#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:12 GMT TreeBASE (cc) 1994-2008 Study reference: Lee S., Crous P.W., & Wingfield M.J. 2006. Pestalotioid fungi from Restionaceae in the Cape Floral Kingdom. Studies in Mycology, 52. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1498] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=29; TAXLABELS Bartalinia_laurina_AF405302 Bartalinia_robillardoides_AF405301 Hypoxylon_schweinitzii_AF455511 Pestalotiopsis__aquatica_AF409956 Pestalotiopsis__maculans_AF405296 Pestalotiopsis__matildae_CBS_118143 Pestalotiopsis__matildae_CBS_118155 Pestalotiopsis__microspora_AF409958 Pestalotiopsis__rhododendri_AF409968 Pestalotiopsis__sp_AF409961 Pestalotiopsis__sp_AF409979 Pestalotiopsis__sp_AF409980 Pestalotiopsis__sydowiana_AF409970 Pestalotiopsis__theae_AF405297 Pestalotiopsis__versicolor_AF405298 Pestalotiopsis__vismiae_AF409977 Sarcostroma_restionis_CBS_118153 Sarcostroma_restionis_CBS_118154 Seimatosporium_grevilleae_AF405304 Truncatella_angustata_AF405306 Truncatella_angustata_DQ093715 Truncatella_betulae_SL1015 Truncatella_hartigii_CBS_118145 Truncatella_hartigii_CBS_118148 Truncatella_megaspora_PREM_58870 Truncatella_restionacearum_CBS_118150 Truncatella_restionacearum_CMW_18755 Truncatella_spadicea_PREM_58873 Xylaria_hypoxylon_AF201711 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=26; TAXLABELS Bartalinia_lateripes_AF382368 Bartalinia_robillardoides_AF382366 Discostroma_sp_AF382380 Dyrithiopsis_lakefuxianensis_AF452047 Monochaetia_monochaeta_AF382370 Pestalotia_palmarum_AF382361 Pestalotia_photiniae_AF382363 Pestalotia_vacinii_AF382362 Pestalotiopsis_bicilia_AF382356 Pestalotiopsis_maculans_AF382354 Sarcostroma_restionis_CBS_118153 Sarcostroma_restionis_CBS_118154 Seimatosporium_grevilleae_AF382372 Seimatosporium_leptospermi_AF382373 Seimatosporium_vaccinii_AF382374 Seiridium_cardinale_AF382376 Seiridium_cupressi_AF382378 Truncatella_angustata_AF382383 Truncatella_conorumpiceae_AF382384 Truncatella_hartigii_CBS_118145 Truncatella_hartigii_CBS_118148 Truncatella_laurocerasi_AF382385 Truncatella_restionacearum_CMW_18755 Truncatella_sp_AF382382 Xylaria_curta_U47841 Xylaria_hypoxylon_U47840 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=26; TAXLABELS Bartalinia_lateripes_AF382368 Bartalinia_robillardoides_AF382366 Discostroma_sp_AF382380 Dyrithiopsis_lakefuxianensis_AF452047 Monochaetia_monochaeta_AF382370 Pestalotia_palmarum_AF382361 Pestalotia_photiniae_AF382363 Pestalotia_vacinii_AF382362 Pestalotiopsis_maculans_AF382354 Petalotiopsis_bicilia_AF382356 Sarcostroma_restionis_CBS_118153 Sarcostroma_restionis_CBS_118154 Seimatosporium_grevilleae_AF382372 Seimatosporium_leptospermi_AF382373 Seimatosporium_vaccinii_AF382374 Seiridium_cardinale_AF382376 Seiridium_cupressi_AF382378 Truncatella_angustata_AF382383 Truncatella_conorumpiceae_AF382384 Truncatella_hartigii_CBS_118145 Truncatella_hartigii_CBS_118148 Truncatella_laurocerasi_AF382385 Truncatella_restionacearum_CMW_18755 Truncatella_sp_AF382382 Xylaria_curta_U47841 Xylaria_hypoxylon_U47840 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1087] TITLE partial_28S_rDNA_2; LINK TAXA = Taxa3; DIMENSIONS NCHAR=856; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bartalinia_lateripes_AF382368 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGCCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTTGCTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCTCTCGGGAAGTGTTAATAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Bartalinia_robillardoides_AF382366 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCTCTCGGGAAGTGTTAATAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Discostroma_sp_AF382380 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTCAGGAATGTGGCTCCCTC--GGGAGTGTTAATAGCCTGTTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Dyrithiopsis_lakefuxianensis_AF452047 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTCAGTTTAGGCCAGCATCGACTTTCGGCGGCGGATAAAAGCTTCAGGAATGTGGCTCCTCTCGGGGAGTGTTA-TAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Monochaetia_monochaeta_AF382370 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTAAGAGGGTGAGAGCCCCGTACGGTTGGATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTATAGGCCAGCATCGATTTTCGGAGGGGGATAAAAGCTTTGGGAATGTGGCTCCCTTCTGGGAGTGTTA-TAGCCCATTGTATAATACCTTTCTGGGGATCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAGGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotia_palmarum_AF382361 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTA-TAGCCCATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotia_photiniae_AF382363 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTA-TAGCCCATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotia_vacinii_AF382362 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTA-TAGCCCATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotiopsis_maculans_AF382354 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCCCTACGGGGAGTGTTA-TAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Petalotiopsis_bicilia_AF382356 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCCCTACGGGGAGTGTTA-TAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Sarcostroma_restionis_CBS_118153 AGAACCCACCGGGATTGCCCTAGTAACG-CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT-GGGTCCGAATTGTAATTTGTAGAGGATGTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCC-TTC-GGGAGTGTTA-TAAACTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Sarcostroma_restionis_CBS_118154 AGAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCC-TTC-GGGAGTGTTA-TAACCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGG--------------- Seimatosporium_grevilleae_AF382372 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCTTTCGGGGAGTGTTA-TAACCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGAAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTCAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Seimatosporium_leptospermi_AF382373 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCTTTCGGGGAGTGTTA-TAACCTGTTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Seimatosporium_vaccinii_AF382374 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTCCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCC-TC-GGGAGTGTTA-TAGCCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGCCCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTTCGGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Seiridium_cardinale_AF382376 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCCCTCCGGGGAGTGTTA-TAGCCCATTGTATAATACCTCTCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Seiridium_cupressi_AF382378 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATTCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCCCTCCGGGGAGTGTTA-TAGCCCATTGTATAATACCTCTCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGCCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGCTTTGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_angustata_AF382383 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGCAGAGGATGATTTTGGTTAGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGGTAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTCTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTGGGAATGTGGCTCCTTTCGGGGAGTGTTA-TAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_conorumpiceae_AF382384 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTTTAGGCCAGCATCGACTTTTGGCGGCGGATAAAAGCTTTAGGAATGTGGCTCCTCTCGGGGAGTGTTA-TAGCCTATTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCTTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_hartigii_CBS_118145 -----CCACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTCTTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTCAGGAATGTAGCTCCCCTCGGGGAGTGTTA-TAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_hartigii_CBS_118148 ----------GGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTCTTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTCAGGAATGTAGCTCCCCTCGGGGAGTGTTA-TAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTCTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_laurocerasi_AF382385 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGCAGAGGATGATTTTGGTTAGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTTAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTCTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTGGGAATGTGGCTCCTTTCGGGGAGTGTTA-TAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAACCCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_restionacearum_CMW_18755 -------------ATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTTTAGGCCAGCATCGACTTCTGGCGGCGGATAAAAGCTTCAGGAATGTGGCTCCCTACGGGGAGTGTTA-TAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_sp_AF382382 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGCGGATAAAAGCTTTAGGAATGTGGCTCCTCTCGGGGAGTGTTA-TAGCCTATTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Xylaria_curta_U47841 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCG-CAACAGCTCAAATTTGNTATCTGGCCTTCGGGTCCGAGTTGTAATTTGCAGAGGATGNTTTGTGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGACCAGACCTTTTCNCAGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTGGGTTGAGGCCAGCATCGGTTTCCGCAGGGGGATAAAAGCCTGGGGAACGTAGCTCCCTC--GGGAGTGTTA-TAGCCCCTCGCATAATACCTT-GCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCGTCAACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTATTCGGGTGTCAAACCCTTATGCGCAATGAAAGTGAACGGAGGTGAGAGCC-TCACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGAGAAAGACTTATCGA Xylaria_hypoxylon_U47840 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCG-CAACAGCTCAAATTTGNNATCTGGCCCTCGGGTCCGAGTTGTAATTTGTAGAGGATGNTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCTTGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTAAGTTTAGGCCAGCATCGGTTTCTGTAGGGGGATAAAAGCTCTGGGAACGTAGCTCC-TCC-GGGAGTGTTA-TAGCCCTCTGCATAATACCTTTACGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCGTCAACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCC-TTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGAGAAAGACTTATCGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1085] TITLE partial_28S_rDNA; LINK TAXA = Taxa2; DIMENSIONS NCHAR=856; FORMAT DATATYPE=Standard SYMBOLS= "A C G T -" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bartalinia_lateripes_AF382368 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGCCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTTGCTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCTCTCGGGAAGTGTTAATAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Bartalinia_robillardoides_AF382366 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCTCTCGGGAAGTGTTAATAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Discostroma_sp_AF382380 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTCAGGAATGTGGCTCCCTC--GGGAGTGTTAATAGCCTGTTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Dyrithiopsis_lakefuxianensis_AF452047 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTCAGTTTAGGCCAGCATCGACTTTCGGCGGCGGATAAAAGCTTCAGGAATGTGGCTCCTCTCGGGGAGTGTTA-TAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Monochaetia_monochaeta_AF382370 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTAAGAGGGTGAGAGCCCCGTACGGTTGGATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTATAGGCCAGCATCGATTTTCGGAGGGGGATAAAAGCTTTGGGAATGTGGCTCCCTTCTGGGAGTGTTA-TAGCCCATTGTATAATACCTTTCTGGGGATCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAGGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotia_palmarum_AF382361 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTA-TAGCCCATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotia_photiniae_AF382363 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTA-TAGCCCATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotia_vacinii_AF382362 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTA-TAGCCCATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotiopsis_bicilia_AF382356 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCCCTACGGGGAGTGTTA-TAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Pestalotiopsis_maculans_AF382354 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCCCTACGGGGAGTGTTA-TAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Sarcostroma_restionis_CBS_118153 AGAACCCACCGGGATTGCCCTAGTAACG-CGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT-GGGTCCGAATTGTAATTTGTAGAGGATGTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCC-TTC-GGGAGTGTTA-TAAACTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Sarcostroma_restionis_CBS_118154 AGAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCC-TTC-GGGAGTGTTA-TAACCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGG--------------- Seimatosporium_grevilleae_AF382372 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCTTTCGGGGAGTGTTA-TAACCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGAAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTCAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Seimatosporium_leptospermi_AF382373 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCTTTCGGGGAGTGTTA-TAACCTGTTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Seimatosporium_vaccinii_AF382374 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTCCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCCC-TC-GGGAGTGTTA-TAGCCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGCCCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTTCGGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Seiridium_cardinale_AF382376 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCCCTCCGGGGAGTGTTA-TAGCCCATTGTATAATACCTCTCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Seiridium_cupressi_AF382378 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATTCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCCCTCCGGGGAGTGTTA-TAGCCCATTGTATAATACCTCTCTGGGGATCGAGGTACGCGCTTCTGCAAGGATGCTGCCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGCTTTGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_angustata_AF382383 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGCAGAGGATGATTTTGGTTAGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGGTAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTCTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTGGGAATGTGGCTCCTTTCGGGGAGTGTTA-TAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_conorumpiceae_AF382384 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTTTAGGCCAGCATCGACTTTTGGCGGCGGATAAAAGCTTTAGGAATGTGGCTCCTCTCGGGGAGTGTTA-TAGCCTATTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGCCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCTTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_hartigii_CBS_118145 -----CCACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTCTTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTCAGGAATGTAGCTCCCCTCGGGGAGTGTTA-TAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_hartigii_CBS_118148 ----------GGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTCTTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTCAGGAATGTAGCTCCCCTCGGGGAGTGTTA-TAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTCTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_laurocerasi_AF382385 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGCAGAGGATGATTTTGGTTAGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTTAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTCTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTGGGAATGTGGCTCCTTTCGGGGAGTGTTA-TAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAACCCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_restionacearum_CMW_18755 -------------ATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTTTAGGCCAGCATCGACTTCTGGCGGCGGATAAAAGCTTCAGGAATGTGGCTCCCTACGGGGAGTGTTA-TAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Truncatella_sp_AF382382 GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTTGGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGCGGATAAAAGCTTTAGGAATGTGGCTCCTCTCGGGGAGTGTTA-TAGCCTATTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTACGGG--TGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGCGAAAGACTAATCGA Xylaria_curta_U47841 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCG-CAACAGCTCAAATTTGNTATCTGGCCTTCGGGTCCGAGTTGTAATTTGCAGAGGATGNTTTGTGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGACCAGACCTTTTCNCAGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTGGGTTGAGGCCAGCATCGGTTTCCGCAGGGGGATAAAAGCCTGGGGAACGTAGCTCCCTC--GGGAGTGTTA-TAGCCCCTCGCATAATACCTT-GCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCGTCAACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTATTCGGGTGTCAAACCCTTATGCGCAATGAAAGTGAACGGAGGTGAGAGCC-TCACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGAGAAAGACTTATCGA Xylaria_hypoxylon_U47840 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCG-CAACAGCTCAAATTTGNNATCTGGCCCTCGGGTCCGAGTTGTAATTTGTAGAGGATGNTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCTTGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTAAGTTTAGGCCAGCATCGGTTTCTGTAGGGGGATAAAAGCTCTGGGAACGTAGCTCC-TCC-GGGAGTGTTA-TAGCCCTCTGCATAATACCTTTACGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCGTCAACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCC-TTACGGG--TGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT-CTGCGCATGGGGGAGAAAGACTTATCGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1086] TITLE 'ITS1&2, 5.8S rDNA'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=612; FORMAT DATATYPE=Standard SYMBOLS= "A C G T -" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bartalinia_laurina_AF405302 CAGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TT-GTTGCCTCGGCAGTAGTTGCTGGGC-GAGCCTACCCGGGAACGAGCTACCCTGTAGCGAGTTAC-CCTGGAAC-GACTTACCCTGGAACGCCTGCCGGT---GGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAATCGACTTT--------ACTGTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATTTTTTTT-CTCGTTTTTGAAATACTATAAACC----TCAGCCGCTAAACCCCC-AATTTCT-TATGGTTGACCTCGGACCAGGTGGGATCCCG---------- Bartalinia_robillardoides_AF405301 CAGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TT-GTTGCCTCGGCAGTAGTTGCTGGGC-GAGCCTACCCGGGAACGAGCTACCCTGTAGCGAGTTAC-CCTGGAAC-GACTTACCCTGTAACGCCTGCCGGT---GGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAATCGACTTT--------ACTGTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATTTTTTTC-CTCGTTTTTGAAATACTATAAACC----TCAGCCGCTAAACCCCC-AATTTTT-TATGGTTGACCTCGGACCAGGTGGGATCACCCGCTGAACTT Hypoxylon_schweinitzii_AF455511 CAGCGGAGGGATCATTACCGAGTT-TACAACTCCCAAACCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCC--GGGCGCGTCGCAGCCCCGGATCCCATGGCGCCC-GC-CGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCCTACGTCGCGGCTCTGTTTTATTTGTGCTCTGAGCCTTTCTCGGCGACCCTAG-CGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCAC----CGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACA-CTCGCACCGGGAGCGCGGCGCGGC-CA--CAGCCGTAAAACACCCCAAACTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__aquatica_AF409956 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGCAGAAGTTAT------------------------------------------------------AGGTCTTCTTATAGCTGCTGCCGGT---GGACCATTAAACTCTTGTTATTTTAT-GTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAATCTACTTCTTTA--TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGA-GCGTAGTAA-TTTTTT--CTCGCTTTTGTTAGGTGCTATAACTCC--CAGCCGCTAAACCCCCAATTTTTT--GTGGTTGACCTCGGATCAGGTAGAAATACCCGCTGAACTT Pestalotiopsis__maculans_AF405296 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCA-TT-GTTGCCTCGGCAGAAGCTACCCGGT--ACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTAC-CCTGGAAC-GGCTTACCCTGTAACGGCTGCCGGT---GGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGA-GCGTAGTAA-TTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAATTTTT-AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__matildae_CBS_118143 CTGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCA-TT-GTTGCCTCGGCAGAAGCTACCTGGT-TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTAC-CCTGGAAC-GGCCTACCCTGTAACGGCTGCCGGT---GGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCGGCAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGA-GCGTAGTAA-ATTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__matildae_CBS_118155 CTGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCA-TT-GTTGCCTCGGCAGAAGCTACCTGGT-TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTAC-CCTGGAAC-GGCCTACCCTGTAACGGCTGCCGGT---GGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGA-GCGTAGTAA-ATTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__microspora_AF409958 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCA-TT-GTTGCCTCGGCAGAAGCTGCTCGGTGCACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTAC-CCTGGAAC-GGCTTACCCTGCAACGGCTGCCGGT---GGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGA-GCGTAGTAA-TTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__rhododendri_AF409968 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGCAGAAGTTAT------------------------------------------------------AGGCCTTCTTATAGCTGCTGCCGGT---GGACCATTAAACTCTTGTTATTTTAT-GTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAATCTACTTCTCTTCGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGA-GCGTAGTAA-TTTTTTT-CTCGCTTTTGTTAGGTGCTATAACTCC--CAGCCGCTAAACCCCCAATTTTTT--GTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__sp_AF409961 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCA-TT-GTTGCCTCGGCAGAAGCTGCTCGGTGCACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTAC-CCTGGAAC-GGCTTACCCTGTAACGGCTGCCGGT---GGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGA-GCGTAGTAAATTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCG-TAAATCCCCCAATTTTT-AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__sp_AF409979 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCA-TT-GTTGCCTCGGCAGAAGCTACCTGGT-TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTAC-CCTGGAAC-GGCCTACCCTGTAACGGCTGCCGGT---GGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGA-GCGTAGTAA-ATTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__sp_AF409980 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCA-TT-GTTGCCTCGGCAGAAGCTACCTGGT-TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTAC-CCTGGAAC-GGCCTACCCTGTAACGGCTGCCGGT---GGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGA-GCGTAGTAA-ATTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAATTTTTTAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__sydowiana_AF409970 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGCAGAAGTTAT------------------------------------------------------AGGTCTTCTTATAGCTGCTGCCGGT---GGACCATTAAACTCTTGTTATTTTAT-GTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGA-GCGTAGTAA-TTTTTTT-CTCGCTTTTGTTAGGTGCTATAACTCC--CAGCCGCTAAACCCCCAATTTTTT--GTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__theae_AF405297 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGCAGAGGTTACCTGGT-------------------------------------AC-CTGGAGAC-AGGTTACCCTGTAGCAGCTGCCGGT---GGACTACTAAACTCTTGTTATTTTAT-GTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAATTTACAGT--------AATGTAATTCCTGAAATACAACGGCGGATCTGTGGTATCCTCTGA-GCGTAGTAA-ATTATTT-CTCGCTTTTGTTAGGTGCTGCAGCTCC--CAGCCGCTAAACCCCCAATTTTTT--GTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__versicolor_AF405298 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGCAGAAGTTAT------------------------------------------------------AGGATTTCTTATAGCTGCTGCCGGT---GGACCATTAAACTCTTGTTATTTTAT-GTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAATCTACTTCTTTA--TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGA-GCGTAGTAA-TTTTTTT-CTCGCTTTTGTTAGGTGCTATAACTCC--CAGCCGCTAAACCCCCAATTTTTT--GTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Pestalotiopsis__vismiae_AF409977 CAGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCA-TGTGAAC-TTACCA-TT-GTTGCCTCGGCAGAAGCTGCTCGGTGCACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTAC-CCTGGAAC-GGCTTACCCTGTAACGGCTGCCGGT---GGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGA-GCGTAGTAAATTTTTAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAATTTTT-AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Sarcostroma_restionis_CBS_118153 CTGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCA--TTGTTGCCTCGGCAGAAC---CTACCC----GGTACCT-----------ACCCTGTAGCGTTTTGC-CGGTGGAC--ATCTAAACTCTTGTTA-------------------------------TTTAATAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGCCGTCTGCT--TTAT----TGCAGTAGCCC--AAATCCAACGGCGGATCTGTGGTATCCTCTGA-GCGTAGTAATTTTTTT--CTCGCTTTTGTTAGGTGCTGCAGCTCC--CAGCCGCTAAAC-CCCCAATTTTTTAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Sarcostroma_restionis_CBS_118154 ----GGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCA--TTGTTGCCTCGGCAG?AC---CTACCC----GGTACCT-----------ACCCTGTAGCG?TTTGC-CGGTGGAC--ATCTAAACTCTTGTTA-------------------------------TTTAATAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGCCGTCTGCT--TTAT----TGCAGTAGCCC--AAATCCAACGGCGGATCTGTGGTATCCTCTGA-GCGTAGTAATTTTTTT--CTCGCTTTTGTTAGGTGCTGCAGCTCC--CAGCCGCTAAAC-CCCCAATTTTTTAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Seimatosporium_grevilleae_AF405304 CAGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCA--TTGTTGCCTCGGCAGAAC---CTACCC----GGTACCT-----------ACCCTGTAGCGTTTTGC-CGGTGGAC--ATCTAAACTCTTGTTA-------------------------------TTTAATAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGCCGTCTGCT--TTAT----TGCAGTGGCCC--AAATCCAACGGCGGATCTGTGGTATCCTCTGA-GCGTAGTAATTTTTTT--CTCGCTTTTGTTAGGTGCTGCAGCTCC--CAGCCGCTAAAC-CCCCAATTTTTTAATGGTTGACCTCGGA------------------------- Truncatella_angustata_AF405306 CAGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCA-CT-GTTGCCTCGGCAGATGTTGCTGGGC-GAACCTACCCTGTAGCGAGCTACTCTGTAGCGACCTAC-CCGGGAAC-GGCTTACCCTGTAGCGCCTGCCGGT---GGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAACTGGCTTT--------ACTGCCATTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATTTTTTT--CTCGTTTTTGAAATACTGTAAACC----TCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGAT------------------------ Truncatella_angustata_DQ093715 CAGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCA-CT-GTTGCCTCGGCAGATGTTGCTGGGC-GAACCTACCCTGTAGCGAGCTACTCTGTAGCGACCTAC-CCGGGAAC-GGCTTACCCTGTAGCGCCTGCCGGT---GGACTACTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAACTGGCTTT--------ACTGCCATTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATTTTTTT--CTCGTTTTTGAAATACTGTAAACC----TCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGATCAGGTAGGAAACCCG--------- Truncatella_betulae_SL1015 CTGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGTAG----TGC-------------------------CTACCCTGTAGCGAGTTAC-CCTGTAAC-GACCTACCCTGTAGCGCCTGCCGAT---GGACCATTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAGTCGACTGT--------ACTGTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATCTTTAT--CTCGTTTTTGAAATACTATAAACC----TCAGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Truncatella_hartigii_CBS_118145 -----GAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGTAG----TGC-------------------------CTACCCTGTAGCGAGTTAC-CCTGTAAC-GACCTACCCTGTAGCGCCTGCCGAT---GGACCATTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAGTCGACTGT--------ACTGTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATCTTTAT--CTCGTTTTTGAAATACTATAAACC----TCAGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Truncatella_hartigii_CBS_118148 CTGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGTAG----TGC-------------------------CTACCCTGTAGCGAGTTAC-CCTGTAAC-GACCTACCCTGTAGCGCCTGCCGAT---GGACCATTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAGTCGACTGT--------ACTGTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATCTTTAT--CTCGTTTTTGAAATACTATAAACC----TCAGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Truncatella_megaspora_PREM_58870 CTGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGTAG----TGC-------------------------CTACCCTGTAGCGAGTTAC-CCTGTAAC-GACCTACCCTGTAGCGCCTGCCGAT---GGACCATTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAGTCGACTGT--------ACTGTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATCTTTAT--CTCGTTTTTGAAATACTATAAACC----TCAGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Truncatella_restionacearum_CBS_118150 CTGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGCAG----CGC-------------------------CTACCCTGTAGCGAGTTAC-CCTGTAAC-GACCTACCCTGTAGCGCCTGCCGAT---GGACCATTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAGTCGACTGT--------ATTGTCGTTCCTCAAATCCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATCTTTAT--CTCGTTTTTGAAATACTGTAAACC----TCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Truncatella_restionacearum_CMW_18755 --------------TTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGCAG----CGC-------------------------CTACCCTGTAGCGAGTTAC-CCTGTAAC-GACCTACCCTGTAGCGCCTGCCGAT---GGACCATTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAGTCGACTGT--------ATTGTCGTTCCTCAAATCCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATCTTTAT--CTCGTTTTTGAAATACTGTAAACC----TCAGCCGCTAAACCCCCCAATTTTT-AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Truncatella_spadicea_PREM_58873 -CGCGGAGGGATCATTACAGAGTTATCTAACTCCCAAACCCA-TGTGAAC-TTACCT-TTTGTTGCCTCGGTAG----TGG-------------------------CTACCCTGTAGCGAGTTAC-CCTGTAAC-GACCTACCCTGTAGCGCCTGCCGAT---GGACCATTAAACTCTTGTTATTTTTAAGTAATCTGAGCGTCTT------ATTTTA----------------ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCT-------AGCTTAGTATTGGGAGTCGACTGT--------ACTGTCGTTCCTCAAATTCAACGGCGGATTTATAGCAATCTCTGA-ACGTAGTAATCTTTAT--CTCGTTTTTGAAATACTATAAACC----TCAGCCGCTAAACCCCCCAATTTT--AATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTT Xylaria_hypoxylon_AF201711 TGACGCAGCAGATAGCGTCTACCT-CGCGGGCTCCTACCTTGGTAGGAGC-TTGCAAGGTGGGCGC--AGGTCTGTTTTTCCATAT---TCGTAAGGCTCTCTCTTTTATTAGAGAGCGGTCTGCGCAGTGGACGCAGTTAGTTACTTACGTTGCGACATCGCAAGCGTTATTGTACAAATACTGTGGAGGTCACATAAACCTGTTT--ACTGTTATAATCTGAAATATATAAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCCCT---GTTGCTTAGCGTTGGGAGCCTACAGCCT------GCTGTAGCTCCTTAAAGGTAGTGGCGGAGTCGGTTCACACTCTAG-ACGTAGTAAAATCTTTATCTCGCCTATGGATGAGCCGGCGCC-----TTGCCGTAAAACCCCTAATCTTTCACAAGGTTGACCTCGGATCAGGTAGGAATACCCGGTGAACTT ; END; BEGIN TREES; TITLE Tb7678; LINK TAXA = Taxa1; TRANSLATE 1 Hypoxylon_schweinitzii_AF455511, 2 Xylaria_hypoxylon_AF201711, 3 Seimatosporium_grevilleae_AF405304, 4 Sarcostroma_restionis_CBS_118154, 5 Sarcostroma_restionis_CBS_118153, 6 Pestalotiopsis__theae_AF405297, 7 Pestalotiopsis__versicolor_AF405298, 8 Pestalotiopsis__rhododendri_AF409968, 9 Pestalotiopsis__sydowiana_AF409970, 10 Pestalotiopsis__aquatica_AF409956, 11 Pestalotiopsis__maculans_AF405296, 12 Pestalotiopsis__sp_AF409961, 13 Pestalotiopsis__vismiae_AF409977, 14 Pestalotiopsis__microspora_AF409958, 15 Pestalotiopsis__sp_AF409979, 16 Pestalotiopsis__sp_AF409980, 17 Pestalotiopsis__matildae_CBS_118143, 18 Pestalotiopsis__matildae_CBS_118155, 19 Bartalinia_laurina_AF405302, 20 Bartalinia_robillardoides_AF405301, 21 Truncatella_angustata_AF405306, 22 Truncatella_angustata_DQ093715, 23 Truncatella_restionacearum_CMW_18755, 24 Truncatella_restionacearum_CBS_118150, 25 Truncatella_spadicea_PREM_58873, 26 Truncatella_betulae_SL1015, 27 Truncatella_megaspora_PREM_58870, 28 Truncatella_hartigii_CBS_118148, 29 Truncatella_hartigii_CBS_118145; TREE Fig._8_MP = [&R] ((((((((29,25),28,27,26),(24,23)),(((22,21),19),20))Truncatella_clade,(((((18,17),16,15),11),(14,(13,12)))'Pestalotiopsis-A clade',(((10,(9,8)),7),6)'Pestalotiopsis-B clade')),((5,4),3)Sarcostroma_clade),1),2); END; BEGIN TREES; TITLE Tb7681; LINK TAXA = Taxa3; TRANSLATE 1 Truncatella_hartigii_CBS_118145, 2 Sarcostroma_restionis_CBS_118153, 3 Sarcostroma_restionis_CBS_118154, 4 Xylaria_hypoxylon_U47840, 5 Xylaria_curta_U47841, 6 Seiridium_cupressi_AF382378, 7 Seiridium_cardinale_AF382376, 8 Seimatosporium_vaccinii_AF382374, 9 Seimatosporium_leptospermi_AF382373, 10 Seimatosporium_grevilleae_AF382372, 11 Petalotiopsis_bicilia_AF382356, 12 Pestalotiopsis_maculans_AF382354, 13 Pestalotia_palmarum_AF382361, 14 Pestalotia_vacinii_AF382362, 15 Pestalotia_photiniae_AF382363, 16 Monochaetia_monochaeta_AF382370, 17 Discostroma_sp_AF382380, 18 Bartalinia_lateripes_AF382368, 19 Truncatella_angustata_AF382383, 20 Truncatella_laurocerasi_AF382385, 21 Bartalinia_robillardoides_AF382366, 22 Dyrithiopsis_lakefuxianensis_AF452047, 23 Truncatella_conorumpiceae_AF382384, 24 Truncatella_sp_AF382382, 25 Truncatella_restionacearum_CMW_18755, 26 Truncatella_hartigii_CBS_118148; TREE Fig._9b_NJ = [&R] ((((((((3,2),(10,9)),8),17),(((((1,26),25),(24,23)),(22,(21,18))),(20,19))),((16,(7,6)),(((15,14),13),(12,11)))),4),5); END; BEGIN TREES; TITLE Tb7680; LINK TAXA = Taxa2; TRANSLATE 1 Xylaria_hypoxylon_U47840, 2 Xylaria_curta_U47841, 3 Seiridium_cupressi_AF382378, 4 Seiridium_cardinale_AF382376, 5 Seimatosporium_vaccinii_AF382374, 6 Seimatosporium_leptospermi_AF382373, 7 Seimatosporium_grevilleae_AF382372, 8 Pestalotiopsis_bicilia_AF382356, 9 Pestalotiopsis_maculans_AF382354, 10 Pestalotia_palmarum_AF382361, 11 Pestalotia_vacinii_AF382362, 12 Pestalotia_photiniae_AF382363, 13 Monochaetia_monochaeta_AF382370, 14 Discostroma_sp_AF382380, 15 Bartalinia_lateripes_AF382368, 16 Truncatella_angustata_AF382383, 17 Truncatella_laurocerasi_AF382385, 18 Bartalinia_robillardoides_AF382366, 19 Dyrithiopsis_lakefuxianensis_AF452047, 20 Truncatella_conorumpiceae_AF382384, 21 Truncatella_sp_AF382382, 22 Truncatella_restionacearum_CMW_18755, 23 Truncatella_hartigii_CBS_118148, 24 Truncatella_hartigii_CBS_118145, 25 Sarcostroma_restionis_CBS_118153, 26 Sarcostroma_restionis_CBS_118154; TREE Fig._9_MP = [&R] (((((((26,25),(7,6)),(14,5))Discostroma_clade,(((((24,23),22),(21,20)),(19,(18,15))),(17,16))'Truncatella/Bartalinia clade'),((13,((12,11,10),(9,8))),(4,3))basal_clade),1),2); END; BEGIN TREES; TITLE Tb7679; LINK TAXA = Taxa1; TRANSLATE 1 Hypoxylon_schweinitzii_AF455511, 2 Xylaria_hypoxylon_AF201711, 3 Seimatosporium_grevilleae_AF405304, 4 Sarcostroma_restionis_CBS_118154, 5 Sarcostroma_restionis_CBS_118153, 6 Pestalotiopsis__theae_AF405297, 7 Pestalotiopsis__versicolor_AF405298, 8 Pestalotiopsis__rhododendri_AF409968, 9 Pestalotiopsis__sydowiana_AF409970, 10 Pestalotiopsis__aquatica_AF409956, 11 Pestalotiopsis__maculans_AF405296, 12 Pestalotiopsis__sp_AF409961, 13 Pestalotiopsis__vismiae_AF409977, 14 Pestalotiopsis__microspora_AF409958, 15 Pestalotiopsis__sp_AF409979, 16 Pestalotiopsis__sp_AF409980, 17 Pestalotiopsis__matildae_CBS_118143, 18 Pestalotiopsis__matildae_CBS_118155, 19 Bartalinia_laurina_AF405302, 20 Bartalinia_robillardoides_AF405301, 21 Truncatella_angustata_AF405306, 22 Truncatella_angustata_DQ093715, 23 Truncatella_restionacearum_CMW_18755, 24 Truncatella_restionacearum_CBS_118150, 25 Truncatella_spadicea_PREM_58873, 26 Truncatella_betulae_SL1015, 27 Truncatella_megaspora_PREM_58870, 28 Truncatella_hartigii_CBS_118148, 29 Truncatella_hartigii_CBS_118145; TREE Fig._8b_NJ = [&R] ((((((((29,25),(28,(27,26))),(24,23)),((22,21),(20,19))),((((18,17),(16,15)),(14,((13,12),11))),((((10,9),7),8),6))),((5,3),4)),1),2); END;