019):0.008171):0.003026):0.003259,(11:0.017195,(16:0.0028,((15:0.0,(14:0.0,(12:0.0,13:0.0):0.0):0.0):0.00281,(18:0.002748,(17:0.002747,(20:0.0,(21:0.0,(19:0.0,22:0.0):0.0):0.0):0.0):0.0):0.002951):0.002929):0.008903):0.0):0.031213):0.155263); END;