#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 18:43 GMT TreeBASE (cc) 1994-2008 Study reference: Layton D.J., & Kellogg E. 2014. Morphological, phylogenetic, and ecological diversity of the new model species Setaria viridis (Poaceae: Paniceae) and its close relatives. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15334] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=144; TAXLABELS Cenchrus_calyculatus_A_a Cenchrus_calyculatus_A_b Cenchrus_calyculatus_E_a Cenchrus_calyculatus_E_b Cenchrus_ciliaris_1_E_a Cenchrus_ciliaris_1_E_b Cenchrus_ciliaris_2_D_a Cenchrus_ciliaris_2_D_b Cenchrus_echinatus_B_a Cenchrus_echinatus_B_b Cenchrus_echinatus_D Cenchrus_myosuroides_D Cenchrus_myosuroides_E_a Cenchrus_myosuroides_E_b Cenchrus_pilosus_E_a Cenchrus_pilosus_G_a Cenchrus_setigerus_F_a Cenchrus_setigerus_F_b Chaetium_bromoides_A_a Chaetium_bromoides_E_a Ixophorus_unisetus_1_T_a Ixophorus_unisetus_1_T_b Ixophorus_unisetus_1_T_c Ixophorus_unisetus_1_T_d Ixophorus_unisetus_2_O_a Ixophorus_unisetus_2_O_b Ixophorus_unisetus_2_O_c Panicum_miliaceum_I_a Paspalidium_aversum_F Paspalidium_aversum_G_a Paspalidium_aversum_G_b Paspalidium_distans_1_F_a Paspalidium_distans_1_G_a Paspalidium_distans_2_F_a Paspalidium_distans_2_G_a Paspalidium_jubiflorum_E_a Paspalidium_jubiflorum_G_a Pennisetum_alopecuroides_B_a Pennisetum_alopecuroides_B_b Pennisetum_alopecuroides_C Pennisetum_flaccidum_1_B Pennisetum_flaccidum_1_C_a Pennisetum_flaccidum_1_C_b Pennisetum_flaccidum_2_D_a Pennisetum_glaucum_E_a Pennisetum_glaucum_E_b Pennisetum_lanatum_D Pennisetum_lanatum_E Pennisetum_villosum_F Pseudoraphis_paradoxa_F_a Pseudoraphis_paradoxa_F_b Pseudoraphis_spinescens_F_a Pseudoraphis_spinescens_F_b Setaria_adhaerens_1_O_Doust_1401 Setaria_adhaerens_D00_001 Setaria_adhaerens_D99_007 Setaria_barbata_A Setaria_barbata_E Setaria_faberi_Kellogg_1247_A Setaria_faberi_Kellogg_1247_B Setaria_faberi_Layton_154_A Setaria_faberi_Layton_154_B Setaria_faberi_Nee_57234_1_A Setaria_faberi_Nee_57234_1_B Setaria_faberi_Vela_70_1_A Setaria_faberi_Vela_70_1_B Setaria_geniculata_G_a Setaria_grisebachii_F_a Setaria_italica_1_H_Doust_1403 Setaria_italica_2_F_a_Doust_1361 Setaria_italica_ISE_1107 Setaria_palmifolia_B Setaria_palmifolia_F_a Setaria_palmifolia_F_b Setaria_parviflora_G_a Setaria_parviflora_G_b Setaria_parviflora_Kellogg_1259_A Setaria_parviflora_Kellogg_1259_B Setaria_poiretiana_1_B_a Setaria_poiretiana_1_B_b Setaria_poiretiana_1_F_a Setaria_poiretiana_2_B_a Setaria_poiretiana_2_B_b Setaria_poiretiana_2_G_a Setaria_poiretiana_2_G_b Setaria_pumila_D_a Setaria_pumila_D_b Setaria_pumila_E_a Setaria_pumila_E_b Setaria_pumila_ME036_1_A Setaria_pumila_ME036_1_B Setaria_sp_ISE_1679_A Setaria_sp_ISE_1679_B Setaria_sp_ISE_1679_B1 Setaria_sphacelata_A_a Setaria_sphacelata_A_b Setaria_sphacelata_D Setaria_verticillata_2_G_a_Doust_1360 Setaria_verticillata_D00_115_A Setaria_verticillata_D00_115_B Setaria_verticillata_D97_007_A Setaria_verticillata_D97_007_B Setaria_verticillata_D99_025_A Setaria_verticillata_D99_025_B Setaria_verticillata_SETAD2_A Setaria_verticillata_SETAD2_B Setaria_verticillata_SETVE2_A Setaria_verticillata_SETVE2_B Setaria_verticilliformis_D00_116_A2 Setaria_verticilliformis_D00_116_B Setaria_viridis_1_H_a_Doust_1404 Setaria_viridis_2_D_a_PI_408811 Setaria_viridis_Ahart_17139_1 Setaria_viridis_K_1211_S Setaria_viridis_K_1235 Setaria_viridis_ME014_1 Setaria_viridis_Thompson_1 Setaria_viridis_Yang_1108 Setaria_viridis_Yang_8014 Spinifex_sericeus_H Spinifex_sericeus_I_a Stenotaphrum_secundatum_I_a Stenotaphrum_secundatum_I_b Zuloagea_bulbosa_1_O Zuloagea_bulbosa_1_R_a Zuloagea_bulbosa_1_R_b Zuloagea_bulbosa_1_R_c Zuloagea_bulbosa_1_R_d Zuloagea_bulbosa_2_O Zuloagea_bulbosa_2_R_a Zuloagea_bulbosa_2_R_b Zuloagea_bulbosa_2_R_c Zuloagea_bulbosa_3_O_a Zuloagea_bulbosa_3_R_a Zuloagea_bulbosa_3_R_b Zuloagea_bulbosa_3_R_c Zuloagea_bulbosa_4_C Zuloagea_bulbosa_4_D Zuloagea_bulbosa_4_F_a Zuloagea_bulbosa_4_F_b Zygochloa_paradoxa_1_G_a Zygochloa_paradoxa_1_G_b Zygochloa_paradoxa_2_G_a Zygochloa_paradoxa_2_G_b ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M20703] TITLE Setaria_knotted1_alignment; LINK TAXA = Taxa1; DIMENSIONS NCHAR=766; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cenchrus_calyculatus_A_a TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGTTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACA----TCTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Cenchrus_calyculatus_A_b TCGAGTGCCAGAAGGCAAGTAG------TAGCAG----ACTAGCAGTCT---AACAGT-AGAGCTTG------------------CTGTTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--TA----TACATCTGATGTCAAGCAAGCATGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CG----TGTA-GACA----TGTGCATCA--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCACTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACATA-----CG-TATCACC---TAC-TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGC-----TGTCTG---TGTTCTCAAGG--------TTTATT----CAC-CC-ACGTT-GGCCTACGCGCGCCCTCACTTTCAA-GTTTCAACTCG------------TTTTTTTCCCGCGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Cenchrus_calyculatus_E_a TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGTTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AAGG--TTCAGAACCTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACATA--------TGTCGCC-------TAG---TAACA---AACGATTT----CTTCGCCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TGCTCTCAG--------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------ATCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Cenchrus_calyculatus_E_b TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGTTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACA----TCTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Cenchrus_ciliaris_1_E_a TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGAA--GGCAATAATTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACC----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTAACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---GACAGTT-----CCTCTTCAGAT----CGAGAAAGAA-CGCGT----TCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTGC---------CAC-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGCGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCATCTCCGGCAGA Cenchrus_ciliaris_1_E_b TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGCCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGAA--GGCTATAATTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACC----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTAACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCACTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCATCTCCGGCAGA Cenchrus_ciliaris_2_D_a TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCT---------TCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACA----TGCGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----CCTCTTCAGAT----CGAGAAAGAA-CGCGT----CTTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCATCTCCGGCAGA Cenchrus_ciliaris_2_D_b TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGAA--GGCTATAATTTATGCATG-CTACTC--TCAGCTGGCTCG----TGTA-GACC----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTAACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----CCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG----------------TTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCATCTCCGGCAGA Cenchrus_echinatus_B_a TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGAA--GGCTATAATTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACC----TGTGCATTG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTAACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG---------------TTTTTCCGTGCGGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCGTCTCCGGCAGA Cenchrus_echinatus_B_b TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CAC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGAA--GGCTATAATTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACC----TGTGCATCG--AACG--TTCAGAACTTTT-AGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACA---AACAATT-----CCTCTTCAGAT----CGAGAAAGAA-CGCGT----TCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTGC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCTCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCATCTCCGGCAGA Cenchrus_echinatus_D TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGAA--GGCTATAATTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACC----TGTGCATTG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCACCGCCGGAGGTGTCGGCGAGGCTAACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCATAC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCATCTCCGGCAGA Cenchrus_myosuroides_D TCGAGTGCCAGAAGGCAAGTAG------------------TAGCAGTGT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCAAGCTCGG-CGC--ATGCTCAC-TTTTCTGCTTGCCTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACACA--TGTGCATCG--AACG--TTCA--ACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTAGAAGCGCGGCAGCGGACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACATATATA-CG-TATCACC---TACCAA----TAACCCTCAACAATT-----TCTCTTCAGAT----CAAGAAAGAA-CGCGC-----TGTCTG---TGTTCTTAAGG--------TTTATT----CAC-TC-ACGTT-GGCCTAC----------ACCTTTA--CTTTCAACTTG--------------TTTTTTAAGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCATCTCCGGCAGA Cenchrus_myosuroides_E_a TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCG---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACA----TCTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACATA-----CG-TATCACC-------TAG---TAAC----AACAA-------TCT------------GGAGAAAGAA-CGCGT----CCTTTTG---TGCTCTCAG--------------------CAC-GT-ACGGT-GGTGTAC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Cenchrus_myosuroides_E_b TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCG---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACA----TCTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Cenchrus_pilosus_E_a TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACA----TCTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG------------TTTTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGACCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAATCGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Cenchrus_pilosus_G_a TCGAGTGCCGGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACA----TCTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG------------TTTTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGACCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAATCGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Cenchrus_setigerus_F_a TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----CGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGAA--GGCTATAATTTATGCATG-CTACTC--TCAGCTGGCTCA----TGTA-GACC----TGTGCATTG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTAACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG--------------TTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCGTCTCCGGCAGA Cenchrus_setigerus_F_b TCGAGTGCCAGAAGGCAAGTAG---------------TAGTAGCAGTCT---AACAGT-GGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGAA--GGCTATAATTTATGCATG-CTACTC--CCAGCTGGCTCA----TGTA-GACC----TGTGCATTG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTAACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTAGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGT----------------------ACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CCTTTTG---TG---------------------------CAC-GT-ACGGT-GGCGTAC---------CAA-------GTCTCAACTCG--------------TTTCTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCCCTGTCCATCTCCGGCAGA Chaetium_bromoides_A_a TCGAGTGCCAGAAGGCAAGATTATTGCCTATACACTCTAGTAGCATCCTGCTAACAGT-GGCGCTTG------------------CTGCTGCTGCTTCTGGTTCTGCTC--CAGAAGTTTCTTC--------TACATCTGATGTCTAGCA----TGGACGC--ATGCACAC-TTT-CTGCTTGCTTTTACATAGCT--GGCTATAGTTTATGCATG-GTTCTC------------CA----TGTG-GACA----TGTGCATCTCTAGTG--TTCACAACTTTT-GGCCGTGGGTTTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCTCGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATAATAT---------CACCTACTATATAG---TAATC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCCT------GTCTG---GG--CTC---------------------------------------TAC-----TGCTCAAGGT----TTATCCACTCGGGG--------------TTTCTGCGCAGGAGGCGTACCACGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAAGGTGGAGTCGCAGCTTAACTCTCTCTCCATCTCCGGCAGA Chaetium_bromoides_E_a TCGAGTGCCAGAAGGCAAGATTATTGCCTATACACTCTAGTAGCATCCTGCTAACAGT-GGCGCTTG------------------CTGCTGCTGCTTCTGGTTCTGCTC--CAGAAGTTTCTTC--------TACATCTGATGTCAAGCA----TGGACGC--ATGCACAC-TTT-CTGCTTGCTTTTACATAGCT--GGCTATAGTTTATGCATG-GTTCTC------------CA----TGTG-GACA----TGTGCATCTCTAGTG--TTCACAACTTTT-GGCCGTGGGTTTTTGCAGGTGGGGGCGCCGCCTGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCTCGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATAATAT---------CACCTACTATATAG---TAATC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCCT------GTCTG---GG--CTC---------------------------------------TAC-----TGCTCAAGGT----TTATCCACTCGGGG--------------TTTCTGTGCAGGAGGCGTACCACGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAAGGTGGAGTCGCAGCTTAACTCTCTCTCCATCTCCGGCAGA Ixophorus_unisetus_1_T_a TCGAGTGCCAGAAGGCAAGTAT---------------------CAGTCTAACAACAGTCGGAGTTTG------------CTGCTGCTGCTGCTGCTTCCGGTTCTGCTG--GAGAAGTTTTTCC--------TACATCTGATGTCAAACA----TGG-CTC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCAAG-CTACTC----AACTCGTG------TG---GACA----TGTGTATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGTGGGCTCGGCGCCGCCACTGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATAT-AATAT------CACC---TAAC-AG---TAACC---AACAATT-----TCTCTTCTGAT----GGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCACGG-------TTTTATTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------GTCTCAGCTCG--------------TCTTGTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTTCATATCTGGCAGA Ixophorus_unisetus_1_T_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG---------------CAGCTGCTGCCGCTTCCGGTTCTCCCC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACGC-TTTCCTGCTCGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CATATA-GTT-GACA----TGTGCATCT--AGTG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGACTGACAGCGATGGCACAGGAGCTCGAAGCCCGGCAGCGCACGGCGCTTGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTTATGGTGAGCTATG-------------CACG--TGAGCTAG---TAA--------AATT-----AACAAACAGAT----GGAGATAAAAACGCGC----CTCTGGG-TG--TTTTCAA--------TTTTTATTCACTCA----CACGTTTGCCTTAC----GTCCTCG--------CTTTTAACTCG-----------TTTTTTTCGCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCGGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACACAGCTCAACTCGCTCTCCATCTCCGGCAGA Ixophorus_unisetus_1_T_c TTGAGTGCCAGAAGGCAAGTAT---------------------CAGTCTAACAACAGTCGGAGTTTG------------CTGCTGCTGCTGCTGCTTCCGGTTCTGCTG--GAGAAGTTTTTCC--------TACATCTGATGTCAAACA----TGG-CTC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCAAG-CTACTC----AACTCGTG------TG---GACA----TGTGTATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCCCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA---ATAT------CACC---TAAC-AG---TAACC---AACAATT-----TCTCTTCTGAT----GGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCACGG-------TTTTATTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------GTCTCAGCTCG--------------TCTTGTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATATCTGGCAGA Ixophorus_unisetus_1_T_d TCGAGTGCCAGAAGGCAAGTAT---------------------CAGTCTAACAACAGTCGGAGTTTG------------CTGCTGCTGCTGCTGCTTCCGGTTCTGCTG--GAGAAGTTTTTCC--------TACATCTGATGTCAAACA----TGG-CTC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCAAG-CTACTC----AACTCGTG------TG---GACA----TGTGTATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCCCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA---ATAT------CACC---TAAC-AG---TAACC---AACAATT-----TCTCTTCTGAT----GGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCACGG-------TTTTATTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------GTCTCAGCTCG--------------TCTTGTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATATCTGGCAGA Ixophorus_unisetus_2_O_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG---------------CAGCTGCTGCCGCTTCCGGTTCTCCCC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACGC-TTTCCTGCTCGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CATATA-GTT-GACA----TGTGCATCT--AGTG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGACTGACAGCGATGGCACAGGAGCTCGAAGCCCGGCAGCGCACGGCGCTTGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTTATGGTGAGCTATG-------------CACA--TGAGCTAG---TAA--------AATT-----AACAAACAGAT----GGAGATAAAAACGCGC----CTCTGGG-TG--TTTTCAA--------TTTTTATTCACTCA----CACATTAGCCTTAC----GTCCTCG--------CTTTCAACTCG---------TTTTTTTTTCGCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACACAGCTCAACTCGCTCTCCATCTCCGGCAGA Ixophorus_unisetus_2_O_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG---------------CAGCTGCTGCCGCTTCCGGTTCTCCCC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACGC-TTTCCTGCTCGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CATATA-GTT-GACA----TGTGCATCT--AGTG--TTCAGAGCTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGACCGACAGCGATGGCACAGGAACTCGAAGCCCGGCAGCGCACGGCGCTTGGCGGGCTCAGCGCCGCCACGGAGCCGGAGCTGGATCAGTTTATGGTGAGCTATG-------------CACA--TGAGCTAG---TAA--------AATT-----AACAAACAGAT----GGAGATAAAAACGCGC----CTCTGGG-TG--TTTTCAA--------TTTTTATTCACTCA----CACGTTAGCCTTAC----GTCCTCG--------CTTTCAACTCG---------TTTTTTTTTCGCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACACAGCTCAACTCGCTCTCCATCTCCGGCAGA Ixophorus_unisetus_2_O_c TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTG--AACAGT-AGAGCTTGCAG---------TCGCAGCTGCTGCCCCTTCCGGTTCTCCCC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACGC-TTTT--GCTCGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CATATA-GTT-GACA----TCTGCATCT--AGTG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGACTGACGGCGATGGCACAGGAGCTCGAAGCCCGGCAGCGCACGGCGCTTGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTTATGGTGAGCTATA-------------CACA--TGAGCTAG---T-------AACAATT-----AACAAACAGAT----CGAGATAAAAACGCGC----CTCTGAG-TG--TTTTCAA--------TTTTTATTCACTCA----CACGTTTGCCTTAC----GTCCTCG--------CTTTCAACTCG-----------TTTTTTTCGCTGTGCAGGTGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACACAGCTCAACTCGCTCTCCATCTCCGGCAGA Panicum_miliaceum_I_a TCGAGTGCCAGAAGGCAAGACT-------AGCTGTATCAGTAACAGTCT---AACAGT-AGCG----------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCAGAC-TTT-CTGCTTGCTTTTCCATAGCA--TGCTATAGTTTATGCACG-CTGCTC-------------A----TGTA-GACA----TGTGCATCT--AGTG--TTCAGAACTTTT-GGCCGTGGGTGCTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAGGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCGACGGAGCCGGAGCTGGACCAGTTCATGGTGAGCCATA------------CCATACATCAGCTAG---TAACA---CACAATT-----TCTCTTCA--------GAGAAAGGA-CGCGT----CAGTCT--TTGCTCTTCAAGG-------C-TTATT----CAC--TCACGGT-GGCGTAC----GTCCTTG--------CTTTCAACTCGG--------TTCTTGTTCTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAGCTCGCTCTCCATCTCCGGCAGA Paspalidium_aversum_F TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGC-AGTGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTCACTCAGCT----CA----TGTA-GACA----TGTGTATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTCGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCACGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAACC---AACTATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC---CCTGTCTG-TGTGTTCTCAAGG-------TTTTATTCAGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCATCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCACGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Paspalidium_aversum_G_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGC-AGTGCTCG---------------CTGCTGCTGCTGCTTCCGATTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTCACTCAGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTCGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCAA--------TTTTTATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCAG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Paspalidium_aversum_G_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGC-AGTGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTCACTCAGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTCGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCACGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAACC---AACTATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC---CCTGTCTG-TGTGTTCTCAAGG-------TTTTATTCAGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCATCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGGGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCACGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Paspalidium_distans_1_F_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGC-AGTGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTCACTCAGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTCGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCACGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATATAT----------CACC---CAG-TAG---TAACC---AACTATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC---CCTGTCTG-TGTGTTCTCAAGG-------TTTTATTCAGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCATCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCACGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Paspalidium_distans_1_G_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTCCTCC--------TACATCTGATGTCAAGCA----TGG-CAC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCACAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCAA--------TTTTTATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCAG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCACGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Paspalidium_distans_2_F_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGC-AGTGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTCACTCAGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTCGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCACGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAACC---AACTATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC---CCTGTCTG-TGTGTTCTCAAGG-------TTTTATTCAGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCATCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCACGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Paspalidium_distans_2_G_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTCCTCC--------TACATCTGATGTCAAGCA----TGG-CAC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCACAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-GGTGTTCTCAA--------TTTTTATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCAG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Paspalidium_jubiflorum_E_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGC-AGTGCTTG---------------CTGCCGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTCACTCAGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTCGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCACGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAACC---AACTATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC---CCTGTCTG-TGTGTTCTCAAGG-------TTTTATTCAGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCATCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Paspalidium_jubiflorum_G_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTCCTCC--------TACATCTGATGTCAAGCA----TGG-CAC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCACG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCACAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCAA--------TTTTTATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCAG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_alopecuroides_B_a TCGAGTGCCAGAAGGCAAGTAG-------------------CT--GTCT---AACAGT-AGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGGG----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACT----TGCGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCTGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACAT----------ATCACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG---TGTTCTCAAGG--------TTTATT----CAC--TCACGTT-GGCCTAC----GCCCTCA--------CTTTCAACTCGG-----------TTTTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_alopecuroides_B_b TCGAGTGCCAGAAGGCAAGTAG-------------------CTGTGTCTT---ACAGT-AGAGCTTG---------CTGCTGCTGCTGCTTCCGG--CCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTACTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCACCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACTGCGCTCGGCGGGCTCGGTGCCGCCTTGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACAT----------ATCACC---TAC-TAG---TGTCC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG---TGTTCTCAAGG--------TTTATT----CAC--TCACGTT-GGCCTAC----GCCCTCA--------CTTTAAAACTGGG---------TTTTTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGTAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_alopecuroides_C TCGAGTGCCAGAAGGCAAGTAG-------------------CTGTGTCTT---ACAGT-AGAGCTTG---------CTGCTGCTGCTGCTTCCGG--CCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCACCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACTGCGCTCGGCGGGCTCGGCGCCGCCTCGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACAT----------ATCACC---TAC-TAG---CGTCC---AACAATT-----TCTCTCCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG---TGTTCTCAAGG--------TTTATT----CAC--TCACGTT-GGCCTAC----GCCCTCA--------CTTTAAAACTGGG---------TTTTTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGTAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_flaccidum_1_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAAT-AGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT--------ATCACC-------TAG---TCACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG---TGTTCTCAAGG--------TTTATT----CAC--TCACGTC-GGCCTTC----GCCCTCA--------CTTCCAACTCGG-----------TTTTTTCCCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGTAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_flaccidum_1_C_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAAT-AGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCCCC--------TACATCTGATGTCAAGCG----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTCCTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT--------ATCGCC-------TAG---TCACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG---TGTTCTCAAGG--------TTTATT----CAC--TCACGTC-GGCCTTC----GCCCTCA--------CTTCCAACTCGG----------TTTTTTTCCCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGTAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_flaccidum_1_C_b TCGAGTGCCAGAAGGCAAGTAG---------------------CTGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCCCC--------TACATCTGATGTCAAGCG----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTCCTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCAGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACAT----------ATCACC---TAG-TAG---TAACC---AACAATT-----TCTCTTCAGATAGATCGAGAAAGAA-CGCGC----CTGTCTG---TGTTCTCAAGG--------TTTATT----CAC--TCACGTT-GGCCTAC----GCCCTCA--------CTTTCAACTCGG---------TTTTTTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_flaccidum_2_D_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAAT-AGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAACTATATAT--------ATCACC-------TAG---TCACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG---TGTTCTCAAGG--------TTTATT----CAC--TCACGTC-GGCCTTC----GCCCTCA--------CTTCCAACTCGG----------TTTTTTTCCCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCACTGCAGGAGGCGATGGAGTTCATGCGTAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_glaucum_E_a TCGAGTGCCAGAAGGCAAGTAG---------------------CTGCCTAACAACAGT-AGAGAGCT----TGCTGCTGCTGCTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTGC--------TACATCTGATGTCATGCG----TGG-CGCGCATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCACCGCCGGAGGTGTCGGCAAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGTTGGATCAGTTCATGGTGAGCTACA----------CATCACC---TAGTAAT---TAACC---AACAATT-----TCTCTTCAGGT----CGAGAAAGAA-CGGGC----CTGTCAGCTGTGTTCTCAAGG--------TTTATT----CACTCACACGTT-GGCTTAC----GCCCTCA--------CTTTCAACTCGA----TTTTTTTTTTACTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_glaucum_E_b TCGAGTGCCAGAAGGCAAGTAG---------------------CTGCCTAACAACAGT-AGAGAGCT-------TGCTGCTGCTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCATGCG----TGG-CGCGCATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCACCGCCGGAGGTGTCGGCAAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGTTGGATCAGTTCATGGTGAGCTACA----------CATCACC---TAGTAAT---TAACC---AACAATT-----TCTCTTCAGGT----CGAGAAAGAA-CGGGC----CTGTCAGCTGTGTTCTCAAGG--------TTTATT----CACTCACACGTT-GGCTTAC----GCCCTCA--------CTTTCAACTCGA---TTTTTTTTTTTACTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_lanatum_D TCGAGTGCCAGAAGGCAAGTAG---------------------CTGTCT---AACAGT-AGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCTCCTA----CACATCTGCTGTCAAGCA----TGG-C-CGCA{CT}GCAAAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCAGCA-------CGCCATCACC-------TAG---TACCC---AACAATT-----TCCCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCGTCTGTGTTCTCAAGG--------TGTATT----CAC--TCACGTT-GGCCTAC----GCCCTCA--------CTTTCAACTCGGA-------TTTTTTTTTTCCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_lanatum_E TCGAGTGCCAGAAGGCAAGTAG---------------------CTGTCT---AACAGT-AGAGCTTG------------------CTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCTCCTA----CACATCTGCTGTCAAGCA----TGG-C-CGCATGCAAAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--TCAGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCAGCA-------CGCCATCACC-------TAG---TACCC---AACAATT-----TCCCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCGTCTGTGTTCTCAAGG--------TGTATT----CAC--TCACGTT-GGCCTAC----GCCCTCA--------CTTTCAACTCGGA---------TTTTTTTTCCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pennisetum_villosum_F TCGAGTGCCAGAAGGCAAGTAG---------------------CTGTCT---AACAGT-AGAGCTTG---------------CCGCTGCTGCGGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC--CCAGCT----CA----TGTA-GACA----TGTGCATCG--AACG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCACCGGAGGTGTCGGCGAGGCTGTCGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCAGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTACAT----------ATCACC-------TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGGCC----ATGTC---GGTGTTCTCAAGG-------TTTT---------C--AGACGTT-GGCCTAC----GCCATCA--------CTTTCGACTCGG---------TTTTTTTCTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pseudoraphis_paradoxa_F_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------CTGCTGCTGCTA--GCTTCCGGTTTTGCTC--GAGAAGTTTTTCCC-------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCGTAGCG--GGCTATAGTTTATGCATG-CTACTG----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCTGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAACTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATATA---------CACA--TCAGCTCG---TAACA---AACAATT-----TCTATTCAGAT----CGGGGT-GAA-CGCGC----CTGTCTG-TGTGCTCTCAA--------TTTTTATT----TAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG---------TTCTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pseudoraphis_paradoxa_F_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG---------------------CTGCTGCTTCCGGTTCTGCTC--AAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGGACAC-TTTTCTGCTTGCTTTTGCGTAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAACTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGACTCGGCGCCGCAACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACA---AACAATT-----TCTCTTCAGAT----CGGGGT-GAA-CGCGC----CTGTCCG-TGTGCTCTCAA--------TTTTTATT----TAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACCCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pseudoraphis_spinescens_F_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCGTG------------CTGCTGCTGCTGCTGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCGTAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----GGTT-GACT----TGTGCATCT--ATCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTAACGGCGATGGCACAGGAACTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTTG---TAACA---AACAATT-----TCTCTTCAGAT----CGAGGGAGAA-CGCGCGCGCCTGTCTG-TGTGCTCTCAA--------TTTTTATC----TAC--TCACGTT-GGCATAC----GTCCTCG--------CTTTCAACTCGGG--------TTTTTTATTTATGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCCGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Pseudoraphis_spinescens_F_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCGTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTCGAGAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCGTAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----GGTT-GACT----TGTGCATCT--ATCG--TTCAGAACCTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAACTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTTG---TAACA---AACAATT-----TCTCTTCAGAT----CGAGGGAGAA-CGCGCGCGCCTGTCTG-TGTGCTCTCAA--------TTTTTATC----TAC--TCACGTT-GGCATAC----GTCCTCG--------CTTTCAACTCGGG--------TTTTTTATTTATGTGCAGGAGGCATACCATGAG---------ATGCTGGTGGAGTTCCGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_adhaerens_1_O_Doust_1401 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCAAG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGACGAAGAA-CGCGT----CTTTCTG-TG--CCCTCAAGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG---------TTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_adhaerens_D00_001 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCAAG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGACGAAGAA-CGCGT----CTTTCTG-TG--CCCTCAAGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG---------TTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_adhaerens_D99_007 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCAAG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGACGAAGAA-CGCGT----CTTTCTG-TG--CCCTCAAGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG---------TTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_barbata_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTCCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCT----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-AGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CATC----AGCTAG---TAATC---AAGAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGC----TCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GTCCTACGT--GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTAACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGTTCTCCATCTCTGGCAGA Setaria_barbata_E TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTCCTGCTTCTAGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCT----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-AGCCATGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CATC----AGCTAG---TAATC---AAGAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGC----TCTTCTG-TG--CTCTCAAGG--------TTTATC----CAC--TCACGGT-GGCCTACGT--GTCCCTCG-------TTTTGAGCTG----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGCAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_faberi_Kellogg_1247_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_faberi_Kellogg_1247_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----CGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-TGCGC----CCGTCTG-TGTGTTCTCAA--------TTTTTATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCATCTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_faberi_Layton_154_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_faberi_Layton_154_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----CGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-TGCGC----CCGTCTG-TGTGTTCTCAA--------TTTTTATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCATCTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_faberi_Nee_57234_1_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_faberi_Nee_57234_1_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----CGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-TGCGC----CCGTCTG-TGTGTTCTCAA--------TTTTTATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCATCTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_faberi_Vela_70_1_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_faberi_Vela_70_1_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----CGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-TGCGC----CCGTCTG-TGTGTTCTCAA--------TTTTTATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCATCTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_geniculata_G_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCCTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TATGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCAGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATA----------CA-CACC----AGCTAG---TTACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCACTTT-GGCCTAG----GTCCTCA--------CCTTCAACTCGGATC---------TTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTTTCCATCTCTGGCAGA Setaria_grisebachii_F_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTTCTTCCGATTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTCTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGTTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTAAGCTATATAT----------CCCC---TAG-TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGAGC----CTGTCTG-TGTGTTCTCACGG-------TTTTATTCTGTCACGATCTCCGC-GGCGTAC----GTGCTCG--------CTCTCATCTCG--------------TCTTCTCCGTGCAGGAGGCATATCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_italica_1_H_Doust_1403 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_italica_2_F_a_Doust_1361 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-GGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACGTCTGATGTCAAGC-----TGG-CGC--ATGCACGC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_italica_ISE_1107 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_palmifolia_B TCGAGTGCCAGAAGGCAAGTAG------------------CGGCAGTCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTGCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTCCATAGCA--GGCTATAGTTTATGCACG-CTACTC----AACT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GCCCGTGGGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CATC----AGCTAG---TAATC---AACAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_palmifolia_F_a TCGAGTGCCAGAAGGCAAGTAG------------------CGGCAGTCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAATTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCACG-CTACTC----AACT----CA----TGTA-GACA----TGTGCATCA--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCAGCGGACTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CATC----AGCTAG---TAATC---AACAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_palmifolia_F_b TCGAGTGCCAGAAGGCAAGTAG------------------CGTCAGTCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTGCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTCCATAGCA--GGCTATAGTTTATGCACG-CTACTC----AACT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GCCCGTGGGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CATC----AGCTAG---TAATC---AACAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-AGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGTTCTCCATCTCCGGCAGA Setaria_parviflora_G_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGCGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCACTCGGCGGGCTTGGCGCAGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAGCC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCG----------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCTCTCTCCATCTCTGGCAGA Setaria_parviflora_G_b TCGAGTGCCAGAAGGCAAGTAG------------------TAGCAGTCT---AACAGT-AGAGAGCT---------------TTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGGT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGCGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCACTCGGCGGGCTTGGCGCAGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAGCC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCG-----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCTCTCTCCATCTCTGGCAGA Setaria_parviflora_Kellogg_1259_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCGGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGGCGC---ATGCACAC-TTTTCTGCCTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGCT-GACA----TGTGAATCT--AGCG--CTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCACCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CTGCCTG-TGTGTTCTCAA--------GGTTTATT----CGC--TCACTTT-GGCCTAG----GTCCTCA--------CCTTCAACTCGGATC--------GTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_parviflora_Kellogg_1259_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------------CTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGGCGC-GCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----TA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTTTGGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTGCTGTA----------CACA--TCACCTAG---TAACC---AACAATT-----TCACTTAAGAT----CGAGAAAGAA-CGCGC----CTGACTG-TGTATTCTCAA--------GGTTTATT----CGC--TCACTTT-GCCCTAC----GTCCTCA--------CCTTCAACTCGGATC------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAAGAGGCCATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTTTCCATCTCTGGCAGA Setaria_poiretiana_1_B_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-CGAGCTTG---------------CTGCTACTGCTGCTTC-AGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTA-GACA----TGTGCATCT--AGCGTGTTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGTTATGTA-----------CA----TCAACTAG---TAATC---AAGAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGC----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTACGT--GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_poiretiana_1_B_b TCGAGTGCCAGAAGGCAAGTAG------------------CGGCAGTCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTGCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTCCATAGCA--GGCTATAGTTTATGCACG-CTACTC----AACT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GCCCGTGGGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAATC---AACAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTATAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_poiretiana_1_F_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-CGAGCTTG---------------CTGCTACTGCTGCTTC-AGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTA-GACA----TGTGCATCT--AGCGTGTTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGTTATGTA-----------CA----TCAACTAG---TAATC---AAGAATT-----TCTCTTCAGAT----CGAGGAAGAA-CGCGC----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTACGT--GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_poiretiana_2_B_a TCGAGTGCCAGAAGGCAAGTAG------------------CGGCAGCCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCACG-CTACTC----AACT----CA----TGTA-GACA----TGTGCATCA--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCAGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAATC---AACAATT-----TCTCTTGAGAT----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAATTCGCTCTCCATCTCCGGCAGA Setaria_poiretiana_2_B_b TCGAGTGCCAGAAGGCAAGTAG------------------CGGCAGTCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCACG-CTACTC----AACT----CA----TGTA-GACA----TGTGCATCA--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCAGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAATC---AACAATT-----TCTCTTGAGAT----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCACACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAATTCGCTCTCCATCTCCGGCAGA Setaria_poiretiana_2_G_a TCGAGTGCCAGAAGGCAAGTAG------------------CGGCAGTCT---AACAGT-AGCGCTTG---------------TTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCACG-CTACTC----AACT----CA----TGTA-GACA----TGTGCATCA--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCAGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAATC---AACAATT-----TCTCTTGAGAC----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAATTCGCTCTCCATCTCCGGCAGA Setaria_poiretiana_2_G_b TCGAGTGCCAGAAGGCAAGTAG------------------CGGCAGTCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTGCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTCCATAGCA--GGCTATAGTTTATGCACG-CTACCC----AACT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCAGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAATC---AACAATT-----TCTCTTGAGAT----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACGGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAATTCGCTCTCCATCTCCGGCAGA Setaria_pumila_D_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAACTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGCGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATATAT----------CACC--TAG--TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TGTATT----CGC--TCACTTT-GGCCTAC----GTCCTCA--------CCTTCAACTCGGATC--------TTTTTTTTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_pumila_D_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------------CTGCTGCTTCCGGTTCTGTTC--GAGAGGTTTTTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCGGCTTGCTTTTGCATAGCA--GGCTATAGTTTACGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT----------CACA-------------TAACT---------------TCTCTTCAGGT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCAATTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGGATC--------TTTTTTTCTGGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_pumila_E_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGCGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACCGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTAAA-------------CACA--TCAGCTAG---TGACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCACTTT-GGC-TAC----GTCCTCA--------CCTTCAACTCGGATC--------TTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGACGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_pumila_E_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------------CTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCGGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCTTCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT----------CACA-------------TAACT---------------TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTCCTCAAGG--------TTTATT----CGC--TCAATTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGGATC--------TTTTTTTCTGGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_pumila_ME036_1_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGCGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAACTGGATCAGTTCATGGTGAGCTATATAT----------CACC--TAG--TAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TGTATT----CGC--TCACTTT-GGCCTAC----GTCCTCA--------CCTTCAACTCGGATCG-------TTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_pumila_ME036_1_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG------------------CTGCTGCT---TCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCGGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT----------CACA-------------TAACT---------------TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCAATTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGGATCG-------TTTTTTTCTGGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Setaria_sp_ISE_1679_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTAA-AACAGT-AGAGCTTG------------CTGCTGCAGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGGTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATGGGTACTC----AGCT----CA----TGTA-GACA----TGAGCATCT--AGCG--CTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTA---------------CACA--TCAACTAG---CAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGT----CTGCCTG-TG--CCATCAA--------GGTTTATT----CAC--TCACGGT-GGCGTAC----GTCCTCG--------TTTTGAAC----------------------TCTGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_sp_ISE_1679_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAATTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCACG-CTACTT----GGCT----CA----TGTA-GACA----TGTGCATCT--GGCG--TTCAGAACTTTT-GGCCGTGGGTTTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------AA----TCAGCTAG---TAACC---AACAATTATATTTCTCTTCAGAT----CGAGGAAGAA-CGCGT----CTTTCTG-TG--CTCTCAAAGAGTCAAGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_sp_ISE_1679_B1 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGAGGAAGAA-CGCGC----CTTTCTG-TG--CCCTCAAGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_sphacelata_A_a TCGAGTGCCAGAAGGCAAGTAG------------------TAGCAGTCT---AACAGT-AGAGAGCT---------------TTGCTGCTACTGCTTCCTGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGGT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGCGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCACTCGGCGGGCTTGGCGCAGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAGCC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCG-----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCTCTCTCCATCTCTGGCAGA Setaria_sphacelata_A_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCTGTGGGTGTTTGTAGGTTGGCGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCACTCGGCGGGCTTGGCGCAGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAGCC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCG----------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCTCTCTCCATCTCTGGCAGA Setaria_sphacelata_D TCGAGTGCCAGAAGGCAAGTAG------------------TAGCGGTCT---AACAGT-AGGGAGCT---------------TTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGCGCATGCGCAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGGT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGCGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCACTCGGCGGGCTTGGCGCAGCCACGGAGCCGGAGCCGGATCAGTTCATGGTGAGCTATATAT----------CACC---TAG-TAG---TAGCC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGCCTG-TGTGTTCTCAAGG--------TTTATT----CGC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCG-----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCTCTCTCCATCTCTGGCAGA Setaria_verticillata_2_G_a_Doust_1360 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GACAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCCG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_verticillata_D00_115_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GACAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_verticillata_D00_115_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGAGGAAGAA-CGCGT----CTTTCTG-TG--CCCTCACGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_verticillata_D97_007_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GACAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_verticillata_D97_007_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGAGGAAGAA-CGCGT----CTTTCTG-TG--CCCTCACGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_verticillata_D99_025_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GACAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCG----------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_verticillata_D99_025_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGAGGAAGAA-CGCGT----CTTTCTG-TG--CCCTCACGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_verticillata_SETAD2_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GACAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATA-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_verticillata_SETAD2_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGAGGAAGAA-CGCGT----CTTTCTG-TG--CCCTCACGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCCGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_verticillata_SETVE2_A TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GACAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_verticillata_SETVE2_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGAGGAAGAA-CGCGT----CTTTCTG-TG--CCCTCACGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_verticilliformis_D00_116_A2 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GACAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TCGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ACGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCGGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_verticilliformis_D00_116_B TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGAGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----GGCT----CA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCTCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTA-----------CA----TCAGCTAG---TAACT---AACAATTATATTTCTTTTCAGAT----CGAGGAAGAA-CGCGT----CTTTCTG-TG--CCCTCACGGAGTCATGGTTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTGTCCATCTCAGGCAGA Setaria_viridis_1_H_a_Doust_1404 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTGC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA-------TTTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTATTATGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_viridis_2_D_a_PI_408811 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTGC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCACCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA-------TTTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTATTATGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_viridis_Ahart_17139_1 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-CGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG------------TTTTTTTATGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_viridis_K_1211_S TCGAGTGCCAGAAGGCAAGTAG---------------------CATTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTGC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTATTATGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_viridis_K_1235 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCAC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_viridis_ME014_1 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_viridis_Thompson_1 TCGAGTGCCAGAAGGCAAGTAG---------------------CATTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTGC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG----------TTTTTTATTATGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_viridis_Yang_1108 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCAC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Setaria_viridis_Yang_8014 TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGC-----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGTGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--ACAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----TTGTCTG-TGTGTTCTCAA--------TTTTTACT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACTCGG---------TTTTTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Spinifex_sericeus_H TCGAGTGCCAGAGGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGAACTAGAGA----------TTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCGCGGGCTATAGTTTATGCATG-CTGCTC----AGCT----CA----TGTT-GACA----TGTGCATCC--AGCA--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGGCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTC---------GGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTGTA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCTGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCAA-------TTTTTGTT-CACTCAT----ACGTT-GGCCTAC----GTCCTCGGCTCCTCGCTTTCAACCCC---------TGTTTTTTTTTCTGCGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAAGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Spinifex_sericeus_I_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGAACTAGAGA----------TTGCTGCTGCTGCTTTCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCGCGGGCTATAGTTTATGCATG-CTGCTC----AGCT----CA----TGTT-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGGCGGAGGTGTCGGCGAAGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTC---------GGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTGTA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCTGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCAA-------TTTTTGTT-CACTCAT----ACGTT-GGCCTAC----GTCCTCGGCTCCTCGCTTTCAACCCC---------TGTTTTTTTTTCTGCGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAAGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Stenotaphrum_secundatum_I_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGTGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTTAATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTGT--CA----TGTGCATCT-TAGCG--TTCAGAACTTTTT-GCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCGCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTATATAT------CACCC--------------------AACAA-------TTTCTCCAGAT----CGAGAAAGAA-CGCGC----CTGCCTC-TGTGTGCTCAAGG-------TTTTATTCAGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCATCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAGCTCGCTCTCCATCTCCGGCAGA Stenotaphrum_secundatum_I_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTCGCTTTTTAATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTGT--CA----TGTGCATCT-TAGCG--TTCAGAACTTTTT-GCCGTGGGTGTTTGCAGGTGGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGTCGGCGATGGCGCAGGAGCTGGAAGCACGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATGTATATAT------CACCC--------------------AACAATT-----TCTCTCCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGTGCTCAAGG-------TTTTATTCAGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCATCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Zuloagea_bulbosa_1_O TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCCGCTTCCGGTTCTCCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCTCGTGTA----TGTA-GACA----TGTGCGTCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCCCGGCAGTGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCACGGTGAGCTA---------------CACACATCAGCTAGG---AACC---AACAGTT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGCTCTCAA--------TTTTTATCCACTCACGTT-------GGCCTAC----GTCCTCG--------CTTTCAACTCG-----------TTTTCTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACGCAGTTCAACTCGCTGTCCATCTCCGGCAGA Zuloagea_bulbosa_1_R_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCCGCTTCCGGTTCTCCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AACT----CA----TGTTTGACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCCCGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTA---------------CACACATCAGCTAGG---AACC---AACAGTT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCAA--------TTTTTATCCACTCACGTT-------GGCCTAC----GTCCTCG--------CTTTCAACTCG-----------TTTTCTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGAGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Zuloagea_bulbosa_1_R_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCCGCTTCCGGTTCTCCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AACT----CA----TGTTTGACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-ATAT--------CACC-------TAGCGGCAACC---AGCCATT-----TCTCTCCAGAT----CGAGAAAGAA-CGCGC----CTTTCTG-TGTGTCTTCA---------------TTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCAGCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Zuloagea_bulbosa_1_R_c TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGCGCTTG---------CTGCTGCTGCTGCTTCTTCTTCCGGTTCTGCTG--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TCTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCTCGTGTA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGTCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-ATAT--------CACC-------TAGCGGCAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTATCTG-TGTGTTCTCACGG-------TTTAATTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCAGCTCG--------------TCTTGTCCGTGCGGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Zuloagea_bulbosa_1_R_d TCGAGTGCCAGAAGGCATGTAG-------------------CACAGTCTT--AACAGT-AGCGCTTG---------CTGCTGCTGCTGCTTCTTCTTCCGGTTCTGCTG--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCTTGTGTA----TGTA-GACA----TGTGTATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGTCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-ATAT--------CACC-------TAGCAGTAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTTTCCG-TGTGTCTTCA---------------CTCTGTCACCGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCAGCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGAGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Zuloagea_bulbosa_2_O TCGAGTGCCAGAAGGCAAGTAG-------------------CACAGTCT---AACAGT-AGCGCTTG---------CTGCTGCTGCTGCTTCTTCTTCCGGTTCTGCTG--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCTTGTGTA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAATTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGTCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-ATAT--------CACC-------TAGCGGCAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTATCTG-TGTGTTCTCACGG-------TTTAATTCTGTCACGGTCACGGT-GGCGTAC----ATGCTCG--------CTCTCAGCTCG--------------TCTTGTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Zuloagea_bulbosa_2_R_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCCGCTTCCGGTTCTCCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AACT----CA----TGTTTGACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGGGCTGGATCAGTTCATGGTGAGCTA---------------CACACATCAGCTAGC---AACC---AACAGTT-----TCTCTTCAGAT----CGAGAAAGAA-CGCTC----CTGTCTG-TGTGTTATCAA-------TTTTTTTTTCACTCACGTT-------GGCCTAC----GTCCTCG--------CTTCCAACTCG-----------TATTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCACGCGGAGGGTGGAAACGCAGCTCAACTCGCTCTCCATATCCGGCAGA Zuloagea_bulbosa_2_R_b TCGAGTGCCAGAAGGCAAGTAG------------------------------------CAGAGCTTG---------------------CTGCTTCTTCCGTTTCTGCTC--GAGAAGTTTCTCCTACATGGTTACATCTGATGTCAAGCA----TGG-CGC--ATGGACAC-TTTTCTACTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTCGATCAGCTCG--------TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGTCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTG-ATCAGTTCATGGTGAGCTATA-ATAT--------CACC-------TAGCGGCAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTATCTG-TGTGTTCTCACGG-------TTTAATTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCAGCTCG--------------TCTTGTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Zuloagea_bulbosa_2_R_c TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGCGCTTG------------------CTTCTGCTTCTTCCGTTTCTGCTC--GAGAAGTTTCTCCTACATGGCTGCATCTGATGTCAAGCA----TGG-CGC--GTGGACAC-TTTTCTACTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTCGATCAGCTCG--------TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTCGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTA---------------CACACATCAGCTAGG---AACC---AACAGTT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTATCTG-TGTGTTCTCACGG-------TTTAATTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCAGCTCG--------------TCTTGTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Zuloagea_bulbosa_3_O_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGCGCTTG------------------CTTCTGCTTCTTCCGTTTCTGCTC--GAGAAGTTTCTCCTACATAGCTACATCTGATGTCAAGCA----TGG-CGC--ATGGACAC-TTTTCTACTTGCTTTTGCATAGCA--GGCTATAGTTAATGCATG-CTACTCGATCAGCTCG--------TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-ATAA--------CACC-------TAGCAGTAACC---AACAATT-----TCTCTTCAGAT----CGTGAAAGAA-CGCGC----CTTTCGG-TGTGTCTTCA---------------TTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCAGCTCG--------------TCTTGTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTGAACTCGCTCTCCATCTCTGGCAGA Zuloagea_bulbosa_3_R_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG----------------TTGGCTTGCTGCTTCCGGTTCTCCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTTCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACATGCATGTGCATCT--AGCG--TTCAGAACTTTTTGGCCGTGGG--TTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGTGATGGCACAGGAGCTCGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTA---------------CACACATCAGCTAGG---AACC---AACAGTT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGCTCTCAA--------TTTTTATCCACTCACGTT-------GGCCTAC----GTCCTCG--------CTTTCAACTCG-----------TTTTCTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Zuloagea_bulbosa_3_R_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AG--TCAGTAGCGCTTGCTGCTGCTGCTGCTTCTTGTTCCGGTTCTGCTG--GAGAAGTTTCTCC--------TACGTCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTTCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCTTGTGTA----TGTA-GACA----TGTGTATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGTCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-ATAT--------CACC-------TAGCGGCAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTATCTG-TGTGTTCTCACGG-------TTTAATTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCAGCTCG--------------TCTTGTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Zuloagea_bulbosa_3_R_c TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG----------------TTGGCTTGCTGCTTCCGGTTCTCCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTTCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AGCT----CA----TGTT-GACATGCATGTGCATCT--AGCG--TTCAGAACTTTTTGGCCGTGGGT--TTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGTGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTA---------------CACACATCAGCTAGC---AACC---AACAGTT-----TCTCTTCAGAT----CGAGAAAGAA-CGCTC----CTGTCTG-TGTGTTATCAA-------TTTTTTTTTCACTCACGTT-------GGCCTAC----GTCCTCG--------CTTCCAACTCG-----------TATTTTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGAGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCACGCGGAGGGTGGAAACGCAGCTCAACTCGCTCTCCATATCCGGCAGA Zuloagea_bulbosa_4_C TCGAGTGCCAGAAGGCAAGTAG------------------CGGCAGCCT---AACAGT-AGCGCTTG---------------CTGCTGCTGCTGCTTCCGGTTCTGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCCGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCACG-CTACTC----AACT----CA----TGTA-GACA----TGTGCATCA--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCGCGGCAGCGCACAGCGCTCAGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATG-------------TACA--TCAGCTAG---TAATC---AACAATT-----TCTCTTGAGAT----CGAGGAAGAA-CGCGT----CCTTCTG-TG--CTCTCAAGG--------TTTATT----CAC--TCACGGT-GGCCTAC----GTCCTCG--------TTTTGAACTC----------------------TGTACAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Zuloagea_bulbosa_4_D TCGAGTGCCAGAAGGCAAGTAG-------------------CACAGTCT---AACAGT-AGCGCTTG---------CTGCTGCTGCTGCTGCTTCTTCCGGTTCTGCTG--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCTTGTGTA----TGTA-GACA----TGTGTATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-ATAT--------CACC-------TAGCGGCAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTTTCTG-TGTGTCTTCA---------------TTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCGCAAA----CTCTCAGCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAGAATAT?GAGATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCTCTCTCCATCTCCGGCAGA Zuloagea_bulbosa_4_F_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTTG------------------CTGCTGCCGCTTCCGGTTCTCCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCG--GGCTATAGTTTATGCATG-CTACTC----AACT----CA----TGTTTGACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTCGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTA---------------CACACATCAGCTAGG---AACC---AACAGTT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTGTCTG-TGTGTTCTCAA--------TTTTTATCCACTCACGTT-------GGCCTAC----GTCCTCG--------CTTTCAACTCG-----------TTTTCTTTTCTGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAAACGCAGCTCAACTCGCTGTCCATCTCCGGCAGA Zuloagea_bulbosa_4_F_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCT---AACAGT-AGCGCTTG------CTGCTGCTGCTGCTGCTGCTGCTTCCGGTTCTGCTG--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTGCTTGCTTTTGCATAGCA--GGCTATAGTTTATGCATG-CTACTC----AGCTCGTGTA----TGTA-GACA----TGTGCATCT--AGCG--TTCAGAACTTTT-GGCCGTGGGTGTTTGCAGGTGGGTGCGCCGCTTGAGGTGTCGGCGAGGCTGACGGCGATGACGCAGGAGCTGGAAGCCCGGCAGCGCACGGCGTTCGGTGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-ATAT--------CACC-------TAGCGGCAACC---AACAATT-----TCTCTCCAGAT----CGAGAAAGAA-CGCGC----CTTTCTG-TGTGTCTTCA---------------TTCTGTCACGGTCACGGT-GGCGTAC----GTGCTCG--------CTCTCAGCTCG--------------TCTTCTCCGTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAACTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCTGGCAGA Zygochloa_paradoxa_1_G_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTCG------------------CTGCTGCTGCTTCCGGTTCCGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTGCTCCTTGCTTTTGCATAGCG--GGCCATAGTTTATGCATG-CTACTCAC--TGCT----CAA---TGTT-GACA----TGTCCATCT--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTACCTG-TGT--TGTTAA-------TTTTT-ATT----CA----CACGTT-GGCCTAC----GTCCTCG--------CTTTCAACCC----------TGT--TTTTTTTTCTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Zygochloa_paradoxa_1_G_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTCG------------------CTGCTGCTGCTTCCGGTTCCGCTC--GAGAGGTTTCTCC--------TACATCTGATGTCAAGCA----CGG-CGC--ATGCACAC-TTTTCTCCTTGCTTTTGCATAGCG--GGCCATAGTTTATGCATG-CTACTCAC--AGCT----CAA---TGTT-GACA----TGTCCATCT--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGCAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACGATC-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTACCTG-TGTGTTGTTAA-------TTTTT-ATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACCC----------TGT-TTTTTTTTTCTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAATCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Zygochloa_paradoxa_2_G_a TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-AGAGCTCG------------------CTGCTGCTGCTTCCGGTTCCGCTC--GAGAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTCCTTGCTTTTGCATAGCG--GGCCATAGTTTATGCATG-CTACTCAC--TGCT----CAA---TGTT-GACA----TGTCCATCT--AGCG--TTCAGAACTTTT-GGCCGTGTGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTACCTG-TGTGTTGTTAA-------TTTTT-ATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACCC----------TGT-TTTTTTTTTCTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAATCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA Zygochloa_paradoxa_2_G_b TCGAGTGCCAGAAGGCAAGTAG---------------------CAGTCTT--AACAGT-ATAGCTCG------------------CTGCTGCTGCTTCCGGTTCCGCTC--GACAAGTTTCTCC--------TACATCTGATGTCAAGCA----TGG-CGC--ATGCACAC-TTTTCTCCTTGCTTTTGCATAGCG--GGCCATAATTTATGCATG-CTACTCAC--AGCT----CAA---TGTT-GACA----TGTCCATCT--AGCT--TTCAGAACTTTT-GGCCGTGGGTGTTTGTAGGTTGGGGCGCCGCCGGAGGTGTCGGCGAGGCTGACGGCGATGGCACAGGAGCTGGAAGCCCGGCAGCGCACGGCGCTCGGCGGGCTCGGCGCCGCCACGGAGCCGGAGCTGGATCAGTTCATGGTGAGCTATA-------------CACA--TCAGCTAG---TAACC---AACAATT-----TCTCTTCAGAT----CGAGAAAGAA-CGCGC----CTACCTG-TGTGTTGTTAA-------TTTTT-ATT----CAC--TCACGTT-GGCCTAC----GTCCTCG--------CTTTCAACCC----------TGT-TTTTTTTTTCTGCAGGAGGCATACCATGAG---------ATGCTGGTGAAGTTCAGGGAGGAGCTGACGAGGCCGCTGCAGGAGGCGATGGAGTTCATGCGGAGGGTGGAGTCGCAGCTCAACTCGCTCTCCATCTCCGGCAGA ; END; BEGIN TREES; TITLE Setaria_and_relatives_Bayesian_of_knotted1_sequences; LINK TAXA = Taxa1; TRANSLATE 1 Cenchrus_calyculatus_A_a, 2 Cenchrus_calyculatus_A_b, 3 Cenchrus_calyculatus_E_a, 4 Cenchrus_calyculatus_E_b, 5 Cenchrus_ciliaris_1_E_a, 6 Cenchrus_ciliaris_1_E_b, 7 Cenchrus_ciliaris_2_D_a, 8 Cenchrus_ciliaris_2_D_b, 9 Cenchrus_echinatus_B_a, 10 Cenchrus_echinatus_B_b, 11 Cenchrus_echinatus_D, 12 Cenchrus_myosuroides_D, 13 Cenchrus_myosuroides_E_a, 14 Cenchrus_myosuroides_E_b, 15 Cenchrus_pilosus_E_a, 16 Cenchrus_pilosus_G_a, 17 Cenchrus_setigerus_F_a, 18 Cenchrus_setigerus_F_b, 19 Chaetium_bromoides_A_a, 20 Chaetium_bromoides_E_a, 21 Ixophorus_unisetus_1_T_a, 22 Ixophorus_unisetus_1_T_b, 23 Ixophorus_unisetus_1_T_c, 24 Ixophorus_unisetus_1_T_d, 25 Ixophorus_unisetus_2_O_a, 26 Ixophorus_unisetus_2_O_b, 27 Ixophorus_unisetus_2_O_c, 28 Panicum_miliaceum_I_a, 29 Paspalidium_aversum_F, 30 Paspalidium_aversum_G_a, 31 Paspalidium_aversum_G_b, 32 Paspalidium_distans_1_F_a, 33 Paspalidium_distans_1_G_a, 34 Paspalidium_distans_2_F_a, 35 Paspalidium_distans_2_G_a, 36 Paspalidium_jubiflorum_E_a, 37 Paspalidium_jubiflorum_G_a, 38 Pennisetum_alopecuroides_B_a, 39 Pennisetum_alopecuroides_B_b, 40 Pennisetum_alopecuroides_C, 41 Pennisetum_flaccidum_1_B, 42 Pennisetum_flaccidum_1_C_a, 43 Pennisetum_flaccidum_1_C_b, 44 Pennisetum_flaccidum_2_D_a, 45 Pennisetum_glaucum_E_a, 46 Pennisetum_glaucum_E_b, 47 Pennisetum_lanatum_D, 48 Pennisetum_lanatum_E, 49 Pennisetum_villosum_F, 50 Pseudoraphis_spinescens_F_a, 51 Pseudoraphis_spinescens_F_b, 52 Spinifex_sericeus_H, 53 Spinifex_sericeus_I_a, 54 Stenotaphrum_secundatum_I_a, 55 Stenotaphrum_secundatum_I_b, 56 Zuloagea_bulbosa_1_O, 57 Zuloagea_bulbosa_1_R_a, 58 Zuloagea_bulbosa_1_R_b, 59 Zuloagea_bulbosa_1_R_c, 60 Zuloagea_bulbosa_1_R_d, 61 Zuloagea_bulbosa_2_O, 62 Zuloagea_bulbosa_2_R_a, 63 Zuloagea_bulbosa_2_R_b, 64 Zuloagea_bulbosa_2_R_c, 65 Zuloagea_bulbosa_3_O_a, 66 Zuloagea_bulbosa_3_R_a, 67 Zuloagea_bulbosa_3_R_b, 68 Zuloagea_bulbosa_3_R_c, 69 Zuloagea_bulbosa_4_C, 70 Zuloagea_bulbosa_4_D, 71 Zuloagea_bulbosa_4_F_a, 72 Zuloagea_bulbosa_4_F_b, 73 Zygochloa_paradoxa_1_G_a, 74 Zygochloa_paradoxa_1_G_b, 75 Zygochloa_paradoxa_2_G_a, 76 Zygochloa_paradoxa_2_G_b, 77 Pseudoraphis_paradoxa_F_a, 78 Pseudoraphis_paradoxa_F_b, 79 Setaria_pumila_ME036_1_A, 80 Setaria_pumila_D_a, 81 Setaria_pumila_E_a, 82 Setaria_pumila_D_b, 83 Setaria_pumila_ME036_1_B, 84 Setaria_pumila_E_b, 85 Setaria_palmifolia_F_b, 86 Setaria_barbata_A, 87 Setaria_barbata_E, 88 Setaria_geniculata_G_a, 89 Setaria_grisebachii_F_a, 90 Setaria_palmifolia_B, 91 Setaria_palmifolia_F_a, 92 Setaria_parviflora_G_a, 93 Setaria_parviflora_G_b, 94 Setaria_parviflora_Kellogg_1259_A, 95 Setaria_parviflora_Kellogg_1259_B, 96 Setaria_poiretiana_1_B_a, 97 Setaria_poiretiana_1_B_b, 98 Setaria_poiretiana_1_F_a, 99 Setaria_poiretiana_2_B_a, 100 Setaria_poiretiana_2_B_b, 101 Setaria_poiretiana_2_G_a, 102 Setaria_poiretiana_2_G_b, 103 Setaria_sphacelata_A_a, 104 Setaria_sphacelata_A_b, 105 Setaria_sphacelata_D, 106 Setaria_adhaerens_1_O_Doust_1401, 107 Setaria_adhaerens_D00_001, 108 Setaria_adhaerens_D99_007, 109 Setaria_verticillata_D00_115_B, 110 Setaria_verticillata_SETAD2_B, 111 Setaria_verticillata_SETVE2_B, 112 Setaria_verticillata_D97_007_B, 113 Setaria_verticillata_D99_025_B, 114 Setaria_verticilliformis_D00_116_B, 115 Setaria_sp_ISE_1679_B1, 116 Setaria_sp_ISE_1679_B, 117 Setaria_sp_ISE_1679_A, 118 Setaria_italica_1_H_Doust_1403, 119 Setaria_italica_2_F_a_Doust_1361, 120 Setaria_italica_ISE_1107, 121 Setaria_viridis_Ahart_17139_1, 122 Setaria_viridis_Yang_1108, 123 Setaria_viridis_Yang_8014, 124 Setaria_viridis_K_1235, 125 Setaria_viridis_Thompson_1, 126 Setaria_viridis_K_1211_S, 127 Setaria_viridis_1_H_a_Doust_1404, 128 Setaria_viridis_2_D_a_PI_408811, 129 Setaria_viridis_ME014_1, 130 Setaria_faberi_Kellogg_1247_A, 131 Setaria_faberi_Layton_154_A, 132 Setaria_faberi_Nee_57234_1_A, 133 Setaria_faberi_Vela_70_1_A, 134 Setaria_verticillata_2_G_a_Doust_1360, 135 Setaria_verticillata_D00_115_A, 136 Setaria_verticilliformis_D00_116_A2, 137 Setaria_verticillata_D97_007_A, 138 Setaria_verticillata_SETAD2_A, 139 Setaria_verticillata_SETVE2_A, 140 Setaria_verticillata_D99_025_A, 141 Setaria_faberi_Kellogg_1247_B, 142 Setaria_faberi_Layton_154_B, 143 Setaria_faberi_Nee_57234_1_B, 144 Setaria_faberi_Vela_70_1_B; TREE con_50_majrule = [&R] ((19:0.00386216,20:0.00184673):0.054970535,(28:0.06183506,((117:0.02780008,((116:0.01613751,(115:0.00194153,(106:1.0E-8,107:1.0E-8,108:1.0E-8):0.00392517,(109:1.0E-8,110:0.00194242,111:1.0E-8,112:1.0E-8,113:1.0E-8,114:1.0E-8):0.00194685):0.00767199):0.00676989,(((86:0.00673995,87:0.02001865):0.00828766,(96:1.0E-8,98:0.00198828):0.00950373):0.00900808,((85:0.00597414,90:1.0E-8,97:0.00197921):0.00599537,(91:0.00394716,(100:0.00197761,101:0.00396314,102:0.01005172,(69:0.00529781,99:1.0E-8):0.00525039):0.00530861):0.00601889):0.00657304):0.01517998):0.00759646):0.01485392,((((54:0.01042867,55:0.00532667):0.01197198,(36:0.0018578,(29:0.00186099,31:0.0018611,32:0.00186109,34:1.0E-8):0.00186909):0.00818461):0.00287463,(89:0.0249275,((21:0.00391204,(23:0.00184613,24:1.0E-8):0.00182263):0.03478331,(58:0.02055223,(72:0.00761009,((65:0.0149058,(63:0.00971665,64:0.02012787):0.0079333):0.01297966,(70:0.00419319,(60:0.01338669,(67:0.01479499,(59:0.00561106,61:0.00741922):0.00143989):0.00820958):0.00409471):0.00721223):0.00378487):0.0092107):0.01280078):0.01148473):0.00758329):0.02001046,(((41:1.0E-8,42:0.00780091,44:0.003865):0.01601605,((49:0.02833624,(39:0.00578594,40:0.0035522):0.03256866,(47:1.0E-8,48:1.0E-8):0.03141029,(38:0.00806195,43:0.00760081,(45:0.00183825,46:1.0E-8):0.04585413):0.00280059):0.00621482,(12:0.03427008,(2:0.02474773,(((1:1.0E-8,4:1.0E-8):0.0020501,(13:0.00399581,14:1.0E-8):0.00193936,(15:1.0E-8,16:0.00203625):0.00408582):0.0019738,(3:0.02235663,(7:0.00634784,((8:0.00205436,(5:0.01055245,10:0.01256684):0.00400326):0.0,(6:0.00409607,(11:0.00408405,18:0.00615649,(9:0.00205054,17:0.0020408):0.00204775):0.00205012):0.00203889):0.00829276):0.00208932):0.00207759):0.02722901):0.00467111):0.00701102):0.00251673):0.02233849,(30:0.01340304,((37:0.00190271,(33:0.0019103,35:0.00383982):0.00191308):0.0077277,((50:0.00174648,51:0.00383653):0.0216238,(77:0.01522105,78:0.01181845):0.00288759):0.01269282,(141:1.0E-8,142:1.0E-8,143:1.0E-8,144:1.0E-8):0.00768709,((52:0.00543038,53:0.00366508):0.03453692,(76:0.00783117,(74:0.00955416,(73:0.00385341,75:1.0E-8):0.00191245):0.00366363):0.02039922):0.00821959,((27:0.0096119,(22:0.0057123,(25:0.00185795,26:0.00756957):0.00190161):0.00828205):0.06426922,((62:0.00201556,68:0.01725862):0.01638667,(57:0.00964704,(71:1.0E-8,(56:0.02637441,66:0.01626971):0.00311352):0.00192322):0.00710123):0.00557957):0.00928323,((92:1.0E-8,104:0.00191646,(103:0.00383843,(93:1.0E-8,105:0.00565827):0.00182038):0.01016976):0.01620621,((82:0.01000519,83:1.0E-8,84:0.00398294):0.01406904,(81:0.01169007,95:0.03613318,((79:1.0E-8,80:0.00380846):0.00914921,(88:0.00928741,94:0.01566696):0.00852699):0.00232269):0.00460951):0.00264961):0.01380711,((122:1.0E-8,124:1.0E-8):0.00190882,(134:0.00191289,135:1.0E-8,136:0.00576174,137:1.0E-8,138:0.00191215,139:1.0E-8,140:1.0E-8):0.0037937,(120:1.0E-8,121:0.00387648,129:1.0E-8,130:1.0E-8,131:1.0E-8,132:1.0E-8,133:1.0E-8,(127:1.0E-8,128:0.00381908,(125:1.0E-8,126:1.0E-8):0.00191582):0.00579504):0.00190382):0.00569326):0.00942261):0.00515235):0.0063032):0.00431071):0.01772616):0.054970535); END;