#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:35 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., & Takamatsu S. 2015. Erysiphe viburni-plicati and Podosphaera photiniae, two new species of Erysiphales (Ascomycota) from Japan. Mycoscience, 56(1): 14-23. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14941] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=71; TAXLABELS Cystotheca_wrightii_ex_Quercus_AB000932 Fibroidium_sp._ex_Diostea_AB525944 Oidium_maculatae_ex_Viola_AB525947 Podosphaera_aphanis_ex_Agrimonia_AB026141 Podosphaera_aphanis_ex_Fragaria_AB026136 Podosphaera_aphanis_ex_Fragaria_AF073355 Podosphaera_astericola_ex_Aster_AB040353 Podosphaera_balsaminae_ex_Impatiens_AB462802 Podosphaera_balsaminae_ex_Impatiens_AB462805 Podosphaera_cacalia_ex_Cacalia_AB040314 Podosphaera_caricae_papayae_ex_Carica_AB525918 Podosphaera_cercidiphylli_ex_Cercidiphyllum_AB026140 Podosphaera_clandestina_ex_Crataegus_AB525931 Podosphaera_clandestina_ex_Prunus_AF011316 Podosphaera_clandestina_ex_Prunus_AF011317 Podosphaera_clandestina_ex_Spiraea_AB026137 Podosphaera_clandestina_ex_Spiraea_AB026150 Podosphaera_clandestina_ex_Spiraea_AB525941 Podosphaera_curvispora_ex_Aria_AB525928 Podosphaera_elsholtziae_ex_Ajuga_AB026142 Podosphaera_epilobii_ex_Epilobium_AB525926 Podosphaera_erigerontis_canadensis_ex_Conyza_AB040313 Podosphaera_erigerontis_canadensis_ex_Leontodon_AB040331 Podosphaera_erigerontis_canadensis_ex_MatricariaAB046988 Podosphaera_erigerontis_canadensis_ex_MelampyrumAB040332 Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB026148 Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB040342 Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB046987 Podosphaera_ferruginea_ex_Aruncus_AB026152 Podosphaera_ferruginea_ex_Sanguisorba_AB027232 Podosphaera_fugax_ex_Geranium_AB026134 Podosphaera_fuliginea_ex_Veronica_AB046986 Podosphaera_gunnerae_ex_Gunnera_AB525923 Podosphaera_gunnerae_ex_Gunnera_AB525924 Podosphaera_hibiscicola_ex_Hibiscus_AB040308 Podosphaera_intermedia_ex_Clerodendrum_AB026145 Podosphaera_japonica_ex_Stephanandra_AB525943 Podosphaera_leucotricha_ex_Malus_AB027231 Podosphaera_leucotricha_ex_Malus_AF073353 Podosphaera_lini_ex_Linum_AB525925 Podosphaera_longiseta_ex_Prunus_AB000945 Podosphaera_macularis_ex_Humulus_AB525917 Podosphaera_negeri_ex_Escallonia_AB525919 Podosphaera_negeri_ex_Escallonia_AB925920 Podosphaera_pannosa_ex_Rosa_AB022348 Podosphaera_pannosa_ex_Rosa_AF011322 Podosphaera_salatani_ex_Cerasus_AB525929 Podosphaera_sibirica_ex_Veronicastrum_AB026144 Podosphaera_sp._ex_Photinia_AB525934 Podosphaera_sp._ex_Prunus_AB026147 Podosphaera_sp._ex_Pyracantha_AB525936 Podosphaera_sp._ex_Stachyurus_AB525942 Podosphaera_spiraeae_ex_Filipendula_AB022385 Podosphaera_spiraeae_ex_Spiraea_AB026143 Podosphaera_spiraeae_ex_Spiraea_AB026149 Podosphaera_spiraeae_ex_Spiraea_AF154325 Podosphaera_tridactyla_ex_Prunus_AB000943 Podosphaera_tridactyla_ex_Prunus_AF011318 Podosphaera_tridactyla_ex_Prunus_AY833652 Podosphaera_tridactyla_ex_Prunus_AY833654 Podosphaera_tridactyla_ex_Prunus_AY833656 Podosphaera_tridactyla_ex_Prunus_AY833658 Podosphaera_tridactyla_ex_Prunus_AY833659 Podosphaera_tridactyla_ex_PrunusAY833651 Podosphaera_xanthii_ex_Arctium_AB040310 Podosphaera_xanthii_ex_Cosmos_AB040300 Podosphaera_xanthii_ex_Cucumis_AB040324 Podosphaera_xanthii_ex_Helianthus_AB040311 Podosphaera_xanthii_ex_Physalis_AB040336 Podosphaera_xanthii_ex_Rudbeckia_AB040296 Pourthiae_vollisa_AB026138 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=80; TAXLABELS Arthrocladiella_mougeotii_ex_Lycium_AB022379 Arthrocladiella_mougeotii_ex_Lycium_AB329690 Blumeria_graminis_ex_Bromus_AB022362 Blumeria_graminis_ex_Hordeum_AB022399 Blumeria_graminis_ex_Triticum_AB022376 Byssoascus_striatisporus_U17912 Caespitotheca_forestalis_ex_Schinopsis_AB193467 Cystotheca_lanestris_ex_Quercus_AB022353 Cystotheca_wrightii_ex_Quercus_AB022355 Erysiphe_abbreviata_ex_Quercus_AB271785 Erysiphe_adunca_ex_Salix_AB022374 Erysiphe_alphitoides_ex_Quercus_AB257431 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 Erysiphe_arcuata_ex_Carpinus_AB252473 Erysiphe_australiana_ex_Lagerstroemia_AB022407 Erysiphe_corylopsidis_ex_corylopsis_AB478987 Erysiphe_epigena_ex_Quercus_AB292722 Erysiphe_friesii_ex_Rhamnus_AB022382 Erysiphe_glycines_ex_Desmodium_AB022397 Erysiphe_gracilis_ex_Quercus_AB022357 Erysiphe_heraclei_ex_Daucus_AB022391 Erysiphe_hypogena_ex_Quercus_AB292727 Erysiphe_hypophylla_ex_Quercus_AB292716 Erysiphe_japonica_ex_Quercus_AB022415 Erysiphe_ligustri_ex_Ligustrum_AB015917 Erysiphe_miranda_ex_Viburnum_sargentii_MUMH2561 Erysiphe_monascogera_ex_Styrax_AB331645 Erysiphe_mori_ex_Morus_AB022418 Erysiphe_nomurae_ex_Symplocos_AB331648 Erysiphe_paeoniae_ex_Paeonia_AB257438 Erysiphe_pisi_ex_Medicago_AB102942 Erysiphe_pulchra_ex_Benthamidia_AB015935 Erysiphe_pulchra_ex_Swida_AB022389 Erysiphe_quercicola_ex_Quercus_AB292694 Erysiphe_simulans_ex_Rosa_AB022395 Erysiphe_sp._ex_Viburnum_plicatum_MUMH249 Erysiphe_sp._ex_Viburnum_plicatum_MUMH794 Erysiphe_staphyleae_ex_Staphylea_AB015922 Erysiphe_syringae_ex_Syringa_AB015920 Erysiphe_trina_ex_Quercus_AB022350 Erysiphe_vanbruntina_ex_Sambucus_AB015925 Erysiphe_wallrothii_ex_Vaccinium_AB015930 Golovinomyces_adenophorae_ex_Adenophora_AB077632 Golovinomyces_cichoracearum_ex_Solidago_AB077650 Golovinomyces_orontii_ex_Nicotiana_AB022412 Golovinomyces_orontii_ex_Physalis_AB077646 Golovinomyces_sordidus_ex_Plantago_AB077657 Leveillula_duriaei_ex_Salvia_AB080475 Leveillula_lanuginosa_ex_Daucus_AB042641 Leveillula_saxaouli_ex_Haloxylon_AB080469 Leveillula_taurica_ex_Artemisia_AB080470 Leveillula_taurica_ex_Helianthus_AB080472 Neoerysiphe_cumminsiana_ex_Cacalia_AB329669 Neoerysiphe_galeopsidis_ex_Acanthus_AB329670 Neoerysiphe_galeopsidis_ex_Lamium_AB329674 Neoerysiphe_galii_ex_Galium_AB329681 Neoerysiphe_galii_ex_Galium_AB329682 Oidium_phyllanthi_ex_Phyllanthus_AB120754 Oidium_phyllanthi_ex_Phyllanthus_AB120755 Oidium_phyllanthi_ex_Phyllanthus_AB120758 Parauncinula_septata_ex_Quercus_AB022420 Parauncinula_septata_ex_Quercus_AB183533 Phyllactinia_ailanthi_ex_Ailanthus_AB080380 Phyllactinia_angulata_ex_Quercus_AB080464 Phyllactinia_carpinicola_ex_Carpinus_AB080420 Phyllactinia_fraxini_ex_Fraxinus_AB080451 Phyllactinia_guttata_ex_Morus_AB080372 Phyllactinia_hemipteleae_ex_Hemiptelea_AB080430 Phyllactinia_linderae_ex_Litsea_AB080421 Phyllactinia_moricola_ex_Morus_AB022401 Pleochaeta_shiraiana_ex_Celtis_AB022403 Podosphaera_filipendulae_ex_Filipendula_AB022384 Podosphaera_longiseta_ex_Prunus_AB022423 Podosphaera_pannosa_ex_Rosa_AB022347 Podosphaera_tridactyla_ex_Prunus_AB022393 Podosphaera_xanthii_ex_Melothria_AB022410 Sawadaea_polyfida_ex_Acer_AB022364 Sawadaea_tulasnei_ex_Acer_AB022366 Setoidium_castanopsidis_ex_Castanopsis_MUMH5123 Setoidium_castanopsidis_ex_Castanopsis_MUMH5147 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=50; TAXLABELS Erysiphe_abbreviata_AB271785 Erysiphe_alphitoides_AB237783 Erysiphe_aquilegiae_AB015929 Erysiphe_baeumleri_AB015919 Erysiphe_betae_AF011290 Erysiphe_blasti_AB015918 Erysiphe_castaneigena_AF298545 Erysiphe_convolvuli_AF154327 Erysiphe_cruciferarum_AF031283 Erysiphe_deutziae_DQ861917 Erysiphe_deutziae_DQ861918 Erysiphe_diffusa_AB078800 Erysiphe_epigena_AB292720 Erysiphe_friesii_AB000939 Erysiphe_glycines_AB015927 Erysiphe_glycines_AB015934 Erysiphe_hedwigii_AF298539 Erysiphe_helwingiae_AB015916 Erysiphe_heraclei_AB000942 Erysiphe_howeana_AF011301 Erysiphe_huayinensis_AB015914 Erysiphe_hypogena_AB292724 Erysiphe_hypophylla_AB292715 Erysiphe_juglandis_AB015928 Erysiphe_lespedezae_AB015923 Erysiphe_ligustri_AB015917 Erysiphe_liriodendri_AF011302 Erysiphe_macleayae_AB016048 Erysiphe_magnifica_AF011312 Erysiphe_miranda_MUMH2561 Erysiphe_monascogera_AB331646 Erysiphe_paeoniae_AB257438 Erysiphe_pisi_AF073348 Erysiphe_polygoni_AF011307 Erysiphe_polygoni_AF011308 Erysiphe_pseudolonicerae_AB015915 Erysiphe_pulchra__AB015935 Erysiphe_pulchra_AB000941 Erysiphe_pulchra_AB015924 Erysiphe_quercicola_AB292691 Erysiphe_quercicola_AB292694 Erysiphe_staphyleae_AB015922 Erysiphe_syringae_AB015920 Erysiphe_trifolii_AB015913 Erysiphe_vanbruntiana_AB015925 Erysiphe_viburni_AF298541 Erysiphe_viburni_ex_Viburnum_plicatum_MUMH786 Erysiphe_weigelae_AB015931 Erysiphe_weigelae_AB015932 Viburnum_plicatum_MUMH794 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M19355] TITLE Erysiphales_Kenashi_ITS; LINK TAXA = Taxa3; DIMENSIONS NCHAR=605; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_abbreviata_AB271785 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGCT--GCTGT-GCGCAAGG--ACATGC---GGTGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-ATTTTTTGTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTGGT--GTCGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGTCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAG-AACCCACGTT-----GTTCCAGTCA-CATGGAA-TCAAAGG Erysiphe_alphitoides_AB237783 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAC-AACCCACTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_aquilegiae_AB015929 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAAGACCT-AACCAAAA----CTCATGTT-GTCTTT-GTCGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_baeumleri_AB015919 CAGAGTGCGAGGCTCAGT-CGC-GGCGTCT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-TCGCAAGG--ACCTGC---GTCGGCC-GCCC--ACCGGTC--TTGAACTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTCTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTACTTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_betae_AF011290 ---------AGGCTCAGT-CGT-GGCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGTCGTC--GCTGT-CCGCCTGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAAA---CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAAA--TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAAT-GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTATTG-----GGTCCAGTCA-CATGGA--TCACATG Erysiphe_blasti_AB015918 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCT-GCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GTGGAC--GCTGC-CCGTAAGG--ATATGC---GTCGGCT-GCCC--ACCGGTT--TCGG-CTGGAGCGCGTCCGCCAAAGACCC-AATCAAAAA---CTCATGTT-GTCTTT-GCAGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGCA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-AGTGGCCTGCCAAAACCCCGTTT---------GTTCCAGTCA-TATGGA--TCACAGG Erysiphe_castaneigena_AF298545 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCATCGTC--GCTGC-CCGCAAGG--ACCAGC---GTCGGCC-GCCC--ACCGGTC--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAAGAACCCACTT------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_convolvuli_AF154327 CAGAGTGCGAGGCTCCGT-CGT-GGCATCA-GCTGCGTACTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGCCGTTGTCGTC--GCTGC-CCGCATGG--GCATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGTGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCGCT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCTCTTTTG-----GTTCCAGTCA-CATGGA--TCATAGG Erysiphe_cruciferarum_AF031283 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCGCATGGG-ACATGC---GTCGGCC-GCCC--ACCGGTTTCACGA-CTGGAGCAGGTCCGCCAAAGACCC-AACCAAAAA---CTCATGTT-GTCTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGGATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAAACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCTTTA-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_deutziae_DQ861917 CAGAGCGCGAGGCCCACA-CGT-GGCATGT-GCTGCGTGCGGGGCCGACCCTCCCACCCGTGTCGA-TTTGTCTCTTGTTGCTTTGGCGGGCCAGGCTGC-GTCGTC--GCTGC-CCGTACGG--ACACGC---GTCGGCC-GCCT--GCCGGCC--CAGG-CTGGAGCGCGTCCGCCAAAGACCCAAACCCAAAA---CTCATGTT-GTCATTTGCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATCA-CA-CCCCCCTCCAGCTACCTTTGTGTGTGGCTGCGGTGTTGGGGCCCGTCGCGGT--GCGGCGGCCCTGAAAGCTAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTACTTT-GCTTCTCGCGACAGAGTGATGTC-GGTGGCTTGCCAAAAGCCCGATT---------GATCCAGGTAGCACTGGGTCCTCAGG Erysiphe_deutziae_DQ861918 CAGAGCGCGAGGCCCACA-CGT-GGCATGT-GCTGCGTGCGGGGCCGACCCTCCCACCCGTGTCGA-TTTGTCTCTTGTTGCTTTGGCGGGCCAGGCTGC-GTCGTC--GCTGC-CCGTACGG--ACACGC---GTCGGCC-GCCT--GCCGGCC--CAGG-CTGGAGCGCGTCCGCCAAAGACCCAAACCCAAAA---CTCATGTT-GTCATTTGCAGTCT-AAG-CTTTATTA---TTGAATTGATAAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATCA-CA-CCCCCCTCCAGCTACCTTTGTGTGTGGCTGCGGTGTTGGGGCCCGTCGCGGT--GCGGCGGCCCTGAAAGCTAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTACTTT-GCTTCTCGCGACAGAGTGATGTC-GGTGGCTTGCCAAAAGCCCGATT---------GATCCAGGTAGCACTGGGTCCTCAGG Erysiphe_diffusa_AB078800 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCTGTT--GCAGT-CCGCATGG--ACATGC---GTCGGCC-GCCCC-CCCGGTG--TTCCACTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTGT-ATCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCATTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTTCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_epigena_AB292720 CAGAGTGTGAGGCACAGT-CGT-GGCATCT-GCTGCGTACTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGTT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAC-AACCCACTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_friesii_AB000939 CCGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-CCGCATGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAAA---CTCATGTT-GTTTGT-GTCGTCT-TAG-TTTGATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAC--GCGGCGGCCCTTAAAGACAGTGCCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCTTTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_glycines_AB015927 CAGAGCGTGAGGCTCAGT-CGCTGGCATCT-GCCACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTTATAGATTGTTGCTTTGGCGGGCCGGGAC-C-GTCCAC--GTCGT-TCACAGTG--ACGCGT---GCGAGCT-GCCC--ACCGGCT--TTGG-CTGGAGCGTGTCCGCCAAAGACCC-AACCCAAAACT-CTTATATTTGTCATG-GTAGTCT-AAG-TAAAAGTA----TATAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCGAGCTACCGTTGT--GTGGCTGTGGTGTTGGGGCTCGCCGCGTCTCGCGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GATTCTCGCGACAGAGTGACGAC-GATGATCAGCCAAAAAACCCCCTTTTAA--CCAAGTCCGGTCATACGGATTTTACAGG Erysiphe_glycines_AB015934 CAGAGCGTGAGGCTCAGT-CGC-GGCGTCT-GCCATGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTATTGATTGTTGCTTTGGCGGGCCGGGAC-C-GTCCAC--GTCGC-TCGCAGTG--ACGTGT---GCGAACT-GCCC--ACCGGCT--TTGG-CTGGAGCGTGCCCGCCAAAGACCC-ATCCCCAAA---CTCATATT-GTCCT--GCAGTCT-AAG-TGATATTA----TATAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCGAGCTACAATTGT--GTGGCTGTGGTGTTGGGGCTCGCCGCGCCTCGCGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTACTTTTGATTCTCGCGACAGAGTGACGAC-GAAGATCAGCCAAAACCCCCCAACCTTTAATCAAGTCCGGTAAATACGGATTTACAGG Erysiphe_hedwigii_AF298539 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCCGCGCGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGT-GTCGAC--GCTGC-CCGCAAGG--ACATGC---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCTTAAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCA-TCCAGCTACCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTCGGCCTGCCAGAAAGCTCATTT--------GTTCCAGTCA-CATGGA--TCATAGG Erysiphe_helwingiae_AB015916 CAGAGCGTGAGGCTCAGT-CGC-GGCATCT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGT-GTCGATGTGCTGG-CCGCGAGG--ACATGC---ATCGGCC-GCCC--ACCGGCC--TCGG-CTGGAGCGCGCCCGCCAGAGATCT-AACCAAAA----CTCATGTT-GTCTTTTGCAGTCT-AAG-CTTAATTT---ATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCCGTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAAACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGAA-TCACAGG Erysiphe_heraclei_AB000942 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGCGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGTCGTC--GCTGT-CCGCCTGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAAAA--CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTATTG-----GGTCCAGTCA-CATGGA--TCACAGG Erysiphe_howeana_AF011301 -AGA-TGCGAGGCTCAGT-CGT-GGCATCT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGCTGTC--GCTGT-CCGCATGG--ACATGC---GTTGGCC-GCCC--ACCGGTT--TTCAACTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGATAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAA-CCTCATTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_huayinensis_AB015914 CAGAGCGCGAGGCTCAGT-CGT-AGCATGT-GCTGCGCGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGC-GTCGAC--CCTGC-CCGTACGG--ACAAGC---GTCGGCCCGCCC--ACTGTCTATTCGG-CTGGAGCGCGTTCGCCAAAGACCC-AACCACAAA---CTCATGTT-GTCTTTTGTCGTCT-AAG-GTATATATCTAATTGAATTGACAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAAACA-CCCCCCTCGAGCTACCTTTGTTGGTGGCTGTGGTGTTGGGGCACGTCGCGGA--GCGGCGGCCCTTAAAGACAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCT-GGTGGCTTGCCAACAATAACCCGCTC------GTTCCAGTCA-CATGGGA-TCACAGG Erysiphe_hypogena_AB292724 CAGAGTGTGAGGCCCAGT-CGT-GGCATCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-ATTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAC-AACCCACTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_hypophylla_AB292715 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ATATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GTTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAATAAACCCACTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_juglandis_AB015928 CAGAGCGTGAGGTTCAGT-CGT-GGCATCT-GCCGTGTCCTGAGCCGACCCTCCCACCCGTGTCGACTTTATATCATGTTGCTTTGGCGGGCCGGGTTAT-GTCCAG--GTCGC-CCGTAAGG--GTGCGT---ATGGGCA-GCCC--ACCGGCT--TCGG-CTGGAGCGTGTCCGCCAGAGACCT-ATCCAAA-----CTCATGTT-GTCTTT-GCAGTCT-AAG-GTTTATTA----TGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCGAGCCATC-TAGT--GTGGTTACGGTGTTGGGGCTCGTCGGGTTT-CCGGCGGCCCTTAAAGACAGTGGCGGTCCTGACGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAGAAGCCTTTTT--------G-TCCAGTCT-TCTGGA--TCATAGG Erysiphe_lespedezae_AB015923 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCCGTC--GCTGT-CCGCACGG--ATATGC---ATCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAAGACCC-CATCAAAA----CTCAAGTT-GTTTTT-GTCGTCT-TAG-CATTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACGTTT-----GTCCCAGTCA-CATGGGATTCATAGG Erysiphe_ligustri_AB015917 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGTTGC-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGCCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAAGACCC-AACCAAAAA---CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGTGGTCCCGACGTGGACTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCTTTT---------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_liriodendri_AF011302 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TGTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGCC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT-TTCGG-CTGGAGCGTGCCCGCCAAAGACCCCAATCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTACCTTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCGAACTTT-----GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_macleayae_AB016048 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAAGACCT-AACCAAAA----CGCATGTT-GTCTTT-GTCGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_magnifica_AF011312 ------------------------CCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTCGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAACGCGTCCGCCAAAGACCT-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGCGGCTTGCCAGAACAATCTACTTT------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_miranda_MUMH2561 CAGAGCGTGAGGCTCAGT-CGT-GGCAACT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGC-GTCGTC--GCTGT-TCGCAAGG--ACGGTGC--ATCGGCC-ACCC--ACCGGCT--TCGG-CTGGAGCGTGTCCGCCAAAGACCT-AACCAAAAA---CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCCATT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_monascogera_AB331646 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGGGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATC{AG}AATCTTT{AG}AACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAAC-AACCCACTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_paeoniae_AB257438 CAGAGCGTGAGGTCCAGT-CGT-GGCGTCT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TATGTATCTTGTTGCTTTGGCGGGCCGGGCTGT-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGTCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGTCCGCCAAAGACCT-AATCAAAA----CTCATGTT-GTCTAT-GTAGTCT-CAG-CTTTATTA----TTAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCAGT--GCGGCGGCTCTTAAAAATAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAACCTCTATTT--------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_pisi_AF073348 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCTGTC--GCTGT-CCGCATGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TTCAACTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCATCT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_polygoni_AF011307 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTACCGTCGTC--GCTGT-CCGCAGGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAATGACGCCTGGTGGCTTGCCAGAACAACCCCTATTG-----GGTCCAGTCA-CATGGA--TCACAGG Erysiphe_polygoni_AF011308 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTACCGTCGTC--GCTGT-CCGCAGGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCGCGCCAAAGACCC-AACCAAAA----CTCATGTA-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAC--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCAATTG-----GGTCCAGTCA-CATGGA--TCACAGG Erysiphe_pseudolonicerae_AB015915 CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCATGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAC-AACCCACTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_pulchra__AB015935 CAGAGCGTGAGGTTCAGT-CGT-GGCATCTTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGC-TCCATC--GCTGC-CCGCAAGG--ACATGC---G{GT}TGAGC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAGAGACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCTC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCTTTTT--------GTTCCAGTCA-CATGGA--TCATAGG Erysiphe_pulchra_AB000941 CAGAGCGTGAGGCTCAGT-CGT-GGCATTT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGCTGC-GCCGAC--GCTGT-CCGCAAGGAAAGATGC---GTCGGTC-GCCCCCGCCGGCT--TCGG-CTGGAGCGCGTCCGCCAAAGACCC-AACCAAAAAAAACTCATGTT-ATCATT-GCAGTCT-AAGTCTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCCAGCTGCCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGACGGCCCTGAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_pulchra_AB015924 CAGAGCGTGAGGCTCAGT-CGT-GGCATTT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGCTGC-GCCGAC--GCTGT-CCGCAAGGAAAGATGC---GTCGGTC-GCCCCCGCCGGCT--TCGG-CTGGAGCGCGTCCGCCAAAGACCC-AACCAAAAAAAACTCATGTT-ATCATT-GCAGTCT-AAGTCTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCCAGCTGCCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGACGGCCCTGAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_quercicola_AB292691 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAAC-AACCCACTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_quercicola_AB292694 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAGACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAAC-AACCCACTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_staphyleae_AB015922 CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GTCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGC-GTCGTC--GCGAT-CCGCAAGG--ACTGGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAAGACCT-AACCAAAA----CTCATGTT-GTCTAT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCTATT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_syringae_AB015920 CAGAGTGCGAGGCTCAGT-CGT-AGCATCT-GCTGCGTGCTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCACACGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAAGACCC-AACCAAAA----CTCATGTT-TTTTTTCGTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-GGCGGCTTGCCAGAACAACCCACTTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_trifolii_AB015913 CAGAGTGCGAGGCTCAGT-CGC-GGCGTCG-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-TCGCAAGG--ACGTGC---GTCGGCC-GCCC--ACCGGTT--TAGAACTGGAGCGCGCCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_vanbruntiana_AB015925 CAGAGCGTGAGGCTCAGC-CAC-GACATCT-GCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGC-GTCGAT--GCTGG-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAGAGACCG-AACCAAAA----CTCATGTT-ATCTTG-GCAGTCT-AAG-CTTTATTT---ATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CACCCCCCCTCCAGCTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-GGCGGCTTGCCAAAAGCCCATTT---------GTTCCAGTCA-TATGGAT-CCACAGG Erysiphe_viburni_AF298541 CAGAGCGTGAGGCTCAGT-TGT-GGCATCT-GCCGCGCGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGT-GTCGAC--GCTGC-CCGCAAGG--ACATGC---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCTTAAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCA-TCCAGCTACCTTTGC--GTGGCTGCGGT?TTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTCGGCCTGCCAGAAAGCTCATTT--------GTTCCAGTCA-CATGGA--TCATAGG Erysiphe_viburni_ex_Viburnum_plicatum_MUMH786 -------------------------------------------------------------GTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGT-GTCGAC--GCTGC-CCGCAAGG--ACATGC---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAAGACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCTTAAG-CTTTATTA----TTGAATTGACAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCA-TCCAGCTGCCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTCGGCCTGCCAGAAAGCTCATTT--------GTTCCAGTCA-CATGGA--CCATAGG Erysiphe_weigelae_AB015931 CAGAGTGTGAGGCTCAGGGCGT-AGCATCT-GCTGCGTGCTGGGCCAATCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GCCGTC--GCTGG-CCGCAAGG--ACATGC---GTAGGCTGCCGCCCACTGGCT--TCGG-CTGGAGCGCGCCCGCCAAAGACCT-AACCAAAA----CTCATGTT-GTCTTT-GTAGTCT-CAG-TTATATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCTTTGA--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCTCTAAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAAAGCCTATTT-------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_weigelae_AB015932 CAGAGCGTGAGGCTCAGGGCGT-AGCATCT-GCTGCGTGCTGGGCCAATCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GCCGTC--GCTGG-CCGCAAGG--ACATGCGTAGGCTGCC-GCCC--ACTGGCT--TCGG-CTGGAGCGCGCCCGCCAAAGACCT-AACCAAAA----CTCATGTT-GTCTTT-GTAGTCT-CAG-TTATATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTAC-TTTGA--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCTCTAAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAA-GCCTATTT-------GTTCCAGTCA-CATGGA--TCACAGG Viburnum_plicatum_MUMH794 CAGAGCGTGAGGCTCAGT-CGG-GGCACCT-GCCGCGCGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGT-GTCGTC--GCTGT-CCGCCAGG--AGTAGC---GTCGGCC-GCCC--GCCGGCT--TCGG-CTGGAGCGCGTCCGCCAAAGACCC-AACCAAAAAA--CTCATGTT-GTCATT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAAGGT-GGCCTGCCAGAAGCCCATCG---------GGTCCAGTCA-CATGGA--TCACAGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Erysiphales_Kenashi_ITS) = N: 1-605; CODONPOSSET CodonPositions (CHARACTERS = Erysiphales_Kenashi_ITS) = N: 1-605; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M19354] TITLE Erysiphales_Kenashi_28S; LINK TAXA = Taxa2; DIMENSIONS NCHAR=815; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrocladiella_mougeotii_ex_Lycium_AB022379 AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGG-CCTACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTGTTATAGCCTAGGGTGCAATGCAGCCTA-CCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTACGTGAGAACCCG------TAAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACCAGCAT--- Arthrocladiella_mougeotii_ex_Lycium_AB329690 AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGG-CCTACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTGTTATAGCCTAGGGTGCAATGCAGCCTA-CCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TAAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Blumeria_graminis_ex_Bromus_AB022362 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGATCCATT--AGGAGCCCGAGTTGTAATTTGTAGAAGATGCTTT-GGCGACGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACCTGTGGAATGTAGCTCCTTTC----GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAA-CCCGGACTGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCA------TAAGGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Blumeria_graminis_ex_Hordeum_AB022399 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACC-CAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGGTT--ACGGGCCCGAGTTGTAATTTGTAGAAGATGCTTT-GGTAGTGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGAGTACTCAGTGC--CATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAA-CCCGGACTGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC----------------------------------------------------------------------------------------------------------------------------------------------- Blumeria_graminis_ex_Triticum_AB022376 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGTTT--ACGGGCCCGAGTTGTAATTTGTAGAAGATGCTTT-GGTGGCGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAA-CCCGGACTGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCA------TAAGGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Byssoascus_striatisporus_U17912 ----------------------------------------------------------AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCC-TT--TGGGGTCCGAGTTGTAATTTGGAGAAGATGCTTCGGGT-ACGGTCCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGGTG-GCCGTGCC--CGTGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCCATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGTCGATCATCCTGGG-TTCG-CCCGGGTG-CACTCGGCCGCGCTCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTCGGGAACGTGGCTCCCCTC----GGGGAGTGTTATAGCCCGAGGTGCAATGCAGCCTA-CCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------ Caespitotheca_forestalis_ex_Schinopsis_AB193467 TTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCTGTCG--TCAGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GCGGGCCCGGCCTAAGTTCCTTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CTCGTGCC--CGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTACCGATCACCCAGAG-TTCTGCTCTGGTG-CACTCGGTAGCGTACAGGCCAGCATCGGTTCGGGCGGTCGGACAAGGGCCGTAGGAATGTATCTCTCCCTCACGGAAGAGTATTATAGCCTACGGCGCCATACGGCCTG-CCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTGAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCCGTCA--AACGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCATAGC Cystotheca_lanestris_ex_Quercus_AB022353 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--TGGAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-ATGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTTGTC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCTGGGG-TTCT-CCCCGGGG-TACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTCG--GGGCAGTGTTATAGCCTCTCGCGTCATGCAGCCTA-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCG------TTAGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Cystotheca_wrightii_ex_Quercus_AB022355 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CT--CGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCGGGG-TTCT-CCCCGGGG-CACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTCG--GGGCAGTGTTATAGCCCCTCGCGTCATGCAGCCTA-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCG------TTAGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_abbreviata_ex_Quercus_AB271785 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACCCGGAG-TTCT-CTCAGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------- Erysiphe_adunca_ex_Salix_AB022374 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCACC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACACCACTGATCCGCGAGGG-TTCT-CTCTCGGG-CACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTTCGGTGCAATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTA-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCC-----TCGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_alphitoides_ex_Quercus_AB257431 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCT-CTCGAGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------------------------------------------------ Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGG-CCCGCGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCT-CTCGGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC----GGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_arcuata_ex_Carpinus_AB252473 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCC--TGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAG-TTCT-CTCTGGGG-CACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACG{CT}AGGTG------------------------------------------------------------------------- Erysiphe_australiana_ex_Lagerstroemia_AB022407 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGG-CTTGCGCC--TGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGGGCATCGCTGATCATCCGGGG-GTAT-CTCCGGTG-CACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC----GAGGAGTGTTATAGCCCACGGTGCAATGCAGCCCA-TCCGGACCGAGGACCGCGCC-CTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTT-----TTGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_corylopsidis_ex_corylopsis_AB478987 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG--------------------------------------------------------------AATCTGGCTCCGTC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCAG-CCTGCGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCGTGAG-TTCT-CTCTCGTG-CACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGAGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTCA---TTGGAGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_epigena_ex_Quercus_AB292722 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCT-CTCTGGTG-CACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_friesii_ex_Rhamnus_AB022382 TTGACCTCGAATCAGGTAGGAATACCCGCTGAA------------------------------------------------CAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTACGCC--CGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAG-TTCTTCTCAAGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_glycines_ex_Desmodium_AB022397 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGG-TTTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATCTAGAG-TTTT-CTCTGGTG-CACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT----GGGGAGTGTTATAGCTTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCT-----TTGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_gracilis_ex_Quercus_AB022357 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCT--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGGTTCC-CTCTGGTG-CACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCG--GGGGAGTGTTATAGCCTCTGGTGCCATACAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT------TTGGGGTGCATCATC-ACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_heraclei_ex_Daucus_AB022391 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAG-GTCTCCTCGAGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCT---TTGGGGGCGCATCATCGACCGATCCTGA-------------------------------- Erysiphe_hypogena_ex_Quercus_AB292727 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCT-CTCAGGTG-CACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------- Erysiphe_hypophylla_ex_Quercus_AB292716 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCT-CTCGAGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------------------------------------------------ Erysiphe_japonica_ex_Quercus_AB022415 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA--------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CTTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCCAGAG-TTCT-CTCTGGTG-CACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTCGGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT------TTGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_ligustri_ex_Ligustrum_AB015917 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCTGAG-TTCT-CTCAGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGT----------------------------- Erysiphe_miranda_ex_Viburnum_sargentii_MUMH2561 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTTT-CTCTGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTG------------------------------------------------------------------------- Erysiphe_monascogera_ex_Styrax_AB331645 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG???????????????????????????GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTCGAG-TTCT-CTCGAGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCAGACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_mori_ex_Morus_AB022418 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCATCCAGAG-TTCT-CTCTGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTCG--GGGGAGTGTTATAGCCTCTGGTGCCATACAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------- Erysiphe_nomurae_ex_Symplocos_AB331648 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--CAGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--CATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCATCTCGAG-TTCT-CTCGAGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_paeoniae_ex_Paeonia_AB257438 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCC--TGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGGGCACTGCCGATCACCCTGAG-TTCT-CTCAGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-A---------------------------------------------------------------------------------------------------------- Erysiphe_pisi_ex_Medicago_AB102942 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCATGG-CCCGCGCC--TCTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCT-CTCGGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGGAGGAATGTAGCTCCCCTC----GGGGAGTGTTATAGCCTACGGCGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCG--TTCGGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTT--------------- Erysiphe_pulchra_ex_Benthamidia_AB015935 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCT-CTCAGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAG---------------------------------------------------------------------------- Erysiphe_pulchra_ex_Swida_AB022389 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCAGAG-TTTT-CTCTGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_quercicola_ex_Quercus_AB292694 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTT-CTCGAGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_simulans_ex_Rosa_AB022395 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCTGAGG-CCCGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGCCGATCATTCCGAG-TTCT-CTCTGATG-CACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACCGGAGGAACGTAGCTCCCCCCTCGGGAGGAGTGTTATAGCCTCTGGTGCCATACAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AACCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCT------TCGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_sp._ex_Viburnum_plicatum_MUMH249 ----------------------------------------------------------------------------------------GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCC--GTTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACCCCGAG-TTCT-CTCGGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----CT--------------------------------------------------------- Erysiphe_sp._ex_Viburnum_plicatum_MUMH794 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCC--GTTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACCCCGAG-TTCT-CTCGGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----CTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_staphyleae_ex_Staphylea_AB015922 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--GGGAGTCCGAGTTGTAATTTGTAGAAGCTGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCC--TATGTAAAGCGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCT-CTCGGGTG-CACTCGTCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTT--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGT-------------------------------------------------------------------------- Erysiphe_syringae_ex_Syringa_AB015920 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TA--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCT-CTCGGGTG-CACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTCC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGAT----------------- Erysiphe_trina_ex_Quercus_AB022350 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGAATCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGG-TTTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATAT-GGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGACTTGGGCGCTGCCGATCATCCCGAG-TTCT-CTCTGGTG-CACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTCG--GGGCAGTGTTATAGCCTCTGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGACCGATCCTGATGT?TTCGGATGGATTTGAGTAAGAGCATAGC Erysiphe_vanbruntina_ex_Sambucus_AB015925 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGAGG-CCTGCGCC--TATGTAAAGCTCTTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCCGAG-TTTT-CTCGGGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTCCGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC----------------------------------------------------------------------------------------------------------------------------------------------- Erysiphe_wallrothii_ex_Vaccinium_AB015930 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCC--TATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCT-CTCGAGTG-CACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCA-GCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTGGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCT-----TTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Golovinomyces_adenophorae_ex_Adenophora_AB077632 TTGACCTCGAATCAGGTAGGGATACCCG------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGAGGTCGGCGCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGG-CCGACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCA-TCCGGACCGAGGACCGCGCC-TTT--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TCTGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Golovinomyces_cichoracearum_ex_Solidago_AB077650 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGG-CCTACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCGAGGAACGTAGCTCTCTTC----GGGGAGTGTTATAGCCTCGGGCGCAATGCAACCCA-TCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TCAGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGC Golovinomyces_orontii_ex_Nicotiana_AB022412 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTGAGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGCCCGTGG-CCTATGCC--CGTGTAAGGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTGTTATAGCCTAGGGCGTAATGCAGCCTA-TCTGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TATGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATACC Golovinomyces_orontii_ex_Physalis_AB077646 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATTTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGCGG-CCTACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGGCGATGCACAGGCCAGCATCGGTTTGGATGGCTGGAGAAAGGCGCTAGGAACGTAGCTCTCTTC----GGGGAGTGTTATAGCCTAGGGCGTAATGCAGCCCA-TCCGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Golovinomyces_sordidus_ex_Plantago_AB077657 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGGAGGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGG-TCTCCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCGCTTC----GGGGAGTGTTATAGCCTAGGGCGGAATGCAGCCCA-TCTGGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TCTGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Leveillula_duriaei_ex_Salvia_AB080475 TTGACCTCAAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CGCCTGCC--CATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTT-CTTTGGTG-CACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTA-CTCCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGG--------------------------------------------------- Leveillula_lanuginosa_ex_Daucus_AB042641 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCGC--GGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CGCCTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTT-CTTTGGTG-CACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTA-CTCCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGG--------------------------------------------------- Leveillula_saxaouli_ex_Haloxylon_AB080469 TTGACCTCGAATC-----------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CGCCTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTT-CTTTGGTG-CACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTA-CTCCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGGCATCAT--------------------------------------------- Leveillula_taurica_ex_Artemisia_AB080470 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGCGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CGCCTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTC-CTTTGGTG-CACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTA-CTCCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGCAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGGCATCATCGACCGATCCTGAT------------------------------- Leveillula_taurica_ex_Helianthus_AB080472 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CGCCTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTT-CTTTGGTG-CACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTA-CTCCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGG--------------------------------------------------- Neoerysiphe_cumminsiana_ex_Cacalia_AB329669 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGA-CCTGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGA----GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCA-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TATGGGGGCATCATCGACCGATCCTGAAGTCTTCGGA--GATTTGAGT----------- Neoerysiphe_galeopsidis_ex_Acanthus_AB329670 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGA-CCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGTAATGCAGCCCA-TCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TATGGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGATTTGAGTAAGAGCATAGC Neoerysiphe_galeopsidis_ex_Lamium_AB329674 TTGACCTCGAATCAGGTAGG--------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGA-CCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGTAATGCAGCCCA-TCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TATGGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGATTTGAGTA---------- Neoerysiphe_galii_ex_Galium_AB329681 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTTGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGA-CCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGACGACGCGCAGGCCAGCATCGGTTCGGATGGCTGGAAAAAGGTCCTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCA-ACTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TATGGGGGCATCATCGACCGATCCTGAA------------------------------- Neoerysiphe_galii_ex_Galium_AB329682 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTTGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGA-CCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGG-TTCT-CCTCGGTG-CACTCGACGACGCGCAGGCCAGCATCGGTTCGGATGGCTGGAAAAAGGTCCTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCA-ACTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------- Oidium_phyllanthi_ex_Phyllanthus_AB120754 ----------------------------------------------------------------------------------------------------------AGCTCAAATTTGAAATCTGGCTCC-TT--TGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTTGTTGATCATCCGAGG-TTCTGCCTCGGTG-CACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCA-GTCGGACCGAGGACCGCGCCTTTT--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGT-----TTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Oidium_phyllanthi_ex_Phyllanthus_AB120755 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCC-TT--TGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCC--TATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTTGTTGATCATCCGAGG-TTCTGCCTCGGTG-CACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCA-GTCGGACCGAGGACCGCGCCTTTT--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGT-----TTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGAT--------------------- Oidium_phyllanthi_ex_Phyllanthus_AB120758 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTTC-CT--CGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGAGACCCTACACCTATATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCATCGTTGATCATCCGAGG-CTTTGCCTCGGTG-CACTCAACAATGCACAGGCCAGCATCGGTTTGACTGGCTGGAAAAAGGCCCTAGGAATGTAGCTCCTTTC----GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCA-GTTAGACCGAGGACCGCGCC-TTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGT-----TTAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCATAGC Parauncinula_septata_ex_Quercus_AB022420 TTGACCTCGGATCA--------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCC-CT--CGGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGTAG-GGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCC--CGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCAGGC-TTCG-GGCCTGTG-CACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTAGGGCGCCATGCAGCCTA-CCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCT------GAAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGAT----------------- Parauncinula_septata_ex_Quercus_AB183533 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACAAGCTCAAATTTGAAATCTGGCGCC-CT--CGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGCTG-GGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCC--CGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCGGGC-TTCGGGCCCGGTG-CACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTAGAGCGCCATGCAGCCTA-CCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGTTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCT------GAAGGGTGCATCATCGACCGATTCTGATGTCT--------------------------- Phyllactinia_ailanthi_ex_Ailanthus_AB080380 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGCG-TCGACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTCT-CTTTGGTG-CACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC----GGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTA-CCTCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTT-----TGAGGGGG--------------------------------------------------- Phyllactinia_angulata_ex_Quercus_AB080464 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCACGCGGCTCAGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGGG-CGCACGCC--TGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTTGATCATCCAACG-TTCT-CGTTGGTG-CACTCGGCGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTC----GGGGAGTGTTATAGCCCGCGGCGTAATACCGCCTA-CTCCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATGCGCGAAATGAAAGTGAACATAGGTGAGAACCCGAT----CAAGGGGG--------------------------------------------------- Phyllactinia_carpinicola_ex_Carpinus_AB080420 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGCG-TCGACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTCT-CTTTGGTG-CACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC----GGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTA-CCTCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTT-----TGAGGGGG--------------------------------------------------- Phyllactinia_fraxini_ex_Fraxinus_AB080451 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-TGGGTGCT--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTT-CTTTGGTG-CACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC----GGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTA-CCCTGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAACATAGC Phyllactinia_guttata_ex_Morus_AB080372 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAGTG-TCGGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG---CT-CTTTGGTG-CACTTGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTA-CCCCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGGCATCATCGACCGATCCTG--------------------------------- Phyllactinia_hemipteleae_ex_Hemiptelea_AB080430 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CAGGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTTT-CTTTGGTG-CACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCGGGAACGTAGCTCTTCTC----GGAGAGTGTTATAGCCTGCGGCGCAATACCGCCCA-CCTCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGG--------------------------------------------------- Phyllactinia_linderae_ex_Litsea_AB080421 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGCG-TCGACGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTCT-CTTTGGTG-CACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTC----GGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTA-CCTCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTT-----TGAGGGGG--------------------------------------------------- Phyllactinia_moricola_ex_Morus_AB022401 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAGTG-TCGGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-ACAT-CTTTGGTG-CACTTGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTGTTATAGCCGGCGACGCAATACCGCCTA-CCCCGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTG-AAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTT-----CGAGGGGGCATCATCGACCGATCCTG--------------------------------- Pleochaeta_shiraiana_ex_Celtis_AB022403 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTCAC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTG-CCTGTGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTTGGTGATCATCCGGAG-TTTT-CTCTGGTG-CACTCGGCAATGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCCTGGGCGCAATGCAGCCTA-CCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT------TTAGGGTG--------------------------------------------------- Podosphaera_filipendulae_ex_Filipendula_AB022384 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--TGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCT-CCCTGGGG-TACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTC-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------CAAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Podosphaera_longiseta_ex_Prunus_AB022423 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGTGCC--CGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCT-CCCTAGGG-CACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTC-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TGAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Podosphaera_pannosa_ex_Rosa_AB022347 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--TGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGCGCC--CATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCT-CCCTGGGG-TACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTC-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------CAAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Podosphaera_tridactyla_ex_Prunus_AB022393 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGTGCC--CGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGG-TTCT-CCCTAGGG-CACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTC-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------TGAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Podosphaera_xanthii_ex_Melothria_AB022410 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC--T--CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGTGCC--CGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGG-TTCT-CTCTAGGG-CACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTC-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTCTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCG------CAAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Sawadaea_polyfida_ex_Acer_AB022364 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCC-CT--CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCT-CCCCCGGG-CACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCCA-CCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCG------TCAGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Sawadaea_tulasnei_ex_Acer_AB022366 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACC---------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCC--T--CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGG-TTCT-CCCCCGGG-CACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCCA-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCG------TCAGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Setoidium_castanopsidis_ex_Castanopsis_MUMH5123 -------------------------------------------------------------------------------------------GAGTGAAGCGGTAACAGCTCAAATTTGAAATCCGGCTCC-CT--TGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCAGGG-TTCT-CCCTGGGG-CACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGGGGAATGTAGCTGTCTCTCG--GGGCAGTGTTATAGCCTCTCGTGCCATGCAGCCTA-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCG------TTAGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC Setoidium_castanopsidis_ex_Castanopsis_MUMH5147 -------------------------------------------------------------------------------------------GAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CT--TGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCC--CGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCAGGG-TTCT-CCCTGGGG-CACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGGGGAATGTAGCTGTCTCTCG--GGGCAGTGTTATAGCCTCTCGTGCCATGCAGCCTA-CCCGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCG------TTAGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Erysiphales_Kenashi_28S) = N: 1-815; CODONPOSSET CodonPositions (CHARACTERS = Erysiphales_Kenashi_28S) = N: 1-815; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M19356] TITLE Erysiphales_Kama_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=496; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cystotheca_wrightii_ex_Quercus_AB000932 CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCAGGCG-TGGCTGACCCTCCACCCGTGTCTATCTTCTCA--TGTTGCTTTGGCGGGCCGGGCCCTGTGCCCTCCCGGCGCCTGCTGGGACGCGCCCGCCAGAGCCACCCTAACGCGTGCTGTT--TGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTGGCTTGGTCTTGGAGCGCGCCCCGCGGGGCGGCTCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATTTC--TCTCGCGACAGGGTGGTGACGGGACCTGCCAGAAGCCTCA--TCATACTAGG Fibroidium_sp._ex_Diostea_AB525944 CTGAGCGTGAAGCCACGCAGGGCGCGAG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--TGTGCAGTCTGAG-AAACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGACGGGCCCTGCCAAAACCCACC-TATTTTTTTGG Oidium_maculatae_ex_Viola_AB525947 CTGAGCGTGAAGCCACGCAGGGCGCGTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--TGTGCAGTCTGAG-AAAAATTTAATCAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGGCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACCTATATATATTGG Podosphaera_aphanis_ex_Agrimonia_AB026141 CTGAGCGTGAAGCCACGCAGGGCGCCTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTA---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCATGTAGTT--AGTGCAGTCTGAG-AAACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GTTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACA--TATTCTTTGG Podosphaera_aphanis_ex_Fragaria_AB026136 CTGAGCGCGAAGCCACGCAGGACGCTTG---TCCCGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTTCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACC--TATTTTTTGG Podosphaera_aphanis_ex_Fragaria_AF073355 CTGAGCGCGAAGCCACGCAGGACGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACC-TATTTTTTTGG Podosphaera_astericola_ex_Aster_AB040353 CTGAGCGCGAGGCCCCGCAGTGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGCTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC-----AATTTTTGG Podosphaera_balsaminae_ex_Impatiens_AB462802 ----------------GCAGCGCGCAAG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTG------------------------------------------------------------------------------ Podosphaera_balsaminae_ex_Impatiens_AB462805 CTGAGCGCGAGGCCCCGCAGCGCTTGCG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC-----AGTCTTTGG Podosphaera_cacalia_ex_Cacalia_AB040314 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CACTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAACCCC-----CGTCTTTGG Podosphaera_caricae_papayae_ex_Carica_AB525918 CTGAGCGTGAAGCCACGCAGGGCGCTTG---TCCTGCG-CGGTTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGCTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACC-TATTTTTTTGG Podosphaera_cercidiphylli_ex_Cercidiphyllum_AB026140 CTGAGCGTGAGGCCACGCGGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGTTTT---CGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAAATTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACACAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAGAACCC----TTTTTTCTTGG Podosphaera_clandestina_ex_Crataegus_AB525931 CTGAGCGCGAGGCCACGCAGGACACTTG---TCCTGCG-CGGTTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCCACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAGAAAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGTGCGCCA-GCTCGGCGTCCCCT-AACGTAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTTGCACTGAGACCTGCCAGAACCCCCC-TTTTTTTATGG Podosphaera_clandestina_ex_Prunus_AF011316 -------------CACGCAGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCTGCTCCGGCTGGGGAGTGCCCTCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGTGCGCCG-GCTCGGCGTCCCCTAAACATACTGGCGGTACCGTTGTGCTCTCCGCCTAGTCGCGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAGAACACAC--ATATATTTTGG Podosphaera_clandestina_ex_Prunus_AF011317 CTGAGCGCGAAGCCACGCAGGGCGTTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAGAACACAC---ATTTTTTTGG Podosphaera_clandestina_ex_Spiraea_AB026137 CTGAGCGTGAAGCCACGCAGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGAAGGGACCTGCCAGAACACAC--ATATTTCTTGG Podosphaera_clandestina_ex_Spiraea_AB026150 CTGAGCGCGAAGCCACGCAGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCGGTCTGAG-AAACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAGAACACAC--ATATTCTTTGG Podosphaera_clandestina_ex_Spiraea_AB525941 CTGAGCGTGAAGCCACGCAGGGCGCTCG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAACTTTAACAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCTG-GCTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAGAACACAC--ATATTTCTTGG Podosphaera_curvispora_ex_Aria_AB525928 CTGAGCGTGAGGCTACGCAGGACACTTG---TTCTGCG-TGGCCGACCCTCCACCCGTGTGAACTATTTG---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGTAGTC--AGTGTAGTCTGAG-TCTAAATTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCA{AG}AATTTAGTGAATCATCAAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCA-GTTTGGCGTCCCCTAAATACAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCCACGACGGCGCTTGCCAGAACCCCA----TTCTCTTGG Podosphaera_elsholtziae_ex_Ajuga_AB026142 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCGCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCAGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC-----AATTTTTGG Podosphaera_epilobii_ex_Epilobium_AB525926 CTGAGCGTGACGCCACGCAGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTC--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGCCGGGACCTGCCAAAACCCACC--TATTTTTTGG Podosphaera_erigerontis_canadensis_ex_Conyza_AB040313 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTAGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC-----TATTTTTGG Podosphaera_erigerontis_canadensis_ex_Leontodon_AB040331 ------GCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGCTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTCGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC-----AATTTTTGG Podosphaera_erigerontis_canadensis_ex_MatricariaAB046988 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC-----AATTTTTGG Podosphaera_erigerontis_canadensis_ex_MelampyrumAB040332 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGCCAGGGCGGCGACGGCACCCGCCAGAACCCC-----AATTTTTGG Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB026148 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCTC-----AATTTTTGG Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB040342 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCTC-----AATTTTTGG Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB046987 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC-----AATTTTTGG Podosphaera_ferruginea_ex_Aruncus_AB026152 CTGAGCGTGAAGCCACGTAGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCAATGGGACCTGCCAAAACCCACA--TATTTTTTGG Podosphaera_ferruginea_ex_Sanguisorba_AB027232 CTGAGCGTGAAGCCACGCAGGGCGCCTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTA---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCATGTAGTT--AGTGCAGTCTGAG-AAAAACTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GTTCGGCGTCCCCTAAACACAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACA--TATTTTTTGG Podosphaera_fugax_ex_Geranium_AB026134 CTGAGCGTGAAGCCACGCAGGACGCTGG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTG--TGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAACCCCACC--TATTTTTTGG Podosphaera_fuliginea_ex_Veronica_AB046986 CAGAGTGCGAGGCCCCGCGGAGCGCATG---CCCTGCGGTGGCTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCCTCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTCGTCTGAGTGAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCTCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACACAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCTGCAGCGGCACCCGCCAGAACCCC-----ATTTTCTGG Podosphaera_gunnerae_ex_Gunnera_AB525923 GCGAGCGCGAGGCCCCGCGGAGCGCATG---CCCTGCGGTGGCTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCCCCGGCCGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTGGTCTGAGAGAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCTCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACACAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCAACGGCACCCGCCAGAACCCC-----ATTTTCTGG Podosphaera_gunnerae_ex_Gunnera_AB525924 GCGAGCGCGAGGCCCCGCGGAGCGCATG---CCCTGCGGTGGCTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCCCCGGCCGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTGGTCTGAGTGAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCTCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACACAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCAACGGCACCCGCCAGAACCCC-----ATTTTCTGG Podosphaera_hibiscicola_ex_Hibiscus_AB040308 CTGAGCGCGAGGCCCCGCAGCGCGCACG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC-----AGTCTTTGG Podosphaera_intermedia_ex_Clerodendrum_AB026145 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CTCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTGATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTGTGAGTGTTGTCTGAGGAAATGTGGAATGAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTATATCTCGCGACAGGGCGGCGACGGCACCCGCCAGAACCCC-----AATTTTTGG Podosphaera_japonica_ex_Stephanandra_AB525943 CTGAGCGTGAAGCCACGTAGGACGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACC-TATTTTTTTGG Podosphaera_leucotricha_ex_Malus_AB027231 CTGAGCGTGAGGCCACGCAGGACACTCG---TTCTGCG-CGGCTGACCCTCCACCCGTGTGAACTATTTG---TGTTGCTTTGGCGGGCCGGGTTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGTAGTT--AGTGCAGTCTGAG-TCTAAATTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCGCCA-GTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACATA--TCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCC----TTTTTCATGG Podosphaera_leucotricha_ex_Malus_AF073353 CTGAGCGTGAGGCCACGCAGGACACTCG---TTCTGCG-CGGCTGACCCTCCACCCGTGTGAACTATTTG---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGTAGTT--AGTGCAGTCTGAG-TCTAAATTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCGCCA-GTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACATA--TCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCC----TTTTTCATGG Podosphaera_lini_ex_Linum_AB525925 CTGAGCGTGAAGCCACGCAGGGCGCATG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTA---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGTTATT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GGTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGCGGCGATGGGACCTGCCAAAACCCACA--TATTTTTTGG Podosphaera_longiseta_ex_Prunus_AB000945 CCGAGCGCGAGGCCACGCGGGGCGCCTG---TCCTGCGTTGGCTGACCCTCCACCCGTGTGAACTATATCTATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTGGTCTGAGTGAATGTGGAATTAA--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTTGCTTGGTCTTGGGGCTCGCCG-GCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGGACCTGCCAGAAGCCTC---AATTTTCTAG Podosphaera_macularis_ex_Humulus_AB525917 CTGAGCGTGAAGCCACGCAGGGCGCCTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTA---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCATGTAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GTTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACA--TATTTTTTGG Podosphaera_negeri_ex_Escallonia_AB525919 CTGAGCGTGAAGCCACGCAGGGCGCGAG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--TGTGCAGTCTGAG-AAACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGACGGGCCCTGCCAAAACCCACC-TATTTTTTTGG Podosphaera_negeri_ex_Escallonia_AB925920 CTGAGCGTGAAGCCACGCAGGGCGCGAG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--TGTGCAGTCTGAG-AAACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGCCCTGCCAAAACCCACC-TATTTTTTTGG Podosphaera_pannosa_ex_Rosa_AB022348 CTGAGCGCGAAGCCACGCAGGACGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGAATT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAACTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGACGGGACCTGCCAAAACCCACC-TATTTTTTTGG Podosphaera_pannosa_ex_Rosa_AF011322 CTGAGCGCGAAGCCACGCAGGACGCTTG---TCGTGCG-CGGCTGACCTTCCACCCGTGTGAACTGAATT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAACTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGACGGGACCTGCCAAAACCCACC-TATTTTTTTGG Podosphaera_salatani_ex_Cerasus_AB525929 CTGAGCGTGAGGCCACGCGGGGCGCATG---CCTTGCGTCGGCTGACCCTCCACCCGTGTGAACTGTCATC--TGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTCGTCTGAGTGAATGTGGAATAAG--CAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTCGCTTGGTCTTGGGGCCCGCCG-ACCTGGCGGCCCCTAAACGCAGTGGCGGTCCCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCG--------------------------------------------- Podosphaera_sibirica_ex_Veronicastrum_AB026144 CTGAGCGCGAGGCCCCGTCGAGCGCCTG---CTCGGCGGCGGCTGACCCTCCACCCGTGTCAACTTTTTTC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCTGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTATG--CGTGTTGTCTGAGTGAATGCGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-TCCCTCAAGCCTCGCTTGGTCTTGGGGCTCGCCC-GCTGGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGGGCGGCGACGACACCCGCCAGAACCCC-----TCTTTCTGG Podosphaera_sp._ex_Photinia_AB525934 CTGAGCGTGAGGCCACGCAGGACACTCG---TTCTGCG-CGGCTGACCCTCCACCCGTGTGAACTATTTG---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGTAGTT--AGTGCAGTCTGAG-TCTAAATTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCGCCA-GTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACATA--TCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCC----TTTTTCATGG Podosphaera_sp._ex_Prunus_AB026147 CTGAGCGCGAGGCCACGCGGGGCGCATG---CTCTGCGTCGGCTGACCCTCCACCCGTGTGAACCGTCTTC--TGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTAGTCTGAGTGAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA--CCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-ACCCGGCGGCTCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGGGCGGCGACGACACCCGCCAGAACCCCCC---ATTTTCTGG Podosphaera_sp._ex_Pyracantha_AB525936 CTGAGCGTGAGGCCACGCAGGGCGCTCG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT----GTTGCTTTGGCGGGCCGGGCTC---GCCCTCCCGGCTCCGGCTGGGGAGTGCCCGCCAAAGAAGCCCCAACTCGTGTAGTT--AGTGCAGTCTGAG-AAACCTTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACACAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGGGTAGCGATGGGACCTGCCAGAACACTC---TTTTTTATGG Podosphaera_sp._ex_Stachyurus_AB525942 CTGAGCGTGAAGCCACGCAGGATGCTCG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCATGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACAGAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACC--TATTTTTTGG Podosphaera_spiraeae_ex_Filipendula_AB022385 CTGAGCGTGAAGCCACGCAGGGCGCCTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTA---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCATGTAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GTTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACA--TATTTTTTGG Podosphaera_spiraeae_ex_Spiraea_AB026143 CTGAGCGTGAAGCTACGTAGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTATCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACA--TATTTTTTGG Podosphaera_spiraeae_ex_Spiraea_AB026149 CTGAGCGTGAAGCCACGTAGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGACGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAACATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCCCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAAAACCCACA--TATTTTTTGG Podosphaera_spiraeae_ex_Spiraea_AF154325 CTGAGCGTGAAGCCACGCAGGGCGCTTG---TCCTGCG-CGGCTGACCCTCCACCCGTGTGAACTGATTT---TGTTGCTTTGGCGGGCCGGGCTC---GACCCACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCAGTT--AGTGCAGTCTGAG-AAAAATTTAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGCGCGCCG-GCTCGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGAGTGGCGATGGGACCTGCCAGAACACACA--TATTTCTTGG Podosphaera_tridactyla_ex_Prunus_AB000943 CCGAGCGCGAGGCCACGCAGGGCGCCTG---TCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCTATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTTGTCTGAGTGAATGTGGAATTAA--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCC--AATTTTCTTG Podosphaera_tridactyla_ex_Prunus_AF011318 --------------------------------------TCGGCTGACCCTCCACCCGTGTGAACTGTCATC--TGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTCGTCTGAGCGAATGTGGAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTCGCTTGGTCTTGGGGCCCGCCG-ACCTGGCGGCCCCTAAACGTAGTGGCGGTCCCGTTGTGCTCTCCGCGTAATCACGTA--TCTCGCGACAGGGCGGCGACGGAACCTGCCAGAACCCCG-AGTTTTTTCTGG Podosphaera_tridactyla_ex_Prunus_AY833652 CTGAGCGCGAGGCCACGCAGGGCGCCTG---TCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCAATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTTGTCTGAGTGAATGTGGAATTAA--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCC--AATTTTCTTG Podosphaera_tridactyla_ex_Prunus_AY833654 CTGAGCGCGAGGCCACGCAGGGCGCCTG---TCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCAATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTTGTCTGAGTGAATGTGGAATTAA--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-CCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCC--AATTTTCTTG Podosphaera_tridactyla_ex_Prunus_AY833656 CTGAGCGTGAGGCCACGCGGGGCGCATG---CCTTGCGTCGGCTGACCCTCCACCCGTGTGAACTGTCATC--TGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTCGTCTGAGCGAATGTGGAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTCGCTTGGTCTTGGGGCCCGCCG-ACCTGGCGGCCCCTAAACGCAGTGGCGGTCCCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGGGCGGCGACGGAACCTGCCAGAACCCCCAAG-TTTTTCTGG Podosphaera_tridactyla_ex_Prunus_AY833658 CTGAGCGTGAGGCCACGCGGGGCGCATG---CCTTGCGTCGGCTGACCCTCCACCCGTGTGAACTGTCATC--TGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTCGTCTGAGCGAATGTGGAATAAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTCGCTTGGTCTTGGGGCCCGCCG-ACCTGGCGGCCCCTAAACGTAGTGGCGGTCCCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGGGCGGCGACGGAACCTGCCAGAACCCCCAAGTTTTTTCTGG Podosphaera_tridactyla_ex_Prunus_AY833659 CTGAGCGCGAGGCCACGCGGGGCGCATG---CTCTGCGTCGGCTGACCCTCCACCCGTGTGAACCGTCTTC--TGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTAGTCTGAGTGAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA--CCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-ACCCGGCGGCTCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGCGTAGTCACGTA--TCTCGCGACAGGGCGGCGACGACACCCGCCAGAACCCCCC---ATTTTCTGG Podosphaera_tridactyla_ex_PrunusAY833651 CCGAGCGCGAGGCCACGCAGGGCGCCTG---TCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCTATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTC--AGTGTTGTCTGAGTGAATGTGGAATTAA--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCAGGTA--TCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCC--GATTTTCTTG Podosphaera_xanthii_ex_Arctium_AB040310 CTGAGCGCGAGGCCCCGCAGCGCGCACG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC---AGTCTTTGG Podosphaera_xanthii_ex_Cosmos_AB040300 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAACCCC-----AGTCTTTGG Podosphaera_xanthii_ex_Cucumis_AB040324 CTGAGCGCGAGGCCCCGCAGCGCGCACG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGTGGCGACGGCACCCGCCAGAACCCC-----AGTCTTTGG Podosphaera_xanthii_ex_Helianthus_AB040311 CTGAGCGCGAGGCCCCGCAGCGCGCAAG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGTGACGGCACCCGCCAGAACCCC-----AGTCTTTGG Podosphaera_xanthii_ex_Physalis_AB040336 CTGAGCGCGAGGCCCCGCAGCGCGCACG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCC---AGTCTTTGG Podosphaera_xanthii_ex_Rudbeckia_AB040296 CTGAGCGCGAGGCCCCGCAGCGCGCACG---CGCTGCGGCGGTTGACCCTCCACCCGTGTGAACTCTTATC--TGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGCTGTG--AGTGTTGTCTGAGGAAATGTGGAATTAG--TAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCGCCG-GCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTA--TCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCC-----AGTCTTTGG Pourthiae_vollisa_AB026138 CTGAGCGTGAGGCCATGCAGGGCGCTTG---TTCTGCG-TGGCTGACCCTCCACCCGTGTGTACTCGTTT---TGTTGCTTTGGCGGGCCGGGCAC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGACACCCCAACTCGTGCAGTT--TGTGCAGTCTGAG-TCGAATTGAATTATGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCACAGCTTGGTCTTGGGGCGCGCCA-TGCTGGCGTCCCCTAAACAGAGTGGCGGTCTCCTTGGGCTCTCCGCGTAGTCACGCA--TCTCGCGCCAGAGTCGCGATGGGACCTGCCAGAATACCACC--TTCTTTTGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Erysiphales_Kama_ITS) = N: 1-496; CODONPOSSET CodonPositions (CHARACTERS = Erysiphales_Kama_ITS) = N: 1-496; END; BEGIN TREES; TITLE Erysiphales_28S; LINK TAXA = Taxa2; TRANSLATE 1 Erysiphe_sp._ex_Viburnum_plicatum_MUMH249, 2 Erysiphe_sp._ex_Viburnum_plicatum_MUMH794, 3 Erysiphe_abbreviata_ex_Quercus_AB271785, 4 Erysiphe_epigena_ex_Quercus_AB292722, 5 Erysiphe_hypogena_ex_Quercus_AB292727, 6 Erysiphe_ligustri_ex_Ligustrum_AB015917, 7 Erysiphe_monascogera_ex_Styrax_AB331645, 8 Erysiphe_nomurae_ex_Symplocos_AB331648, 9 Erysiphe_pulchra_ex_Swida_AB022389, 10 Erysiphe_pulchra_ex_Benthamidia_AB015935, 11 Erysiphe_miranda_ex_Viburnum_sargentii_MUMH2561, 12 Erysiphe_staphyleae_ex_Staphylea_AB015922, 13 Erysiphe_syringae_ex_Syringa_AB015920, 14 Erysiphe_wallrothii_ex_Vaccinium_AB015930, 15 Erysiphe_vanbruntina_ex_Sambucus_AB015925, 16 Erysiphe_australiana_ex_Lagerstroemia_AB022407, 17 Erysiphe_trina_ex_Quercus_AB022350, 18 Erysiphe_adunca_ex_Salix_AB022374, 19 Erysiphe_alphitoides_ex_Quercus_AB257431, 20 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405, 21 Erysiphe_arcuata_ex_Carpinus_AB252473, 22 Erysiphe_corylopsidis_ex_corylopsis_AB478987, 23 Erysiphe_friesii_ex_Rhamnus_AB022382, 24 Erysiphe_glycines_ex_Desmodium_AB022397, 25 Erysiphe_gracilis_ex_Quercus_AB022357, 26 Erysiphe_heraclei_ex_Daucus_AB022391, 27 Erysiphe_hypophylla_ex_Quercus_AB292716, 28 Erysiphe_mori_ex_Morus_AB022418, 29 Erysiphe_paeoniae_ex_Paeonia_AB257438, 30 Erysiphe_pisi_ex_Medicago_AB102942, 31 Erysiphe_quercicola_ex_Quercus_AB292694, 32 Erysiphe_simulans_ex_Rosa_AB022395, 33 Erysiphe_japonica_ex_Quercus_AB022415, 34 Leveillula_saxaouli_ex_Haloxylon_AB080469, 35 Leveillula_taurica_ex_Artemisia_AB080470, 36 Leveillula_taurica_ex_Helianthus_AB080472, 37 Leveillula_duriaei_ex_Salvia_AB080475, 38 Leveillula_lanuginosa_ex_Daucus_AB042641, 39 Phyllactinia_fraxini_ex_Fraxinus_AB080451, 40 Phyllactinia_guttata_ex_Morus_AB080372, 41 Phyllactinia_moricola_ex_Morus_AB022401, 42 Phyllactinia_angulata_ex_Quercus_AB080464, 43 Phyllactinia_ailanthi_ex_Ailanthus_AB080380, 44 Phyllactinia_carpinicola_ex_Carpinus_AB080420, 45 Phyllactinia_hemipteleae_ex_Hemiptelea_AB080430, 46 Phyllactinia_linderae_ex_Litsea_AB080421, 47 Pleochaeta_shiraiana_ex_Celtis_AB022403, 48 Neoerysiphe_cumminsiana_ex_Cacalia_AB329669, 49 Neoerysiphe_galeopsidis_ex_Acanthus_AB329670, 50 Neoerysiphe_galeopsidis_ex_Lamium_AB329674, 51 Neoerysiphe_galii_ex_Galium_AB329681, 52 Neoerysiphe_galii_ex_Galium_AB329682, 53 Arthrocladiella_mougeotii_ex_Lycium_AB022379, 54 Arthrocladiella_mougeotii_ex_Lycium_AB329690, 55 Blumeria_graminis_ex_Bromus_AB022362, 56 Blumeria_graminis_ex_Hordeum_AB022399, 57 Blumeria_graminis_ex_Triticum_AB022376, 58 Cystotheca_lanestris_ex_Quercus_AB022353, 59 Cystotheca_wrightii_ex_Quercus_AB022355, 60 Golovinomyces_adenophorae_ex_Adenophora_AB077632, 61 Golovinomyces_cichoracearum_ex_Solidago_AB077650, 62 Golovinomyces_orontii_ex_Nicotiana_AB022412, 63 Golovinomyces_orontii_ex_Physalis_AB077646, 64 Golovinomyces_sordidus_ex_Plantago_AB077657, 65 Oidium_phyllanthi_ex_Phyllanthus_AB120754, 66 Oidium_phyllanthi_ex_Phyllanthus_AB120755, 67 Oidium_phyllanthi_ex_Phyllanthus_AB120758, 68 Podosphaera_filipendulae_ex_Filipendula_AB022384, 69 Podosphaera_longiseta_ex_Prunus_AB022423, 70 Podosphaera_pannosa_ex_Rosa_AB022347, 71 Podosphaera_tridactyla_ex_Prunus_AB022393, 72 Podosphaera_xanthii_ex_Melothria_AB022410, 73 Sawadaea_polyfida_ex_Acer_AB022364, 74 Sawadaea_tulasnei_ex_Acer_AB022366, 75 Setoidium_castanopsidis_ex_Castanopsis_MUMH5123, 76 Setoidium_castanopsidis_ex_Castanopsis_MUMH5147, 77 Parauncinula_septata_ex_Quercus_AB183533, 78 Parauncinula_septata_ex_Quercus_AB022420, 79 Caespitotheca_forestalis_ex_Schinopsis_AB193467, 80 Byssoascus_striatisporus_U17912; TREE PAUP_1 = [&R] (((((((((((((((((((1,2),22),10),(3,(((4,5),13),((((7,8),((23,26),31)),(14,19)),27)))),(20,30)),((9,15),11)),12),6),29),21),(((((17,32),25),28),33),24)),18),16),(((48,((49,50),(51,52))),((65,66),67)),((53,54),(((60,(62,64)),63),61)))),((((((((34,36,37,38),35),42),45),39),(43,44,46)),(40,41)),47)),(77,78)),((55,(56,57)),((((58,59),(75,76)),(73,74)),((68,70),((69,71),72))))),79),80); END; BEGIN TREES; TITLE Erysiphales_ITS; LINK TAXA = Taxa3; TRANSLATE 1 Erysiphe_glycines_AB015927, 2 Erysiphe_glycines_AB015934, 3 Erysiphe_heraclei_AB000942, 4 Erysiphe_betae_AF011290, 5 Erysiphe_polygoni_AF011308, 6 Erysiphe_polygoni_AF011307, 7 Erysiphe_trifolii_AB015913, 8 Erysiphe_friesii_AB000939, 9 Erysiphe_lespedezae_AB015923, 10 Erysiphe_baeumleri_AB015919, 11 Erysiphe_diffusa_AB078800, 12 Erysiphe_pisi_AF073348, 13 Erysiphe_howeana_AF011301, 14 Erysiphe_cruciferarum_AF031283, 15 Erysiphe_convolvuli_AF154327, 16 Erysiphe_liriodendri_AF011302, 17 Erysiphe_quercicola_AB292691, 18 Erysiphe_quercicola_AB292694, 19 Erysiphe_abbreviata_AB271785, 20 Erysiphe_castaneigena_AF298545, 21 Erysiphe_alphitoides_AB237783, 22 Erysiphe_pseudolonicerae_AB015915, 23 Erysiphe_monascogera_AB331646, 24 Erysiphe_hypophylla_AB292715, 25 Erysiphe_epigena_AB292720, 26 Erysiphe_hypogena_AB292724, 27 Erysiphe_syringae_AB015920, 28 Erysiphe_magnifica_AF011312, 29 Erysiphe_paeoniae_AB257438, 30 Erysiphe_blasti_AB015918, 31 Erysiphe_aquilegiae_AB015929, 32 Erysiphe_macleayae_AB016048, 33 Erysiphe_weigelae_AB015932, 34 Erysiphe_weigelae_AB015931, 35 Erysiphe_huayinensis_AB015914, 36 Erysiphe_viburni_ex_Viburnum_plicatum_MUMH786, 37 Erysiphe_hedwigii_AF298539, 38 Erysiphe_viburni_AF298541, 39 Erysiphe_deutziae_DQ861918, 40 Erysiphe_deutziae_DQ861917, 41 Viburnum_plicatum_MUMH794, 42 Erysiphe_pulchra_AB015924, 43 Erysiphe_pulchra_AB000941, 44 Erysiphe_helwingiae_AB015916, 45 Erysiphe_vanbruntiana_AB015925, 46 Erysiphe_miranda_MUMH2561, 47 Erysiphe_staphyleae_AB015922, 48 Erysiphe_pulchra__AB015935, 49 Erysiphe_ligustri_AB015917, 50 Erysiphe_juglandis_AB015928; TREE PAUP_181 = [&R] (1,2,((((((((((((((((((((3,4),(5,6)),8),9),((7,10),(11,(12,13)))),14),15),27),(16,(((((17,18),21,22),(23,24),(25,26)),20),19))),28),(30,(31,32))),29),(46,47)),49),48),((39,40),(41,(42,43)))),(44,45)),(36,37,38)),((33,34),35)),50)); END; BEGIN TREES; TITLE Erysiphales_Podosphaera_71_taxa; LINK TAXA = Taxa1; TRANSLATE 1 Cystotheca_wrightii_ex_Quercus_AB000932, 2 Podosphaera_xanthii_ex_Cucumis_AB040324, 3 Podosphaera_hibiscicola_ex_Hibiscus_AB040308, 4 Podosphaera_xanthii_ex_Rudbeckia_AB040296, 5 Podosphaera_xanthii_ex_Cosmos_AB040300, 6 Podosphaera_xanthii_ex_Helianthus_AB040311, 7 Podosphaera_balsaminae_ex_Impatiens_AB462802, 8 Podosphaera_balsaminae_ex_Impatiens_AB462805, 9 Podosphaera_xanthii_ex_Physalis_AB040336, 10 Podosphaera_xanthii_ex_Arctium_AB040310, 11 Podosphaera_astericola_ex_Aster_AB040353, 12 Podosphaera_cacalia_ex_Cacalia_AB040314, 13 Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB026148, 14 Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB040342, 15 Podosphaera_erigerontis_canadensis_ex_MatricariaAB046988, 16 Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB046987, 17 Podosphaera_intermedia_ex_Clerodendrum_AB026145, 18 Podosphaera_elsholtziae_ex_Ajuga_AB026142, 19 Podosphaera_erigerontis_canadensis_ex_Conyza_AB040313, 20 Podosphaera_erigerontis_canadensis_ex_MelampyrumAB040332, 21 Podosphaera_erigerontis_canadensis_ex_Leontodon_AB040331, 22 Podosphaera_fuliginea_ex_Veronica_AB046986, 23 Podosphaera_sibirica_ex_Veronicastrum_AB026144, 24 Podosphaera_tridactyla_ex_PrunusAY833651, 25 Podosphaera_tridactyla_ex_Prunus_AY833652, 26 Podosphaera_tridactyla_ex_Prunus_AY833654, 27 Podosphaera_tridactyla_ex_Prunus_AY833656, 28 Podosphaera_tridactyla_ex_Prunus_AY833658, 29 Podosphaera_tridactyla_ex_Prunus_AY833659, 30 Podosphaera_tridactyla_ex_Prunus_AB000943, 31 Podosphaera_longiseta_ex_Prunus_AB000945, 32 Podosphaera_tridactyla_ex_Prunus_AF011318, 33 Podosphaera_sp._ex_Prunus_AB026147, 34 Fibroidium_sp._ex_Diostea_AB525944, 35 Podosphaera_gunnerae_ex_Gunnera_AB525923, 36 Podosphaera_gunnerae_ex_Gunnera_AB525924, 37 Podosphaera_epilobii_ex_Epilobium_AB525926, 38 Podosphaera_sp._ex_Stachyurus_AB525942, 39 Podosphaera_sp._ex_Pyracantha_AB525936, 40 Pourthiae_vollisa_AB026138, 41 Podosphaera_sp._ex_Photinia_AB525934, 42 Podosphaera_negeri_ex_Escallonia_AB925920, 43 Podosphaera_negeri_ex_Escallonia_AB525919, 44 Podosphaera_spiraeae_ex_Spiraea_AF154325, 45 Podosphaera_spiraeae_ex_Spiraea_AB026149, 46 Podosphaera_spiraeae_ex_Spiraea_AB026143, 47 Podosphaera_salatani_ex_Cerasus_AB525929, 48 Podosphaera_pannosa_ex_Rosa_AF011322, 49 Podosphaera_pannosa_ex_Rosa_AB022348, 50 Podosphaera_macularis_ex_Humulus_AB525917, 51 Podosphaera_lini_ex_Linum_AB525925, 52 Podosphaera_leucotricha_ex_Malus_AF073353, 53 Podosphaera_leucotricha_ex_Malus_AB027231, 54 Podosphaera_japonica_ex_Stephanandra_AB525943, 55 Podosphaera_fugax_ex_Geranium_AB026134, 56 Podosphaera_spiraeae_ex_Filipendula_AB022385, 57 Podosphaera_ferruginea_ex_Sanguisorba_AB027232, 58 Podosphaera_ferruginea_ex_Aruncus_AB026152, 59 Podosphaera_curvispora_ex_Aria_AB525928, 60 Podosphaera_clandestina_ex_Spiraea_AB026137, 61 Podosphaera_clandestina_ex_Spiraea_AB525941, 62 Podosphaera_clandestina_ex_Spiraea_AB026150, 63 Podosphaera_clandestina_ex_Crataegus_AB525931, 64 Podosphaera_clandestina_ex_Prunus_AF011317, 65 Podosphaera_clandestina_ex_Prunus_AF011316, 66 Podosphaera_cercidiphylli_ex_Cercidiphyllum_AB026140, 67 Podosphaera_caricae_papayae_ex_Carica_AB525918, 68 Podosphaera_aphanis_ex_Fragaria_AF073355, 69 Podosphaera_aphanis_ex_Fragaria_AB026136, 70 Podosphaera_aphanis_ex_Agrimonia_AB026141, 71 Oidium_maculatae_ex_Viola_AB525947; TREE PAUP_145 = [&R] (1,(((((((((((2,3),4),8,9,10),((5,6,12),7)),11),((13,14),15,16),17,18,19,20),21),23),(22,(35,36))),(((27,(28,32)),47),(29,33))),((24,(25,26),30),31)),(((((((34,43),42),(((48,49),68),54),67),(37,(((38,55),69),((((44,60,61),(62,64),65),(45,46,58),((50,56,57,70),51)),71)))),(39,63)),(40,((41,52,53),59))),66)); END;