#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:24 GMT TreeBASE (cc) 1994-2008 Study reference: Havrylenko M., Takamatsu S., Divarangkoon R., & Braun U. 2006. Phyllactinia chubutiana: a new species of Erysiphales from Patagonia (Argentina). Mycoscience, 47. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1538] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=42; TAXLABELS Arthrocladiella_mougeotii Blumeria_graminis_AB022362 Blumeria_graminis_AB022376 Blumeria_graminis_AB022399 Brasiliomyces_trina Byssoascus_striatosporus Caespitotheca_forestalis Cystotheca_lanestris Cystotheca_wrightii Erysiphe_adunca Erysiphe_aquilegiae Erysiphe_australiana Erysiphe_friesii Erysiphe_glycines__AB022397 Erysiphe_gracilis_AB022357 Erysiphe_heraclei Erysiphe_mori Erysiphe_pulchra Erysiphe_simulans Golovinomyces_cichoracearum Golovinomyces_orontii Leveillula_taurica Neoerysiphe_galeopsidis Oidium_phyllanthi_AB120754 Oidium_phyllanthi_AB120755 Oidium_phyllanthi_AB120758 Parauncinula_septata_AB022420 Parauncinula_septata_AB183533 Phyllactinia_chubutiana Phyllactinia_kakicola Phyllactinia_moricola Pleochaeta_shiraiana Pleochaeta_turbiana Podosphaera_filipendulae Podosphaera_longiseta Podosphaera_pannosa Podosphaera_tridactyla Podosphaera_xanthii Sawadaea_polyfida Sawadaea_sp._AB193392 Sawadaea_tulasnei Typhulochaeta_japonica ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1159] TITLE Phyllactinia_chubutiana_28S; LINK TAXA = Taxa1; DIMENSIONS NCHAR=825; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrocladiella_mougeotii AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCG-CGGCCTACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTG--TTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTACGTGAGAACCCGTAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACCAGCAT----------- Blumeria_graminis_AB022362 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGATCCATTA--GGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGCG-ACGAGTCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACCTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATAA------GGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Blumeria_graminis_AB022376 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGTTTA-C-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTG-GCGAGTCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATAA------GGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Blumeria_graminis_AB022399 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACC-CAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGGTTA-C-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTA-GTGAGTCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAACCCCGTATGCGGCCGAGTACTCAGTGCC--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC------------------------------------------------------------------------------------------------------------------------------------------------------- Brasiliomyces_trina TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGAATCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCG-AGGTTTGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGG-CC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGAC-TTGGGCGCTGCCGATCATCCCGAG-TTCTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTC--GGGGCAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTGAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGACCGATCCTGATGT?TTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Byssoascus_striatosporus ----------------------------------------------------------AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGTCCGAGTTGTAATTTGGAGAAGATGCTTCGGGT-ACGGTCCCGGTCTAAGTTCCTTGGAACAGGAC---GTCACAGAGGGTGAGAATCCCGTACGTGGTCG-GTGGCCGTGCCC--GTGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCCATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGCGCGCGGTCGATCATCCTGGG-TTCGCCCGGGTGCACTCGGCCGCGCTCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTCGGGAACGTGGCTCCCCTC----GGGGAGTG--TTATAGCCCGAGGTGCAATGCAGCCTACCTGGACCGAGGACCGCGC--TTC---GGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Caespitotheca_forestalis TTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCTGTC--GTCAGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GCGGGCCCGGCCTAAGTTCCTTGGAACGGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCTGGTGCTCGT-GCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTACCGATCACCCAGAGTTCTGCTCTGGTGCACTCGGTAGCGTACAGGCCAGCATCGGTTCGGGCGGTCGGACAAGGGCCGTAGGAATGTATCTCTCCCTCA--CGGAAGAGTATTATAGCCTACGGCGCCATACGGCCTGCCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTGAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCCGTCAAAC--GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCATAGCTGTTGGGA Cystotheca_lanestris TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-ATGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTTGTCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGCTGATCCGCTGGGG-TTCTCCCCGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTC--GGGGCAGTG--TTATAGCCTCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTTA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Cystotheca_wrightii TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGCTGATCCGTCGGGG-TTCTCCCCGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTC--GGGGCAGTG--TTATAGCCCCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTTA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_adunca TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGCACCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACACCACTGATCCGCGAGGG-TTCTCTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTAAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTC-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_aquilegiae TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCA-TGGCCCGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGCCGATCACCCCGAG-TTCTCTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC----GGGGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_australiana TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCG-TGGCTTGCGCCT--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGAC-TTGGGCATCGCTGATCATCCGGGGGTA-TCTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC----GAGGAGTG--TTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_friesii TTGACCTCGAATCAGGTAGGAATACCCGCTGAAC------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTACGCCC--GGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCTGCTGATCACCTTGAGTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_glycines__AB022397 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCG-AGGTTTGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGTTGATCATCTAGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT----GGGGAGTG--TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_gracilis_AB022357 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGCGCTC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCACTGCTGATCATCCAGAGGTTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTC--GGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTG------GGGTGCATCATC-ACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_heraclei TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCCGCGCCT--ATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTT---GGGGGCGCATCATCGACCGATCCTGA---------------------------------------- Erysiphe_mori TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCTGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGCTGCTGATCATCCAGAG-TTCTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTC--GGGGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGCAGGTG--------------------------------------------------------------------------------- Erysiphe_pulchra TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCCCGCGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCTGCCGATCACCCAGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_simulans TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCTG-AGGCCCGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGACGCTGCCGATCATTCCGAG-TTCTCTCTGATGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACCGGAGGAACGTAGCTCCCCCCTCGGGAGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAC-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTCG------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGGCCG-TGGCCTACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGTCGATCATCCGGGG-TTCTCCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCCCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGAGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCC-TTT--GGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTCA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATAGCTGTTGGGA Golovinomyces_orontii TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTGAGCTCGGCCTAAGTTCCTTGGAACAGGAC---ATCAGAGAGGGTGAGAATCCCGTATGTGCCCG-TGGCCTATGCCC--GTGTAAGGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGTCGTCGATCATCCGAGG-TTCTCCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTG--TTATAGCCTAGGGCGTAATGCAGCCTATCTGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACGAGCATACCTGTTGGGA Leveillula_taurica TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CC------------GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-A-GCGCCTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATA--------AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGTTGATCATCCAAAG-TTTTCTTTGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGGACGTAGCTCCTTTC----GGGGAGTG--TTATAGCC-GTGGCGCAATACCACCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCTAAA-CCCACACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTCGA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Neoerysiphe_galeopsidis TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCG-TGACCTGTGCCC--GTGTAAGGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAAAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGTGGATCATCCGAGG-TTCTCCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCTTAGAAATGTAGCTCCTCGC----GGGGAGTG--TTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAT------GGGGGCATCATCGACCGATCCTGAA-TCTTCGGATGGATTTGAGT------------------- Oidium_phyllanthi_AB120754 ----------------------------------------------------------------------------------------------------------AGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGTTGTTGATCATCCGAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCGCCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Oidium_phyllanthi_AB120755 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCCT--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGTTGTTGATCATCCGAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCGCCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGAT----------------------------- Oidium_phyllanthi_AB120758 ----------------------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTTCCT---CGGAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTCTGCGGCCGAGACCCTACACCTATATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCATCGTTGATCATCCGAGGCTTTGCCTCGGTGCACTCAACAATGCACAGGCCAGCATCGGTTTGACTGGCTGGAAAAAGGCCCTAGGAATGTAGCTCCTTTC----GGGGAGTG--TTATAGCCTAGGGCGTCATGCAGCCCAGTTAGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTTA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCATAGCTGTTGGGA Parauncinula_septata_AB022420 TTGACCTCGGATCA--------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCT---CGGCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGT-AGGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCC--GTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGAC-TTGGGGGCCGTGGATCATCCAGGCTTCGGGCC-TGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAA-CCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGAT------------------------- Parauncinula_septata_AB183533 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACAAGCTCAAATTTGAAATCTGGCGCCCT---CGGCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGC-TGGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCC--GTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGAC-TTGGGGGCCGTGGATCATCCGGGCTTCGGGCCCGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCTAGAGCGCCATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGTTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAA-CCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGAA------GGGTGCATCATCGACCGATTCTGATGTCT----------------------------------- Phyllactinia_chubutiana TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATTTGGCTCCCT--GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCG-GGGCACACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGTTGATCATCCAACG-TTTTCGTTGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTC----GGGGAGTG--TTATAGCCTGCGGCGCAATACCGCCTACTCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCAAGTGTTTGGGTGCAAAA-CCCATGCGCGGAATGAAAGTGAACGC-------------------------------------------------------------------------------------- Phyllactinia_kakicola TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCG-GTTTCGACGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCATCGCTGATCATCCAAAG-TTCTCTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC----GGAGAGTG--TTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCGTTAA-----GGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGG- Phyllactinia_moricola TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCCA-GTGTCGGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTCGCTGATCATCCAAAG---CTCTTTGGTGCACTTGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTC----GGAGAGTG--TTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTCGA-----GGGGGCATCATCGACCGATCCTG----------------------------------------- Pleochaeta_shiraiana TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTC-AC-CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCCG-GTGCCTGTGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGAC-TTGGGCGTTGGTGATCATCCGGAG-TTTTCTCTGGTGCACTCGGCAATGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC----GGGGAGTG--TTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTA------GGGTGCATCATCGACCGATC-------------------------------------------- Pleochaeta_turbiana TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAAAAGCTCAAATTTGAAATCTGACTTCCGAC-CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTACTAGACCTAGCCTAAGTTCCTTGGAACAGGACTCTGTCATAGAGGGTGAGAATCCCGTATGCGGCTC-GAGTCTGTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTTGGGCGTCATTGATCATCCAGAGTTCTTCTCTGGTGCACTCGGCGACGCACAGGCCAGCATCGGTTTGGGCGGTTGGAGAAAGGTCTTGGGAAAGTAGCTCCTCTC----GGGGAGTG--TTATAGCCCGAGACGCAATGCAGCCAGCCCGGATCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTGAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTTAA-----GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_filipendulae ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_longiseta ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_pannosa ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGCGCCC--ATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_tridactyla ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGTTGATCCGTTAGGG-TTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_xanthii ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT----CGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GCGCCCGTGCCC--GTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGTTGATCCGCTAGGG-TTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTCTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAA------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_polyfida TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCTGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_sp._AB193392 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGCCGATCCGCGGGGG-TTCTCCCTCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGTCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_tulasnei TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACC---------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCT----CGGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGAC---GTCGTAGAGGGTGAGAATCCCGTATGCGGCTG-GTGCCCTCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGAC-TTGGGCGCTGCTGATCCGCGGGGG-TTCTCCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTG--TTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGC--TTC--GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAA-CCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTCA------GGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Typhulochaeta_japonica TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA--------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGAC---GTCATAGAGGGTGAGAATCCCGTATGTGGCCG-AGGCTTGCGCCC--GTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGAC-TTGGGCGCTGCTGATCATCCAGAG-TTCTCTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTC--GGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCC-TTC-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA-CCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTG------GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Phyllactinia_chubutiana_28S) = N: 1-825; CODONPOSSET CodonPositions (CHARACTERS = Phyllactinia_chubutiana_28S) = N: 1-825; END; BEGIN TREES; TITLE Tb7760; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_pulchra, 2 Erysiphe_mori, 3 Erysiphe_heraclei, 4 Erysiphe_gracilis_AB022357, 5 Erysiphe_glycines__AB022397, 6 Erysiphe_friesii, 7 Erysiphe_australiana, 8 Erysiphe_aquilegiae, 9 Erysiphe_adunca, 10 Cystotheca_wrightii, 11 Cystotheca_lanestris, 12 Caespitotheca_forestalis, 13 Byssoascus_striatosporus, 14 Brasiliomyces_trina, 15 Blumeria_graminis_AB022399, 16 Blumeria_graminis_AB022376, 17 Blumeria_graminis_AB022362, 18 Arthrocladiella_mougeotii, 19 Typhulochaeta_japonica, 20 Sawadaea_tulasnei, 21 Sawadaea_sp._AB193392, 22 Sawadaea_polyfida, 23 Podosphaera_xanthii, 24 Podosphaera_tridactyla, 25 Podosphaera_pannosa, 26 Podosphaera_longiseta, 27 Podosphaera_filipendulae, 28 Pleochaeta_turbiana, 29 Pleochaeta_shiraiana, 30 Phyllactinia_moricola, 31 Phyllactinia_kakicola, 32 Phyllactinia_chubutiana, 33 Parauncinula_septata_AB183533, 34 Parauncinula_septata_AB022420, 35 Oidium_phyllanthi_AB120758, 36 Oidium_phyllanthi_AB120755, 37 Oidium_phyllanthi_AB120754, 38 Neoerysiphe_galeopsidis, 39 Leveillula_taurica, 40 Golovinomyces_orontii, 41 Golovinomyces_cichoracearum, 42 Erysiphe_simulans; TREE Figure = [&R] (((((((((8,((3,6),1)),(5,((4,(14,42)),(2,19)))),9),7)Erysipheae,(((41,40),18),(38,(35,(36,37))Oidium_subgen._Microidium))Golovinomyceteae),(((30,31),(32,39)),(29,28))Phyllactinieae),(((((21,22),20),(10,11)),((23,(26,24)),(25,27)))Cystotheceae,((15,16),17)Blumerieae)),((34,33),12)),13); END;