#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 19:29 GMT TreeBASE (cc) 1994-2008 Study reference: Spalik K., & Downie S. 2006. The evolutionary history of Sium sensu lato (Apiaceae): dispersal, vicariance, and domestication as inferred from ITS rDNA phylogeny. American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1524] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=59; TAXLABELS Afrocarum_imbricatum_1 Afrocarum_imbricatum_K132 Berula_erecta_erecta_150 Berula_erecta_erecta_4 Berula_erecta_erecta_K185 Berula_erecta_incisa_1111 Berula_erecta_incisa_1530 Berula_erecta_incisa_1816 Berula_erecta_incisa_2157 Berula_erecta_incisa_6 Berula_erecta_incisa_K198 Berula_erecta_incisa_K199 Berula_erecta_orientalis_2 Berula_erecta_orientalis_3 Berula_erecta_orientalis_E111 Berula_erecta_orientalis_E116 Berula_erecta_thunbergii_5 Berula_erecta_thunbergii_799 Berula_erecta_thunbergii_E112 Berula_erecta_thunbergii_E113 Cicuta_virosa Cryptotaenia_canadensis Cryptotaenia_japonica Helosciadium_bermejoi Helosciadium_crassipes Helosciadium_inundatum_64358 Helosciadium_nodiflorum_1871 Helosciadium_nodiflorum_919 Helosciadium_nodiflorum_E120 Helosciadium_repens Neogoezia_breedlovei Neogoezia_planipetala Oenanthe_fistulosa Oxypolis_occidentalis 'Sium bracteatum-burchellii' Sium_frigidum_109 Sium_frigidum_2337 Sium_latifolium_8 Sium_latifolium_9 Sium_medium_10 Sium_medium_11 Sium_medium_12 Sium_ninsi Sium_repandum Sium_serra Sium_sisaroideum_16 Sium_sisaroideum_E128 Sium_sisaroideum_E132 Sium_sisarum_15 Sium_sisarum_388 Sium_suave_1494 Sium_suave_17 Sium_suave_18 Sium_suave_19 Sium_suave_GB Sium_suave_K124 Sium_suave_K182 Sium_suave_K197 Sium_tenue ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1137] TITLE ITS_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=627; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=. GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Afrocarum_imbricatum_1 TCGAATCCTGCAATAGCAAAAAGACCCGCTAACATGT--AAACATATTGGGCAAGCGT-CGGGGG-GGC-TAATGCC--CGTCCTCGGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCCGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGGAGAACTGAATTGCACGTGCGCCCCCCGTACGCAGGAGGCGTCGTCATTCCGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCCAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTCTCACTCCCCTAGGGGAGCT-GGTCCTGTCTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGACGTGGCGACATCGGTGGTTGT---AAAATGACCCTCTCGTCTTGTCGTGCCAATGCCTGTC-ACCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACGCTATGTGCGCTTCAA Afrocarum_imbricatum_K132 TCGAATCCTGCAATAGCAAAAAGACCCGCTAACATGT--AAACATATTGGGCAAGCGT-CGGGGGGGGC-TAATGCC--CGTCCTCGGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCCGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AATGGAGAACTGAATTGCACGTGCGCCCCCCGTACGCAGGAGGCGTCGTCATTCCGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCCAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCTAGGGGAGCT-GGTCCTGTCTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGATGTGGCGACATCGGTGGTTGT---AAAATGACCCTCTCGTCTTGTCGTGCCAATGCCTGTC-ACCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACGCTATGTGCGCTCCAA Berula_erecta_erecta_150 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGATG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAGTCGAACTGAATTGCACGCGCGCCTCCTGTACGCAGGAAGCGTGGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACATCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGGCAATGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_erecta_4 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGATG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAGTCGAACTGAATTGCACGCGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACATCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGGCAATGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_erecta_K185 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGCTG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAGTCGAACTGAATTGCACGCGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACATCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCCACGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCCTGGCAATGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_incisa_1111 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC-CCGTCTTCAGCGAACCCC-{AT}GGTAGGTGGCCCTTC-GGGTG-CCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAATAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCACCTCGTTGCCCCC--GACCTCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGATGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTCGTCTTGTCGTGCCAATGCCTGTT-GCCTTAGTGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_incisa_1530 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC-CCGTCTTCAGCGAACCCC-{AT}GGTAGGTGGCCCTTC-GGGTG-CCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAATAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCACCTCGTTGCCCCC--GACCTCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGATGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTCGTCTTGTCGTGCAAATGCCTGTT-GCCTTAGTGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_incisa_1816 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCCCCCGTCTTCAGCGAACCCC-{AT}GGTAGGTGGCCCTTC-GGGTG-CCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAATAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCACCTCGTTGCCCCC--GACCTCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGATGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTCGTCTTGTCGTGCCAATGCCTGTT-GCCTTAGTGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_incisa_2157 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG-GGC-TTATGCC-CCGTCTTCAGCGAACCCC-{AT}GGTAGGTGGCCCTTC-GGGTG-CCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAATAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCACCTCGTTGCCCCC--GACCTCTC--ACTCCCCTAGGTGAGCT-GG-CGCGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGATGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTCGTCTTGTCGTGCCAATGCCTGTT-GCCTTAGTGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_incisa_6 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC-CCGTCTTCAGCGAACCCC-{AT}GGTAGGTGGCCCTTC-GGGTG-CCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAATAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCACCTCGTTGCCCCC--GACCTCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGATGGACGTCGCGACATCGGTGGTTGT---AAGAAGACCCTCTCGTCTTGTCGTGCAAATGCCTGTT-GCCTTAGTGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_incisa_K198 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC-CCGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTG-CCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAATAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCACCTCGTTGCCCCC--GACCTCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGATGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTCGTCTTGTCGTGCCAATGCCTGTT-GCCTTAGTGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_incisa_K199 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-CTATGCC-CCGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTG-CCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAATAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCACCTCGTTGCCCCC--GACCTCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGGGCGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGATGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTCGTCTTGTCGTGCCAGTGCCTGTT-GCCTTAGTGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_orientalis_2 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCT-AGGTAGGTGGCCCTTT-GGGTGCCCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAGTTGAACTGAATTGCACGCGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACATCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGGCAATGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_orientalis_3 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAGTCGAACTGAATTGCACGCGCACCTCCTGTACGCAGGAAGCGCCGTCATTCTGAAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACATCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGGCAATGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_orientalis_E111 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCTGCCTACGAAATTGGGCGCCGAAAGCGCCAAGG-AAAGTCGAACTGAATTGCACGCGCACCTCCTGTACGCAGGAAGCGCCGTCATTCTGAAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACATCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGGCAATGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACACTCTGTGCGCTTCAA Berula_erecta_orientalis_E116 TCGAATCCTGCGATAGCAAAATGACCCGCTAACATGT-AAAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCT-AGGTAGGTGGCCCTTT-GGGTGCCCACCTGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AAAGTTGAACTGAATTGCACGCGCGCCTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACATCTC--ACTCCCCTAGGTGAGCT-GGGCCTGTCTGGGGG-CGGTTAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGGCAATGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGCTGCCACACACTCTGTGCGCTTCAA Berula_erecta_thunbergii_5 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAACATATTGGGCAAGCGT-AGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCCGCCAACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGTGTCGTCATTCTGAAA-CGAAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCTAGGGGAGCT-GTGCTTGTTTGGGGG-CGGATGATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTCTC--GGCGACGGATGTCGCGACATCGGTGGTTGTTGTAAAAAGACCCTCTCGTCTTGTCGTGCCAAAGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GGCACACACTCTGTGCGCTTCAA Berula_erecta_thunbergii_799 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAACATATTGGGCAAGCGT-AGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCCGCCAACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGTGTGGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCTAGGGGAGCT-GTGCTTGTTTGGGGG-CGGATGATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTCTC--GGCGACGGATGTCGCGACATCGGTGGTTGTTGTAAAAAGACCCTCTCGTCTTGTCGTGCCAAAGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GGCACACACTCTGTGCGCTTCAA Berula_erecta_thunbergii_E112 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAACATATTGGGCAAGCGT-AGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCCGCCAACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGTGTCGTCATTCTGAAA-CGCAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCTAGGGGAGCT-GTGCTTGTTTGGGGG-CGGATGATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTCTC--GGCGACGGATGTCGCGACATCGGTGGTTGTTGTAAAAAGACCCTCTCGTCTTGTCGTGCCAAAGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GGCACACACTCTGTGCGCTTCAA Berula_erecta_thunbergii_E113 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAACATATTGGGCAAGCGT-AGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCCGCCAACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGTGTCGTCATTCTGAAA-CGCAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGGTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCTAGGGGAGCT-GTGCTTGTTTGGGGG-CGGATGATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTCTC--GGCGACGGATGTCGCGACATCGGTGGTTGTTGTAAAAAGACCCTCTCGTCTTGTCGTGCCAAAGCCTGTT-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GGCACACACTCTGTGCGCTTCAA Cicuta_virosa TCGAATCCTGCGATAGCAAAATGACCCGGTAACGTGT--AAACTCATTGGGCAAGCGT-CGGGGG--GC-CTGGGTC--CCTCGTCTGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGGAAAACTAAAATTGAATTGCACGTGC-CTTCCCGTACGCGGGAAGCGTCGTCATTTTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCACTC--ACTCCCTCAGGGGAGCT-AGGCCGGTTTGGGG--CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAGCGAGACTTTT--GGCGACGGACGTCGTGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGCGCCAATGCCCGTC-GCCTTATCGAGCTCAAGGACCCC-AAGGC-GCCACATATTGTGTGCGCTTCGA Cryptotaenia_canadensis TCGAATCCTGCGATAGCAAAATGACCTGCTAACATGT--AAACACATTGGGCAAGCGT-CGGGGG--GC-CTGGGCC--TCACGTCAGTGAACCCC-AGGCCGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGGAAAAGTAAAACTGAATTGCACGTGTGCTTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-TAGGCCAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCACTC--ACTCCCTTGGGGGACGT-GGGCCGGTTTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTCTTCGAGCGACGGACGTCGCGACATCGATGGTTGT---AAAAATTCCCTCTTGTATTGTCGTGCCAATGCCTGTC-GCCTTAACGAGCTCAAGGACCCC-AAGGC-GCCACATACCGTGTGCGCTTCGA Cryptotaenia_japonica TCGAATCCTGCGATAGCAAAATGACCCGCTAACATGT--AAACACATTGGGCAAGCGT-CGGGGG--GC-TTGGGCC--TCACGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAATTAAAACCGAATTGCACGCGCGCTTCCTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-TAGGCCAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCACTC--ACTCCCTTGGGGGACGT-GGGCCGGTTTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTCTTCTAGCGACGGACGTCGCGACATTGATGGTTGT---AAAAAATCCCTCTTTTCTTGTCGTGCCAATGCCCGTC-GCCTTAATGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTCCGA Helosciadium_bermejoi TCGAATCCTGCAATAGCAAAATGACCAGCTAACATGT--TAACACATTGGGAGAGCGC-CGGGGG--GC-TTGTTCC--TCTCGCCAGCGAACCCC-AGGAAGGTGGCCCTCA-GGGTGCCCACCGGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AATGTAAAACTGAATTGCACGTGCGCTTCTTGTTCGCAGGAAGTGTCGTCATTCTGGAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCC--GACCAT--------------------T-ATAC-GGTATGGGGG-CGGACAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAGATGAGTCTTTT--GGCGGCGGACGTCGCGACATCGGTGGTTGT---AAAAATACCCTCTTGTCTTGTCGTGCCAATGCCCGTC-GCCTTATGGAGCTCAAGGACCTC-TAGGC-GCCACAAACTGTGTTCGCTTTGA Helosciadium_crassipes TCGAATCCTGCAATAGGGAAATGACCAGCTAACATGTTAAAACACATTGGGCGAGCGT-CGGGGG--GC-TTGCGCC--TCCCGTCAGCGAACCCC-GGGTAGGTGGCCCTTA-GGGTGCCCACCGGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AATGTAAAACTGAAATGAACGTGCGCTTCTTGTTCGCAGGAAGTGTCGTCATTGC{AG}{GT}AA-CCCCAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCGT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCGT{CT}GTGTTGCCCCC--GACCAT--------------------T-ATGC-GGTATGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTTCAAAGATGAGTCTTTT--GGCGGTGGACGTCGCGACATCGGTGGTTGT---AAAAATACCCTCTTGTCTTGTTGTGCCAATGCCCGTCCGCCTTATGGAGCTCAAGGACCTC-TAGGC-GCCACAGACTGTGATCGCTTTGA Helosciadium_inundatum_64358 TCGAATCCTGCAATAGGAAAATGACCGGCTAACATGT--AAACACATTGGGCGAGCGT-CGGGGG--GC-TTGCGCC--TCACGTCAGCGAACCCC-AGGTAGGTGGCCCTTA-GGGTGCCCACCGGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AATGTAAAACTGAAATGAACGTGCGCTTCTTGTTCGCAGGAAGTGTTGTCATTGCGGAA-CCCCAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCGTCGCGTTGCCCCC--GACCAT--------------------T-ATAC-GGTATGGGAG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTTCAAAGATGAGTCTTTT--GGCGGCGGACGGCGCGGCATCGGTGGTTGT---AAGAATACCCTCTTGTCTTGTCGTGCCAATGCCCGTC-GCCTTATGGAGCTCAAGGACCTC-TAGGC-GCCACAAACTGTGATCGCTTTGA Helosciadium_nodiflorum_1871 TCGAATCCTGCTATAGCAAAATGACCAGCTAACATGT--TAACACATTGGGAGAGCGC-CGGGGG--GC-TTGTGCC--TCTCGCCAGCGAACCCC-GGGAAGGTGGCCCTCA-GGGTTCCCACCGGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AATGTAAAACTGAATTGCACGTGCGCTTCTTGTTCGCAGGAAGTGTCGTCATTCTGGAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCC--GACCAT--------------------T-ATAC-GGTATGGGGG-CGGACAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTACAAAGATGAGTCTTTT--GGCGGCGGATGTCGCGACATCGGTGGTTGT---AAAAATACCCTCTTGTCTTGTCGTGCCAATGCCCGTC-GCCTTATGGAGCTCAAGGACCTC-TAGGC-GCCACAAACTGTGTTCGCTTTGA Helosciadium_nodiflorum_919 TCGAATCCTGCTATAGCAAAATGACCAGCTAACATGT--TAACACATTGGGAGAGCGC-CGGGGG--GC-TTGTGCC--TCTCGCCAGCGAACCCC-GGGAAGGTGGCCCTCA-GGGTTCCCACCGGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AATGTAAAACTGAATTGCACGTGCGCTTCTTGTTCGCAGGAAGTGTCGTCATTCTGGAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCC--GACCAT--------------------T-ATAC-GGTATGGGGG-CGGACAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTACAAAGATGAGTCTTTT--GGCGGCGGACGTCGCGACATCGGTGGTTGT---AAAAATACCCTCTTGTCTTGTCGTGCCAATGCCCGTC-GCCTTATGGAGCTCAAGGACCTC-TAGGC-GCCACAAACTGTGTTCGCTTCGA Helosciadium_nodiflorum_E120 TCGAATCCTGCTATAGCAAAATGACCAGCTAACATGT--TAACACATTGGGAGAGCGC-CGGGGG--GC-TTGTGCC--TCTCGCCAGCGAACCCC-GGGAAGGTGGCCCTCA-GGGTTCCCACCGGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AATGTAAAACTGAATTGCACGTGCGCTTCTTGTTCGCAGGAAGTGTCGTCATTCTGGAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCC--GACCAT--------------------T-ATAC-GGTATGGGGG-CGGACAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTACAAAGACGAGTCTTTT--GGCGGCGGACGTCGCGACATCGGTGGTTGT---AAAAATACCCTCTTGTCTTGTCGTGCCAATGCCCGTC-GCCTTATGGAGCTCAAGGACCTC-TAGGC-GCCACAAACTGTGTTCGCTTTGA Helosciadium_repens TCGAATCCTGCAATAGCAAAATGACCAGCTAACATGT--TAACACATTGGGAGAGCGC-CGGGGG--GC-TTGTGCC--TCTCGCCAGCGAACCCC-AGGAAGGTGGCCCTCA-GGGTGCCCACCGGCCTACGAAATTGGGCGCGGAAAGCGCCAAGG-AATGTAAAACTGAATTGCACGTGCGCTTCTTGTTCGCAGGAAGTGTCGTCATTCTGGAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCC--GACCAT--------------------T-ATAC-GGTATGGGGG-CGGACAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAGATGAGTCTTTT--GGCGGCGGACGTCGCGACATCGGTGGTTGT---AAAAGTACCCTCTTGTCTTGTCGTGCCAATGCCCGTC-GCCTTATGGAGCTCAAGGACCTC-TAGGC-GCCACAAACTGTGTTCGCTTTGA Neogoezia_breedlovei TCGAGTCCTTGAATAACAAAGTAACCCGCTAACATGT--AAACACATTGGGTGAGCAT-TGGGGT--GC-TTTAGTT--TCTCATTTGTGTACCCA-AGGTAGGTGGCCCTTT-GGGTTCTCACCGGCCTATGAAATTGGGCACGAAAAGTGCCAAGG-AAAGTAAAATTGAATTGCATGTGCGCTTCTTGTACGCTGGAAGCGTCATCATTCTGAAA-CACAAATGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-T-GGCTAAGGGCACATCTGCTTGGGTGTCACGTATATTGTTGCCTT---GACCACTA--ACTCCTAGAGGGGAGCT-TGGCTGGTTTGTGGG-CAGATAATGGCCTCCTGTGCCTTGCAG-TGCAGTTGGTATTAAAATGAGACATT---GTTGATGCATGTTACGACATTGGTGGTTGA---AAAAAGGCTATCTCGTTTCGTCGTACCATTGCTCGTC-ACCTAAGCTAGCTCAAGGACTCT-TAGGC-ACCATGTATTGTGTGTGCTTCGA Neogoezia_planipetala TCGAATCCTAGAATACCAAAATGACCTGCTAACGTGT--AAACACATTGGGTGAGCAT-CGGGGT--GC-TTCGGTT--TCTCGTTTGCGTACCCA-AGGCGGGTGGCCCTTT-AGGTTCCCATCGGCCTATGAAATTGGGCACGGAAAGTGCCAAGG-AAAGTAAAATTGAATTGCATGTGCGCTTCTTGTACGCTGGAAGCGTCGTCATTCCGCAA-CACAAATGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTAAGGCCAT-T-GGCTAAGGGCACGTCTGCTTGGGTGTCACGTATCTTGTTGCCCC---GACCA-TA--ACTCCCAGAG{GT}GGAGCT-TGGCTGGTTTGTGGG-CGGATAATGGCCTCCTGTGCCTCGCGG-TGCGGTTGGTATTAAAATGAGACATT---GTTGATGCATGTTACGACATTGGTGGTTTT---AAAAAGGCCGTCTCGTCTTGTCGTGCCATTGCCCATC-ACCTAAGCTAGCTCAAGGACTCT-TAGGT-GCCATGTATTGCGTGCACTTCGA Oenanthe_fistulosa TCGAATCCTGCGATAGCAAAATGACCCGCTAACGAGT--AAACACATTGGGCGAGCGT-CGGGGG--GC-TTCGGAC--CCTCGTATGTGAACCCC-AGGCAGGTGGCCCTTC-GGGTGCC-ACAGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAATTGAAATGCACGCGCGCTTCATGTACGCTTGAAGTGCCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCACTC--CCTCCCTCGGAGGACGT-AGGCTGGTTTGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAGTGAGACTTTT--GGCGACGGATGTCGCGACACTGGTGGTTGT---AAAAAGACCCTCTTGACTTGTCGTGCCATTTCCCGTC-ACCTTAGTGAGCTCAAGGACCCC-AAGGC-GCCACATGTTGTGAGCGCTTCGA Oxypolis_occidentalis TCGAATCCTGTGATAGCAAAATGACCCGCTAACGTGT--AAACACATTGGGCAATCTT-CGGGGG--GC-TTTTGCC--TCTCGTCTGTGAACCCC-AGGCAGGTGGCCCTTCAGGGTGCCCATCGGTCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAATTCAAACTGAATTGCACGCGCGCTTCCTATTCGCTGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCC--TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCAT-TAACCACTA--ACCCCCTAAGGGGAACTTAGGTTGGTTTGGGGG-CGGATAATGGCCTCCTGTGCCTACCGG-TGTGGTTGGTGCAAAAATGAGA-TTTT--GGTGACGGACGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGCCAGTGCCCGTC-ACCTAAGCGAGCTCAAGGACCC--AAGGT-GCCATGTATTGTGTGCGCTTCGA 'Sium bracteatum-burchellii' TCGAATCCTGCAATAGCAAAATGACCCGCTAACGTGT--AAACATATTGGGCAAGCGT-CGGGGG--GC-TTATGCC--CGTCTTCAGCGAACCCCCAGGTAGGTGGCCCTTC-GGGTGCCCACCCGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAGAACTGAATTGCACGTGCGCCTCCTGTACGCAGGAAGTGTCGTCATTCTGAAA-CGCAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCTAGGGGAGCT-GGGCTTATCTTGGGG-CGGATAATGGCCTCCCGTGCCTTGCGGGTGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGGCGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTCGTCTTGTCGTGCCAAAGCCTGTC-GCCTTAGTGAGCTCAAGGACCCA-AAGGT-GGCACACGCTCTGTGCGCTTCAA Sium_frigidum_109 TCGAATCTCGCAATAGCAAAATGAACCGCCAACTTGT--AAAAACATTGGGCAAGCCT-CGGGGG--GC-TTGGGCC--TCTCGTCGGCTGACCCC-AGGCAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGACAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TTGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC-TGACCACGC--ACTCCCCCAGGGGAGTT-GGGCCGGTTTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCTG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGTGACGGTCG-CACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGCCAATGCATGTC-GCCTAAGCT-GCTCAAGGACCC--AAGGC-GCCACATATTGTGCGCGCTTCCA Sium_frigidum_2337 TCGAATCCTGCAATAGCAAAATGACCCGCCAACTTGT--AAAAACATTGGGCAAGCCT-CGGGGG--GC-TTGGGCC--TCTCGTCGGCTGACCCC-AGGCAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGACAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TTGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC-TGACCACGC--ACTCCCCCAGGGGAGTT-GGGCCGGTTTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCTG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGTGACGGTCG-CACGACATCGGTGGTTGT---AAAAAG{AG}CCCTCTTGTCTTGTCGTGCCAATGCATGTC-GCCTAAGCT-GCTCAAGGACCC--AAGGC-GCCACATATTGTGCGCGCTTCCA Sium_latifolium_8 TCGAATCCTGCAATAGCAAAATGACCTGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGAGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTTGGTGGCC-TTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTAGCCCC---GACCTCTC--ACTCCCCAAGGGGTGTT-GGGCAGGTTTGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGATGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGT-GCCACGTACTGTGTGCGCTTCGA Sium_latifolium_9 TCGAATCCTGCAATAGCAAAATGACCCGCTAATATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAATGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCTGGTTTGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGT-GCCACATACTGTGTGCGCTTCGA Sium_medium_10 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTTTGGGGG-CGGATAATGGCCTCCCGTGTCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCGA Sium_medium_11 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTTTGGGGG-CGGATAATGGCCTCCCGTGTCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCGA Sium_medium_12 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTT-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAAT{CT}GCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTTTGGGGG-CGGATAATGGCCTCCCGTGTCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCGA Sium_ninsi TCGAATCCTGCAATAGCAAAATGACCCGCTAACTTGT--AAAAACATTGGGCAAGCGTTCGGGGG--CCTTTGGGCC--TCTCTTCAGCGAACCCC-AGGCAGGTGGCCCTTC-AGGTGCCCATCGGCCTACGAACTCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCGTTCTGAGA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCGT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCCC-GACCACTC--ACTCCCCC-GGGGAGTT-GGGCTGATTTGGGGG-CGGATAATGGCTTCCCGTGCCTTGCGG-TGCGGTTGGTGTAAAAATGAGTCTTTT--GGCGACGGTCGTCGCGACATTGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGCCAATGCATGTC-ACCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCCA Sium_repandum TCGAATCCTGCAAAAGCAAAATGACCCGCTAACATGT--AAACATATTGGGCAAGCGT-AGGGGG-GGC-TAATGCC--CGTCCTCGGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCCGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGGAGAACTGAATTGCACGTGCGCCCCCCGTACGCAGGAGGCGTCGTCATTCCGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAC-TAGGCCAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCTAGGGGAGCT-GGTACTGTCCGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGACGTGGCGACATCGGTGGTTGT---AAAATGACCCTCTCGTCTTGTCGTGCCAATGCCTGTC-ACCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACACGCTCTGTGCGCTTCAA Sium_serra TCGAATCCTGCAATAGCAAAATGACCCGCTAACTTGT--AAAAACATTGGGCAAGCGT-CGGGGG--GC-TTGGGCC--TTTCGCCAGCGAACCTC-AGGTAGGTGGCCCTTC-GGGTGCCCGCCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAAGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCTC-TTACCACTC--ACTCCCGATGTGGAGTT-TGGCCGGTTTGGGGG-CGGATAATGGCCTCCCGTACCTTGTGG-TGCGGTTGGTGCAAAACTGAGTCTTTT--GGCGACAGTCGTCGCGACATCGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGCGCCAATGCCTGTC-GCCTTAGCGAGCTCAAGGACCCA-AAGGC-GCCACATACTGTGCGCGCTTCCA Sium_sisaroideum_16 TCGAATCCTGCAATAGCAAAATGACCCGCTAACTTGT--AAAAAAATTGGGCAAGCGC-CGGGGG--GC-TTGGGCC--TCTCGTCAGCGAACCCC-GGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGT-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCTTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCCCTTACCACTC--ACTCCCCCAGGGGAGTT-GGGCCTGTTTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGTCGTCGCGACATCGGTGGTTAT---AAAAAGACCCTCCTGTCTTGTCGTGCCAATGCTTGTC-GCCTTAGCGAGCTCAAGGACCCCCAAGGC-GCCACATACTTTGTGCGCCTCCA Sium_sisaroideum_E128 TCGAATCCTGCAATAGCAAAATGACCCGCTAACTTGT--AAAAATATTGGGCAAGCGC-CGGGGG--GC-TTGGGCC--TCTCGTCAGCGAACCCC-GGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGT-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCTTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCCCTTACCACTC--ACTCCCCCAGGGGAGTT-GGGCCTGTTTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGTCGTCGCGACATCGGTGGTTAT---AAAAAGACCCTCCTGTCTTGTCGTGCCAATGCTTGTC-GCCTTAGTGAGCTCAAGGACCCCCAAGGC-GCCACATACTTTGTGCGCCTCCA Sium_sisaroideum_E132 TCGAATCCTGCAATAGCAAAATGACCCGCTAACTTGT--AAAAATATTGGGCAAGCGC-CGGGGG--GC-TTGGGCC--TCTCGTCAGCGAACCCC-GGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGT-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCTTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCCCTTACCACTC--ACTCCCCCAGGGGTGTT-GGGCCTGTTTGGTGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGTCGTCGCGACATCGGTGGTTAT---AAAAAGACCCTCATGTCTTGTCGTGCCAATGCTTGTC-GCCTTAGCGAGCTCAAGGACCCCCAAGGC-GCCACATACTTTGTGCGCCTCCA Sium_sisarum_15 TCGAATCCTGCAATAGCAAAATGACCCGCTAACTTGT--AAAAATATTGGGCAAGCGC-CGGGGG--GC-TTGGGCC--TCTCGTCAGCGAACCCC-GGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGT-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCTTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTTAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCCCTTACCACTC--ACTCCCCCAGGGGAGTT-GGGCCTGTTTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGTCGTCGCGACATCGGTGGTTAT---AAAAAGACCCTCCTGTCTTGTCGTGCCAATGCTTGTC-GCCTTAGCGAGCTCAAGGACCCCCAAGGC-GCCACATACTTTGTGCGCCTCCA Sium_sisarum_388 TCGAATCCTGCAATAGCAAAATGACCCGCTAACTTGT--AAAAATATTGGGCAAGCGC-CGGGGG--GC-TTGGGCC--TCTCGTCAGCCAACCCC-GGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGT-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCTTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTTAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCCCTTACCACTC--ACTCCCCCAGGGGAGTT-GGGCCTGTTTGGGGG-CGGATAATGGCCTCCCGTGCCTTGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTC--GGCGACGGTCGTCGCGACATCGGTGGTTAT---AAAAAGACCCTCCTGTCTTGTCGTGCCAATGCTTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTTTGTGCGCCTCCA Sium_suave_1494 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGAACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCC---GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTATGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCGA Sium_suave_17 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGAACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCC---GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTATGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGAC-GCCTTAACGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCGA Sium_suave_18 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGTT-AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGAACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCC---GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTATGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGAC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCGA Sium_suave_19 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGAACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTATGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGGGCGCTTCGA Sium_suave_GB TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGAACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTATGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGTCATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGGGCGCTTCGA Sium_suave_K124 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGAACGTGCGCTTCTTGTACGCAGGAAG{CT}GTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCC--GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTATGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGGACCC-AAGGC-GCCACATACTGTGGGCGCTTCGA Sium_suave_K182 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGAACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCA--GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTATGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGTC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGGGCGCTTCGA Sium_suave_K197 TCGAATCCTGCAATAGCAAAATGACCCGCTAACATGT--AAAAACACTGG-CAAGCGT-CGGGGG--GC-TTAGGCC--TCTCGTCAGCGAACCCC-AGGTAGGTGGCCCTTC-GGGTGCCCACCGGCCTACGAAATCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATCGAACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCATTCTGAAA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAT-TAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCC---GACCTCTC--ACTCCCCAAGGGGAGTT-GGGCCGGTATGGGGG-CGGATAATGGCCTCCCGTGCCATGCGG-TGCGGTTGGTGCAAAAATGAGTCTTTT--GGCGACGCACGTCACGACATCGGTGGTTGT---AAAAAGACCCTCTTGTATTGTTGTGCCAATGCGTGAC-GCCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCGA Sium_tenue TCGAATCCTGCAATAGCAAAATGACCCGCTAACTTGT--AAAAACATTGGGCAAGCGTTCGGGGG--CCTTTGGGCC--TCTCTTCAGCGAACCCC-AGGCAGGTGGCCCTTC-AGGTGCCCACCGGCCTACGAACTCGGGCGCGGAAAGCGCCAAGG-AAAGTAAAACTGAATTGCACGTGCGCTTCTTGTACGCAGGAAGCGTCGTCGTTCTGAGA-CACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCGT-CAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATCTTGTTGCCCCCC-GACCACTC--ACTCCCCC-GGGGAGTT-GGGCTGATTTGGGGG-CGGATAATGGCTTCCCGTGCCTTGCGG-TGCGGTTGGTGTAAAAATGAGTCTTTT--GGCGACGGTCGTCGCGACATTGGTGGTTGT---AAAAAGACCCTCTTGTCTTGTCGTGCCGATGCATGTC-ACCTTAGCGAGCTCAAGGACCCC-AAGGC-GCCACATACTGTGTGCGCTTCCA ; END; BEGIN SETS; CHARSET ITS1 (CHARACTERS = ITS_rDNA) = 1-222; CHARSET 5RNA (CHARACTERS = ITS_rDNA) = 223-386; CHARSET ITS2 (CHARACTERS = ITS_rDNA) = 387-627; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_rDNA) = N: 1-627; CODONPOSSET CodonPositions (CHARACTERS = ITS_rDNA) = N: 1-627; END; BEGIN TREES; TITLE Tb7738; LINK TAXA = Taxa1; TRANSLATE 1 Sium_tenue, 2 Sium_suave_K197, 3 Sium_suave_K182, 4 Sium_suave_K124, 5 Sium_suave_GB, 6 Sium_suave_19, 7 Sium_suave_18, 8 Sium_suave_17, 9 Sium_suave_1494, 10 Sium_sisarum_388, 11 Sium_sisarum_15, 12 Sium_sisaroideum_E132, 13 Sium_sisaroideum_E128, 14 Sium_sisaroideum_16, 15 Sium_serra, 16 Sium_repandum, 17 Sium_ninsi, 18 Sium_medium_12, 19 Sium_medium_11, 20 Sium_medium_10, 21 Sium_latifolium_9, 22 Sium_latifolium_8, 23 Sium_frigidum_2337, 24 Sium_frigidum_109, 25 'Sium bracteatum-burchellii', 26 Oxypolis_occidentalis, 27 Oenanthe_fistulosa, 28 Neogoezia_planipetala, 29 Neogoezia_breedlovei, 30 Helosciadium_repens, 31 Helosciadium_nodiflorum_E120, 32 Helosciadium_nodiflorum_919, 33 Helosciadium_nodiflorum_1871, 34 Helosciadium_inundatum_64358, 35 Helosciadium_crassipes, 36 Helosciadium_bermejoi, 37 Cryptotaenia_japonica, 38 Cryptotaenia_canadensis, 39 Cicuta_virosa, 40 Berula_erecta_thunbergii_E113, 41 Berula_erecta_thunbergii_E112, 42 Berula_erecta_thunbergii_799, 43 Berula_erecta_thunbergii_5, 44 Berula_erecta_orientalis_E116, 45 Berula_erecta_orientalis_E111, 46 Berula_erecta_orientalis_3, 47 Berula_erecta_orientalis_2, 48 Berula_erecta_incisa_K199, 49 Berula_erecta_incisa_K198, 50 Berula_erecta_incisa_6, 51 Berula_erecta_incisa_2157, 52 Berula_erecta_incisa_1816, 53 Berula_erecta_incisa_1530, 54 Berula_erecta_incisa_1111, 55 Berula_erecta_erecta_K185, 56 Berula_erecta_erecta_4, 57 Berula_erecta_erecta_150, 58 Afrocarum_imbricatum_K132, 59 Afrocarum_imbricatum_1; TREE Fig._1 = [&R] (26,((39,((((35,34),(30,(32,33,31),36)),((((58,59),16),(((43,41,40),42),25),((((55,(56,57)),(46,45)),(47,44)),((50,53),52,49,48,51,54))),((((17,1),(24,23)),(15,(11,10,12,13,14))),((22,21),(20,18,19),(((4,3,6),5),((8,2,7),9)))))),(38,37))),27),(29,28)); END;