#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 11:59 GMT TreeBASE (cc) 1994-2008 Study reference: Maier W., Khoza T., Harmse N., Wingfield B.D., & Wingfield M.J. 2006. A disease epidemic on Zizyphus mucronata in the Kruger National Park caused by Coniodictyum chevalieri. Studies in Mycology, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1529] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=19; TAXLABELS Clinoconidium_bullatum_AF487383 Clinoconidium_cf_bullatum_AB178259 Clinoconidium_cf_bullatum_AB178260 Clinoconidium_cf_bullatum_AF487382 Clinoconidium_sp._AB177594 Clinoconidium_sp._AB178258 Clinoconidium_sp._AF487381 Coniodictyum_chevalieri_AF487384 Coniodictyum_chevalieri_WM3450 Coniodictyum_chevalieri_WM3451 Dicellomyces_scirpi Graphiola_cylindrica Graphiola_phoenicis Kordyana_celebensis Kordyana_tradescantiae Laurobasidium_hachijoense_AB176715 Laurobasidium_hachijoense_AB177562 Laurobasidium_hachijoense_AB177566 Laurobasidium_lauri ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1143] TITLE LSU; LINK TAXA = Taxa1; DIMENSIONS NCHAR=508; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Clinoconidium_bullatum_AF487383 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCAC-GGTCCGCATTGTAATTTCGAGAGATGTCTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGCGGTTGGATTCAGCTTTTTTTTTAAAAAGTGTATTTCCATTCGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGCAGGAAGAACGTAGCTTTCTTCGGAAAGTGTTATAGCCTCTTGCTT-GATACGGCTTGGGGGACCGAGGC Clinoconidium_cf_bullatum_AB178259 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCAC-GGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGCGGTCGGATTCAGCTTTTTTTT--AAAAGTGTATTTCCGGTCGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGTAGGAGGAACGTAGCTTTCTTCGGAAAGTGTTATAGCCTCTTGCTT-GATACGGCTTGGGGGACCGAGGC Clinoconidium_cf_bullatum_AB178260 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCAC-GGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGCGGTCGGATTCAGCTTTTTTTT--AAAAGTGTATTTCCGGTCGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGTAGGAGGAACGTAGCTTTCTTCGGAAAGTGTTATAGCCTCTTGCTT-GAT-CGGCTTGGGGGACCGAGGC Clinoconidium_cf_bullatum_AF487382 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCAC-GGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGCGGTTGGATTCAGCTTTTTTT---AAAAGTGTATTTCCAGTCGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGCAGGAGGAATGTAGCTTTCTTCGGAAAGTGTTATAGCCTCTTGCTT-GATACGGCTTGGGGGACCGAGGC Clinoconidium_sp._AB177594 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCACGGGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGCGTTTGGATTCAGCTTTTTTT---AAAAGTGTATTTCCAGTCGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGTAGGAAGAATGTATCTTTCTTCGGAAAGTGTTATAGCCTCTTGCTT-GATACGGCTTGGGGGACCGAGGC Clinoconidium_sp._AB178258 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCACGGGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGCGTTTGGATTCAGCTTTTTTT---AAAAGTGTATTTCCAGTCGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGTAGGAAGAATGTATCTTTCTTCGGAAAGTGTTATAGCCTCTTGCTT-GATACGGCTTGGGGGACCGAGGC Clinoconidium_sp._AF487381 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCACGGGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGCGTTTGGATTCAGCTTTTTTT---AAAAGTGTATTTCCAGTCGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGTAGGAAGAATGTATCTTTCTTCGGAAAGTGTTATAGCCTCTTGCTT-GATACGGCTTGGGGGACCGAGGC Coniodictyum_chevalieri_AF487384 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCGTGCTTGCGCGTCCGCATTGTAATTTCTAGAGGCGTTTTCCACGCTGGACCACG--TACATGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAATCCCGTACTTGACGTGGACGACCATGCGTTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGATTGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGTTGGAAGTTAGTCATGGGTCGTGTAGCTCAGCTTGTGTTTTCATTGGCTTTCTCTATGCGATCCAAGCCAGCATCGGTTTTGACTGTCGGATAAGAGCAGGAGGAAAGTGGC-TTTTTCGGAAGACCTTATAGCCTCTTGCTG-GATACGACGGTTGGGACCGAGGA Coniodictyum_chevalieri_WM3450 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCGTGCTTGCGCGTCCGCATTGTAATTTCTAGAGGCGTTTTCCACGCTGGACCACG--TACATGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAATCCCGTACTTGACGTGGACGACCATGCGTTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGATTGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGTTGGAAGTTAGTCATGGGTCGTGTAGCTCAGCTTGTGTTTTCATTGGCTTTCTCTATGCGATCCAAGCCAGCATCGGTTTTGACTGTCGGATAAGAGCAGGAGGAAAGTGGC-TTTTTCGGAAGACCTTATAGCCTCTTGCTG-GATACGACGGTTGGGACCGAGGA Coniodictyum_chevalieri_WM3451 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGCGTGCTTGCGCGTCCGCATTGTAATTTCTAGAGGCGTTTTCCACGCTGGACCACG--TACATGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAATCCCGTACTTGACGTGGACGACCATGCGTTTTGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGATTGCAGCTCTAAATTGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGTTGGAAGTTAGTCATGGGTCGTGTAGCTCAGCTTGTGTTTTCATTGGCTTTCTCTATGCGATCCAAGCCAGCATCGGTTTTGACTGTCGGATAAGAGCAGGAGGAAAGTGGC-TTTTTCGGAAGACCTTATAGCCTCTTGCTG-GATACGACGGTTGGGACCGAGGA Dicellomyces_scirpi GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTTTG--GTCCGCATTGTAATCTCGAGATGTGTTTTCCGTGCTAGACCGTG--GACAAGTTCCTTGGAATTGGATGTCATAGAGGGTGAGAACCCCGTACATGCCGCGGATGCCTA-GTGCTTTGTGATACACGTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTTAGATGTGTGTAGTGGTGCTCAGCCG--------CAAGGCGTTTTCATTGCTACACAGGCCAACATCGGTTGTAGGGGGTGGAGAATAGGCGGAGGAATGTGGC--ACCTCCGGGTGCGTTATAGCCTCTGCCCG-GATACATCCCCCACGACCGAGGT Graphiola_cylindrica GCGAGTGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGC---CGCAA-GGTCCGCATTGTAATCTCGAGAAGTGTTTTCCGCGCTGGACCATG--GACAAGTTCCCTGGAATGGGATGTCATAGAGGGTGATAACCCCGTACTTGCTGTGGACGCCCA-GTGCTTTGTGATACACTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAAGTCAGACGTGCAT-GCAGTATTCAGCCTGGCTTCGGCTTGGTGTATTTATTGTTTTGCAGGCCAACATCGATTTTCGGCAACGGATAAGGGTATAGGGAATGTGGC--CTCTCCGGAGGTGTTATAGCCCTGTACTG-GATACGTTGCTGGGGATCGAGGA Graphiola_phoenicis GCGAGTGAAGCGGGAAGAGCTCAAAT{CT}TGAAAGCTGGC---AGCAA-TGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCTGGACCGTG--GACAAGTTTCCTGGAATGGAATGTCATAGAGGGTGAAAACCCCGTACTTGCCGCGGACGCCCA-GTGCTTTGTGATGCGCGTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCATTGGAAGTCAGACGTGCAT-GCAGTACTCAGCCTGGCTTTGGCTTGGTGTATTTGCTGTTTTGCAGGCCAACATCGATTTTTGGCAACGGATAAGGGTAGAGAGAATGTGGC--CTCCCCGGAGGTGTTATAGCTCTCTACTG-GATACGTTGCCGGGGATCGAGGA Kordyana_celebensis GCGAGTGAAGCGGGAAAAGCTCAAATTTGAAAGCTTAC---AGTAA-TGTACGCGTTGTAATCTCGAGAAATGTTTTCCGTGCTGGACCATG--GACAAGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAACCCCGTCTTTGCCATGGACGCCCA-GCGCTTTGCGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTCAGACGTGTAGCGCGGTACTCAGCCT--------TATGGTGTTTTTACCGCATTACTGGCCAGCATCGATTTTGAGCGACGGAGAAGGGTGTGAGGAACGTGGC--ACCTCCGGGTGTGTTATAGCCTTACACTG-GATACGTCGCTTGGGATCGAGGA Kordyana_tradescantiae GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTTGC---AGCAA-TGCACGCGTTGTAATCTCGAGAAATGTTTTCCGTGCTGG{AT}CCATG--GACAAGTTCCTTGGAATAGGATGTCATAGAGGGTGAGAACCCCGTCTTTGCCATGGACGCCCA-GTGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCGCTTCAAGTCAGACGTGTAGTGCGGTACTCAGCCT--------TACGGCGTTTTTACCGTTTTACTAGCCAGCATCGATTTTGAGCAACGGATAAGGGTGTGGGGAACGTGGC--ACCT-CGGGTGTGTTATAG{AC}CTTACACTG-GATACGTCGCTTGGGATCGAGGA Laurobasidium_hachijoense_AB176715 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCAC-GGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGTCGTTGGATTCAGCTTTTTCTT--AAAAGTGTATTTCCGGCGGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGGGAGAGGAACGTAGCTTTCTTCGGAAAGTGTTATAGCCTCTTTCTT-GATACGGCTTGGGGGACCGAGGC Laurobasidium_hachijoense_AB177562 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCAC-GGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACG--TACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGTCGTTGGATTCAGCTTTTTCT---AAAAGTGTATTTCCGGCGGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGGGAGAGGAACGTAGCTTTCTTCGGAAAGTGTTATAGCCTCTTTCTT-GATACGGCTTGGGGGACCGAGGC Laurobasidium_hachijoense_AB177566 GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---CTCAC-GGTCCGCATTGTAATTTCGAGAGATGTTTTCCGCGTTGGACCACGTATACAAGTCTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACATCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGTCGTTGGATTCAGCTTTTTCT---AAAAGTGTATTTCCGGCGGTACAGGCCAGCATCGGTTTTCTGGGCCGGATAAGGGGGAGAGGAACGTAGCTTTCTTCGGAAAGTGTTATAGCCTCTTTCTT-GATACGGCTTGGGGGACCGAGGC Laurobasidium_lauri GCGAGTGAAGCGGGATGAGCTCAAATTTGAAAGCTGGC---TTCAC-GGTCCGCATTGTAATTTCGAGAGACGTTTTCCGCGTTGGACCACG--TACAAGTTTCCTGGAAAGGAGTGTCATAGAGGGTGATAACCCCGTACTTGATGTGGACGCCCA-AGGCTTTGTGATACGTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAGCACTGGAGGTTAGACGTGTGCCGTTGGATTCAGCTTTTTTTT--TAAAGTGTATTTCCGGCGGTACAGGCCAGCATCGGTTTTCGGGATCGGATAAGGGTGAGAGGAACGTAGCTTTCTTCGGATTGTGTTATAGCCTCTTTCTTGGATACGGCCTGGGAGACCGAGGC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = LSU) = N: 1-508; CODONPOSSET CodonPositions (CHARACTERS = LSU) = N: 1-508; END; BEGIN TREES; TITLE Tb7744; LINK TAXA = Taxa1; TRANSLATE 1 Laurobasidium_lauri, 2 Laurobasidium_hachijoense_AB177566, 3 Laurobasidium_hachijoense_AB177562, 4 Laurobasidium_hachijoense_AB176715, 5 Kordyana_tradescantiae, 6 Kordyana_celebensis, 7 Graphiola_phoenicis, 8 Graphiola_cylindrica, 9 Dicellomyces_scirpi, 10 Coniodictyum_chevalieri_WM3451, 11 Coniodictyum_chevalieri_WM3450, 12 Coniodictyum_chevalieri_AF487384, 13 Clinoconidium_sp._AF487381, 14 Clinoconidium_sp._AB178258, 15 Clinoconidium_sp._AB177594, 16 Clinoconidium_cf_bullatum_AF487382, 17 Clinoconidium_cf_bullatum_AB178260, 18 Clinoconidium_cf_bullatum_AB178259, 19 Clinoconidium_bullatum_AF487383; TREE con_50_majrule_RR = [&R] ((((5,6),(8,7)),9),((((2,3,4),((17,18),((14,15,13),19,16))),1),(12,10,11))); END; BEGIN TREES; TITLE Tb7745; LINK TAXA = Taxa1; TRANSLATE 1 Laurobasidium_lauri, 2 Laurobasidium_hachijoense_AB177566, 3 Laurobasidium_hachijoense_AB177562, 4 Laurobasidium_hachijoense_AB176715, 5 Kordyana_tradescantiae, 6 Kordyana_celebensis, 7 Graphiola_phoenicis, 8 Graphiola_cylindrica, 9 Dicellomyces_scirpi, 10 Coniodictyum_chevalieri_WM3451, 11 Coniodictyum_chevalieri_WM3450, 12 Coniodictyum_chevalieri_AF487384, 13 Clinoconidium_sp._AF487381, 14 Clinoconidium_sp._AB178258, 15 Clinoconidium_sp._AB177594, 16 Clinoconidium_cf_bullatum_AF487382, 17 Clinoconidium_cf_bullatum_AB178260, 18 Clinoconidium_cf_bullatum_AB178259, 19 Clinoconidium_bullatum_AF487383; TREE nj_RR = [&R] ((((5,6),(8,7)),9),(((((2,3),4)Laurobasidium,((17,18),((((14,15),13),19),16))Clinoconidium),1)Cryptobasidiaceae_lauraecous_hosts,((12,11),10)Coniodictyum_Africa_Zizyphus)Cryptobasidiaceae); END;