#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:57 GMT TreeBASE (cc) 1994-2008 Study reference: Bian L., & Dai Y. 2015. Coltriciella globosa and C. pseudodependens spp. nov. (Hymenochaetales) from southern China based on morphological and molecular characters. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15184] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=48; TAXLABELS Amyloporia_carbonica_AF287844 Coltricia_cinnamomea_AF311003 Coltricia_cinnamomea_AM412243 Coltricia_cinnamomea_AM412244 Coltricia_cinnamomea_Cui10494 Coltricia_confluens_AM412241 Coltricia_crassa_Dai12914 Coltricia_crassa_Yuan2213 Coltricia_macropora_Cui9019 Coltricia_macropora_Cui9039 Coltricia_minor_Dai13050 Coltricia_montagnei_AY039683 Coltricia_perennis_AF311004 Coltricia_perennis_Cui10318 Coltricia_perennis_Cui9282 Coltricia_perennis_HQ534102 Coltricia_spina_Dai13083 Coltricia_spina_HQ328521 Coltriciella_dependens_AM412248 Coltriciella_dependens_AM412249 Coltriciella_dependens_AM412250 Coltriciella_dependens_AM412251 Coltriciella_dependens_AM412253 Coltriciella_dependens_AM412254 Coltriciella_dependens_AY059059 Coltriciella_globosa_Cui7545 Coltriciella_navispora_AY059062 Coltriciella_oblectabilis_AY059061 Coltriciella_pseudode_Dai13081 Coltriciella_pseudodep_Cui8073 Coltriciella_pseudodep_Cui8138 Coltriciella_pusilla_AY059060 Coltriciella_sonorensis_HQ439179 Coltriciella_sp._TAA159956_AM412247 Coltriciella_subglobos_Wei5020 Inonotus_baumii_HQ328528 Inonotus_plorans_AY059046 Onnia_tomentosa_AF311023 Phellinus_adamantinus_AY059031 Phellinus_igniarius_HQ328533 Phellinus_mori_HQ328535 Phellinus_noxius_HQ328532 Phellinus_ribis_AF311040 Phylloporia_bibulosa_AF411824 Phylloporia_chrysita_AF411821 Phylloporia_ephedrae_AF411826 Phylloporia_pectinata_AF411823 Phylloporia_spathulata_AF411822 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M30988] TITLE Hymenochaetales_LSU; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1293; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amyloporia_carbonica_AF287844 CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTT-GGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTT------GCTTTTGCTTGGTGCACTTTCTG-GTTACGGGCCAGCATCAATTTTGACTGTTGGAAAAAGGTTGGGGGAATGTGGCACC--CTC-G-GGTGTGTTATAGCCCTCAGTCATATACAATGGTTGGGATTGAGGATCTCAGCACGCCTT--TA-TGGCC--GGGGTTCGCCCACGTTC-GTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGT{CT}TAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGCAATGAAAGTGAAAGTTGAGATCCTCG-------TCA---TGGGGAGCATCGACGCCCGGACCTGACCTTCTGTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coltricia_cinnamomea_AF311003 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGTGTTTTCTGCATTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACATGGACTACCAATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAAGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACATTCTGCAGGACTCAACCTT-GTCCTTAG-GGACTTGGTGTATTTCCTGTAGAATGGGTCAACATCAATCTTGGCCAGTGGATAAAGGGGGAGAGAATGTAGCACCT-TTGCAGG-TGTGTTATAGCTCTCTTTCATATACATTGGCTGGGATTGAGGACTGCAGCATGCCC-TC-TGGGGCCAGG-ACTTTATCTATGTCTCATGCTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCTTATGCATAATGAAAGTGAAAATTGGGAACCCAC------ATAAAT-GGGGGTGCACTGATGCCTGGCCCTGATGTTTACTGACGGTGCTACGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAACTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltricia_cinnamomea_AM412243 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTGCCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATCATGCAGGACTCAACCAT--CTCGCATATGAGATGGTGTATTTCCTGTGGGATGGGTCAACATCAATTTTGGCCAGTGGATAAAGGAGGGGGGAATGTGGCACCT-TTGCAGG-TGTGTTATAGCCCTCTTTCATATACATTGGCTGGGATTGAGGACCGCAGCATGCCCTTTATTGGGCCAGGAC-TT---CCATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTGGGAACCTCC------GTAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGCAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltricia_cinnamomea_AM412244 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATCCTGCAGGACTCAACCAT--GTCA-ACTTGATATGGTGTATTTCCTGTAGGATGGGTCAACATCAATTTTGGCCAGTGGATAAAGGAGGGGGGAATGTGGCACCT-TTGCAGG-TGTGTTATAGCCCTCTTTCATATACATTGGCTGGGATTGAGGACTGCAGCATGCCCTTG--TGGGCCAGAAC-TT---CCATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTGGGAACCTCC------GTAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGCAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltricia_cinnamomea_Cui10494 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTTAAATCTGGCAGCTTT---GTTGTCCGAGTTGTAATCTGTAGAAGTGTTTTCTGCATTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACATGGACTACCAATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAAGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACATTCTGCAGGACTCAGCCTT-GTCCTTAG-GGACTTGGTGTATTTCCTGCAGAATGGGTCAACATCAATCTTGGTCAGTGGATAAAGGAGGAGGGAATGTAGCACCT-TTGCAGG-TGTGTTATAGCCCTCTTTCATATACATTGGCTGGGATTGAGGACTGCAGCATGCCC-TC-TGGGGCCAGG-ACTT-ATC-ATGTCTCATGCTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTACGCATAATGAAAGTGAAAATTGGGAACCCATCAC--TGTAGTTGGGGGGTGCACCGATGCCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCACTTAGTTGGACTGCTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCAAGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_confluens_AM412241 CCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCC---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACCGTGTACAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTCTGTGATATGCTCTCAAAGAGTCGAGTTGCTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACATCCTGCAGGACTCAGCCTTGCCTT--GTTAGGCCTGGTGTATTTCCTGCAGGATGGGTCAACATCAATCTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCCTTGCGGG--TGTGTTATAGCCCTCCTTCATATGCACTGACTGGGATTGAGGACTGCAGCATGTCCT--TT-TGG--------------------ACATGCTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCAGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGA-CCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCT-AACCTATTCTCAAACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltricia_crassa_Dai12914 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGTTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCGTTTTCTGCATTGGACCATGTACAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCCATGACATGGACTACCAATGCTTTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCGCATCTTGCAGGACTCAGCCTT--GCCTAGT-AGGCTTGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTAGCACCT-TTGCAGG-TGTGTTATAGCCCTCCTTTGTATACATTGGCTGGGATTGAGGACTGCAGCATGCCC-TT-TGTGGCCAGG--ACTTATC-ATGTCGCATGCTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTACGCATAATGAAAGTGAAAGTTGGGAAACCTC-----TGTAA-AGGGGGTGGCACTGATGCCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCACTTTGTTGGACTGCTTGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_crassa_Yuan2213 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGTTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCGTTTTCTGCATTGGACCATGTACAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCCATGACATGGACTACCAATGCTTTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCGCATCTTGCAGGACTCAGCCTT--GCCTAGT-AGGCTTGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTAGCACCT-TTGCAGG-TGTGTTATAGCCCTCCTTTGTATACATTGGCTGGGATTGAGGACTGCAGCATGCCC-TT-TGTGGCCAGG--ACTTATC-ATGTCGCATGCTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTACGCATAATGAAAGTGAAAGTTGGGAAACCTC-----TGTAA-AGGGGGTGGCACTGATGCCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCACTTTGTTGGACTGCTTGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_macropora_Cui9019 CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGCTAT---GCTGTCCGAGTTGTAATCTGTAGAAGTGTTTTCTGCATTGGACCATGTACAAGTCTCTTGGAATAGAGTGTCATAGAGGGTGAGAATCCTGTCCATGACATGGACTACCAATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATATAGGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCATATCCTACAGGACTCAGCCTTTGTCCTTTT-GGACTTGGTGTATTTCTTGCAGGATAGGTCAACATCAGTCTTGGTCAGTGGATAAAGAAGGAGGAAATGTAGCATCTGTAATAGGGTGTGTTATAGCTCTCCCTCATATACATTGACTGGGATTGAGGACTGCAGCATGCCCTTT-TGTGGCCCTAGTGGTTTACTATGTTACATGCTTAGGATGTTGACAGAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTAGGTGGAAAACCTTTATGCATAATGAAAGTGAAAGTTGGGAACCTTC------GCAA---GGGGGTGCACTGATGCCTGGCCCTGATGTTTACTGATGGTGCTGTGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAGCCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGTTGTCACTTTATTGGATTGCTTGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_macropora_Cui9039 CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGCTAT---GCTGTCCGAGTTGTAATCTGTAGAAGTGTTTTCTGCATTGGACCATGTACAAGTCTCTTGGAATAGAGTGTCATAGAGGGTGAGAATCCTGTCCATGACATGGACTACCAATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATATAGGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCATATCCTACAGGACTCAGCCTTTGTCCTTTT-GGACTTGGTGTATTTCTTGCAGGATAGGTCAACATCAGTCTTGGTCAGTGGATAAAGAAGGAGGAAATGTAGCATCTGTAATAGGGTGTGTTATAGCTCTCCCTCATATACATTGACTGGGATTGAGGACTGCAGCATGCCCTTT-TGTGGCCCTAGTGGTTTACTATGTTACATGCTTAGGATGTTGACAGAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTAGGTGGAAAACCTTTATGCATAATGAAAGTGAAAGTTGGGAACCTTC------GCAA---GGGGGTGCACTGATGCCTGGCCCTGATGTTTACTGATGGTGCTGTGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAGCCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGTTGTCACTTTATTGGATTGCTTGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_minor_Dai13050 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGTGTTTTCTGCATTGAACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAGACTCCATCTAAGGCTAAATACAAGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACATCCTGTAGGACTCAGCCTT-GCCCTTAG-GGACTTGGTGTATTTCTTGCAGGATGGGTCAACATCAATTTTGGTCATTGGATAAGGGAGAAGGGAATGTAGCACCT-TTGCGGG-TGTGTTATAGCCCTCCTTCATATACATTGGCTGGGATTGAGGACTGCAGCATGCCCCTC-TGGGGCCAGGCAACATATCATGTTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCTTATGCATAATGAAAGTGAAAATTGGGAGCCCTT-----TATAA-TGGGGGGTGCACTGATGCCCGGCCCAGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTTGTTGGACCGCTCGATGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCAAGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_montagnei_AY039683 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGTGTTTTCTGCATTGAACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTTCATGACACGGACTACCAATGCTTTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCAAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACATTCTGCAGGATTCAACCTT----GCTAATAGGCTTGGTGTATTTCCTGTAGGATGGGTCAACATCAATTTTGGTCGGTGGATAAAGGAGTAGGGAATGTAGCACCT-TCACAGG-TGTGTTATAGCCCTTCTTTGTATACACTGGCTGGGATTGAGGACTGCAGCATGCCCCTTTGTGGGCCAGGACCTA---TCATGTCGCATGCTTAGGATGTTGGCAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTAGGAACCTCT------GTAA--GGGGGGTGCACTGATGCCCGGCCCTGATGTTTACTGATGGTGCTGTGGTGGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltricia_perennis_AF311004 CCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCT-TCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACCGTGTACAAGTCTCTTGGAAGAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTCTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACGTCCTGCAGGACTCAGCCTTGCCTTTTATTAGGCCTGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCCTTGCGGG--TGTGTTATAGCCCTCCTTCATATGTACTGACTGGGATTGAGGACTGCAGTAGGTCCT--TT-TGG--------------------ACTTGCTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCAGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTGGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltricia_perennis_Cui10318 CCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACCGTGTACAAGTCTCTTGGAAGAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTCTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACGTCCTGCAGGACTCAGCCTTGCCTTTTATTAGGCCTGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCC-TTGTGGG-TGTGTTATAGCCCTCCTTCATATGTACTGACTGGGATTGAGGACTGCAGCAAGTCC--T-TTTGGACTTG--------------------CTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCAGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCACTTTGTTGGACTGCTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACACTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_perennis_Cui9282 CCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACCGTGTACAAGTCTCTTGGAAGAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTCTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACGTCCTGCAGGACTCAGCCTTGCCTTTTATTAGGCCTGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCC-TTGTGGG-TGTGTTATAGCCCTCCTTCATATGTACTGACTGGGATTGAGGACTGCAGCAAGTCC--T-TTTGGACTTG--------------------CTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCAGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCACTTTGTTGGACTGCTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATACACACTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_perennis_HQ534102 CCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACCGTGTACAAGTCTCTTGGAAGAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTCTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACGTCCTGCAGGACTCAGCCTTGCCTTTTATTAGGCCTGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCCTTGTGGG--TGTGTTATAGCCCTCCTTCATATGTACTGACTGGGATTGAGGACTGCAGCAAGTCCT--TT-TGG--------------------ACTTGCTTAGGATGTTGACAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCAGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coltricia_spina_Dai13083 CCC-TAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGTGTTTTCTGCATTGGACCATGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACATGGACTACCAATGCTTTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAAGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACATTCTGCAGAACTCAGCCTT-GCTTTTAT-GG-CTTGGTGCATTTTCTGTAGAATGGGTCAACATCAATCTTGGTTGGTGGATAAAGGGGAAGGGAATGTAGCACCTCTTGTAGG-TGTGTTATAGCCCTCCTTCATATACATTGACTGGGATTGAGGACTGCAGCATGACC--T-TGTGGCCATG-CTTT------------------AGGATGTTGGCAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------ACAA---GGGGGTGCACTGATGCCCGGCCCAGATGTTTACTGATGGTGCTGTGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGGGCTGTCACTTTGTTGGACTGCTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCAAGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltricia_spina_HQ328521 CCC-TAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGTAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGTGTTTTCTGCATTGGACCATGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACATGGACTACCAATGCTTTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAAGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCACATTCTGCAGAACTCAGCCTT-GCTTTTAT-GG-CTTGGTGCATTTTCTGTAGAATGGGTCAACATCAATCTTGGTTGGTGGATAAAGGGGAAGGGAATGTAGCACCTCTTGTAGG-TGTGTTATAGCCCTCCTTCATATACATTGACTGGGATTGAGGACTGCAGCATGCCC--T-TGTGGCCAGG-ACTTTAAC-ATGTCCCATGCTTAGGATGTTGGCAAAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------ACAA---GGGGGTGCACTGATGCCCGGCCCAGATGTTTACTGATGGTGCTGTGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltriciella_dependens_AM412248 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTCTGCAGAACTCAGCCTT--GCCT-ATTAGGCCTGGTGTATTTTCTGTAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCT-GTGAAGG-TGTGTTATAGCCCTTTTTCATATACATTGACTGGGATTGAGGACTGCAGCATGCCCCTT-GTGGGCCAGGCTTTT----CATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGA-CCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltriciella_dependens_AM412249 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTCTGCAGAACTCAGCCTT--GCCTTATTAGGCCTGGTGTATTTTCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCT-GTGAAGG-TGTGTTATAGCCCTTTTTCATATACATTGACTGGGATTGAGGACTGCAGCATGCCCTTTTGTGGGCCAGGCTTTT----CATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coltriciella_dependens_AM412250 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTCTGTTGGACTCAGCCTT--GCCTTTT-AGGCCTGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCT-GTGAAGG-TGTGTTATAGCCCTCTTTCATATACATTGATTGGGATTGAGGACTGCAGCATGCCCCTTGTG-GGCCAGGCTTTC-----ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTAATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGA-CCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltriciella_dependens_AM412251 -CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCGTTGCACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGATTACCAATGCTTTATGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTCTGCAGAACTCAGCCTT--GCCT-ATTAGGCCTGGTGTATTTTCTACAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCT-GTGAAGG-TGTGTTATAGCCCTTTTTCATATACATTGATTGGGATTGAGGACTGCAGCATGCCCCTT-GTGGGCCAGGCTTTT----CATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGA-CCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltriciella_dependens_AM412253 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTGCCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATTCTGCAGAACTCAGCCTTTGGTGATTGAAGCCTTGGTGTACTTTCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGATGAGGGAATGTGGCACCTGTGAAGG--TGTGTTATAGCCTTCATTCATATACATTGACTGGGATTGAGGATTGCAGCATGCCCT--TTGTGGCCAGGCTTC------ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGTGCATAATGAAAGTGAAAGTTGGGAACCTCC------ACAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coltriciella_dependens_AM412254 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTGCCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATTCTGCAGAACTCAGCCTTTGGTGATTGAAGCCTTGGTGTACTTTCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGATGAGGGAATGTGGCACCTGTGAAGG--TGTGTTATAGCCTTCATTCATATACATTGACTGGGATTGAGGATTGCAGCATGCCCT--TTGTGGCCAGGCTTC------ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGTGCATAATGAAAGTGAAAGTTGGGAACCTCC------ACAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coltriciella_dependens_AY059059 CCCTTAGTAACTGTGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTGCCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATTCTGCAGAACTCAGCCTTTGGTAATT-AAACCTTGGTGTACTTTCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGATGAGGGAATGTGGCACCTGTGAAGG--TGTGTTATAGCCTTCATTCATATACATTGGCTGGGATTGAGGATTGCAGCATGCCCT--TTGTGGCCAGGCTTC------ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltriciella_globosa_Cui7545 CCCCTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTATGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTCTGTGGGACTCAACCTT---GCCTATTAGGCCTGGTGTATTTCCTGTAGGATGGGTCAACATCAATCTTGGTCAATGGATAAAGGATGAGGGAATGTGGCACCT-TTGCAGG-TGTGTTATAGCCCTCTTTCATATACATTGGCTGGGATTGAGGACTGCAGCATGCCCTTG---TGGCCAGGACATT---TCATGTTACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCT------GTAA---GGGGGTGCACCGACGCCCGGCCCTGATGTTTACTGACGGTGCTGAGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCACTTTGTTGGACTGCTTGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltriciella_navispora_AY059062 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTGCCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATTCTGCAGAACTCAGCCTT---GCCTATTAGGCCTGGTGTATTTTCTGTAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCT-GTGAAGG-TGTGTTATAGCCCTCTTTCATATACATTGACTGGGATTGAGGACTGCAGCATGCCCT--TGTGGGCCAGGCTTTC-----ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGT?AAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACGCCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltriciella_oblectabilis_AY059061 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCGTTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCACCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTTGCATTCTGCAGGACTCAGCCTT-GCCTTTATTAGGCCCGGTGTATTTCCTGCAGGATAGGTCAACATCAATTTTGGTTAGTGGATAAAGGAGGAGGGAATGTGGCACCTGTGAAGG--TGTGTTATAGCCTTCTTTCATATACATTGACTGGGATTGAGGATTGCAGCATGCCCT--TTGTGGCCAGGCTT-C-----ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACGCCCGGCCCTGATGTTTACTGATGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltriciella_pseudode_Dai13081 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTTGCATTCTGCAGAACTCAGCCTT---GCCTATTAGGCCTGGTATATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGGGGGAATGTGGCATCT-GTAAAGG-TGTGTTATAGCCCTCTTTCATATACATTGGCTGGGATTGAGGATTGCAGCATGCCCT---TGTGGCCAGACTTTT----CATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCAGTCACTTTGTTGGACTGCTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltriciella_pseudodep_Cui8073 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTTGCATTCTGCAGAACTCAGCCTT---GCCTATTAGGCCTGGTATATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGGGGGAATGTGGCATCT-GTAAAGG-TGTGTTATAGCCCTCTTTCATATACATTGGCTGGGATTGAGGATTGCAGCATGCCCT---TGTGGCCAGACTTTT----CATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCAGTCACTTTGTTGGACTGCTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltriciella_pseudodep_Cui8138 CCCCTAGTA-CTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTTGCATTCTGCAGAACTCAGCCTT---GCCTATTAGGCCTGGTATATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGGGGGAATGTGGCATCT-GTAAAGG-TGTGTTATAGCCCTCTTTCATATACATTGGCTGGGATTGAGGATTGCAGCATGCCCT---TGTGGCCAGACTTTT----CATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCAGTCACTTTGTTGGACTGCTCGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Coltriciella_pusilla_AY059060 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCGTTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGATTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTTGCATTCTGCAGGACTCAGCCTT--GCCTTATTAGGCCCGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCT-GTGAAGG-TGTGTTATAGCCTTCTTTCATATACATTGACTGGGATTGAGGATTGCAGCATGCCCT--TTGTGGCCAGACTTC------ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCACAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Coltriciella_sonorensis_HQ439179 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTTGCATTCTGTAGGACTCAGCCTT-GCCTTTATTAGGCT{CT}GGTGTATTTCCTGCAGGATAGGTCAACATCAATTTTGGTTAGTGGATAAAGGAGGAGGGAATGTAACACCTGTGAAGGGGTGTGTTATAGCCTTCTTTCATATACATTGACTGGGATTGAGGATTGCAGCATGCCCT--TTGTGGCCAGGCTTTC-----ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGTGCATAATGAAAGTGAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGAC{AG}CCCGGCCCTGATGTTTACTGATGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coltriciella_sp._TAA159956_AM412247 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTCT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTCTGCAGAACTCAGCCTT---GCCTATTAGGCCTGGTGTATTTCCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGAGGGAATGTGGCACCT-GTGAAGG-TGTGTTATAGCCCTCTTTCATATACATTGACTGGGATTGAGGACCGCAGCATGCCCC-TTGTGGGCCAGGCTTTC-----ATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCC{CGT}TCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTAAAAGTTGGGAACCTCC------GCAA---GGGGGTGCACTGACACCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coltriciella_subglobos_Wei5020 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGCTTT---GCTGTCCGAGTTGTAATCTGTAGAAGCATTTTCTGCATTGGACTGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACAGACTACCAATGCTTTGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGATGTCAGTTTCATTCTGCAGAACTCAGCCTT--GCCT-ATTAGGCTTGGTGTATTTTCTGCAGGATGGGTCAACATCAATTTTGGTCAGTGGATAAAGGAGGGGGGAATGTGGCACCT-GTGAAGG-TGTGTTATAGCCCTCTTTCATATACATTGACTGGGATTGAGGACTGCAGCATGCCCCTTATGGGGCCAGACTTTT----CATGTCACATGCTTAGGATGTTGACAAAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTGTTTGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAACTTCC------GCAA---GGGGGTGCACCGACGCCCGGCCCTGATGTTTACTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCACTTTGTTGGACTGCTTGACGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAGGTTAAGGTGCCGGAATGTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAG Inonotus_baumii_HQ328528 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGCCTCCTGGTCGTCCGAGTTGTAGTCTGGAGAAGTGTTATCCGCGTCGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACC-CCGATGCTATGTGAGGCACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCCGTGGAACTCAGCCTG------GTTTCGACCTGGTGTACTTTCCATGTGACGGGTCAACATCAATTTCGACCGGTGGACAAGGGCGAGGGGAATGTAGCGTGGCTTC-GGGACGTGTTATAGCCCCCCGTCGTATACACTGGCTGGGATTGAGGACCGCAGCACGCCCT--TG-TGGCCGGGGG-TTCGCCCACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTCGGGTGGAAAACCCTTGCGCGTAATGAAAGTGAAAGTTGGGAACCTCC------GCGA---GGGGGTGCACCGACGCCCGGCCCTGACGTTCTCTGACGGTGCCGCGGTAGAGCACGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Inonotus_plorans_AY059046 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTCTGTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGTTATCCGCGTCGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGGCACGGACC-CCGATGCTATGCGAGGCACTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTATGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTCCCGTAGAACTCAGCCTG------GCTTCGGCCTGGTGTATTTTCTATGTGACGGGTCAGCATCAGTTTTGGACGGTGGAAAAAGGCAGAGGGAATGTAGCGCCGCTTC-GGGGCGTGTTATAGCGCTTTGTCAAATACACTGGCTGGGACTGAGGACTGCAGCACGCCCT--TG-TGGCCGGGGGGTTCGCCCACGTATCGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTCGGGTGGTAAACCCTTGCGCGGAATGAAAGTGAAAGTTGGGAAGCTTC------GAGA---GGGGCTGCACCGACGCCCGGCCCTGACGTTCTCTGACGGTGCTGCGGTAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Onnia_tomentosa_AF311023 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTCTTCTGGCCGTCCGAGTTGTAACCTGGAGAAGTGTTTTCCGCGTCGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACCACCGATGCTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTCACGGAACTCAGCCTT------GCTTCGGCTTGGTGTACTTTCTGTGTGACGGGTCAACGTCAATTTTGGTCGGCGGAGAAAGGTTGAGGGAATGTGGCGCCGTTTC-GGGACGTGTTATAGCCCTCTTCCGCATACGTCGGCTGGGATTGAGGACCGCAGCGCGCCTT--TAATGGCCGGGGG-TTCGCCCACGTACCGCGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTCGGGTGGAAAACCCTTGCGCGTAATGAAAGTGAAAGTTGGGAGCCTCC------GTAA---GGGGGTGCACCGACGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCACGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phellinus_adamantinus_AY059031 CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTTTT---GCTGTCCGAGTTGTAATCTGGAGAAGTGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTCTGTGATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTACTAGACTCAGCTTT------GCTTCGGCTTAGTGTACTTCTAATAAGACGGGTCAACATCAATTTTGGTCGGTGGAAAAAGGTTTGAGAAATGTAGCGTATCTTCGGGTACGTGTTATAGTCTCTTACTGTATACACTGGCTGGGATTGAGGTCTGCAGCACGCCTT--TA-TGGCC--AGGGTTCGCCCATGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTAGGGTGGAAAACCCTTGTGCGTAATGAAAGTGAAAGTTGGGAACTCTC------GCAA---GGGAGTGCACCGACGCCCGGCCCTGAAGTTTACGGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phellinus_igniarius_HQ328533 CCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCGGGCTC-TGCTCGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGCGTCGGACCGTGCACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGGCACGGACCGCCGATGCTTTGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGACGGAACTCAGCCTT------GCTTCGGCCTGGTGTACTTTCTGT-CGACGGGTCAACATCAGTTTTGACCGGTGGAAAAAGGTAGGGGGAATGTAGCGCCGCTTC-GGGGCGTGTTATAGCCCCTTGCTGTATGCATCGGTCGGGACTGAGGACCGCAGCACGCCTT--TT-TGGCCGGGGG-TTCGCCCACGTACCGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCCAACATGCTTGCGAGTGTTCGGGTGGAAAACCCTTGCGCGTAATGAAAGTAACAGTTGGGAACCTCC------GCAA---GGGGGTGCACCGACGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCAAGTATGCTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phellinus_mori_HQ328535 CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTTAAATCTGGCGGTCTCCTGGCCGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGCGTCGGACCGTGCACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGGCACGGACCGCCGATGCTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCGGCAGAACTCAGCCTT------GCTTCGGCCTGGTGTACTTTCTGT-CGACGGGTCAACATCAGTTTTGACCGGTGGAGAAAGGCGAGGGGAATGTAGCGCCGTTTC-GGGGCGTGTTATAGCCCCCCGTCAGATACACCGGCTGGGACTGAGGACCGCAGCACGCCTT--TT-TGGCCGGGGG-TTCGCCCACGTACCGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCCAACATGCTTGCGAGTGTTCGGGTGGAAAACCCTTGCGCGTAATGAAAGTGACAGTTGGGAACCTCC------GCAA---GGGGGTGCACCGACGCCCGGCCCTGACGTTCTCTGACGGTGCTGCGGTAGAGCAAGTATGCTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phellinus_noxius_HQ328532 CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTTTT---GCTGTCCGAGTTGTAATCTGGAGATGTGTTTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACTACCAATGCTTTGTGATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTTGCTAGACTCAGCTTT------GCTTCGGCTTAGTGTATTTCTAGTC-AACGGGTCAACATCAATTTTGGTCGGTGGAAAAAGGCTTGAGAAATGTAGCGTGCCCTCTGGTGCGTGTTATAGACTCTTGCTGTATACACTGGCTGGGATTGAGGACTGCAGCACGCCTT--TA-TGGCC--AGGGTTCGCCCATGTAACGTGCTTAGGATGTTGACATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCCTGCGAGTATTAGGGTGGAAAACCCTTGTGCGTAATGAAAGTGAAAGTTGGGAACTCTC------GCAA---GGGAGTGCACCGACGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phellinus_ribis_AF311040 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCGGCCTCT-GGCCGTCCGAGTTGTAATCTGTAGAGGCGTCGTCCGCGTCGGCCCGTGTATAAGTCTCCTGGGATGGGGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACCGCCGATGCTCTGTGAGGAGCCCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATCGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTCCTGGCATTCAGCCTT------GCTTCGGCTTGGTGTACTTGCCTCG-GATGGGTCAACGTCAATTTTGGCTGGTGGACAAGGGTGAGGGGAATGTAGCGTGGTTTC-GGGACGTGTTATAGCTCCTTGTCGAATGCACCGGCTGGGATTGAGGATCGCAGCACGCCCT--TG-TGGCC-GGGGGTTCGCCCACGTAACGTGCTTAGGACGTTGGCATAATGGCTTTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTGTTCGGGTGGAAAACCCTTGCGCGTAATGAAAGTGAAAGTTGGGAACCTCCTTCCCTGTGTC--GGGGGTGCACCGACGCCCGGCCCTGAGGTTCTCTGATGGTGCTGCGGTAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phylloporia_bibulosa_AF411824 CCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTGTAATCTGGCGGCCTCT-GGCCGTCCGAGTTGTAATCTGTAGAGGCGTTGTCTGTGTCGGTCCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGGCCACCGATGCACTGTGAGGCGCCCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATATGGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATCGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTTAAGGCACTCAGCCTT------GCTTTCGCTTGGTGTACTTGCCTTG-AATGGGTCAACATTAATTTTGGCTGGTGGATAAGGGCGAGGGGAATGTAGCGTCATTTC-GGGGCGTGTTATAGCCTCTCGTCGAATGCATTAGTTAGGATTGAGGAATGCAGCACGCCCT--GG-TGGCC-AGAGGTTCCCCTATGTAACGTGCTTTGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTCGGGTGGAAAACCCTTGCGCGTAATGAAAGTGAAAGTTGGGAGCCTCC------GTGA---GGGGGTGCACTGACGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTGGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phylloporia_chrysita_AF411821 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGACGGTCTTT-GGCCGTCCGAGTTGTAATCTGTAGAGGCGTCGTCCGCGTCGGCCCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCGATGACATGGACCGCCGATGCTCTGTGAGGTGCCCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTTCGTGGCACTCAGCCTT------GCTTCGGCTTGGTGTACTTGCCTTG-GACGGGTCAACATCAATTTTGGCCGGTGGACAAGGGTGAGGGGAATGTGGCGTTGTTTC-GGGACGTGTTATAGCCCCTTGTCGAACACGCCGGCTGGGATTGAGGATCGCAGCACGCCCT--CG-AGGCCTAGGGGTTCGCCCATAGAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTGTTCGGGTGGAAAACCCTTGCGCGTAATGAAAGTGAAAGTTGGGAGCCTCC------GTGA---GGGGGTGCACTGACGCCCGGCCCTGAGGTTCTCTGATGGTGCTGCGGTAGAGCAAGCAGGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phylloporia_ephedrae_AF411826 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCGGTCCCT-GGCCGTCCGAGTTGTAATCTGTAGAGGCGTCGTCCGCGTCGGCCCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACCACCGATGCTCTGTGAGGTGCCCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTGGAGGCACTCAGCCTT------GCTTCGGCTTGGTGTACTTGTCTTG-GATGGGTCAACATCAATTTTGGCCGGCAGACAAGGGTGAGGGGAATGTAGCGTCGTTTC-GGGACGTGTTATAGCCTTTCATCGAATATGCCGGCTGGGATTGAGGACCGCAGCACGCCCT--TG-TGGCCGGAGGTTACGCCTACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTCGGGTGGAAAACCCTTGCGCATAATGAAAGTGAAAGTTGGGAGCCTCC------GCAA---GGGGGTGCACCGACGCCCGGCCCTGACGTTCTCTGACGGTGCTGCGGTAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phylloporia_pectinata_AF411823 CCCTTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCGGTCTCT-GGCCGTCCGAGTTGTAATCTGTAGAGGCGTCGTCCGCGTCGGCCTGTGTACAAGTCTCCTGGAATGGAGCATCATAGAGGGTGAGAATCCCGTCTGTGACACAGACCACCGATGCTCTGTGAGGTGCCCTCGAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCCCGTGGCACTCAGCCTT------GCTTCGGCTTGGTGTACTTGCTTTG-GATGGGTCAACGTCAATTTTGGCCGGTGGACAAGGGTGGGGGGAAGGTGGCATCGTTTC-GGGATGTGTTATAGCCCCTCGTCAAATACGCGGGCCGGGATTGAGGATCGCAGCACGCCCT--TG-TGGCCGAGGGTTTTGCCCACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTTGGGTGGAAAACTCTTGCGCGTAATGAAAGTGAAAGTTGGGAGCCTCC------GTGA---GGGGGTGCACCGACGCCCGGCCCTGACGTTCTCTGACGGTGCTGCGGTAGAGCAAGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Phylloporia_spathulata_AF411822 CCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCGGTCTTC-GACCGTCCGAGTTGTAATCTGTAGAGGTGTCGTCCGCGTCGGCCTGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCCATGACATAGACCACCGATGCTTTGTGAGGCACCCTTGAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAGGCTAAATACCGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCAGTCGCATCCCAGGGCATTCAGCCTT------GCTTCGGCTTGGTGTACTTGCCTTG-GATGGGTCAACATCGATTTTGGTCGGCGGATAAGGATAAGAGGAATGTAGCGTTGCTTC-GAGACGTGTTATAGCCTCTTGTCAGATGCGTCGACTGGGATTGAGGACTGCAGCATGCCCT--TG-TGGCT-GGGGGTTCGCCTACATAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCAAGTGTTTGGGTGGAAAATCCTTGCGCATAATGAAAGTGAAAGTTGGGAGCCTCCTTCCAAGGGG---GGGGGTGCACCGACGCCCGGCCCCGAAGTCTTCTGACGGTGCTGCGGTAGAGCAGGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ ; END; BEGIN TREES; TITLE Consensus_Tree; LINK TAXA = Taxa1; TRANSLATE 1 Amyloporia_carbonica_AF287844, 2 Coltricia_cinnamomea_AF311003, 3 Coltricia_perennis_AF311004, 4 Onnia_tomentosa_AF311023, 5 Phellinus_ribis_AF311040, 6 Phylloporia_chrysita_AF411821, 7 Phylloporia_spathulata_AF411822, 8 Phylloporia_pectinata_AF411823, 9 Phylloporia_bibulosa_AF411824, 10 Phylloporia_ephedrae_AF411826, 11 Coltricia_confluens_AM412241, 12 Coltricia_cinnamomea_AM412243, 13 Coltricia_cinnamomea_AM412244, 14 Coltriciella_sp._TAA159956_AM412247, 15 Coltriciella_dependens_AM412248, 16 Coltriciella_dependens_AM412249, 17 Coltriciella_dependens_AM412250, 18 Coltriciella_dependens_AM412251, 19 Coltriciella_dependens_AM412253, 20 Coltriciella_dependens_AM412254, 21 Coltricia_montagnei_AY039683, 22 Phellinus_adamantinus_AY059031, 23 Inonotus_plorans_AY059046, 24 Coltriciella_dependens_AY059059, 25 Coltriciella_pusilla_AY059060, 26 Coltriciella_oblectabilis_AY059061, 27 Coltriciella_navispora_AY059062, 28 Coltricia_perennis_Cui10318, 29 Coltricia_cinnamomea_Cui10494, 30 Coltriciella_globosa_Cui7545, 31 Coltriciella_pseudodep_Cui8073, 32 Coltriciella_pseudodep_Cui8138, 33 Coltricia_macropora_Cui9019, 34 Coltricia_macropora_Cui9039, 35 Coltricia_perennis_Cui9282, 36 Coltricia_crassa_Dai12914, 37 Coltricia_minor_Dai13050, 38 Coltriciella_pseudode_Dai13081, 39 Coltricia_spina_Dai13083, 40 Coltricia_spina_HQ328521, 41 Inonotus_baumii_HQ328528, 42 Phellinus_noxius_HQ328532, 43 Phellinus_igniarius_HQ328533, 44 Phellinus_mori_HQ328535, 45 Coltriciella_sonorensis_HQ439179, 46 Coltricia_perennis_HQ534102, 47 Coltriciella_subglobos_Wei5020, 48 Coltricia_crassa_Yuan2213; TREE MJ_Con_of_14_MPTs = [&R] (1:29.0,((4:19.0,((43:19.5,44:8.5):12.5,(23:27.5,41:15.0,(8:25.0,((5:19.0,6:20.0):4.0,(10:13.0,(7:44.0,9:37.0):4.0):7.0):1.5):13.25):7.75):10.5):18.5,((22:10.0,42:13.0):32.5,((21:25.0,(39:3.0,40:2.0):17.0):11.0,(((36:0.0,48:0.0):11.0,((33:0.0,34:0.0):41.0,(37:23.0,(2:11.0,29:9.0):6.0):8.5):6.0):5.0,((11:6.0,(3:3.0,46:1.0,(28:0.0,35:0.0):3.0):2.5):12.5,((30:16.0,(12:8.0,13:3.0):6.0):4.5,(((14:3.5714285714285716,27:4.428571428571429):1.8571428571428572,(16:1.4285714285714286,(15:1.0,18:6.0):0.5):1.2857142857142858):1.7857142857142858,(17:9.285714285714286,25:5.142857142857143,47:10.571428571428571,(31:0.0,32:0.0,38:0.0):8.571428571428571,((26:4.0,45:4.0):7.857142857142857,(24:4.0,(19:0.0,20:0.0):1.5):7.071428571428571):7.0):2.0):5.857142857142857):9.0):9.0):7.0):22.25):8.0):26.0):0.0; END;