#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 9:56 GMT TreeBASE (cc) 1994-2008 Study reference: Zelski S.E., Raja H.A., Miller A.N., & Shearer C. 2014. Conioscypha peruensis sp. nov., its phylogenetic placement based on 28S rRNA gene, and a report of Conioscypha gracilis from PerĂº. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15250] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=51; TAXLABELS Ascotaiwania_lignicola Ascotaiwania_mitriformis Ascotaiwania_sawada Carpoligna_pleurothecii Cercophora_newfieldiana Chaetomium_globosum_ Chaetosphaeria_innumera Codinaea_simplex_ Conioscypha_japonica Conioscypha_lignicola Conioscypha_peruensis Conioscyphascus_varius Dactylaria_higginsii Diaporthe_padi Diaporthe_pustulata Dothidea_sambuci_ Gaeumannomyces_cylindrosporus Gaeumannomyces_graminis_var._avenae Gaeumannomyces_graminis_var._graminis Gaeumannomyces_graminis_var._tritici Hypocrea_Scheinitzii Hypomyces_subiculosus_ Leucostoma_niveum Magnaporthe_grisea Magnaporthe_salvinii Mycoleptodiscus_coloratus Ophioceras_commune_a Ophioceras_commune_b Ophioceras_commune_c Ophioceras_dolichostomum_a Ophioceras_dolichostomum_b Ophioceras_dolichostomum_c Ophioceras_dolichostomum_d Ophioceras_hongkongense Ophioceras_leptosporum Ophioceras_sp._CMU26633 Ophioceras_tenuisporum Ophiostoma_africanum Ophiostoma_piliferum Petriella_setifera Petriella_sordida Pleospora_herbarum_ Pseudohalonectria_lignicola_a Pseudohalonectria_lignicola_b Pseudohalonectria_suthepensis_ Pyricularia_borealis Setosphaeria_monoceras_ Sordaria_fimicola_ Valsa_ambiens Xylaria_acuta Xylaria_hypoxylon ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M20509] TITLE Conioscypha_alignment; LINK TAXA = Taxa1; DIMENSIONS NCHAR=922; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ascotaiwania_lignicola ------------CAACA-----------------------------------AGCTCAAATTTGAAATCTGGCGCCTCTTGCGGGGGGTCCGAGTTGTAATCTGCAGATGAGTCTTCCG----G-CGA-CGCGAGCGCCCAAGTTCCCTGGAATGGGACGCCATAGAGGGTGAGAGCCCCGTACT-----GGCGTGCGCCGAGCC-TCTGTGAAGCTCATTCGACGAGTCGAGTAGTTTGGAAATGCTGCTCTAATCGTGGGGTAAATCTCCCATAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAACAAGGGCGTTAAAAAGTATGTGAAATTGTTGTGGGGGAAGCGCTTGTCGCCAGACGTGGC-GGCGGCGGGTTACCCGGC-----TTCT-GGCCGGCGCACTCCGCCC-GCCGCCAGGCCAGCAACGACTCCGGCTCGGGACCCAGTGCCGGCGGGAACGTAG-C--TCCTTC---GGGGAGTGTTACAGCCCAC--CGGTGGCGTCCTG--GCCTGGGTCGAGGTTAGCGCA-TC---TGCCCGGATGC-TGGCTTAA-TGGCGCCA-AACGACCCGT-CTTGAAACACGGACCAAGGAG-TTGACCTAGCGCG---CGAGTGTACGGGTG-TCAAGCCCCTAC-GCGC-AGTGAAAGCAAA-CGGTGGTGGG-AGCTCTGGCGCACCATCGACCGATCCTGAAGTT--CACGGATGGATTTGAGTAGGAGCGTGCTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTTCTAG Ascotaiwania_mitriformis -----------CCAACAGGG-TTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCCCAGATTTGAAATCTGAC-CTCTTT----GGGGTCCGAGTTGTAATCTGCAGATGGGTTTTCCG----G-TGA-GGCGTGCGTCCAAGTTCCCTGGAATGGGATGCCGGAGAGGGTGAGAGCCCCGTAAA-----GGCGCGCGCCGAGCC-TCTGTGAGGCCCATTCGACGAGTCGAGTAGTTTGGAAATGCTGCTCTAATCGTGGGGTAAATCTCCCATAAGGCTAAATATCGGCCGGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGGATAAGGCCGTCAAAAAGCATGTGAAATTGTTGTGGGGGAAGCGCTCGTCGCCAGACGTGGC-GGCGGCTGATTTACCGGCG----TCCT-CGCCGGTGTCCTCTGCCC-GCCGCCAGGCCAGCACCGGCTCGGACC-GGGGCCCAAAACGCACGGGAACGTGG-C--TCCCCTC--GGGGAGTGTTATAGCCCGC---GCCTACGCCCTG--TTCCGGGCCGAGGAACGCGCA-TC---TGCTCGGATGCTTGGCCTAA-TGGCGCCTAAGCGACCCGTCCTTGAAACACGGACCAAGGAGGTTGACCTTGACCGCGCCGATTGTTCGGGTG-TCAAGCCCCTAC-GCGT-AGTGAAAGCGAA-CGCTGGTGGG-AGCCCTGGTGCACCATCGACCGATCCTGAAGTT--TACGGATGGATTTGAGTAGGAGCGCGTCGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTTCTAG Ascotaiwania_sawada -------------AACAGGGGTTGCC--AGTAACGGCGAGTGAAGCGGCAACAGCCCAGATTTGAAATCTGGC-CTT-------GGTGCCCGAGTTGTAATCTGGAGATGGGTTTTCCA----G-CGA-CGCGT-GCGCCGGATGCCGTAGA--GGGATGCCGTAGAGGGTGAGAGCCCCGTACT-----GGCG--CGACTAGCT-TCTTTGTTGCCCATTCGACGAGTCGAGTAGTTTGGAAATGCTGCTCTAATCGTGGGGTAAATCTCCCATAAGGCTAAATATCGGCCGGAGACCGATAGCGCACAAGTACCGTGAGCGAAAGATGAAAAGAGCCTTGGATAAGGGCGTCAAAAAGCATGTGAAATTGTTGTGGGGGAAGCGCTCGTCGCCAGTCGTGTC-GGCGGCTGATTTGCCGGCG----TTCT-CGCGGGTGCCCTCTGCCC-GCCGCCAGGCCAGCACCGGCTCGGCCT-CTGTCCCAATGCACGCGGGAACGTAG-C--TCCCCAC--GGGGAGTGTTATAGCCCAC--GTGCGACGCCCTG--GGCCGGGCCGAGGATCGCGCA-TC---TGCTCGGATGC-TGGCTTAA-TGGCGCCT-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TTGCCCTGGCGCG---CGAGTGTTCGGGTG-TAAAGCCCCTAC-GCGC-AGTGAAAGCGAA-CGCAGGTGGG-AGTCCTGATGCACCATCGACCGATCCTGAAGCT--TGCAGATGGATTTGAGTAGGAGCGCGCCGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAA-AGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGCCCAATCGAACCTTCTAG Carpoligna_pleurothecii AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCCCAGATTTGAAATCCGGC-TTTC-------GGGCCCGACTTGTAATCTGCAGATGAGTCTTTTG----G-CGG-AGCGC-CGTCCAAGTTCCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACC-----GACGTGCGCCGAGTC-TTTGCAAAGCTCATTCGAAGAGTCGAGTAGTTTGGAAATGCTGCTCAAATTGTGGGGTAAATCTCCCATAAGGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAACAAGGGCGTCAAAAAGCATGTGAAATTGTTGTGAGGGAAGCGCTCGATGCCAGACGTGGA-GGCGGTTGGTTACCCGGCG----TTCT-CGCCGGCGCACTCTGCC--GTCTCCAGGCCAGCATCAGTTCGGCTT-GGGGCTCAATGCAGTTGGGAACGTGG-C--TCTTC------GGAGTGTTATAGCCCAG--CTGCGACGTCCTG--GGCCGGACTGAGGAACGCGCA-TC---TGCCCGGATGC-TGGCGTAA-TGGCTTCT-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TTGACCTAACATG---CGAGTGTTTGGGTG-TAAAGCCCTCAC-GCGC-AGTGAAAGCGAA-CGCAGGTGGG-AGCTTCGGCGCACCATCGACCGATCCTGAAGTT--TACGGATGGATTTGAGTAAGAGCATGTTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTTCTAG Cercophora_newfieldiana AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCCC-------AGGCCCGAGTTGTAATTTGTAGAGGAAGCTTCTG----G-TGA-GGTAC-CTGCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATA-----GCAGAGTACCGACCC-TATGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGATCAGACTTGCG-CCCGGCGGATCATCCGGCG----TTCT-CGCCGGTGCACTCCGCCG-GG-CTCAGGCCAGCATCGGTTCTCGCG-GGGGGATAAAGGCTCGGGGAACGTAG-C--TCCTC----CGGGAGTGTTATAGCCCCT-TGTGCAATGCCCTC--GCGGGGACCGAGGTTCGCGCA-TC---TGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGGTTTTGCG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTA--TTCGGATGGATTTGAGTAAGAGCGTTAAGCCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAACCATCTAG Chaetomium_globosum_ AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGC-GCAACAGCTCAAATTTG?CATCTGGC-TTC---------GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAG----G-CGC-GGCAC-CTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATA-----GTTGGATGCCTAGCC-TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CC????GGATCATCCGGTG----TTCT-CACCGGTGCACTCCGCCC-GG-?TCAGGCCAGCATCGGTTCTCGCG-GGGGGATAAAGGTCCTGGGAACGTAG-C--TCCTC----CGGGAGTGTTATAGCCCGG-GGCGTAATGCCTC---GCGGGGACCGAGGTTCGCGCA-TC---TGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGGTTTTGCG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCGTTAA??CTTGGACCCGAAAGATGGTGAACTAT?CTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAACCATCTAG Chaetosphaeria_innumera AGGAAAAGAAAC?AACAGGGATTGCT?CAGTAACGGCGAGTGAAGCGGCCACAGCTCAAATTTGAAATCTGGC-CCCC--------GGCCCGAGTTGTAATTTGCAGAGGATGCTTCGG----G-CGC-GGCGC-CTTCCAAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTACG-----GTTGGACGCCAAGCC-CGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAGACCCCTTCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAA-AAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGGCGATCCTCTGGCG----TTCT-CGCCAGGGCACTCGCCCC-GG-GGCAGGCCAGCGTCGGTTTGGGCG-GGCGGACAAGGGCGTCGGGCACGTAG-C--TCCCT----CGGGAGTGTTATAGCCCGG-CGCGCGATGCTCCC--GCCCGGACCGAGGTTCGCGCT-CT----GCAAGGACGC-TGGCGTAA-TGGTCACC-AGCGGCCCGT-CTTGAAACACGGACCAAGGAG-TCGAGGTTCTGCG---CGAGTGTATGGGTG-CCAAACCCGCAC-GCGC-AATGAAAGTGAA-CGTAGGTGGG-AGCCTCGGCGCACCACCGACCGATCCTGATGTT--CTCGGATGGATTTGAGTAGGAGCGTTGGGCCTCGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAACCATCTAG Codinaea_simplex_ ????????????????????ATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCC--------AGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTG----G-CAA-GGTGC-CTTCCAAGTCCCCTGGAACGGGGCGCCGAAGAGGGTGAGAGCCCCGTCCG-----GTCGGCCACCAAGCC-TGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAGACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACGTGTG-CCGGGGTGCTCAGCGGGCG----TTCT-CGCCCGTGCACTCGCCCC-GG-TACAGGCCAGCGTCGGTTCGCGCG-GGGGGACAAAGGCGCCGGGAACGTAG-C--TCCTC----CGGGAGTGTTATAGCCCGG-CGTGCCATGCCCCC--GCGCGGACCGAGGTTCGCGCT-CC----GCAAGGACGC-TGGCGTAA-TGGTCTCC-AGCGGCCCGT-CTTGAAACACGGACCAAGGAG-TCGAGGTTTTGCG---CGAGTGTTTGGGTG-TCAAACCCGCAC-GCGT-AATGAAAGTGAA-CGCAGGTGGG-AGCTTCGGCGCACCACCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCGTAGGGCCTCGGACCCGAAAGATGGTGAACTATACGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGCGTATGGGGGCGAAAGACTAATCGAACCATCTAG Conioscypha_japonica --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TG---CGAGTGTACGGGTG-CAAAGCCCTGGC-GCGC-AATGAAAGTGAT-CATGGGTGGG-AGCCTTGGCGCACCATCGACCGATCCTGACGTTTCTACAGATGGATTTGAGTAAGAGCACACTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTTCTAG Conioscypha_lignicola --GAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCCCAGATTTGAAATCCGGC-TCTCTT---GGGGGCCCGAGTTGTAATCTGCAGATGGGTCTTTTG----G-TGA-AGCGC-CGTCCAAGTTCCCTGGAATGGGACGCCTCAGAGGGTGAGAGCCCCGTACA-----GGCGGTCGCCGAGCC-TCTGTAAAGCCCATTCGACGAGTCGAGTAGTTTGGAAATGCTGCTCTAATCGCGGGGTAAACCTCCCGTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGGGCCTTGAACAAGGGCGTCAAAAAGTATGTGAAATTGTTATGGGGGAAGCGCTCGATGCCAGACTCGGG-GGCGGTTGGTTACCCGGCG----GTCCTCGCCGGCGCACTCTGCCG-TC-CCCGGGCCAGCATCAGTTCGGCGC-GGGGCTTACTGCCTCGGGGAACGTGG-C--TCCCT----CGGGAGTGTTATAGCCTCG--TGGCGACGCCCCG--TGCCGGACTGAGGACCGCGCCTTC--GGGCCTGGATGC---TCGTAA-TGGCCCCT-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TTGACCTAGCATG---CGAGTGTACGGGTG-TAAAGCCCTGGC-GCGC-AATGAAAGTGAT-CATGGGTGGG-AGCCCTGGCGCACCATCGACCGATCCTGACGTCTCTACAGATGGATTTGAGTAAGAGCATGCTGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTTCTAG Conioscypha_peruensis -GGA{AG}AAGAA?ACAACAGGGACTGCCTCAGTAACGGCGAGTGAAGCGGCACCAGCCCAGATTTGAAATCGGGT-TCCCCC-GCGGGGGCCTGAATTGTAGTCTGCAGATGGGTCTTTCT----GGCAACGCGGC-CGTCCAAGTGCCCTGGAATGGGACGCCGTAGAGGGTGAGAGCCCCGTACC-----GACGGCCGCCGCGCCGCCTGCAAAGCCCATTCGACGAGTCGAGTAGTTTGGAAATGCTGCTCAAATCGCGGGGTAAACCTCCCGTAAGGCTAAGTACTGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAACAAGGGCGTCAAACAGTATGTGAAATTGTTGTGGGGGAAGCGCCCGCGACCAGACTCGGG-GGCGGTTGGTTACCCGGCGGGCCCCCC-CGCCGGCGCACTCTGCC--GCCCCCGGGCCAGCATCGGTTGGGCCG-GGTGCCCACTGCTGCGGGGAACGTGG-C--TCCCTCC--GGGGAGTGTTATAGCCCCG--CAGCGACGCCCCC--GGCCCGACCGAGGACCGCGCTCTC--GAGCCCGGATGC-TGGCGTAA-TGGTCTCT-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TTGACCTGGCGTG---CGAGTGTATGGGTG-GCAAGCCCTAGC-GCGC-AATGAAAGTGAT-CTTGGGTGGG-ATCCCCGGCGCACCATCGACCGATCCTGAAGTT--TACGGATGGATTTGAGTAAGAGCACGCCGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTTCTAG Conioscyphascus_varius AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCCCAGATTTGAAATCCGGC-TCTCTA---GGGAGCCCGAGTTGTAGTCTGCAGATGGGTCTTTCT----GGCGG-AGCGC-CGTCCAAGTTCCCTGGAATGGGACGCCGTAGAGGGTGAGAGCCCCGTACG-----GATGGTCGCCGAGTCTCTTGTAAAGCCCATTCGACGAGTCGAGTAGTTTGGAAATGCTGCTCAAATCGCGGGGTAAACCTCCCGTAAGGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGCGTGAGCGAAAGATGAAAAGAGCCTTGAACAAGGGCGTCAAAAAGTATGTGAAATTGTTGTGGGGGAAGCGCCCGAGACCAGACTCGGT-GGCGGTTGGTTACCCGGCGAGACCCCT-CGCCGGCGCACTCTGCC--GTCCCCGGGCCAGCATCGGTTGGACCT-GGGGCCCAATGCCGCGAGGAACGTGG-C--TCCCCTC--GGGGAGTGTTATAGCCACG--CGGCGACGCCCCA--GGACCGACCGAGGACCGCGCTCTC--GAGCCTGGATGC---TCGTAA-TGGTCTCT-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TTGACCTGGCATG---CGAGTGTATGGGTT-CCAAGCCCTAGC-GCGC-AATGAAAGTGA--TCTGGGTGGG-ATCCCCGGCGCACCATCGACCGATCCTGAAGTT--TACGGATGGATTTGAGTAAGAGCATGCCGGGTCTGACCCGAAAGAAGGTGAACTATGCATGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGTGCATGGGGGCGAAAGACCAATCGAACCTTCTAG Dactylaria_higginsii AGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CACC-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCCG----G-CGA-GGCAC-CTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTAGGACGCCGAGCC-GATGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGCCGGATCATCCAGCG----TTCT-CGCTGGTGCACTCCGGCC-GG-CTCAGGCCAGCATCGGTTTCCGCC-GGGGGACAAAGGCCTCGGGAACGTAG-C--TCGCTCC--GGCGAGTGTTATAGCCCGT-GGCGTAATACCCCG--GCGGGGACCGACGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGAAGTC--TTCTGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAG Diaporthe_padi --GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CTC---------GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTG----G-CGC-GGTGC-CTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG-----GTCGGACACCAAGCC-TGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAA-AAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGCGGCTCATCAGGGG----TTCT-CCCCTGTGCACTCCGCCC-GG-CTCAGGCCAGCATCGGTTCTCGCG-GGGGGACAAGACCGCCGGGAACGTAG-C--ACCCCCC--GGGGTGTGTTATAGCCCGG-CGGACGATACCCTC--GCGGGGACCGAGGTTCGCGCT-CC----GCAAGGATGC-TGGCGTAA-TGGTCACC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGTCCATTAGAG---CGAGCGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--CTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAG Diaporthe_pustulata --GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CTC---------GGCCCGAGTTGTAATTTGCAGAGGATGCTTCTG----G-CGC-GGTGC-CTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG-----GTCGGACACCAAGCC-TGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAA-AAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGCGGCTCATCAGGGG----TTCT-CCCCTGTGCACTCCGCCC-GG-CTCAGGCCAGCATCGGTTCTCGCG-GGGGGACAAGACCGCCGGGAACGTAG-C--ACCCCCC--GGGGTGTGTTATAGCCCGG-CGGACGATACCCTC--GCGGGGACCGAGGTTCGCGCT-CC----GCAAGGATGC-TGGCGTAA-TGGTCACC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGTCCATTAGAG---CGAGCGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--CTCGGAAGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAG Dothidea_sambuci_ AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGC-TTAT--------GGCCCGCATTGTAATTTGTAGAGGATGCTTTTA----GGCA--GCCGC-CGGTCAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTG---ACCGGCTCTGGCACCTTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGA-CTTGGCTGTTCAACAGGTC----TTCT-GACCTGCCTATTCAGTCT-TG-TCCAGGCCAGCATCAGTTTCGGCG-GCCGGATAAAGGCTCTGGGAATGTGG-CTTTCCCTTCGGGGGAAGTGTTATAGCCCAG-GGTGTAATACGGCC-AGCTGGGACTGAGGTCCGCGCT-TC---GGCTAGGATGC-TGGCGTAA-TGGTTGTA-AGCGGCCCGT-CTTGAAACACGGACCAAGGAG-TCTAACATCTATG---CGAGTGTTAGGGTG-TCAAACCCTTAC-GCGT-AATGAAAGTGAA-CGGAGGTGAG-AACCCGGGTGCATCATCGACCGATCCTGATGTC--TTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAG Gaeumannomyces_cylindrosporus --GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCT--------AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-TGA-GGTGC-TTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTTTGACGCCGAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCT-CGCTGGTGCACTCCGCCC-GG-CTCAGGCCAGCATCGGTTTTCGCC-GGGGGACAAAAGCTTCGGGAACGTAG-C--TCCTCTC--GGGGAGTGTTATAGCCCGT-TGCATAATACCCCG--GCGGGGACCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCT-- Gaeumannomyces_graminis_var._avenae --GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCC--------AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-CAA-AGCGC-TTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTAGGACGCCGAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCT-CGCTGGTGCACTCCGCCC-GG-CTCAGGCCAGCATCGGTTTTCGCC-GGGGGACAAAAGCTTCGGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCCGT-TGCTTAATACCCCG--GCGGGGACCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAG Gaeumannomyces_graminis_var._graminis --GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCT--------AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-CAA-AGCGC-TTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTATGACGCCGAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCT-CGCTGGTGCACTCCGCCC-GG-CTCAGGCCAGCATCGGTTTTCGCC-GGGGGACAAAAGCTTCGGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCCGT-TGCTTAATACCCCG--GCGGGGACCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAG Gaeumannomyces_graminis_var._tritici -------GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCC--------AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-CAA-AGCGC-ATACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTACGACGCCGAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCT-CGCTGGTGCACTCCGCCC-GG-CTCAGGCCAGCATCGGTTTTCGCC-GGGGGACAAAAGCTTCGGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCCGT-CGTTTAATACCCCG--GCGGGGACCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAG Hypocrea_Scheinitzii AGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCCTC------GGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTG----G-CAA-GGCGC-CGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTG-----GCTGGCCGCCGAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAA-AAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGG-CGCGGCGGATCATCCGGGG----TTCT-CCCCGGTGCACTTCGCCG-TG-TCCAGGCCAGCATCAGTTCGTCGC-GGGGGAAAAAGGCTTCGGGAACGTGG-C--TCCCC----TGGGAGTGTTATAGCCCGT-TGCGTAATACCCTG--CGGTGGACTGAGGACCGCGCA-TC----TCAAGGATGC-TGGCGTAA-TGGTCACC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGTCTTCGTATG---CGAGTGTTCGGGTG-TCAAACCCCTAC-GCGT-AATGAAAGTGAA-CGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--CTCGGATGGATTTGAGTAAGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAG Hypomyces_subiculosus_ AGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCCT------AGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-CAA-GGCGC-CGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTG-----GCTGGACGCCGAGCC-TTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGG-CTTGGCGGATCATCCGGCG----TTCT-CGCCGGTGCACTTCGCCT-CG-CCCAGGCCAGCATCAGTTCGCCCC-GGGGGACAAAAGCTTCGGGAATGTGG-C--TCCTC----CGGGAGTGTTATAGCCCGT-GGCACAATACCCTG--GGGCGGACTGAGGTTCGCGCG-TC----CCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGTCCTCGTATG---CGAGTGTTCGGGTG-TCAAACCCCTAC-GCGT-AATGAAAGTGAA-CGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--CTCGGATGGATTTGAGTAAGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAG Leucostoma_niveum --GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGC-TCC---------GGCCCGCATTGTAATTTGCAGAGGATGCTTTTG----G-CGA-GGTGC-CTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATG-----GATGGACACCAGACC-TGTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAA-AAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGCAGCTCATCAGGGG----TTCT-CCCCTGTGCACTCTGCCC-GG-CTCAGGCCAGCATCGGTTCTCGTG-GGAGGATAAGAACAGTGGGAACGTGG-C--CCCCTCTCGGGGGGGTGTTATAGCCCAT-TGTACGATACTCTC--GTGGGGACCGAGGTTCGCGCT-CC----GCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGTCCATTAGAG---CGAGCGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTC--TTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAG Magnaporthe_grisea AGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCCC-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-TGA-GGCAC-CTACCGAGTCCCCTGGAATGGGGCGCCATAGAGGGTGAGAGCCCCGTATG-----GTAGGACGCCGAACC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCT-CGCTGGTGCACTCCGCCC-GG-TTCAGGCCAGCATCGGTTTTCGCC-GGGGGACAAAGGCTTCGGGAACGTGG-C--TCCTTTC--GGGGAGTGTTATAGCCCGT-TGCGTAATACCCCG--GCGGGGACCGACGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGAAGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAG Magnaporthe_salvinii AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCT--------AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-TGA-AGCGC-TTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTTTGACGCCGAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCT-CGCTGGTGCACTCCGCCC-GG-CTCAGGCCAGCATCGATTTTCGCC-GGGGGACAAAAGCTTCGGGAACGTGG-C--TCTCTTC--GGGGAGTGTTATAGCCCGT-TGCGTAATACCCCG--GCGGGGATCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTAG Mycoleptodiscus_coloratus AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCCC-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTG----G-TGA-GGCAC-CTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTCGGACGCCGAACC-TCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGGG-CTCGGGGGATCATCCGCCG----TTCT-CGCTGGTGCACTCCGTCG-GG-CTCGGGCCAGCATCGGTTTTCCTC-GGGGGACAAAGGCTTCGGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCTGG-TGCGTCATGCTCCG--GCGGGGACCGAGGACCGCGCT-TC----GGCATGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGC-AATGAAAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_commune_a --GAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCTC-------GGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGG----G-CGA-GGCTT-TGATCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----ATCAGCCGCCGAACC-CGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTCGGG-CTCTTGGGATCATCCGCCC----TTCT-GGGCGGTGCACTCCCTCG-TT-CTCGGGCCAGCATCGGTTCTCCTC-GGGGGATAAAGGCGCCAGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCTGG-CGCGTCATGCTCCG--GGGGGGACCGAGGACCGCGCT-TC---GGCATGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTACGGGTG-TAAAACCCGAAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_commune_b -GGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCTC-------GGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGG----G-CGA-GGCTT-TGATCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----ATCAGCCGCCGAACC-CGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTCGGG-CTCTTGGGATCATCCGCCC----TTCT-GGGCGGTGCACTCCCTCG-TT-CTCGGGCCAGCATCGGTTCTCCTC-GGGGGATAAAGGCGCCAGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCTGG-CGCGTCATGCTCCG--GGGGGGACCGAGGACCGCGCT-TC---GGCATGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTACGGGTG-TAAAACCCGAAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGCTCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACC------ Ophioceras_commune_c AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCTC-------GGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGG----G-CGA-GGCTT-TGATCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----ATCAGCCGCCGAACC-CGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTCGGG-CTCTTGGGATCATCCGCCC----TTCT-GGGCGGTGCACTCCCTCG-TT-CTCGGGCCAGCATCGGTTCTCCTC-GGGGGATAAAGGCGCCAGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCTGG-CGCGTCATGCTCCG--GGGGGGACCGAGGACCGCGCT-TC---GGCATGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTACGGGTG-TAAAACCCGAAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_dolichostomum_a -GGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TCCTTT---CGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTCG----G-CGA-GGCGC-TGACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----ATCAGATGCCAAACC-GGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGAT-CTCAGGGGATCATCCGCCG----TTCT-CGGCGGTGCACTCCCCTG-AGCTTCAGGCCAGCATCGGTTCTCTCC-GGGGGATAAAAGCGCTGGGAACGTGG-C--TCCTTTC--GAGGAGTGTTATAGCCCAG-CGTACAATGCTCCG--GGGGGGACCGAGGACCGCGCC-TT-AGGGCAAGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTACGGGTG-TAAAACCCGAAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_dolichostomum_b -GGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TCCTCT---CGGGGTCCGAATTGTAATTTGCAGAGGATGCTTTCG----G-AGA-GGCGC-TGACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----ATCAGATGCCGAACC-GGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGAT-CTCAGGGGATCACCCGCCG----TTCT-CGGCGGTGCACTCCCCTG-GGCTTCAGGCCAGCATCGGTTCTCTCC-GGGGGATAAAAGCGCTGGGAACGTGG-C--TCCTCTC--GGGGAGTGTTATAGCCCAG-CGTACAATGCTCCG--GGGGGGACTGAGGACCGCGCC-TT-AGTGCAAGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTACGGGTG-TAAAACCCGAAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGAAGTA--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_dolichostomum_c -GGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-T-CCCTTCAGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-CGA-AGCGC-TGACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----ATCAGATGCTGAACC-AGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGAT-CTCAGGGGATCATCCGCCG----TTCTTCGGCGGTGCACTCCTCTG-AGCTTCAGGCCAGCATCGGTTTTCTCC-GGGGGATAAAAGCGCTGGGAACGTGG-C--TCCTTTC--GGGGAGTGTTATAGCCCAG-CGTACAATGCTCCG--GGGGGGACCGAGGACCGCGCC-TT-AGGGCAAGGATGC-TGGCGTAA-TGGTCACCGGGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTACGGGTGTTAAAACCCGAAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_dolichostomum_d --GAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TCCCTTTCAGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTCG----G-CGA-GGCGC-TGACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----ATCAGATGCCGAGCC-GGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACCTGAT-CTCAGGGGATCACCCGCCG----TTCT-CGGCGGTCCACTCCCCTGTGTTTTCAGGCCAGCATCGGTTTTCTCC-GGGGGATAAAAGCGCCGGGAACGTGG-C--TCCTCTC--GGGGAGTGTTATAGCCCGG-CGTATAATGTCTCG--GGGGGGACCGAGGACCGCGCC-TTAGTTGCAAGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTACGGGTG-TAAAACCCGAAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_hongkongense AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TCCTCT--CCGGGGTCCGAGTTGTAATTTGCAGAGGATGCATTCG----G-CGA-GGCGC-TGACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----ATCAGATGCCGAACC-GGTGTAATGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGAT-CTCAGGGGATCATCCGCCG----TTCT-CGGCGGTGCACTCCCCTG-TGCTTCAGGCCAGCATCGGTTCTCTCC-GGGGGATAAAAGCGCCGGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCCGG-CGTACAATGCTCCG--GAGGGGACCGAGGACCGCGCCTTC--GTGCAAGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTACGGGTG-TAAAACCCGAAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_leptosporum AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCTC-------GGGTCCGAGTTGTAATTTGCAGAGGATGCGTTCG----G-CGA-CGCAC-TGACCGAGTCCCCTGGAATGGGGCGCCATAGAGGGTGAGAGCCCCGTATG-----GTCGGCTGCTGAACC-GGTGTAATGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGCGCCTGTGACCAGACTCTGT-TCTTGGGGATCATCCGTCC----TTCT-GGGCGGTGCACTCCTCTT-GG-ATGGGGCCAGCATCGGTTTTCGCC-GGGGGAAAAGGACTTAGGGAACGTGG-C--TCTCCTC--GGAGAGTGTTATAGCCCTC-TGTTTGATGCCCCG--GCGGGGACCGAGGACCGCGCT-TC---GGCATGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGTG---CGAGTGTACGGGTG-TAAAACCCGCAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGACGTT--CTCTGACGGATTTGAGTAGGAGCATTAACGCTTGCACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_sp._CMU26633 ----------------------TGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CTTC-------GGGTCCGAGTTGTAATTTGCAGAGGATGCGTTCG----G-CGA-CGCAC-TGACCGAGTCCCCTGGAATGGGGCGCCATAGAGGGTGAGAGCCCCGTATG-----GTCGGCTGCTGAACC-GGTGTAATGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCCTATTACCAGACTCTGT-TCTTGGGGATCATCCGTCC----TTCT-GGGCGGTGCACTCCTCTT-GG-ATGGGGCCAGCATCGGTTTTCGCC-GGGGGAAAAGGACTTTGGGAATGTGG-C--TCCCCTC--GGGGAGTGTTATAGCCCTC-TGTTTGATGCCCCG--GCGGGGACCGAGGACCGCGCT-TC---GGCATGGATGC-TGGCGTAA-TGGTAATC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGTG---CGAGTGTACGGGTG-TAAAACCCGCAC-GCGC-AGTGAAAGCGAA-CGCTGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGACGTT--CTCTGACGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophioceras_tenuisporum AGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCC-------GGGCCCGAGTTGTAATTTGCAGAGGATGCTTTCG----G-TGC-GGCCC-CTTCTGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATA-----GTCGGACGCCAAACC-GGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGCG-CCCGGCGGATCATCCAGCG----TTCT-CGCTGGTGCGCTCCGCCG-GG-CTCGGGCCAGCATCGGTTTCCGCC-GGGGGACAAAGGCGCCGGGAACGTGG-C--TCCCCTA--GGGGAGTGTTATAGCCCGG-CGTGCAATGCCCTG--GCGGGGACCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTAGGG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGA-AATGAAAGTGAA-CGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTA--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Ophiostoma_africanum AGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGC-GCAACAGCTCAAATTTGAAATCTGGC-TACATT--CAGTGGTCCGAGTTGTAATTTGTAGAGGATGGTTTTG----G-CGC-GGCGC-CGTCCGAGTTCCTTGGAACAGGACGCCACAGAGGGTGAGAGCCCCGTACG-----GACGGACGCCTAGCC-TCTACAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACG---CAGAGA-CGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAA-GCTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGCGCCCCCGTGGACCACC--GCG----TTCT-CGCCGGTGCACTCCGCGG-G--CGCAGGCCAGCATCGGTTCTCCTA-GGGGGACAAAGACCGCGGGAACGTAG-C--TCTTC-----GGGAGTGTTATAGCCCGC-GGTGGCATGCCCCT--GGGGGGACCGAGGACCGCGCT-TC---GGCAAGGATGC--TGCGTAA-TGGTCACA-GGACGCCCGT-CTTGAAACACGGACCAAGGAG-TTCAACACTTGGG---CGAGTGTATGGGTG-CCAAACGC-CAC-GCGCAAATGAAAGTAAATCGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTC--TTCGGATGGATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAG Ophiostoma_piliferum AGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCTC-------GGGCCCGAGTTGTAATTTGGAGAGGATGCTTCTG----G-CGC-GGCGC-CGTCCGAGTTCCTTGGAACAGGACGCCATAGAGGGTGAGAGCCCCGTACG-----GGCGGCCGCCTAGCC-TTTGCGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGCG-GCCCGCGGATCATCCGGTG----TTCCTCACCGGTGCGCTCCGCG--GGCCGCAGGCCAGCATCGGCTCTCCTG-GGGGGACAAAGGTCGCGGGAACGTGG-C--TCCTT----AGGGAGTGTTATAGCCCGC-TTCGTCATGCCTCC--GGGGGGGCCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCACC-GGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTGGGG---CGAGTGTCTGGGTG-CCAAACCCGCAC-GCGA-AATGAAAGTAAA-CGCAGGTGAG-AGCTTCGGCGCATCACCGACCGATCCTGATGTC--TTCGGATGGATTTGAGTAAGAGCCTTACCGCTTGGACCCGAAAGATGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCATCTAG Petriella_setifera AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TGCCTG---TGCAGTCCGAGTTGTAATTTGAAGAGGATGCTTTTG----G-CAA-GGTGC-CTTCCGAGTTCCCTGGAATGGGACGCCATAGAGGGTGAGAGCCCCGTATG-----GTCGGTCGCCGAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTG-CTCGTCGAATCAGCCGTCG----CTCGTCGGCGGCGCATTTCGGCG-GG-CTCAGGCCAGCATCAGTTCGCTGT-GGGGGAGAAAGGCGGTAGGAATGTGG-C--TCCTC------GGAGTGTTATAGCCTAC-CGTATAATACCCCT--CGGCGGACTGAGGACCGCGCA-TC----TCAAGGATGC-TGGCGTAA-TGGTTGTC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGTCCTAATATG---CGAGTGTTCGGGTG-TCAAACCCCTAC-GCGT-AATGAAAGTGAA-CGGAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--CTCGGATGGATTTGAGTATGAGCATATTGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTAAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAG Petriella_sordida AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TGCCTG---TGCAGTCCGAGTTGTAATTTGAAGAGGATGCTTTTG----G-CAA-GGTGC-CTTCCGAGTTCCCTGGAATGGGACGCCATAGAGGGTGAGAGCCCCGTATG-----GTCGGTCGCCGAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGTG-CTCGTCGAATCAGCCGTCG----CTCGTCGGCGGCGCATTTCGGCG-GG-CTCAGGCCAGCATCAGTTCGCTGCAGGGGGAGAAAGGCGGTAGGAATGTGG-C--TCTTC------GGAGTGTTATAGCCTAC-CGTATAATACCCCT--CGGTGGACTGAGGACCGCGCA-TC----TCAAGGATGC-TGGCGTAA-TGGTTGTC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGTCCTAATATG---CGAGTGTTCGGGTG-TAAAACCCCTAC-GCGT-AATGAAAGTGAA-CGGAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--CTCGGATGGATTTGAGTATGAGCATATTGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTAAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAG Pleospora_herbarum_ ----TAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TCTTTT----AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTG-----GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATCGC----CGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCT-TGCAGTTGCTCATCCGGGC----TTTT-GCCCGGTGCACTCTTCTG-TA-GGCAGGCCAGCATCAGTTTGGGCG-GTGGGATAAAGGTCTCTGTCACGTAC-C--TCTCTTC-GGGGAGGCCTTATAGGGGAG--ACGACATACCACC-AGCCTAGACTGAGGTCCGCGCA-TC---TGCTAGGATGC-TGGCGTAA-TGGCTGTA-AGCGGCCCGT-CTTGAAACACGGACCAAGGAG-TCTAACATCTATG---CGAGTGTTTGGGTG-TCAAGCCCGAGC-GCGT-AATGAAAGTGAA-CGGAGGTGGG-AACCCGGGTGCACCATCGACCGATCCTGAAGTT--TTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAG Pseudohalonectria_lignicola_a ---------AACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCC-------GGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-CGC-GGTCC-CCTCCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTCGGAGACCAAGCC-TTTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCTCCGCTGGTGCACTCCGTCC-GG-CTCAGGCCAGCATCGGTCTCCGGC-GGGGGACAAAAGCTCCGGGAACGTGGCC--TCTCCTC---AGAGGTGTTATAGCCCGGCTGCAGAATACCCCGCCTCGGGGACCGAGGACCGCGCCCTCCGGGGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGAGCATTAGGG---CGAGTGTATGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTGGGTGAGAAGCTTTGCCGCATCATCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTCGGACCCGAAAGATGGTGAACTATGCCTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Pseudohalonectria_lignicola_b AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCC-------GGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-CGC-GGTCC-CCTCCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTCGGAGACCAAGCC-TTTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCTCCGCTGGTGCACTCCGTCC-GG-CTCAGGCCAGCATCGGTCTCCGGC-GGGGGACAAAAGCTCCGGGAACGTGGCC--TCTTCTT--AAGAGGTGTTATAGCCCGGCTGCAGAATACCCCGCCTCGGGGACCGAGGACCGCGCCCTCCGGGGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGAGCATTAGGG---CGAGTGTATGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGTGGGTGAGAAGCTTTGCCGCATCATCGACCGATCCTGAAGTC--TTCGGATGGATTTGAGTAGGAGCCTTAACGCTCGGACCCGAAAGATGGTGAACTATGCCTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Pseudohalonectria_suthepensis_ --GAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCCCCG-----GGGCCCGAGTTGTAATTTGCAGAGGATGCTTTCG----G-CGA-GGCCC-CTTCCGAGTCCCCTGGAACGGGGCGCCAGAGAGGGTGAGAGCCCCGTACG-----GTTGGACGCCGAGCC-GGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGGA-AAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGCG-CCCGGCGGATCATCCGGCG----TTCT-CGCCGGTGCGCTCCGCCG-GG-CTCGGGCCAGCATCGGTTTCCTCC-GGGGGATAAAGGCGCCGGGAACGTGG-C--TCCCCTC--GGGGAGTGTTACAGCCCGG-CGCGCAATGCCCCG--GCGGGGACCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCAAGCATTGGGG---CGAGTGTTTGGGTG-TCAAACCCGCAC-GCGA-AATGAAAGTGAA-CGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTA--TTCGGATGGATTTGAGTAGGAGCCTCAACGCTTGGACCCGAAAGATGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATAGGGGCGAAAGACTAATCGAACCATCTAG Pyricularia_borealis --GAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CCC--------AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTG----G-CGA-GGTCC-CTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATG-----GTTGGACACCGAACC-TATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGCGGATCATCCAGCG----TTCT-CGCTGGTGCACTCCGCCC-GG-CTCAGGCCAGCATCGGTTTTCGCC-GGGGGACAAAGGCTTCGGGAACGTGG-C--TCCCTTC--GGGGAGTGTTATAGCCCGT-CGCGTAATACCCCG--GCGGGGACCGACGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCGAGGAG-TCAAGCATTAGTG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTAAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTT--TTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTA- Setosphaeria_monoceras_ AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TCTTTC----AGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTG-----GCAGC-GGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGC----CGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGA-AAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCT-TGCAGTTGCTCATCCGGGC----TTTT-GCCCGGTGCACTCTTCTG-CA-GGCAGGCCAGCATCAGTTTGGGCG-GTGGGATAAAGGTCTCTGTCATGTAC-C--TCTCTTC-GGGGAGGCCTTATAGGGGAG--GCGACATACCACC-AGCCTAGACTGAGGTCCGCGCA-TC---TGCTAGGATGC-TGGCGTAA-TGGCTGTA-AGCGGCCCGT-CTTGAAACACGGACCAAGGAG-TCTAACATCTATG---CGAGTGTTTGGGTG-TCAAGCCCGAGC-GCGT-AATGAAAGTGAA-CGGAGGTGGG-AACCCGGGTGCACCATCGACCGATCCTGAAGTT--TACGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAG Sordaria_fimicola_ ----------ACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCCGCAACAGCTCAAATTTGAGATCTGGC-TTC---------GGCCCGAGTTGTAATTTGTAGAGGAAACTTTCG----G-TGA-GGCAC-CTTCTGAGTCCCTTGGAACAGGGCGCCATAGAGGGTGAGAGCCCCGTATA-----GTCGGATGCCGATCC-AATGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGTGACCAGACTTGCG-CCGTTCCGATCATCCGGTG----TTCT-CACCGGTGCACTCGGGGC-GG-CTCAGGCCAGCATCGGTTTTGGTG-GGGGGATAAAGGTCCAGGGAACGTAG-C--TCCTC----CGGGAGTGTTATAGCCCTG-GGCGTAATGCCCTC--GCTGGGACCGAGGTTCGCGCA-TC---TGCAAGGATGCTTGGCGTAAATGGTCATC-AACGACCCGTCCTTGAAACACGGACCAAGGAG-TCAAGGTTTTGCG---CGAGTGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAGAGTGAA-CGTAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTA--TTCGGATGGATTTGAGTAAGAGCGTTAAGCCTTGGACCCGAAAGATGGTGAACTATGCTTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGAGCATGGGGGCGAAAGACTAATCGAACCATCTAG Valsa_ambiens -------------AACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGC-TTA---------GGCCCGCATTGTAATTTGCAGAGGATGCTTCTG----G-CGA-GGTGC-CTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATG-----GATGGACACCAGACC-TGTGTGAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAA-AAGGGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCG-CCGGGCAGCTCATCAGGGG----TTCT-CCCCTGTGCACTCTGCCC-GG-CTCAGGCCAGCATCGGTTCTCGTG-GGAGGATAAGAACGGTAGGAACGTGG-C--CCCCCTCCGGGGGGGTGTTATAGCCTGC-CGTACGATACTCCC--GTGGGGACCGAGGTTCGCGCT-CC----GCAAGGATGC-TGGCGTAA-TGGTCATC-AGCGACCCGT-CTTGAAACACGGACCAAGGAG-TCGTCCATTAGAG---CGAGCGTTTGGGTG-TAAAACCCGCAC-GCGT-AATGAAAGTGAA-CGCAGGTGAG-AGCTTCGGCGCATCATCGACCGATCCTGATGTC--TTCGGATGGATTTGAGTAAGAGTTTTAACGGACGGACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTAG Xylaria_acuta -----------CCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-CTTC-------GGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTG----G-CGC-GGTGC-CTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACG-----GTTGGACACTAAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTT-CCTAGCGGATCATCCGGTG----TTTT-CACCGGTGCACTTCGCTA-GG-TTTAGGCCAGCATCGGTTTCCGTA-GGGGGATAAAAGCTCTGGGAACGTAG-C--TCCTC----CGGGAGTGTTATAGCCCTC-TGCATAATACCCTT--ACAGGGACCGAGGACCGCGCT-TC---GGCAAGGATGC-TGGCGTAA-TGGTCGTC-AACGACCCGT-CTTGAAACACGGACCAAGGAG-TCGAACATTTGTG---CGAGTGTTTGGGTG-TTAAACCCTCAC-GCGT-AATGAAAGTGAA-CGGAGGTGAG-AGCCCTGGTGCATCATCGACCGATCCTGATGTC--TTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGCGCATGGGGGCGAAAGACTTATCGAACCATCTAG Xylaria_hypoxylon AGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGC-TTTC-------GGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTG----G-CGC-GGTGC-CTTCCGAGTTCCCTGGAACGGGACGCCTTACAGGGTGAGAGCCCCGTACG-----GTTGGACACCAAGCC-TCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA-AAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTT-CTTAGCGGATCATCCGGTG----TTAT-CACCGGTGCACTTCGCTA-AG-TTTAGGCCAGCATCGGTTTCTGTA-GGGGGATAAAAGCCTTGGGAACGTAG-C--TCCTT----CGGGAGTGTTATAGCCCTT-TGCATAATACCCTT--CTGGGGACCGAGGACCGCGCTATA---TGCAAGGATGC-TGGCATAA-TGGTCGTC-AACGACCCGT-CTTGAA?CACGGACCAAGGAG-TCGAACATTTATG---CGAGTGTTTGGGTG-TTAAACCCTCACGGCGT-AATGAAAGTGAA-CGGAGGTGAG-AGCCCTGGTGCATCATCGACCGATCCTGATGTC--TTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATCTGCGCATGGGGGCGAAAGACTTATCGAACCATCTAG ; END; BEGIN TREES; TITLE Conioscypha_peruensis_MLT; LINK TAXA = Taxa1; TRANSLATE 1 Conioscypha_peruensis, 2 Setosphaeria_monoceras_, 3 Pleospora_herbarum_, 4 Dothidea_sambuci_, 5 Chaetomium_globosum_, 6 Sordaria_fimicola_, 7 Codinaea_simplex_, 8 Chaetosphaeria_innumera, 9 Cercophora_newfieldiana, 10 Diaporthe_padi, 11 Diaporthe_pustulata, 12 Valsa_ambiens, 13 Leucostoma_niveum, 14 Conioscypha_japonica, 15 Conioscypha_lignicola, 16 Conioscyphascus_varius, 17 Carpoligna_pleurothecii, 18 Ascotaiwania_sawada, 19 Ascotaiwania_mitriformis, 20 Ophiostoma_piliferum, 21 Ophiostoma_africanum, 22 Magnaporthe_grisea, 23 Gaeumannomyces_graminis_var._graminis, 24 Pseudohalonectria_suthepensis_, 25 Pseudohalonectria_lignicola_a, 26 Pseudohalonectria_lignicola_b, 27 Gaeumannomyces_cylindrosporus, 28 Gaeumannomyces_graminis_var._avenae, 29 Gaeumannomyces_graminis_var._tritici, 30 Magnaporthe_salvinii, 31 Mycoleptodiscus_coloratus, 32 Ophioceras_sp._CMU26633, 33 Ophioceras_commune_a, 34 Ophioceras_commune_b, 35 Ophioceras_commune_c, 36 Ophioceras_dolichostomum_a, 37 Ophioceras_dolichostomum_b, 38 Ophioceras_dolichostomum_c, 39 Ophioceras_dolichostomum_d, 40 Ophioceras_hongkongense, 41 Ophioceras_leptosporum, 42 Ophioceras_tenuisporum, 43 Pyricularia_borealis, 44 Dactylaria_higginsii, 45 Xylaria_acuta, 46 Xylaria_hypoxylon, 47 Hypocrea_Scheinitzii, 48 Hypomyces_subiculosus_, 49 Petriella_sordida, 50 Petriella_setifera, 51 Ascotaiwania_lignicola; TREE Imported_tree_0 = [&R] (4:0.037008082874859995,((2:0.005542536239234714,3:0.0049119807557760934):0.13268652766564384,((45:1.2866388144329902E-4,46:0.023917930241777952):0.0639429022229224,((((47:0.02412183643680378,48:0.02889120448809498):0.02044554779810046,(49:0.0053190414161678615,50:0.0012517556042528695):0.09178672316964143):0.01993213675967798,(((1:0.05994705206550791,16:0.02522455191399403):0.038753259966943496,(14:0.036461436321403626,15:0.0015185058541357442):0.042605704747304796):0.04458376759122388,(17:0.04248923171014322,(51:0.0670705214867658,(18:0.07619371250148785,19:0.0481888683172785):0.040036347016384):0.060391236871154184):0.01570216192905473):0.23413026553196117):0.052831655423250135,((20:0.041085401129666604,21:0.059606559266434087):0.04735093336194843,((((10:1.26913382035967E-6,11:1.26913382035967E-6):0.009066595235711492,(12:0.007110834464851271,13:0.011931491948659806):0.03913333671471398):0.07733418031055325,((7:0.043767386414749615,8:0.05250091721305217):0.0618361703156225,(9:0.03513652195739565,(5:0.009279047982596773,6:0.04740276254834513):0.0163195302590192):0.016602545637791163):0.0167773021218613):0.016882054231500253,(((24:0.024380692284133466,42:0.01081143259489005):0.026184460417357346,(25:1.26913382035967E-6,26:0.0026360003523287013):0.05551465200292617):0.006818945923561678,(((43:0.01149900319400132,(22:0.006227281201833279,44:0.027871480056605176):0.003008390670443538):0.002647490215213202,(27:0.006955109200073843,(30:0.005632904116242029,(23:1.26913382035967E-6,(28:0.0011707571616297358,29:0.005089266955225043):0.0016941921155749064):0.005081270827411745):0.00258138592880011):0.01297947072948304):0.012119285082272956,(31:0.01981956424908108,((32:0.009501654814095931,41:0.008004012084532004):0.053445354075198355,((34:0.001319420339374929,(33:1.26913382035967E-6,35:1.26913382035967E-6):1.26913382035967E-6):0.030472321137702686,(40:0.005187792470670871,((36:0.005692307152680717,38:0.011708795118157094):0.0016132037792870554,(37:0.006752746863932331,39:0.023804446853782302):0.0050628396414067875):0.007564878717046052):0.027782925850273595):0.024431039461493536):0.048506136636442695):0.017053478725900517):0.011492490534801982):0.018046817254750224):0.015064254350719928):0.010610473394765034):0.03269494522219133):0.125315728931733):0.037008082874859995); END;