#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 23:59 GMT TreeBASE (cc) 1994-2008 Study reference: Vasco-palacios A.M., Lopez-q C., Franco-molano A.E., & Boekhout T. 2014. Austroboletus amazonicus sp. nov. and Fistulinella campinaranae var. scrobiculata, two commonly occurring boletes from a forest dominated by Pseudomonotes tropenbosii (Dipterocarpaceae) in Colombian Amazonia. Mycologia, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15343] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=35; TAXLABELS Austroboletus_amazonicus_KF714508 Austroboletus_amazonicus_KF714509 Austroboletus_amazonicus_KF714510 Austroboletus_betula_AY612797 Austroboletus_dictyotus_JX901138 Austroboletus_eburneus_JX889668 Austroboletus_fusisporus_JX889720 Austroboletus_gracilis_DQ534624 Austroboletus_lacunosus_JX889669 Austroboletus_mucosus_AY612798 Austroboletus_niveus_DQ534622 'Austroboletus novae-zelandiae DQ534623' Austroboletus_sp_KF030351 Austroboletus_subvirens_JN378518 Boletellus_ananas_AY612799 Boletellus_dicymbophilus_HQ161852 Boletellus_exiguus_vHQ161862 Boletellus_piakaii_HQ161861 Clavulina_amazonica_KF714513 Fistulinella_campinaranae_var._scrobiculata__KF714520 Fistulinella_campinaranae_var._scrobiculata_KJ195892 Fistulinella_cinereoalba_GQ477439 Fistulinella_prunicolor_JX889548 Fistulinella_viscida_AF456825 Royoungia_boletoides_DQ534663 Russula_sp_KF714534 Tylopilus_alboater_AY612832 Tylopilus_ballouii_AY612823 Tylopilus_ballouii_HQ161873 Tylopilus_rufonigricans_AY612835 Xerocomus_amazonicus_AY612839 Xerocomus_cyaneibrunnescens_JQ751259 Xerocomus_parvogracilis_JQ751262 Xerocomus_potaroensis_JQ751260 Zangia_citrina_HQ326941 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=20; TAXLABELS Austroboletus_amazonicus_KF937307 Austroboletus_amazonicus_KF937308 Austroboletus_amazonicus_KF937309 Austroboletus_fusisporus_AB509830 Austroboletus_fusisporus_JX889719 'Austroboletus novae-zelandiae HM060327' Austroboletus_rustropii_JN168683 Austroboletus_subvirens_JN378518 Boletaceae_sp._511AMV_root_KF878352 Boletellus_ananas_JN168685 Boletellus_dicymbophilus_KC155373 Clavulina_amazonica_KF937313 Fistulinella_campinaranae_var._scrobiculata_KF937331 Fistulinella_campinaranae_var._scrobiculata_KJ195891 Fistulinella_gloeocarpa_GQ981503 Russula_sp._KF937358 Xerocomus_cyaneibrunnescens_JQ751259 Xerocomus_parvogracilis_JQ751261 Xerocomus_potaroensis_JQ751260 Zangia_citrina_HQ326917 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M20847] TITLE Fistulinella_and_Austroboletus_species.__Maximum_likelihood_tree_based_on_LSU_sequences; LINK TAXA = Taxa1; DIMENSIONS NCHAR=466; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Austroboletus_amazonicus_KF714508 CCAGGGCTTATGTGTTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-TGGGGATCAACC-TTGCTTCATTCGTGGTGTGGG--GTGTATTTCTTAGTC-GACGGGTCAGCATCAGTTTCG-GTC-GCTGTACAAGGATG--AGAGAAATGTGGCACTCTTCG--GA-GTGTGTTTATAGTCTTTCGTCGCATGCAGTGGCTTG-GGACTGAGGAAC------TCTGCACG----------A-------AATTCGCTTTGTGT-TATAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_amazonicus_KF714509 CCAGGGCTTATGTGTTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-TGGGGATCAACC-TTGCTTCATTCGTGGTGTGGG--GTGTATTTCTTAGTC-GACGGGTCAGCATCAGTTTCG-GTC-GCTGTACAAGGATG--AGAGAAATGTGGCACTCTTCG--GA-GTGTGTTTATAGTCTTTCGTCGCATGCAGTGGCTTG-GGACTGAGGAAC------TCTGCACG----------A-------AATTCGCTTTGTGT-TATAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_amazonicus_KF714510 CCAGGGCTTATGTGTTGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-TGGGGATCAACC-TTGCTTCATTCGTGGTGTGGG--GTGTATTTCTTAGTC-GACGGGTCAGCATCAGTTTCG-GTC-GCTGTACAAGGATG--AGAGAAATGTGGCACTCTTCG--GA-GTGTGTTTATAGTCTTTCGTCGCATGCAGTGGCTTG-GGACTGAGGAAC------TCTGCACG----------A-------AATTCGCTTTGTGT-TATAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_betula_AY612797 ACCAGCGCTATGTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCCTC-CAGGGATCAACC-TTGC----TTC---TCGCTCG--GTGCACTTCCTGGTC-GACGGGTCAGCATCAGTTTCA-ATCG-CCGTACAATGCCA--GAGGGAACGTGGCACTCTTC---GGAGTGTGTT-ATAGCCTTTTGTCGTATGC-GGCGGTCG-GGACTGAGGAAC------TCGGCACGA-------------------TTT-CGGTCTGTGTCTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_dictyotus_JX901138 CCAGGGCTTATGTGTCGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGTTTGATGTCAGTCACGTCAAT-TAAGGATCAACC-TCGC----TTCATTGT-CAAG--GTGTACTTCTTAGTT-GTCGGGTCAGCATCAGTTTCG-ATC-ACGGTACAAAGTCG--AGAGAAATGTGGCACTCCTCG--GA-GTGTGTT-ATAGTCTTTCGTAGTATGC-AGTGCTTG-GGACTGAGGAAC------TCTGCAC-------------------GATTT-CTTTTTGTGCATAGGTTGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_eburneus_JX889668 CCAGGGCTTATGTGTCGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGTTTGATGTCAGTCACGTTGCT-TGGGGATCAACC-TTGC----TTCA--TTGCCAG--GTGTATTTCTTATTC-AACGGGTCAGCATCAGTTTCG-CTCCGCTGTACAAGGCCA--ACAGAAATGTGGCACTCTTCG--GA-GTGTGTT-ATAGTCTTTTGTCATATGC-AGCGCTCG-GGACTGAGGAAC------TCTGCAC-------------------GA-TCTACTTTTGTGCATAGGTTGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_fusisporus_JX889720 CCAGGGCTTATGTGTCGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAATAGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGCTGAAAGGGAAACACTTGATGTCAGTCACGTTAAC-TAGGGATCAACC-TTGCGC--TTAATCCCGCTAG--GTGTATTTCCTACTT-AATGGGTCAGCATCAGTTTTG-ATT-ACTGTACAAACTCG--GGAGAAATGTAGCACTCTCAG--CA-GTGTGTT-ATAGTCTTTCGTCTTATGC-AGTCATTA-GGACTGAGGAAC------TCTGCAC-----------G-------GACTAGCTCTT-GTGCATACGTTGCTGGCATAATGGCCTTAAGTGACCCGTCTTGA Austroboletus_gracilis_DQ534624 CCAGTGCTTATGTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTCGAT-TAGGGATCAACC-TTGC----TTT--CTCGCTGG--GTGTACTTCCTAGTC-GACGGGTCAGCATCAGTTTCG-GTC-GCCGTACAAGGGCG--AGAGAAATGTGGCACTCTTCG--GA-GTGTGTT-ATAGTCTTTCGTCCTATGC-GGTGGTTG-GGACTGAGGAAC------TCTGCAC-----------G-------GCTTCACGGCTTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_lacunosus_JX889669 CCAGGGCTTATGTGTTGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATGGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGCTGAAAGGGAAACACTTGATGTCAGTCACGTTGAT-TAGGGATC{AG}ACC-TTGC----TTTAACTTGTGAG--GTGTATTTCTTAGTT-GACGGGTCAGCATCAGTTTTG-ATT-ACAGTACAATGGCA--AGGGAAATGTAGCACTCTTAG--GA-GTGTGTT-ATAGTCTCGAGTCGTATGCTAGTGGTTG-GGACTGAGGAAC------TCTGCACA----------G-------GACTAGCTTTTTGTGCATAGGTTGCTGGCATAATGGCCTTAAGTGACCCGTCTTGA Austroboletus_mucosus_AY612798 CCAGGGCTTATGTGTTGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCATTGGT-TGGGGATCAACC-TTGCTTCATT------GTGGG--GTGTATTTCCTAGTC-AATGGGTCAGCATCAGTTTCA-GTC-GCTGTACAAGGGCG--AGAGAAATGTGGCACTCTTAG--GA-GTGTGTT-ATAGTCTTTCGTCGTATGCAGTG-CTTG-GGACTGAGGAAC------TCTGCACG----------A-------CCTTG--TTTGTGT--AT?GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_niveus_DQ534622 CCAGGGCTTATGTGTTGCCCTCTCAACAAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGGTAAATACCAGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTCGAT-TGGGGATCAACC-TTGC----TTTCATTTGCCGG--GTGTATTTCCTAGTC-AACGGGTCAGCATCAGTTTCG-GTC-GCCGTACAAGGGCA--AGAGAAATGTGGCACTCTTCG--GA-GTGTGTT-ATAGTCTTTTGTCATATGC-GGCGCTCG-GGACTGAGGAAC------TCTGCAC-------------------GAATCTACTTTTGTGCATAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA 'Austroboletus novae-zelandiae DQ534623' CCAGGGCTTATGTGTTGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTCGAT-TAGGGATCAACC-TTGC----TTTTATTGGTGGG--GTGTATTTCCTAGTC-GACGGGTCAGCATCAGTTTCG-GTC-GCAGTACAAGGGCA--AGAGAAATGTGGCACTCTTTG--GA-GTGTGTT-ATAGTCTTTTGTCGTATGC-GGTGGTTG-GGACTGAGGAAC------TCTGCAC-------------------GACTTG--TTTTGTGCATAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Austroboletus_sp_KF030351 CCATGTGCTATGTGAAACGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGCTGAAAGGGAAACGCTGGATGTCAGTCGCGTTAGCCTAAGGATCAACC-TA-----GTGAATA------G--GTGTATTTCTTAGTT-GACGGGTCAACATCAGTTTTG--ATGACTGTACAAAGGCA-AAGGGAAATGTAGCACTCTTAG--GA-GTGTGTTATAGACCCTTGGTTGGATGCAAGTCATAA-GGACTGAGGAAC------TCTGCATAACCTT----TTGTTTTTTCATTA-GGTTTGTTGCAAGGGATGTTGGCATAATGGCATTCATCGACCCGTCTTGA Austroboletus_subvirens_JN378518 CTAGGGCCTATGTGAAACGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCCTAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGCTGAAAGGGAAACGCTGGATGTCAGTCGCATTAGC-TGGGGATCAACC-CG-----GGTGATAT--CTGG--GTGTAGTTCCTGGTG-GATGGGTCAGCATCATTTTTT-TATTACTGTATAAGGGCA-AAAGGAAATGTAGCACTCTTAG--GATGTGTGTTATAGACTTTTG-TTAGATGCA-GTAGTTG-GGACTGAGGTAC------TCTGTGCA------------CGATTCAA{CT}TA-GGATTTGTGCAAGGGATGCTGGCATAATGGCATTCATCGACCCGTCTTGA Boletellus_ananas_AY612799 ACCGGCGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTCGCGTCAGCCGCGTCGGT-CGGGGATCAACCCTTGCGAAGCGA---TCGCTGGGGGTGCACTTCCTGTCC-GACGGGTCAGCATCAGTTTTG-GTCG-TCGTACAAGGGCG--AGGGGAACGTGGCACTCTTCC-GGGAGTGTGTT-ATAGCCTTTCGTCGCATGC-GTCGGCAG-GGACTGAGGAAC------TCGGCATGGCC----------------CTTT-GTGTCTGTGTCTAGGATGCTGGCATAATGGCGTCAAGCGACCCGTCTTGA Boletellus_dicymbophilus_HQ161852 ACCAGGGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGTGTCGGC-CGGGGATCAACC-TTGC----TTT---TCGCTGG--GTGCACTTCCTGGTC-GACGGGTCAGCATCAGTTTCG-GTCG-TCGTACAATGGCG--AGGGGAACGTGGCACTCTTC---GGAGTGTGTT-ATAACCTCTCGTCGCATGC-GGCGGTGG-GGACTGAGGATC------TCGACACGG------------------CTTC-CAGCCTGTGTCTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Boletellus_exiguus_vHQ161862 GCCAGGGCTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTCGGC-CAGGGATCAACC-ATGCT---TTC---TTGCTGG---TGCATTTCCTGGTTCGATGGGTCAGTGTCAGTTTTG-GTCG-TCGTAAAATGGCG--AGGAGAATGTGGCACTCTTTCGTGGAGTGTGTTTATAGCTCTTGGTCGTATAC-GTCAGTCA-GGACTGAGGTAC------TCGGCACGACT----------------TCT----GTCTGTGTCTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Boletellus_piakaii_HQ161861 GCCAGGGCTCTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTCGGC-TGGGGATCAACC-TTGCA---TTT---CGCTGGG---TGCACTTCCTAGTG-GACGGGTCAGCATCAGTTTCG-GTCG-CCGTACAATGGTC--GAGGGAATGTGGCACTCTT---TGGAGTGTGTT-ATAGCCTTTGGTCGTATGC-GGTGGTGG-GGACTGAGGAAC------TCGGCATGGCT----------------TCT----GTCTGTGTCTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Clavulina_amazonica_KF714513 GCCAGTGCTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGAAGTCAGTCATGTTTGC-TTGGACTCAACC-TAAC----CTCG----GTTTG--GTGCATTTCCTTGCA-GACGGGCCAGCGTTCATGTTG--TTTGCCAGAGAAGGAGC--GAGAGAATGTGACTCCTTTGG-----GAGTGTT-ATAGCTCTCACTCGCATGTGGGGAACAATATGGAGTGGTACAGCACGCTTGTG---------------------------------------------------------------------------- Fistulinella_campinaranae_var._scrobiculata__KF714520 ACCAGGGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGAGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-TGGGGATCAACC-TTGT---GTGAATAACGCTGG--GTGTACTTCCTGGTG-GACGGGTCAGCATCAGTTTCT-ATTCCGTTCGTAGAATGATCAAGGGAAAGTGGCACTCTTAG--GA-GTGTGTTTATAGCCTTTGGTCGTATGCG-GGGATGG-AGACTGAGGAAAGAAAA-TCTCAGCA------------CGGTCTAATAACGGGCTTGTGTTTAGGATGCTGGCGAAATGGCCTTAAGCGACCCGTCTTGA Fistulinella_campinaranae_var._scrobiculata_KJ195892 ACCAGGGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGAGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-TGGGGATCAACC-TTGT---GTGAATAACGCTGG--GTGTACTTCCTGGTG-GACGGGTCAGCATCAGTTTCT-ATTCCGTTCGTAGAATGATCAAGGGAAAGTGGCACTCTTAG--GA-GTGTGTTTATAGCCTTTGGTCGTATGCG-GGGATGG-AGACTGAGGAAAGAAAA-TCTCAGCA------------CGGTCTAATAACGGGCTTGTGTTTAGGATGCTGGCGAAATGGCCTTAAGCGACCCGTCTTGA Fistulinella_cinereoalba_GQ477439 ACCAGGGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGAGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTAGCGTCGGG-TTGG-ATCAACT-TGTA---GTTA--AATACTGG--GTGTATTTCCTAGTC-GACGGGTCAGCATCAGTTTTT-ATTTCGTTCGTATAATGA-CAAGGGAATGTGGCACTCTTAG--GA-GTGTGTT-ATAGCCTTTGGTCGTATGCG-GCGGTGG-ATACTGAGGAA-------CCTCAGCA------------CGGTCTAATAGCGGACTTGTGTTTAGGATGC-GGCGAAATGGCCTTAA?-GACCCGTCTTGA Fistulinella_prunicolor_JX889548 ACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTTGGC-TGGGGATCAACC-TTGC----TTT---TCGCTGG--GTGTACTTCCTGGTT-GACGGGTCAGCATCAGTTTCG-GTC-GCCATACAAGGGCG--AGAGGAATGTGGCACTCTTCG--GG-GTGTGTT-ATAGCCTTTCGTCGTATGT-GGCAATCG-GGACTGAGGAAC------TCAGCAT-------------------GGCTTCACGCTTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Fistulinella_viscida_AF456825 ACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-TGGGGATCAACC-TTGC----TTC---TCGCTGG--GTGTACTTCCTGGTC-GACGGGTCAGGATCAGTTTCG-GTC-GCCATACAAGGGCG--AGGGGAATGTGGCACTCTTCG--GA-GTGTGTT-ATAGCCTTTCGTCGTATGT-GGTGGTAG-GGACTGAGGAAC------TCAGCAC-------------------GGCTTCATGCTTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Royoungia_boletoides_DQ534663 CCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATCGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGTC-CGGGGGTCAACC-TTGCAT-TCGT---TTGCTCG--GTGTATTTCCTGGTC-GACGGGTCAGCATCAGTT-CGCATCGCCCGTACAAGGGCG--GAAGGGACGTGGCACTCTTTA-CAGAGTGTGTT-ATAACCTTTCGTCGTATGC-GGCGGCTGAGGACTGAGGAAC------TCGGCACGGACG---------------GTCTTCGTCTTGTGCTTGGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Russula_sp_KF714534 CCAGGGCTTCTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGAC-CGAGACTCAACC-TTGC----TTTG----GCTTG--GTGTATTTCTCGGCT-GACGGGTCAGCATCAATTTTG--ACCCTCAGATAATGGCA--AGGGAAAGGTGGCACCTTTT----AGGTGTGTT-ATAGTCCCATGTCGCATGT-GAGGGTTG-GGATTGAGGAACTCAG--CATGCACCTCTGGGTGTCGGGGCTTTGGCCCACGTTACATGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGA Tylopilus_alboater_AY612832 ACCAGTGCTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTCGGC-C{AG}GGGATCAACC-TTGC----TTT---GCGCTGG--GTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCG-GTCG-CCGTACAAGGGCG--AAGGGAAAGTGGCACTCTTC---GGGGTGTGTT-ATAGCCTTTCGTCGTATGC-GGGGGTCG-GGACTGAGGAAC------TGAGCACGA--------------------CTTCGGTCTGTGCTTGGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Tylopilus_ballouii_AY612823 GCCAGTGCAGTGTGATGTGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACGGGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACATCAGC-CGGGGATCAACC-CTGCT---TTC---TTGCTGG--GCGTACTTCCTGGTT-GATGGGTCAGCATCAGTTTCA-GTCG-CTGTACAAAAGTG--TAGGGAATGTGGCACTCTT---TGGAGTGTGTTTATAGCCTTGCATCGAATGC-GGTGGTCG-GGACTGAGGAAC------TCAGCATGGCT----------------TTT---AGTCTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Tylopilus_ballouii_HQ161873 GCCAGTGCAGTGTGATGTGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACGGGCGAGAGACCGATAGTGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACATCAGC-CGGGGATCAACC-CTGCT---TTC---TTGCTGG--GCGTACTTCCTGGTT-GATGGGTCAGCATCAGTTTCA-GTCG-CTGTACAAAAGTG--TAGGGAATGTGGCACTCTT---TGGAGTGTGTTTATAGCCTTGCATCGAATGC-GGTGGTCG-GGACTGAGGAAC------TCAGCATGGCT----------------TTT---AGTCTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Tylopilus_rufonigricans_AY612835 ACCAGTGCTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGACGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCATGTCGGC-CGGGGATCAACC-TTGC----TTC---TTGCTGG--GCGTATTTCCTGGTC-GACAGGTCAGCATCAGTTTCA--GTCGCCATACAAGGGCA--AAGGGAACGTGGCACTCTTC---GGGGTGTGTT-ATAGCCTTTCGTCGTATGT--GGCGTCG-GGACTGAGGTAC------TCGGCACGG--------------------CTTCGGTCTGTGCTTAGGATG?????????????????????????GTCTTGA Xerocomus_amazonicus_AY612839 GCCAGTGCTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTCGGC-CAGGGATCAACC-TTGCT---TAG---TTGCTGG--GTG?ATTTCCTGGTG-GACGGGTCAGCATCAGTTTCG-GTCG-TCGTACAATGGTA--AAGGGAATGTGGCACCTCT---TGGGGTGTGTT-ATAGCCTTTTGTCGAATGC-GTCGGTCA-GGACTGAGGAAC------TCGGCATGATC----------------TATTTGGATTTGTGT-TAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Xerocomus_cyaneibrunnescens_JQ751259 GCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-CGGGGATCAACC-TTGC----TTT---TCGCTGG--GTGTACTTCCCGCTC-GACGGGTCAGCATCAGTTTCG-GTTG-CCGTACAAGGGCA--AAGGGAATGTGGCACTCTTC---GGAGTGTGTT-ATAGTCCTTCGTCGTATGC-GGCGCTCG-GGACTGAGGAAC------TCAGCACGG--------------------CTTTCGTCTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Xerocomus_parvogracilis_JQ751262 ACCAGTGCCATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTCGATGTCAGTCGCGTCGGT-CGGGGATCAACC-TTGC----TTCA--TTGCTGG--GCGTATTTCCCGGTC-GACGGGTCAGCATCAGTTTCT-GTC-GCCATACAAGGATG--AAGGGAATGTGGCACTCCTCG--GA-GTGTGTT-ATAGCCTTTTGTCATATGT-GGTGGTCG-GGACTGAGGAAC------TCAGCAC-------------------GGCTTC-CGCTTGTGCTCGGGATGCTGGCATAATGGCCTTGAGCGACCCGTCTTGA Xerocomus_potaroensis_JQ751260 GCCAGTGCTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-CAGGGATCAACC-TTGCT---TAG---TTGCTGG--GTGCATTTCCTGGCG-GACGGGTCAGCATCAGTTTCG-GTCG-TCGTACAATGGTA--AAGGGAACGTGGCACCTCT---TGGGGTGTGTT-ATAGCCTTTTGTCGGATGC-GTCGGTCA-GGACTGAGGAAC------TCGGCACGATC----------------CCTTTGGATTTGTGTCTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA Zangia_citrina_HQ326941 ACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATAGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGC-CGGGGGTCAACC-TTGC---TTGT---TCGCTCG--GTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGTACTCGCCGTACAAGGGCG--AAGGGAACGTGGCACTCTTA---GGAGTGTGTT-ATAGCCTTTCGTCGTATGC-GGTGGTCG-GGACTGAGGAAC------TCGGCACGG--------------------CTTCGGTCTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M20848] TITLE Fistulinella_and_Austroboletus_species._Maximum_likelihood_tree_based_on_ITS_sequences; LINK TAXA = Taxa2; DIMENSIONS NCHAR=430; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Austroboletus_amazonicus_KF937307 TTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGAATTCTTCAACCAA--TGTC-TT--GTTGAC----ATGGATTGGACTTGGAGGTT-GCTGGCAAGTAGTTA----GTGCTCGG--TCAGCTCTTCTGAAATGCATTAGCAAAGAT-----CGGGTTTCGAGTGCAAGTCGGATCGATTTCCTCTAGGGGTGTCGTCGACACACCAACTAGCCTTTGATGTGATAATGATCATC---------GTAGTGAATTTTTGGTATTGCAC------GAACTTGCTCTCGCTT-------CTAATT-ACAAGTCACCAAGGGGGAAAAGGGCATTGCTTGCTTAGCTACTAGTC Austroboletus_amazonicus_KF937308 TTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGAATTCTTCAACCAA--TGTC-TT--GTTGAC----ATGGATTGGACTTGGAGGTT-GCTGGCAAGTAGTTA----GTGCTCGG--TCAGCTCTTCTGAAATGCATTAGCAAAGAT-----CGGGTTTCGAGTGCAAGTCGGATCGATTTCCTCTAGGGGTGTCGTCGACACACCAACTAGCCTTTGATGTGATAATGATCATC---------GTAGTGAATTTTTGGTATTGCAC------GAACTTGCTCTCGCTT-------CTAATT-ACAAGTCACCAAGGGGGAAAAGGGCATTGCTTGCTTAGCTACTAGTC Austroboletus_amazonicus_KF937309 TTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGAATTCTTCAACCAA--TGTC-TT--GTTGAC----ATGGATTGGACTTGGAGGTT-GCTGGCAAGTAGTTA----GTGCTCGG--TCAGCTCTTCTGAAATGCATTAGCAAAGAT-----CGGGTTTCGAGTGCAAGTCGGATCGATTTCCTCTAGGGGTGTCGTCGACACACCAACTAGCCTTTGATGTGATAATGATCATC---------GTAGTGAATTTTTGGTATTGCAC------GAACTTGCTCTCGCTT-------CTAATT-ACAAGTCACCAAGGGGGAAAAGGGCATTGCTTGCTTAGCTACTAGTC Austroboletus_fusisporus_AB509830 TTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCACTTTGGTATTCCAAAGTGCATGCCTGTTTGAGTGTCATTTCTTTTAT-CAACTCCCTTATCTTT--ATCGAT-AATCGAGCTTGGACTTGGAAGTT-GCTGGCGTCCA-TTA------ACCATG--TCAGCTCTTCTCAATTGCATTAGCAA----------TCGCTTACAGTGCAAGTCAACTC----------------CT---TGACACACCAATTAGCCTTTGACATGGTAATCATAATCCCATCTGTCATAGTGAATTTTTGGTATTGCTC------ATCATTAGCATTGCTT-------CTAATCCTAATCCTAGCACTTAGTTACTAG--TTGGCTCTAATCATCAGCTGAC Austroboletus_fusisporus_JX889719 TTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCACTTTGGTATTCCAAAGTGCATGCCTGTTTGAGTGTCATTTTATTTAT-CAACTCCCTTATCCTT--ATCGAT-AATCGAGCTTGGACTTGGAAGTC-GCTGGCGTCCA-TTA------GGCTTA--TCAGCTCTTCTCAATTGCATTAGCAA----------TCGCTTACAGTGCAAGTCAACTC----------------ATCATTGACACACCAATTAGCCTTTGACATGGTAATCATAATCCTATCTGTCATAGTGAATTTTTGGTATTGCTC------ATCTTTAGCATTGCTT-------CTAATCCTAATGCTAGCACTTAGTTACTAG--TTGGCTTTCATCATTAGCTGAC 'Austroboletus novae-zelandiae HM060327' TTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGAATTCTCAACTCATGCTCATGTC--TTACATGACATGGGATTGGACTTGGAGGTT-GCTGGCA-GCATATA-----TAGCTTA--TCAGCTCTTCTGAAATGCATTATCGA---------TTGGTTTCAAGTGCAAGTCAGGTT----------------------GACGCACCAATTAGCCTTTGACATGATAATCATCTGTC--------GTAGTGAATTTTTGGTATTGCAC----GAACACAGACTATCGCTT-------CTAATT--AGTATTAGTATACATATACTATG-GCTACTTGACCTCAAATCAGGT Austroboletus_rustropii_JN168683 TTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTGAATTCT-CAACCATGTTGTC-TT--GTTGACTGACATGGATTGGACTTGGAGGTTTGCTGGCAGGTACACAAGTTGTACTTT---TCAGCTCTTCTGAAATACATTAGCGA---------TGGGTTTCGAGTGCAAGTCAATTC----CCTTTAAGAGAGGGGGTCGACACACCAACTAGCCTTTGATGTGATAATGATCATC---------GTAGTGAATTTTTGGTATTGCATCTCAATAGACTTA-TATCGCTT-------CTAATTTACAAGT-----ACAAGGAAAAG-----TGTGTGCTTAGCTACTAGTC Austroboletus_subvirens_JN378518 GTGTAGTTCCTGGTGGATGGGTCAGCATCATTTTTTTATTACTGTATAAGGGCAAAAGGAAATGTAGCACTCTTA-GGATGTGTGTTATAGACTTTTGTTAGATGCAGTAGTTGGGACTGAGGTACTCTGTGCACGATTCAA{CT}-----TAGGATTTGTGCAAGGGAT-GCTGGC--ATAATGG------CATTCA--TCGACCCGTCT-TGAAACACGGACCAAGGA--------GTCTAACATGCATGCGAGT-AT------------------TTGGGTAGGAAAACTCGAGTGCGAAATGAAAGTGATAAAAATATGGTTGAGACCTCTGTTAAGGAGGGCATCAA{CT}GCCCAGACTAGAGTCTAGTAG-----ACAATGGATCTGCGGTAGAG---------------------------------- Boletaceae_sp._511AMV_root_KF878352 TTGCGATAAGTAATGTGAATTGCAGATTTTCCGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTGGGTATTCCTAGGAGCATGCCTGTTTGAGTGTCAATTAATTGAT-CAACCATGTCA--AGTTGATTGCTTGACTTGGGTTGGAGTTGGGAGTT-GCTGGCGCCTT---TG-----AGGATG--TCAGCTCTCCTGAAAAGGATTAGTGGAGGGA------TGTAATTCT----ACTCTACTCT-------------------TGGGCGTGATAATGATCGTCCTAGA--GCGGGGGAACGA--------AAGGATTGAACTCT--CTGCTTCGAACTGAATAGCGATGTTCAAGG--------TAAAG-ACATGCTAGTTATTAGCTTTGG-CGAGGACAGCATGAATGAACTGAG Boletellus_ananas_JN168685 GTGCACTTCCTGTCCGACGGGTCAGCATCAGTTTTG-GTCGTCGTACAAGGGCGAGGGGAA-CGTGGCACTCTTCCGGGAGTGTGTTATAGCCTTTCGTCGCATGCGTCGGCAGGGACTGAGGAACTCGG--CATGG--CCCT-----TTGTGTCTGTGTCTAGGAT-GCTGGC--ATAATGG------CGTCAA--GCGACCCGTCT-TGAAACACGGACCAAGGA--------GTCCAACATGCCTGCGAGT-GT------------------TTGGGTG-CAAAACCCGAGTGCAAAACGAAAGTGATC--------ATCGAGACCTCCGTCATGGAGGGCACCGACGCCCAGACCTGAGTCC--TTG-----ACGACGGTCCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTAT Boletellus_dicymbophilus_KC155373 TTGCGATAAGTAATGTGAATTGCAGATTTCCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATT-GAATTCT-CAACCATGTCTTGATTCGTTTCGAGCGCATGGCTTGGAGTTGGGAGCT-GCTGGCAGCCC---A-------GGCTG--TCGGCTTTCCTGAAATGCATTAGCAAAAGGTCG--CTGGTCTTTAG-ACATGCACGGCCT-CGGACGTGATAATGATCGTCCTCGC-TGGAGTGTCTTTTGATCGTGCACAGAACGGCCTATTGCTTCTAGT--CTGCACGACGTCGCTCGACACTATTAGTTCGGTCGCAAGA-----CTGGCGAACGTGTAGGGCAACCTCTCGCTTTGGATACTTGACCTCAAATCAGGT Clavulina_amazonica_KF937313 ATGCGATAAGTAATGTGAATTGCAGAATT-CAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGTGAAATTTCTCAAGCTGAGATGTTTTT----CTT------AGTCTTGGTGTT--GGGCT--CTGCCGTGT---CT---CTTATTGGG--ATGGCTGGCCTTAAAAGCATTAGCTGA---------CTCTCATGTGAATAAATTGGTTC-----------------TACTCGGCGTGATTAATGATTTTGACCGCTGAGGACATCTTTG-----GCGATGGCCAGTTCTCATTTGAGTTGCTT-CTAATCTTGGTTGTACGG-------ATTGTTAGTCTGTATGCCTCGTTTTTCAG------ATTTGACCTCGAATCAGGT Fistulinella_campinaranae_var._scrobiculata_KF937331 GCTCGTCTATTAGATGGTGTTGAAGAATCAGAATCA--TCACTAT-CGAACGCGAGGGTAGATATA-CACTAT----GGTTTTGGCTATTAG--ATGGTCGAAAGGATCATGCGAACGCAAAGCATGTAGGACTTGT--CTAC-----TAGTTAGTCTTTCGAAAAG-GCTGACGAACGCAAG------AAACAT--GTGCATTGACTATTAGATGAATGCTAGAGAC------TGTCGAACGTGCAAGCAAGTGGT------------------GTCCACGTCCAGACTAGAGTTTGCATGTTAGATGGGAGGTCAAGAACCTATACGAACGCAAGGATGTATATT-ATGCTTATGCTT--GTCCACTAG-----CCAGCATTCATGCTGGCGAAGGCAAGTATGTATGTATGTATGTATGTGCTTGAC Fistulinella_campinaranae_var._scrobiculata_KJ195891 GCTCGTCTATTAGATGGTGTTGAAGAATCAGAATCA--TCACTAT-CGAACGCGAGGGTAGATATA-CACTAT----GGTTTTGGCTATTAG--ATGGTCGAAAGGATCATGCGAACGCAAAGCATGTAGGACTTGT--CTAC-----TAGTTAGTCTTTCGAAAAG-GCTGACGAACGCAAG------AAACAT--GTGCATTGACTATTAGATGAATGCTAGAGAC------TGTCGAACGTGCAAGCAAGTGGT------------------GTCCACGTCCAGACTAGAGTTTGCATGTTAGATGGGAGGTCAAGAACCTATACGAACGCAAGGATGTATATT-ATGCTTATGCTT--GTCCACTAG-----CCAGCATTCATGCTGGCGAAGGCAAGTATGTATGTATGTATGTATGTGCTTGAC Fistulinella_gloeocarpa_GQ981503 TTGCGATAAGTAATGTGAATTGCAGATTTTCCGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTGGGTATTCCTAGGAGCATGCCTGTTTGAGTGTCAATTAAATCAT-CAACCATGTCA--GCTTGATCGCTTGACTTGGCTTGGACTTGGGGGTT-GCTGGCGCTGC---AA-----GGCCTG--CCAGCTCTCCTGAAAAGCATTAGTGAAGGGA------TATGTGTCGCA--AGTCTACCCT--------------------GGGCGTGATAATGATCGTCCTAAACGATAGACGAAGCA--------GGACATAATGAACT--TTGCTTCCAACTTCATACCCATATTCAAGG--------TGGAC-GCATGCTAGTTATTAGCTTCAG-CGAGGGCAGCATGAATAAACCTTT Russula_sp._KF937358 ATGCGATACGTAATGTGAATTGCAGAATT-CAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACACCCTCAACCTTCTTGGTTTCT----TGACCAGGAAGGCTTGGACTTTGGAGGT--TTTCCTTGCTGGCT---TGTATCTAG--TCGGCTCCTCCTAAATGAATTAGTGGG---------ATTTACTTTGCTGATCCTTGACG-----------------TGATAAGTATGTTTCTACGTCTTGGTC-TTCACAATGTCACCT-----GCTTCAAACTGTCTTTAAACAAAAGAC-----AATGTTCGAGTCACC---------TCGTGAGTC-GTGGCTTGACCTCACCAA------CCTTGACCTCAAATCGGGT Xerocomus_cyaneibrunnescens_JQ751259 GTGTACTTCCCGCTCGACGGGTCAGCATCAGTTTCG-GTTGCCGTACAAGGGCAAAGGGAA-TGTGGCACTCTTC--GGAGTGTGTTATAGTCCTTCGTCGTATGCGGCGCTCGGGACTGAGGAACTCAG--CACGG--CTTT--------CGTCTGTGCTTAGGAT-GCTGGC--ATAATGG------CCTTAA--GCGACCCGTCT-TGAAACACGGACCAAGGA--------GTCTAACTTGCCTGCGAGT-GT------------------TTGGGTG-GCAAACTCGAGCGCGAAATGAAAGTGAAA--------GTCGAGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGAGTCT--TCG-----ACGACGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTAT Xerocomus_parvogracilis_JQ751261 TTGCGATAAGTAATGTGAATTGCA?ATTTTCAGTGA----ATCAT-CGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCA-TTAAATTCT-CAACCATGTCCTTGATCGATTTCAAGACATGGCTTGGAGTTGGGAGTTTGTCGGCATCG----AA-----AGATGG--TCGACTCTCCTGAAATGTATTAGCAAAAGGAGGCTCTTGAGCATCGCATGGGCTAGCCTT-------------------TCGACGTGATAATGATCGTCGTGGTTGGGTCATGTTGCAT------CAAGAATTCAGCTCTGCTTGCTTCCAAC---AAACCCATGGACAGG----------AATT-CGACTCTGGACTCGAGTCCAAGGTTCAAGTCCTA?CTACTAGTCGGC Xerocomus_potaroensis_JQ751260 GTGCATTTCCTGGCGGACGGGTCAGCATCAGTTTCG-GTCGTCGTACAATGGTAAAGGGAA-CGTGGCACCTCTT--GGGGTGTGTTATAGCCTTTTGTCGGATGCGTCGGTCAGGACTGAGGAACTCGG--CACGAT-CCCT-----TTGGATTTGTGTCTAGGAT-GCTGGC--ATAATGG------CCTTAA--GCGACCCGTCT-TGAAACACGGACCAAGGA--------GTCTAACATGCCTGCGAGT-GT------------------TTGGGTGTGTAAACTCGAGCGCGTAATGAAAGTGAAA--------GTCGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAGTCT--TTG-----ACAAAGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTAT Zangia_citrina_HQ326917 ACGCAAACGTTAATCGTCATAATCAGGCGTAAAGGG--TGTGTAGGCGGCTTTAAAAAAATATAATAAGTATTATATTTTTTATAGTAAAAATTATATTTAAATAAAAGCTAGAATCTAAAAGAGGGTAA---GCTAAACAACATAATTAATTGGGACTGACAACTT--ATAATAATGTGGAGTACTAAAGGTTAAAGCTATTTATCTACTTAAGATTGACGCTGAGA-------AACGAAGGGGAGAATAAGAAAC--------------TTAGATTAGAGACCTAATTATCTCTCTCAGTCAACGATGAATGGTAGTTATTAAAAACTTTTATAATATTAGTAACGAGGTTAACACGATGACCATTCCGCCTTGTTAGTAAGACTGCAAAGTTGAAAACAAAAA-AATTAGTCGGTCTTGAAGCAAAC ; END; BEGIN TREES; TITLE Austroboletus_amazonicus_sp._nov._and_Fistulinella_campinaranae_var._scrobiculata_LSU; LINK TAXA = Taxa1; TRANSLATE 1 Austroboletus_betula_AY612797, 2 Austroboletus_eburneus_JX889668, 3 'Austroboletus novae-zelandiae DQ534623', 4 Austroboletus_amazonicus_KF714508, 5 Austroboletus_amazonicus_KF714509, 6 Austroboletus_amazonicus_KF714510, 7 Austroboletus_dictyotus_JX901138, 8 Austroboletus_fusisporus_JX889720, 9 Austroboletus_gracilis_DQ534624, 10 Austroboletus_lacunosus_JX889669, 11 Austroboletus_mucosus_AY612798, 12 Austroboletus_niveus_DQ534622, 13 Austroboletus_sp_KF030351, 14 Austroboletus_subvirens_JN378518, 15 Boletellus_ananas_AY612799, 16 Boletellus_dicymbophilus_HQ161852, 17 Boletellus_piakaii_HQ161861, 18 Boletellus_exiguus_vHQ161862, 19 Clavulina_amazonica_KF714513, 20 Fistulinella_cinereoalba_GQ477439, 21 Fistulinella_campinaranae_var._scrobiculata__KF714520, 22 Fistulinella_campinaranae_var._scrobiculata_KJ195892, 23 Fistulinella_prunicolor_JX889548, 24 Fistulinella_viscida_AF456825, 25 Royoungia_boletoides_DQ534663, 26 Russula_sp_KF714534, 27 Tylopilus_ballouii_AY612823, 28 Tylopilus_alboater_AY612832, 29 Tylopilus_ballouii_HQ161873, 30 Tylopilus_rufonigricans_AY612835, 31 Xerocomus_amazonicus_AY612839, 32 Xerocomus_cyaneibrunnescens_JQ751259, 33 Xerocomus_parvogracilis_JQ751262, 34 Xerocomus_potaroensis_JQ751260, 35 Zangia_citrina_HQ326941; TREE Imported_tree_0 = [&R] (19:0.20810436,(26:0.09062697,((13:0.07223204,14:0.09765497)0.9970:0.13772829,((9:0.01246414,((3:0.00828805,(2:0.04395741,12:0.03437506)0.6050:0.02124107)0.2050:0.00798501,((8:0.0882424,10:0.05377247)0.4330:0.0312912,(7:0.0700077,(11:0.0288407,(4:0.0,(5:0.0,6:0.0)0.3370:0.0)0.9950:0.02795746)0.6660:0.0193869)0.0720:0.00559613)0.0760:0.00852308)0.3490:0.00727282)0.6240:0.02613864,((20:0.05139883,(21:0.0,22:0.0)0.9990:0.03847964)0.9960:0.12461147,(((17:0.03927503,(27:0.0,29:0.0)1.0000:0.09024663)0.1440:0.0,(18:0.07405847,(31:0.0,34:0.01687406)0.9680:0.0328304)0.5600:0.02469613)0.2310:0.02436339,((1:0.04055785,(15:0.07895948,16:0.0323212)0.4940:0.02058269)0.1030:0.01043264,((32:0.04232138,(33:0.05587232,(23:0.01986077,24:0.01031707)0.7290:0.00806192)0.5570:0.01470865)0.1040:0.00381738,((25:0.05296623,35:0.01461365)0.6660:0.01412047,(28:0.01283513,30:0.05470587)0.5900:0.01367112)0.2320:0.01178558)0.0470:0.0)0.0790:0.0)0.4290:0.01518777)0.4370:0.04837632)0.2120:0.00339812)0.7970:0.14546636)0.0000:0.20810436); END; BEGIN TREES; TITLE Austroboletus_amazonicus_sp._nov._and_Fistulinella_campinaranae_var._scrobiculata_ITS; LINK TAXA = Taxa2; TRANSLATE 1 Boletaceae_sp._511AMV_root_KF878352, 2 Austroboletus_amazonicus_KF937307, 3 Austroboletus_amazonicus_KF937308, 4 Austroboletus_amazonicus_KF937309, 5 Austroboletus_fusisporus_AB509830, 6 Austroboletus_fusisporus_JX889719, 7 'Austroboletus novae-zelandiae HM060327', 8 Austroboletus_rustropii_JN168683, 9 Austroboletus_subvirens_JN378518, 10 Boletellus_ananas_JN168685, 11 Boletellus_dicymbophilus_KC155373, 12 Clavulina_amazonica_KF937313, 13 Fistulinella_campinaranae_var._scrobiculata_KF937331, 14 Fistulinella_campinaranae_var._scrobiculata_KJ195891, 15 Fistulinella_gloeocarpa_GQ981503, 16 Russula_sp._KF937358, 17 Xerocomus_cyaneibrunnescens_JQ751259, 18 Xerocomus_parvogracilis_JQ751261, 19 Xerocomus_potaroensis_JQ751260, 20 Zangia_citrina_HQ326917; TREE Imported_tree_0 = [&R] ((12:0.23607266,16:0.39421181)0.8840:0.09102244,((20:1.70208605,((13:0.0,14:0.0)0.9870:0.38921213,(19:0.05625456,(9:0.20923877,(10:0.10720964,17:0.05403709)0.4700:0.04312856)0.0330:0.0)0.9910:0.97682882)0.9720:1.01216464)0.9780:0.93884736,((18:0.14933541,(1:0.12748044,15:0.08584525)0.9880:0.0996895)0.9420:0.15191805,(11:0.23566642,((5:0.02654248,6:0.00394366)1.0000:0.14809516,(7:0.08966768,(8:0.02454419,(4:0.0,(2:0.0,3:0.0)0.3080:0.0)1.0000:0.04381948)0.9330:0.03694734)0.7870:0.0336386)0.8910:0.0864191)0.5800:0.03280569)0.7260:0.15127913)0.8840:0.01401646); END;