#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 20:09 GMT TreeBASE (cc) 1994-2008 Study reference: Labiak P.H., Sundue M.A., Rouhan G., Hanks J.G., Mickel J.T., & Moran R. 2014. Phylogeny and Historical Biogeography of the Lastreopsid Ferns (Dryopteridaceae). American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15390] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=115; TAXLABELS 'Arachniodes aristata (Lorence 9314)' 'Arachniodes denticulata (Mynssen 549)' Arachniodes_rhomboidea_GB Arthropteris_altescandens_GB 'Bolbitis acrostichoides (Fay 1068)' 'Bolbitis auriculata (Fay 110)' 'Bolbitis humblotii (Razafitsalana 115)' 'Coveniella poecilophlebia (Kessler 14303)' 'Coveniella poecilophlebia (van der Werff 11478)' Ctenitis_eatonii_GB 'Cyclodium heterodon var. heterodon (Labiak 3996)' 'Cyclodium rheophilum (Granville 15523)' Dryopteris_crispifolia_GB Dryopteris_fragrans_GB 'Dryopteris patula (Sundue 1104)' Dryopteris_patula_GB 'Dryopteris wallichiana (Labiak 4434)' 'Elaphoglossum amygdalifolium (Herrera 2063)' 'Elaphoglossum decoratum (NYBG391/77B)' 'Elaphoglossum hybridum (FR6421)' 'Lastreopsis acuminata (Coveny 10182)' 'Lastreopsis acuminata (Kessler 14227)' 'Lastreopsis acuta (Labiak 4913)' 'Lastreopsis amplissima (Labiak sn)' 'Lastreopsis amplissima (Prado & Hirai 2021)' 'Lastreopsis amplissima (Zardini 15991)' 'Lastreopsis barteriana (Carvalho 5780)' 'Lastreopsis boivinii (RG470)' 'Lastreopsis boivinii (Rouhan 1356)' 'Lastreopsis boivinii (Rouhan 1369)' 'Lastreopsis confinis (Liogier 25604)' 'Lastreopsis currori (Doursett-Lemaire 1906)' 'Lastreopsis currori (Fay 4804)' 'Lastreopsis decomposita (Kessler 14191)' 'Lastreopsis effusa (BP047)' 'Lastreopsis effusa ssp dilatata (Hernandez 1906)' 'Lastreopsis effusa ssp divergens (Villaroel 1597)' 'Lastreopsis effusa ssp divergens (Walker 10612)' 'Lastreopsis exculta ssp exculta (Moran 3239)' 'Lastreopsis glabella (Given 11847)' 'Lastreopsis hispida (Given 11819)' 'Lastreopsis hispida (Schneider sn)' 'Lastreopsis killipii (Altamirano 952)' 'Lastreopsis marginans (Kessler 14192)' 'Lastreopsis marginans (Kessler 14354)' 'Lastreopsis microsora (Coveny 9944)' 'Lastreopsis microsora (Gardner 5018)' 'Lastreopsis microsora (Kessler 14350)' 'Lastreopsis microsora (Kessler 14355)' 'Lastreopsis munita (Clarke & Pickard 1814)' 'Lastreopsis munita (Coveny 1303)' 'Lastreopsis munita (Coveny 1906)' 'Lastreopsis nigritiana (Thomas 8919)' 'Lastreopsis perrieriana (Rouhan 1318)' 'Lastreopsis perrieriana (Rouhan 1321)' 'Lastreopsis pseudoperrieriana (Rouhan 1319)' 'Lastreopsis pseudoperrieriana (Rouhan 1323)' 'Lastreopsis pseudoperrieriana (Rouhan 1325)' 'Lastreopsis pseudoperrieriana (Rouhan 1364)' 'Lastreopsis rufescens (Kessler 14341)' 'Lastreopsis rufescens (Kessler 14343)' 'Lastreopsis rufescens (Kessler 14347)' 'Lastreopsis silvestris (Kessler 14222)' 'Lastreopsis smithiana (Coveny 9951)' 'Lastreopsis smithiana (Kessler 14226)' 'Lastreopsis sp nov (Kessler 14345)' 'Lastreopsis subsericea (van der Werff 16118)' 'Lastreopsis subsimilis (Fay 4802)' 'Lastreopsis tenera (Kessler 14344)' 'Lastreopsis tenera (coll unkn)' 'Lastreopsis tinarooensis (Kessler 14340)' 'Lastreopsis tinarooensis (Van der Werff 17036)' 'Lastreopsis vogelii (Visa 2498)' 'Lastreopsis vogelii (Visa 3706)' 'Lastreopsis walleri (Kessler 14339)' 'Lastreopsis windsorensis (Kessler 14353)' 'Lastreopsis wurunuran (Kessler 14342)' 'Lastreopsis wurunuran (Kessler 14348)' 'Lomagramma matthewii (Wuzhisan 448)' Lomariopsis_marginata_GB 'Maxonia apiifolia (Moran 3541)' 'Megalastrum abundans (Schwartsburd 1631)' 'Megalastrum atrogriseum (Sundue 1779)' 'Megalastrum canacae (Grangaud 3)' 'Megalastrum connexum (Labiak 4260)' 'Megalastrum fugaceum (Jimenez 1203)' 'Megalastrum lanatum (Grangaud 6)' 'Megalastrum macrotheca (Christenhuzs 4181)' 'Megalastrum retrorsum (Labiak 4356)' 'Megalastrum subtile (Moran 7608)' 'Megalastrum vastum (Cornejo 8163)' 'Mickelia guianensis (Prado 2025)' 'Mickelia oligarchica (Smith 2236)' 'Mickelia pergamentacea (Sanchez 124)' 'Oenotrichia tripinnata (Kessler 14352)' 'Oenotrichia tripinnata (van der Werff 13809)' 'Olfersia cervina (Labiak 5220)' Phanerophlebia_nobilis_GB 'Pleocnemia irregularis (Sundue 2245)' 'Pleocnemia olivacea (WADE1991)' 'Pleocnemia presliana (Kuo 1955)' 'Polybotrya alfredii (Moran 7612)' 'Polybotrya andina (Moran 6729)' 'Polybotrya pubens (Moran 6063)' Polystichum_andersonii_GB Polystichum_munitum_GB 'Rumohra adiantiformis (Jansen & Rouhan 2550)' 'Rumohra adiantiformis (Kessler sn)' 'Rumohra adiantiformis (Prado & Hirai 2022)' 'Rumohra berteroana (Danton 1964)' 'Stigmatopteris ichtiosma (Moran 6752)' 'Stigmatopteris killipiana (Moran 6924)' 'Stigmatopteris lechlerii (Moran 6942)' 'Stigmatopteris sordida (Moran 6946)' 'Teratophyllum wilkesianum (Ranker 1937)' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M31542] TITLE Lastreopsid_rbcL; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1308; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Arachniodes aristata (Lorence 9314)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAAACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTCAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGCAGAGCCGTCTACGAATGCCTCCGCGGTGGACTTGATTTCACGAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCCTAGCTATCTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTGGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTAGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCCCGCGAAGGTAATGAAATTATT 'Arachniodes denticulata (Mynssen 549)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAAACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCATATGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTTTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCAGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGCTGTACAATCAAGCCGAAATTAGGTCTGTCTGCTAAGAATTATGGCAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGGGAAGTCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGCATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTGGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCAGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCCCGCGAAGGTAATGAAATTATT Arachniodes_rhomboidea_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAGGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTAACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGGGAGGAAAACCAGTATATTGCGTATGTAGCTTACCCCTTGGATCTATTCGAAGAAGGTTCTGTCACCAACTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGCAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTTTTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGCCATTACTTAAATGCTACTGCAGGTACGTGTGAGGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGGGGAGATCATATACACGCTGGAACTGTAGTAGGCAAGCTGGAGGGGGAACGAGACGTAACCTTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATATTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCCTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCCC-------------------- Arthropteris_altescandens_GB GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATAGATTGACTTATTACACCCCCGACTACCAAACCAAAGATACCGATATCTTAGCAGCATTTCGAATGACCCCACAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCCGCAGAATCCTCGACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACCAGTCTTGACCGTTATAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTGACCAATTTGTTCACCTCCATCGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCTCTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTTGAAAGAGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTGGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTT--AGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAATCTCAAGCTGAAACAGGGGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACATGTGAAGAGATGATGAAAAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTAACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGATAATGGACTGCTTCTTCACATTCACCGTGCGATGCACGCTGTGATTGATAGACAGCGAAATCACGGTATGCATTTTCGCGTATTAGCTAAAGCGTTACGTATGTCCGGCGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGATGTCACCCTTGGTTTTGTCGATTTACTTCGCGACGATTACATTAAAAAAGATCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTCTCTATGCCGGGTGTAATCCCCGTAGCTTCAGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATATTTGGGGACGATTCCGTATTACAGTTTGGCGGAGGAACCTTAGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCCCGTGAAGGTAATGAAATTATT 'Bolbitis acrostichoides (Fay 1068)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTCCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTAACTAGTCTTGATCGTTACAAGGGCCGATGCTACGACATAGAACCCGTCGCTGGGGAAGAAAACCAGTATATCGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCCGTTACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGTGCTTTACGCTTGGAGGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTAGCCGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACATGCGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTATCTGACCGGAGGGTTTACTGCAAATACCAGCTTAGCTTATTATTGTAGAGACAATGGATTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGGAATCACGGCATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGTCGTGGCGTATACTTCACGCAAGATTGGGTGTCTATGCCGGGTGTAATACCCGTAGCTTCGGGAGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTTGGTGGAGGGACCTTAGGACATCCTTGGGGAAATGCGCCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTTGCTCGCGAAGGTAATGAAATCATT 'Bolbitis auriculata (Fay 110)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGGGAGGAGAACCAGTATATCGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTTGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTAGCCGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACATGCGAAGAAATGTTGAAGAGGGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTCTATTGTAGAGACAATGGATTGCTTCTTCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGGAATCACGGCATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTGGGCAAACTAGAGGGGGAACGGGAAGTAACCCTGGGTTTTGTCGATTTACTTCGCGACGACTACATCGAGAAAGATCGTAGTCGTGGCGTATACTTTACACAAGATTGGGTGTCTATGCCGGGTGTAATACCCGTAGCTTCGGGAGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATGCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATCATT 'Bolbitis humblotii (Razafitsalana 115)' GGTTTTGGATTCAAGGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGGTATTAGAGACTGATATATTAGCAGCCTTCAGAATGACCCCACAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACTACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTGCTGGAGAAGACAACCAGTATATTGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCCGTTACCAATTTGTTAACCTCCATTGTAGGTAATGTCTTCGGATTTAAAGCTCTTCGCGCCTTACGCTTGGAAGACCTTCGAATTCCTCCTTCTTATTCTAAGACTTTTATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCGTTTATGCGTTGGAGAGATCGCTTTCTATTCGTAGCCGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCGGGTACATGCGAAGAAATGTATAAGAGAGCTCGTTTTGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTATTTATTGTAGAGACAATGGATTGCTTCTTCATATTCACCGTGCAATGCATGCTGTGATTGATAGACAACGGAATCACGGCATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTGGGCAAACTAGAAGGGGAACGAGAAGTAACCCGAGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAAGATCGTAGTCGTGGCATATACTTTACACAAGATTGGGTGTCTATGCCGGGTGTACTACCCGTAGCTTCGGGAGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAGATTTTCGGGGATGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAAGCTCGTAATGAGGGTCGCGATCTCGCTCGCGAAGGTAATGAAATCATT 'Coveniella poecilophlebia (Kessler 14303)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCTATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATGTACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Coveniella poecilophlebia (van der Werff 11478)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATGTACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT Ctenitis_eatonii_GB -----------------------------------ATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAAGAAGCTGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAACTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCTTTACGATTGGAAGACCTTCGAATTCCTCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAAGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACGATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGGCTTGATTTCACAAAGGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCGGAAGCTCTCTTCAAATCCCAGGCTGAAACAGGGGAAATCAAGGGGCATTACCTAAATGCCACTGCAGGTACGTGTGAGGAAATGTTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACTAGCTTAGCTTATTATTGTAGAGACAACGGACTGCTTCTTCATATTCATCGTGCAATGCATGCAGTGATCGATAGACAACGAAATCACGGTATGCATCTTCGTGTACTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACATGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTTGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGGATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAATTCGGTGGGGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGC---------------------------------------------------------- 'Cyclodium heterodon var. heterodon (Labiak 3996)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTATGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATAAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCTGGTGCGGTAGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATT 'Cyclodium rheophilum (Granville 15523)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAAGGCCGATGCTATGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTTGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAAGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGCTCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTTCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCTGGTGCGGTAGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATT Dryopteris_crispifolia_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACTAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCGCAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAAGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATT-TAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGCGGACTTGATTTCACGAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCACATTCACCGTGCTATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGAGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCCCGCAACGAGGGTCGCGACCTCGCCC-------------------- Dryopteris_fragrans_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTTAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCCGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATCCCCCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGCGGACTTGACTTCACGAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGGGAAATCAAGGGGCATTACTTAAATGCCACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTATTTTTGCTAGAGAGTTGGGTGTACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCACATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTCGGTGGGGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCCTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCCC-------------------- 'Dryopteris patula (Sundue 1104)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTACTATACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTATGACATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCATATGTAGCTTATCCTTTAGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCTTTACGCTTAGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATACGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTTACCGGAGGGTTTACAGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCCATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAACGAGGGTCGCGACCTCGCCCGTGAAGGTAATGAAATTATC Dryopteris_patula_GB --------------------------------TCGATTGACCTACTATACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCATATGTAGCTTATCCTTTAGATCTATTCGAAGAAGGTTCTGTCACCATAAAGTTCACCTCTATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCTTTACGCTTAGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATACGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCTTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCTTTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCCGAAGCTCTTTTCAAATCCCAGGCTGAAACAGG-GGAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACAGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCCATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAACGAGGGTCGCGACCTTGCCC-------------------- 'Dryopteris wallichiana (Labiak 4434)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAGGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGCGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAAGCCCAGGCTGAAACGGGGGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTTAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGCAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAACGAGGGTCGCGACCTCGCCCGTGAAGGTAATGAAATTATT 'Elaphoglossum amygdalifolium (Herrera 2063)' ---------------------------------------------TACACCCCCGAATACAAGAACAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAGCCCGGAGTACCGGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACATGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATAATTACAAGGGCCGATGCTACGATATTGAACCCGTTGCTGGAGAAGAAAATCAGTATATCGCATACGTAGCTTATCCTTTGGATCTCTTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTAGCCTTAGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATGGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATACGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTACGGTAAATCTAGCCACAATTGGGTCCGTGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTTATGCGTTGGAGAGATCGCTTCCTATTCGTGGCGGAAGCTCTTTTCAAATCTCAGGCTGAAACAGGAGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGAATAAGAGAGCTGTTTTCGCTAGAGAATTGGGCGCGCCAATTATCATGCATGACTACTTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCCCATTATGCTAGAGACAATGGGTTGCTTCTTCATATTCACCGTGCTATGCATGCTGTGATTAGTAGACAACGGAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACATGCCGGAACTGTAGTGGGTAAACTAGAGGGAGAACGAGAAGTAACCCTTGGTTTCGTTGATTTACTTCGTGACGATTATATTGAGAAAGATCGTAGTCGTGGTGTATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCTGTAGCTTCGGGAGGTATCCACGTATGGCACATGCCTGCTCTAACCGAGATATTTGGAGACGATGCCGTATTACAGTTTGGTGGAGGAACCTTAGGACATCCTTGGGGAAACGCGCCCGGTGCAGTCGCTAACCGAGTTGCATTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTTGCTCGTGAAGGTAATGAAATTATT 'Elaphoglossum decoratum (NYBG391/77B)' ---------------------------------------------TACACCCCTGAGTACAAGACCAAAGATACCGATATATTAGCAGCGTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCTGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATTGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGGTCTGTCACCAATCTGTTCACTTCCATTGTAGGTAATGTTTTCGGATTTAAAGCCCTACGCGCTTTACGCTTAGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTTATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTAGGATGTACAATCAAGCCAAAGTTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGTCTCCGTGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTTGTGGCGGAAGCTCTTTTCAAATCTCAGGCTGAAACAGGCGAAATCAAGGGACACTACTTAAATGCTACCGCAGGTACGTGTGAAGAGATGATGAAGAGAGCTGTTTTTGCTAGAGAATTAGGTGCACCAATTGTCATGCATGACTACTTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGCGCTATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGGATGTCCGGTGGAGATCATATACACGCCGGAACCGTAGTGGGTAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTTGATTTACTTCGTGACGATTATATTGATAAAGATCGTAGTCGTGGTATATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCTGTAGCTTCGGGAGGTATACACGTCTGGCATATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAACGAGGGTCGTGACCTTGCTCGTGAAGGTAATGAAATTTTT 'Elaphoglossum hybridum (FR6421)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCTGAGTACAAGACCTTAGATACCGATATATTAGCAGCGTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCTGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATTGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCTGTCACCAATTTGTTCACTTCCATTGTAGGTAATGTTTTCGGATTTAAAGCCCTACGCGCTTTACGCTTAGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACCTTTATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTAGGATGTACAATCAAGCCAAAGTTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGTCTCCGTGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTTGTGGCGGAAGCTCTTTTCAAATCTCAGGCTGAAACAGGCGAAATCAAGGGACACTACTTAAATGCTACCGCAGGTACGTGTGAAGAGATGATGAAGAGAGCTGTTTTTGCTAGAGAATTAGGTGCACCAATTGTCATGCATGACTACTTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGCGCTATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGGATGTCCGGTGGAGATCATGTACACGCCGGAACCGTAGTGGGTAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTATATTGATAAAGATCGTAGTCGTGGTGTGTACTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCTGTAGCTTCGGGGGGTATACACGTCTGGCATATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAACGAGGGTCGTGACCTTGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis acuminata (Coveny 10182)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis acuminata (Kessler 14227)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTGGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis acuta (Labiak 4913)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis amplissima (Labiak sn)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCACCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCAACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis amplissima (Prado & Hirai 2021)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCACCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCAACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis amplissima (Zardini 15991)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCACCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCAACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis barteriana (Carvalho 5780)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis boivinii (RG470)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis boivinii (Rouhan 1356)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis boivinii (Rouhan 1369)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis confinis (Liogier 25604)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATAAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis currori (Doursett-Lemaire 1906)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis currori (Fay 4804)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis decomposita (Kessler 14191)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACTTAATACACCCCCGAGT?CAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTGGA-TTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGC---------------------------------------------------------- 'Lastreopsis effusa (BP047)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGATTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCGAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis effusa ssp dilatata (Hernandez 1906)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATAAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis effusa ssp divergens (Villaroel 1597)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATAAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis effusa ssp divergens (Walker 10612)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATAAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis exculta ssp exculta (Moran 3239)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTGGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTTCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis glabella (Given 11847)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGGGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis hispida (Given 11819)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTATCTGACCGGGGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis hispida (Schneider sn)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTATCTGACCGGGGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis killipii (Altamirano 952)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis marginans (Kessler 14192)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis marginans (Kessler 14354)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis microsora (Coveny 9944)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis microsora (Gardner 5018)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis microsora (Kessler 14350)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTAGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis microsora (Kessler 14355)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis munita (Clarke & Pickard 1814)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis munita (Coveny 1303)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis munita (Coveny 1906)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis nigritiana (Thomas 8919)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis perrieriana (Rouhan 1318)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis perrieriana (Rouhan 1321)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis pseudoperrieriana (Rouhan 1319)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis pseudoperrieriana (Rouhan 1323)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis pseudoperrieriana (Rouhan 1325)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis pseudoperrieriana (Rouhan 1364)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis rufescens (Kessler 14341)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis rufescens (Kessler 14343)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis rufescens (Kessler 14347)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis silvestris (Kessler 14222)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis smithiana (Coveny 9951)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGGGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis smithiana (Kessler 14226)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGAC-TCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTCCCTATTCGTAGCAGAAGCTCTTTTCAA?TCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis sp nov (Kessler 14345)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACTAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis subsericea (van der Werff 16118)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis subsimilis (Fay 4802)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis tenera (Kessler 14344)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis tenera (coll unkn)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis tinarooensis (Kessler 14340)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis tinarooensis (Van der Werff 17036)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis vogelii (Visa 2498)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGTTTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTGGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis vogelii (Visa 3706)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGTTTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTGGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis walleri (Kessler 14339)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCTTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATGTACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTGGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis windsorensis (Kessler 14353)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTAGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis wurunuran (Kessler 14342)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACTAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTTGCTCGTGAAGGTAATGAAATTATT 'Lastreopsis wurunuran (Kessler 14348)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACTAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTTGCTCGTGAAGGTAATGAAATTATT 'Lomagramma matthewii (Wuzhisan 448)' ---------------------------------------------TACACCCCCGAATATAAGACTAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAAGAGAACCAGTATATCGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCTGTCACCAATCTGTTTACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCGCTACGCGCTTTACGTTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAACCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGGGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACCTGTGAAGAAATGTTGAAGAGAGCTATTTTCGCTAGAGAATTGGGTGCACCAAGGGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTAGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACCGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGATGATTACATTGAAAAAGACCGTAGTCGCGGTATATACTTCACCCAAGATTGGGTGTCTATGCCGGGTGTATTTCCTGTAGCTTCGGGAGGTATCCACGTTTGGCACATGCCAGCTCTAACCGAGATTTTTGGGGACGATTCCGTATTACAATTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATGAGATTATT Lomariopsis_marginata_GB ---------------------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCATTCCGAATGACCCCCCAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAGTCTTGACCGTTACAAGGGTCGATGCTACGACATAGAACCCGTCGCTGGAGAAGAAAACCAATATATCGCGTATGTAGCTTACCCCTTGGATTTGTTTGAAGAAGGTTCCGTCACCAATATGTTTACTTCTATTGTAGGTAACGTTTTTGGATTTAAGGCCCTACGTGCTTTACGTTTGGAAGACCTTCGAGTTCCCCCTTCTTATTCGAAAACTTTTATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTCTATTAGGATGTACAATCAAACCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGGGGACTTGATTTTACAAAAGATGATGAAAATGTGAATTCCCAGCCATTTATGCGTTGGAGAGATCGCTTCGTATTCGTAGCAGAAGCTCTTTTTAAAGCCCAGGCTGAAACAGGGGAAATCAAGGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCTGCTTTCGCCAGAGAGTTGGGTGCACCAATTGTCATGCACGACTATTTGACCGGAGGATTTACGGCAAATACCAGTTTAGCTTTCTATTGTAGAGATAATGGATTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTAGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACCTTGGGTTTCGTCGATTTACTTCGTGACGATTACATCGAAAAGGATCGTAAGCGCGGTATCTATTTCACCCAAGATTGGGTGTCTATGCCGGGTGTATTCCCGGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATATTTGGGGATGACGCCGTATTACAATTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCCGGTGCGGTAGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATT 'Maxonia apiifolia (Moran 3541)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAATGTTTTTGGGTTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGGAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAGATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTTAAGCGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGCAGAGATAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGCGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTTGCTCGTGAAGGTAATCAAATTATT 'Megalastrum abundans (Schwartsburd 1631)' GGTGTTGGATTTAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTGTCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCGGGGTTTCGTCGATTTGCTTCGCGACGATTTTATTGAAAAAGATCGCAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATT 'Megalastrum atrogriseum (Sundue 1779)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCGAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTCATTGTGAAGAAATGATGAAGAGAGCTGTCTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGCCGTGGTATTTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATA 'Megalastrum canacae (Grangaud 3)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGAACTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCCAAGACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTTGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACTGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCACGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCTTGTCCGGCGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGACGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTATGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGCGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGCAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCGCGTGAAGGTAATGAAATTATT 'Megalastrum connexum (Labiak 4260)' GGTGTTGGATTTAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTATACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAAGCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTATCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACTAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCGGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAAAAAGATCGTAACCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATGCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCCCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATT 'Megalastrum fugaceum (Jimenez 1203)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGCTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGCTACGTGTGAAGAAATGCTCAAGAGAGCTGTCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATT 'Megalastrum lanatum (Grangaud 6)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGAACTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCCAAGACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTTGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACTGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCACGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCTTGTCCGGCGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGACGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTATGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGCGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGCAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCGCGTGAAGGTAATGAAATTATT 'Megalastrum macrotheca (Christenhuzs 4181)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTCTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATTTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATA 'Megalastrum retrorsum (Labiak 4356)' GGTGTTGGATTTAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTATACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAAGCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTATCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACTAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCGGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAAAAAGATCGTAACCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATGCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCCCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATT 'Megalastrum subtile (Moran 7608)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCCTAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTCTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGACGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAACCGTGGTATTTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATA 'Megalastrum vastum (Cornejo 8163)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGCGAGCTGTCTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATTTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATA 'Mickelia guianensis (Prado 2025)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGGATGACCCCACAACCCGGGGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAAGAGAATCAGTATATCGCATATGTAGCTTATCCTTTAGATCTCTTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTTGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAACTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTCCGCGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATTAAGGGACATTACTTAAATGCTACCGCGGGCACGTGTGAAGAGATGTTGAAGAGAGCTATTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCACGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCCTATTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAAAGAAACCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACCGTAGTGGGTAAACTAGAGGGAGAACGCGAAGTAACCCGGGGTTTCGTCGATTTACTTCGTGACGATTATATTGAGAAAGATCGTAGTCGTGGTATATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTCCCTGTAGCTTCGGGAGGTATCCACGTCTGGCATATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAACGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCCTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCCCGTGAAGGTAATGAAATTATT 'Mickelia oligarchica (Smith 2236)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGACGATGCTACGATATCGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCATATGTAGCTTATCCTTTAGATCTCTTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCTCTACGTGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCTAAGACTTTCATTGGACCGCCTCATGGTATTCAAGTTGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTATCTGCTAAAAATTATGGTAGAGCCGTGTACGAATGCCTCCGTGGTGGACTCGATTTCACAAAAGATGATGAAAATGTAAATTCTCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACGTGTGAAGAGATGTTGAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGATTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTTCATATTCATCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACCGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTTGATTTACTTCGTGACGATTATATTGAGAAAGATCGTAGTCGTGGTATATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTATTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATGCCGTATTACAATTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGGAATGAGGGCCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Mickelia pergamentacea (Sanchez 124)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATACATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTCGACCGTTACAAGGGACGATGCTACGATATCGAACCCGTCGCTGGGGAGGAGAACCAGTATATCGCATATGTAGCTTATCCTCTGGATCTCTTTGAAGAAGGTTCTGTCACCAATTTGTTCACTTCCATTGTAGGTAATGTTTTCGGATTTAAAGCCCTACGCGCTTTACGCTTGGAAGACCTCCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTATGAATGCCTCCGCGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAACCATTCATGCGTCGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCCGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTCGCTAGAGAATTGGGCGCACCAATTGTCATGCATGACTACCTAACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTATTGTAGAGACAACGGGTTGCTTCTTCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTAGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACCGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGTGACGATTATATCGAGAAAGATCGTAGTCGTGGTATATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCTGTAGCTTCGGGAGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGAGACGATGCCGTATTACAGTTTGGTGGAGGAACCTCGGGACATCCTTGGGGAAATGCACCCGGTGCGGTTGCTAACCGAGTTGCGTTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATT 'Oenotrichia tripinnata (Kessler 14352)' GGTGTTGGATTCAAAGCCGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCACCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Oenotrichia tripinnata (van der Werff 13809)' GGTGTTGGATTCAAAGCCGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCACCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Olfersia cervina (Labiak 5220)' GGTGTTGGATTCAAAGCCGGTGTCAAAGATTATCGACTGAACTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTTATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCACGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCAATGCACGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATT Phanerophlebia_nobilis_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAGTCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGCCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGGGAAGAAAACCAATATATCGCGTATGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCCAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGCGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGAGAAGTAAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGGCAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCTTTACGCATGTCCGGTGGTGATCATATACACGCCGGAACTGTAGTAGGTAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTGCAGGCTCGTAATGAGGGTCGCGACCTTGCTC-------------------- 'Pleocnemia irregularis (Sundue 2245)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTACCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGGCCGCCTCATGGTATTCAGGTTGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAACGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTATTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGCTTTACCGCTAATACCAGCTTAGCTATTTATTGTAGAGACAATGGGTTGCTCCTCCATATTCACCGTGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCACATACACGCTGGAACTGTAGTAGGAAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCGTTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Pleocnemia olivacea (WADE1991)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACAGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTACCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGGCCGCCTCATGGTATTCAGGTTGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAACGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGCTTTACCGCTAATACCAGCTTAGCTATTTATTGTAGAGACAATGGGTTGCTCCTCCATATTCACCGTGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCACATACACGCTGGAACTGTAGTAGGAAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCGTTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Pleocnemia presliana (Kuo 1955)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTACCCTTTGGATCTCTTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTAAGAGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGGCCGCCTCATGGTATTCAGGTTGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAACGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACGGGAGGCTTTACCGCAAATACCAGCTTAGCTATTTATTGTAGAGACAATGGTTTGCTCCTCCATATTCACCGTGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCACATACACGCTGGAACTGTAGTAGGAAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCGTTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Polybotrya alfredii (Moran 7612)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCTCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACTGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCAATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAACGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTCCAGGCTCGTAATGAAGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATT 'Polybotrya andina (Moran 6729)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCAATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTCCAGGCTCGTAATGAAGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATT 'Polybotrya pubens (Moran 6063)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCCCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCA{AT}GCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCAGCTTAGCTTATTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCAATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAAGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATT Polystichum_andersonii_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTATGACATCGAACCCGTCGCCGGGGAAGAAAACCAATATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCTATCGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGCGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGAGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAGGAAATGTTGAAGAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGTAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGGCAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGTAAACTGGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTCGGTGGAGGAACCTTAGGACATCCTTGGGGAAACGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTC-------------------- Polystichum_munitum_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTATGACATCGAACCCGTCGCCGGGGAAGAAAACCAATATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCTATCGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGCGGACTTGA-TTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGAGAAATTAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAGGAAATGTTGAAGAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGTAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGGCAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGTAAACTGGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAACGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTC-------------------- 'Rumohra adiantiformis (Jansen & Rouhan 2550)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGAGACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAATCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCCGTCACCAATATGTTAACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGTGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAGGCTCTTTTTAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGCGAAGAAATGCTCAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCACCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAGCGAGAAGTAACCCTGGGTTTCGTCGATTTGCTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGATGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Rumohra adiantiformis (Kessler sn)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAATCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAGAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAGGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCACCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAGCGAGAAGTAACCCTAGGTTTCGTCGATTTGCTTCGCGATGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGTGGTATCCATGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGATGATTCCATATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Rumohra adiantiformis (Prado & Hirai 2022)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAATCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTAACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAGGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCACCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTGCTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGATGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGCAATGAAATTATT 'Rumohra berteroana (Danton 1964)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAATCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAGGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCACCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAGCGAGAAGTAACCCTGGGTTTCGTCGATTTGCTTCGCGATGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGATGATTCCATATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Stigmatopteris ichtiosma (Moran 6752)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACTCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCTTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCCGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTATAAGGGCCGATGCTACGACCTTGAACCCGTCGCTGGAGAGGAGAACCAGTACATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATATGTTAACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAAAGAGCTGTTTTTGCTAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCTCCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTACTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCAGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGACGATTACATTGAAAAAGACCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCCATGCCAGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGATGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Stigmatopteris killipiana (Moran 6924)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACTCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCTTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCCGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACCTTGAACCCGTCGCTGGAGAGGAGAACCAGTACATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTTACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGAGAAATCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGTTGAAAAGAGCTGTTTTTGCTAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCTCCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCCGTAATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTACTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCAGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGACGATTACATTGAAAAAGACCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCCATGCCAGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGATGATGCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Stigmatopteris lechlerii (Moran 6942)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACTCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCTTTCAGAATGACCCCACAACCTGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCCGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACCTTGAACCCGTCGCTGGAGAGGAGAACCAGTACATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATATGTTAACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAAAGAGCTGTTTTTGCTAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCTCCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTACTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCAGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGACGATTACATTGAAAAAGACCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCCATGCCAGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGATGATGCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Stigmatopteris sordida (Moran 6946)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACTCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCTTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCCGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACCTTGAACCCGTCGCTGGAGAGGAGAACCAGTACATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTTACAAAAGATGATGAGAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGAGAAATCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGTTGAAAAGAGCTGTTTTTGCTAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCTCCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCCGTAATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTACTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCAGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGACGATTACATTGAAAAAGACCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCCATGCCAGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGATGATGCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT 'Teratophyllum wilkesianum (Ranker 1937)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACTAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCGCTACGTGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAGACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACGTGCGAAGAAATGTTGAAGAGAGCTATTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTTACCGGAGGATTTACCGCAAATACCAGCTTAGCTTATTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGGAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCACTACGCATGTCCGGTGGAGATCATGTACATGCCGGAACCGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAAGATCGTAGTCGTGGTGTATACTTCACCCAAGATTGGGTGTCTATGCCGGGTGTACTTCCTGTAGCTTCGGGAGGTATCCACGTTTGGCACATGCCAGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAATTTGGTGGAGGAACATTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATGAGATTATT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M31541] TITLE Lastreopsid_DNA_data_concatenated; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3236; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Arachniodes aristata (Lorence 9314)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAAACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTCAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGCAGAGCCGTCTACGAATGCCTCCGCGGTGGACTTGATTTCACGAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGTTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCCTAGCTATCTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTGGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTAGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCCCGCGAAGGTAATGAAATTATTATTACTCCCGCAAAGCTTAGTGATCATTTATCAAATTTTCAA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAATGG--AAA-CCTAAGCAAAGGAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATCTAGCTTGTTCCCCTTTC-GGAACAGAAATTAAACCATAA---T-TTT------C--------TTACTT-----TACAAAA--------ATATTCTACCTTCGAGCAAATTAATTTGGTACACGATG------AAGTATCTAA-------ATTACTCGTCCACATCACTCCAACTAAATTCCC-----GCCGAGGGATTACCTATT----CCCATTGCTTCTACTGAGATAGTCCTTCGGCTTCTTT------GAAG-TTGGATGACTTG-----ATTTGAAAT--------------CCCGTCTCTTTCAA----ATCGGCAATTTAGCTAGATTTCGATATGAAGGGGTAGGG---GATAAAACTTCGGGTAGGTAGAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCCTGTACTTCGGAAGTCGTACCGGTTGATGACGAAGCGGAATTATTCTGGTACGCAAAAAACTTGGGACG------ATTCCGGAAAGAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAGGGA----AATCCAAGCTCGGAAGTTGCGGGTGGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTTTTCTATCTTT--TGGTTAAACAGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAAGTAGAAATAAAGAACGAAGTAAAT---GAAGAAAGAAATTGGTGAAACTAATTCT---------TTTTCTCAAGGGATCATCTAAG-AAGTGTATCCATG-CTATGCGACCAAAACGTAGGCAAGACTGACATAGATTTTATGGACGCCATTTCCTAAAA-TTGGGACGG-CTCCCTCCTCTCC-----GAACGGGGGGAAA--AGAAGGAAGCCCCAATATATTCTGATGT---GGAAGAAGTATCGATCCCC------AGTAATTTTT-ATATATG----CCCTCTTCCC-----------TTAAAACAAGGG---AGACAGTCC--AC-CCA----TTTCTTGATT--GTTCTATCTAACC-------AAATATATGCAGACGAATTC-TCGACCAGTTTTGT------------AC----TATTTAGCCTTCCTTGACTTCCATAAAGGAGCCGAATGGGCGGAAACCTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTAGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCTAAG-----AACCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAGTTGTTTAGATCCACATAATTTG--------CCAAAATACGGAAACCGTTTCAAACTTCTTCTCCGTCT-GG----TCCCTCGAAAGCAGTTTGCAAGTGAGCCATTCAGGCTT----CTAA----TATGCATGAATGGCTCAATCTAGTCCCCCCA----------GAATTTA-----TCTACTACAAGCGATATTGTATCAAGCATATCGACAGAAGCGAGATCAACGATTTGACTAGGTAAG--AAACTAGAGTTGAAAAATATACTTAACTGATTTCTAGTTAAATTTTATCCAT-AAATGA 'Arachniodes denticulata (Mynssen 549)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAAACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCATATGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTTTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCAGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGCTGTACAATCAAGCCGAAATTAGGTCTGTCTGCTAAGAATTATGGCAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGGGAAGTCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGCATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTGGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTATATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCAGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCCCGCGAAGGTAATGAAATTATTATTACTCCCGCAAAGCTTAGTTATCATTTATCAAATTTATAA-TTTAATCAAAT-----AATT-------------TGGAGATCTCTACAATGA--AAA-CCTAAGCAGGGGAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGACAGAAGTTTTTTGATCTAGCCTGTTCCCCTTCT-GGAGCGGAAATTAAACCATAA---T-TTT------T--------TTACTT-----CACAAGA--------ATATTCTACTTCTGAGCAAATTAATTTGGTACACGATG------AAGTATCTAA-------ATTACTCGTCCACATCACTTCAACTAAATTCCT-----ACCGAGGGATTACCTATT----CCTCTTGCTTCTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACTCCA---GCCCGTCTCTTTCGA----ATCGGCAATTTAGCTAGATTTCAATATGAAGGGGTGAAA---GAGAAAACTTCGGGTAGGTAAAAATAGAGGAAGGAAAGGGAGGGATTTGCGTCATTCCCGTTACTCCCGTACTTCGGAAGTCGTACCGGTTGATGACGAAGCGGAATTATTCTGGTACGCAAGAAACTTGGGACG------ATTCCAGAGAGAGGAAAAATTGCGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAGATA----AATCCAAGCTCGAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTTTTCTATCTTT--TGGTTAAACAGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAAGTAGAAGTAAGGAACGAAGTAAGT---GAAGAAAGAAATTGGTGAAACTAATTCT---------TTTTATCGAGGGATCATCTAAG-AAGTGTATCCATG-CTATGCAACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACGCCATTTACTAAAA-TTGGGGTGG-TTCTCTCCTCCCC-----GAACGGGGAGAAT--GGAAGGAAACCCCGATATATTCCGATGT---GGAAGAAGTATCGATCCCC------AGTAATTTTT-ATATATG----CCCCCTTCGT-----------TTAAAACAAGGG---AGACAGTCC--AC-CCG----TTTCTTGATT--GTCCCATTTGACC-------AAAAATATGCAGACGAATTC-TTGACCAGTTTTGT------------AC----TATTTAGTCTCCCTGGACTTCCATAAGGGAGCCGAATGGGCGGAAACCTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGGTGTAGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCTAAA-----AATCCCGA-AGCC----CTAGTCGAGTTAACCCCTTCATCCATGGATCGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAACCTGTAGTTGTTTGGATCCATATAATTTG--------TCAAGATACGGAAACCGCTTTAAACTTCTTCTCCGTCT-GG----TCTCTCGAAAGCACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCA----------TAATTTA-----TTTACTACAGGCGATATTGTATCAAGCATATCGATGAAAGCGAGATCGACGATTTGACTAGGTAAA--AAACTAGAGTTGAGAAATATACTTAACTGATTTCTAGTTAACTTCTATCCGT-AAATGA Arachniodes_rhomboidea_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAGGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTAACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGGGAGGAAAACCAGTATATTGCGTATGTAGCTTACCCCTTGGATCTATTCGAAGAAGGTTCTGTCACCAACTTGTTCACCTCCATTGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGCAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTTTTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGCCATTACTTAAATGCTACTGCAGGTACGTGTGAGGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGTATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGGGGAGATCATATACACGCTGGAACTGTAGTAGGCAAGCTGGAGGGGGAACGAGACGTAACCTTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATATTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCCTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCCC---------------------------------------------------------------TTTAATCGAAT-----AAAT-------------TGGAGGTCTCTACAATGA--AAA-CCTAAGCAAGGGAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATATAGCTTGTTCCTTTTTC-AGAGCAAAAATTAAACCATAA---T-CTT------C--------TTACTT-----CATGAAA--------ATATTCCACTTTTGAGCAAATTAATTTGGTACACGATG------AAGTATCTAA-------ATTACCCGTCCACATCACTTCAACTAAATTCCC-----ACCGAGGGATTACCTATT----TCTGTCGCTTTTACCGAGATGGTTCTTTGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAATCCCAACTCCA---GCCTGTCTCTTTCAA---------------------------------------------------------------------------------------------TGCGCCATTCCCGTCACTCCTGTACTTCGGAAGTCGTATTGGTTAATGACGAAGCGGAATTATTCTGGTACGCAAAAAACTTGGGACG------ATTCCAAAAAGAGGAAAATTTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTAACTGAACCTTGGGATAGA----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTTTTTTACCTTT--TGGTTAAACAGTAACAATTGCTTCCGACTCGGTGAGAAATATTCTCCTAAGGATTGTTGAAAGTAGAGATAAAGAACGAAGTAAGT----AAGAAAGAAATTGGTGAAACTAATTCT---------TTTTCTCGAGGGATCATCTAAG-AAGTGTATCCATG-CTATGCGACCAAAACGTAGGCGAGACTGACATAGATTTTATGGACGCCATTTACTGAAATTTGGGGCGG-CTCCCTCCTCTCT-----GAACGGGGGAGGGGAATAAGGAAGTCCCAATATATTCCGACGT---GGAAAAAGTCTTGATCCCC------AGTAATTTTC-ATATACG----CCCCCTTCGT-----------TTGAAACAAGGG---AAACGGTCC--AC-CCA----TTTCTCGACT--GTTCCATTTAACC-------AGATATATGCAGACGAATTC-TCGACCAGTTTTGT------------AC----CATGTAGCCTTCCTTGACTTCCATAAGGGAGCCGAATGGGCGGAAACCTCCATGTTCGGTTCTGAATTAGCGACGTTATAA-CCATTTGTTGTAGTC-ACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCAAG-----AATCC-----------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTCTCTGTCTGGG----TCTCTCGAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----CTAA----TATGCATGAATGGCTCAATCTAGTCCTCCCA----------CAATTTA-----CCTACTACAAGCGATATTGTATCAAGCATATCGATAAAAGCGAGATCAACGATTTGACTAGGTAAG--AAACTAGAGTTGAGAAATGTACTTAACTGATTTGTAGTTAACTTCTAT----------- Arthropteris_altescandens_GB GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATAGATTGACTTATTACACCCCCGACTACCAAACCAAAGATACCGATATCTTAGCAGCATTTCGAATGACCCCACAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCCGCAGAATCCTCGACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACCAGTCTTGACCGTTATAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTGACCAATTTGTTCACCTCCATCGTAGGTAATGTCTTTGGATTTAAGGCTCTACGCGCTCTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTTGAAAGAGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTGGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTT--AGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAATCTCAAGCTGAAACAGGGGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACATGTGAAGAGATGATGAAAAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTAACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGATAATGGACTGCTTCTTCACATTCACCGTGCGATGCACGCTGTGATTGATAGACAGCGAAATCACGGTATGCATTTTCGCGTATTAGCTAAAGCGTTACGTATGTCCGGCGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGATGTCACCCTTGGTTTTGTCGATTTACTTCGCGACGATTACATTAAAAAAGATCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTCTCTATGCCGGGTGTAATCCCCGTAGCTTCAGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATATTTGGGGACGATTCCGTATTACAGTTTGGCGGAGGAACCTTAGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCCCGTGAAGGTAATGAAATTATTATTACTCCCGCAAAGCCTAGTAATCATTT-------------------------------------------------------------ATGA--AAA-TTTAGGCAAAAGGC----TTGGGATGATAGAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTTGCACGAGTTTTTTGGTTTAGCTTGTTCTTTTTTT-TGAGCATAATTTAAATCATAA---T-TCT------T--------TAACTTTCAAATATAGAA--------ATATTTGACTTTTGACCCAATTAATTTGGTGCACGATGGAATGCAAGTATCTGA-------ATCAACTGTCTATGTCACTTTAACTAAATTGTTAATCAACCGAAGGATTACCCATT----------GTTCGTAGTGAGATGGTCCTTCGGCTTTTTT------ACAG-TTGTATGACTTA-----ATTTGAAACCCCGATTCTA---GCCTGTATTTTTTGA----ATCGACAATTTAGCTAGATTTCATTACGAATAAACAAAG------ATAACTT-GGGTAGGCAAAAATAAAGAAAGGAAAGGGAGGG-----------------------------TCGAAAGTCGTACCGCTTAGTAACGAAGCAGGATTATTTAGGTCTGCAAAAAACTTAGGACGCCTCCAAGTCCAAAAGGAGGAAAAATTAGGAATCTATGGGTAAACATCTAAAATATTTGTCTTATCGTCACTGAACCGTGGAAAAAAAAAGAATCCAAGCTCGAAAGTTCTAACTAGATGAATCTTGGTTTATCAGGATTATCAAGTCAAGGAC-------TGTTT--TGGCTAAGCAGCAGCAGTTGCTTTCGACTCGGTGAGAAATATTTCCCTAAAGATTTT---GAGTAAAAATAAAGAACGAAGTAAATTAGAAAAAAAAAGAGTGATGAAACTA---------CTTTTTTCCTTCAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGACTAAAACGTAAGTAAGACTGACATAGATTTTATGGATGACGCTTACTCAAA-TTGGGCCGG-TTTTCTGTTCTTC-----GAACAGGAGATAAAAAAAAGACCCGACTTTCTTTTTTCGATATGGAGGAGGAAGCCTCGATCCTCATA-AAAAGAATTTTG-ATATATG----CCTCCTTTAA-----------AGAAAGCAGGGG---AGACGATTC--AC-TTATCTTTCTTTTTATT--GTTCCATTTACCT-------AAACAAAT-------------TATACCAGTTTTGT---------------------TTAGCTTTACTTTCTCTCCATAAAGGAGCCGAATGGGCGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTCATGA-TCAGCTGCCGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTATCCGCTGTTGATACGATACTAAGAAT-CCGG-AGCCCCAGCTAACTCAATTAAGCCCTTCACTTATAAATTGCGTCGTGAACAAACAAGAACTTTAGTTTGTTCACGAT-TTGCTAACTAATCCGTCG-------------------TTGCTCATA-AAAGCAATACATAAACC--TTTCAACTCTTTTTGCCCCT-GG----ATTTTCAAAAAGAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TAGGCATGAATGGCTTAGTTGACCCCCCTC-----------TACTATA-----TTTTTTACAAGCGCTATT----------------TTAAAGCGAGATCAACAATTTAACTAGGCAAA--AAACTGGAGTTGAAGCAGATACTTAGCTGATTGATAGTTCAGTTTTATACGT-AAGTGA 'Bolbitis acrostichoides (Fay 1068)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTCCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTAACTAGTCTTGATCGTTACAAGGGCCGATGCTACGACATAGAACCCGTCGCTGGGGAAGAAAACCAGTATATCGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCCGTTACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGTGCTTTACGCTTGGAGGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTAGCCGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACATGCGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTATCTGACCGGAGGGTTTACTGCAAATACCAGCTTAGCTTATTATTGTAGAGACAATGGATTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGGAATCACGGCATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGTCGTGGCGTATACTTCACGCAAGATTGGGTGTCTATGCCGGGTGTAATACCCGTAGCTTCGGGAGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTTGGTGGAGGGACCTTAGGACATCCTTGGGGAAATGCGCCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTTGCTCGCGAAGGTAATGAAATCATTATTACTCTCGCAAAGCTTAGTGATCATTTATTAAATAATCAA-TTTAATAAGAT-----AAAT-------------TATAGGTCTATACAGTAG--AAA-CCTAAGCGACGGAC----TCGGGATACTGATATTT------------------AATAAGCAGG-----TTACTT-AAGAAATGATGAAAGTTTATCGGTCTAGCTTGTTTCTTTTTC-GACGCAGAAGTTAGATCATAG---T-TTT---------------TTAATT---TATATAAAA--------ATATTCCATTTCCGATCAAATTAATTTGGTACATGATG------AGGTATCTAA-------ATTAACCGCCTACGTAATTTCAGATAAATTTCCAATCAACAGAGAGATTACTAATT----TTTGATGCTTCTACTGAGATAGTCCCTCGGCTTCTTCGGA---GTAG-TTGCACGACTTG-----ATTTGAAATCGCGACTCCAGCCGCCCGCCTTTTTCGA----ATCGGAAATTTAACTAGATTTCGACGTAAGAAGAGAGAG------ACAACCTAGAGTAGGTAGAAATATAAAAAGGAAAGGGAGGGATT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGGA-AGCAAGATATGTAAGACACCTTAATTTC-TTATTTGTCT-GG----TCCTTTGAAAACAGTTTGCAAGTGAGCCATTCATACTT----CTAA----TATGCATGAATGGCTCGATCTAGCCCCCCCCTTCTATACTTTACTGTA-----TTGCTTATAAGCAATATTGTATCAAACATATGGATAAAAGTGAGATCAGCGGTTTAACTAGGTAAA--AGACTAAAGTTGAGAAATATACTTAATTGATTTCTAGTTAACTTATATCCAT-AAATAA 'Bolbitis auriculata (Fay 110)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGGGAGGAGAACCAGTATATCGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTTGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTAGCCGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACATGCGAAGAAATGTTGAAGAGGGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTCTATTGTAGAGACAATGGATTGCTTCTTCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGGAATCACGGCATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTGGGCAAACTAGAGGGGGAACGGGAAGTAACCCTGGGTTTTGTCGATTTACTTCGCGACGACTACATCGAGAAAGATCGTAGTCGTGGCGTATACTTTACACAAGATTGGGTGTCTATGCCGGGTGTAATACCCGTAGCTTCGGGAGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATGCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATCATTATTACTCTCGCAAAGCTTAGTGATCATTTATTAAATAATCAA-TTTAATAAAAT-----TAAC-------------TAGAGGTTTACACAATGA--AAA-CCTAAGCAACGGAC----TTGGGATACCGATATTT------------------AATAAGCAGG-----TTACAT-AGAAAATGGTAAGAGTTTATCGGTTTAGCTTGTTTTC------GAAGCAAAAATTAGAGCATAG---CCTT----------------TTAATT---TATATAGAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACATGATG------AAGTATCTGA-------ATTAACCGCCTACCTCATTTCAGCTCAATTTCTAATCAACAGATGGATTACTAATT----TCTGATGCTTCTACTAAGATAATCTCTCGGCTTCTTCGGA---GTAG-TTGCACGACTTG-----ATTTGAAGCCGCAACTCCAGCCGCCCGTCTCTTTCAA----ATCGAAAATTTAACTAGATTTCGGTGGAAAAAGAGAGAGAGAGAGGTAACCTCGGGTAGATAGAAATATAAAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTGTGAATCCGCATAATTTAATTGGA-AGCAAAATATGTAAACCACCTTAATT---TTGTTTGTCT-GA----TCTTTCGAAAACACTTTGCAAGTGAGCCATTCATACTT----TTAA----TATGCATGAATGGCTCGATCTAGACCCCCCCTT-TATACTTTACTTCA-----TTTCCTACAAACAATATTGTATTAAACATATGGATAAAAGTGAGATCAGCGGTTTAACTAGGTAAA--AGACTAAAATTGAAAAATATACTTAATTGATTTCTAGTTAACTTATATCCAT-AAATAA 'Bolbitis humblotii (Razafitsalana 115)' GGTTTTGGATTCAAGGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGGTATTAGAGACTGATATATTAGCAGCCTTCAGAATGACCCCACAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACTACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTGCTGGAGAAGACAACCAGTATATTGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCCGTTACCAATTTGTTAACCTCCATTGTAGGTAATGTCTTCGGATTTAAAGCTCTTCGCGCCTTACGCTTGGAAGACCTTCGAATTCCTCCTTCTTATTCTAAGACTTTTATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCGTTTATGCGTTGGAGAGATCGCTTTCTATTCGTAGCCGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCGGGTACATGCGAAGAAATGTATAAGAGAGCTCGTTTTGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTATTTATTGTAGAGACAATGGATTGCTTCTTCATATTCACCGTGCAATGCATGCTGTGATTGATAGACAACGGAATCACGGCATGCATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTGGGCAAACTAGAAGGGGAACGAGAAGTAACCCGAGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAAGATCGTAGTCGTGGCATATACTTTACACAAGATTGGGTGTCTATGCCGGGTGTACTACCCGTAGCTTCGGGAGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAGATTTTCGGGGATGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAAGCTCGTAATGAGGGTCGCGATCTCGCTCGCGAAGGTAATGAAATCATTATTACTCTCGCAAAGCTTAGTGATCATTTATTAAATAATCAA-TCTAATAAAAT-----AGAT-------------TAGAGGTCTATACAATGA--AAA-CCTAAGTAACGGAC----TTAGGATACTGATATTT------------------AATAAGCAGG-----TTACTC-AGTAAATGGTAGAATTCTCTCGGTCTAGCTTGTTTCTTTATC-GAAGCAAGAATTAGAGCCTAG---C-TCT---------------TTAATC---TATATAAAA--------AAGTTCTATTTTTGATCAAATTAATTTGGTACATGATG------AAGCATCTTA-------ATTAACTGCCTAGACCATTTCAGCGAAATTCCTAATCAAGGGAGGGATTAGTAATT----TTTAATGCT------AAGATAGTCCCTCGGCTTCTTCGGA---ATAG-TTGCACGACTTG-----GTTTGAAATCACGACTCCAACCGCCCGTCTTTCTCAG----ATTGGAAATCTAACTACATTTCGAAGGAAAAGGAGAAAGAGAAAGACAACCTCGGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTATGAATCCGCATAATTTAGTCGGA-AGCAAAATATGCAAACCACCCTAATT---CTGTTTGTCT-GG----TCTTTCGAAAACAGTTTGCAGGTGAGCCATTCATACTT----TTAA----TATACATGAATGGCTCGACCTAGCCCCCTCTA---------TACTTTA-----TTTGCTACAAGCAATATTGTATTAAACATATGGATAAAAGTTAGATCAGCGGTTTAACTACGTAAA--AGACTAAAGTTGAGAAAAGGAAATAATTGATTTCTAGTTAGCTTCTATCCAT-AAATAA 'Coveniella poecilophlebia (Kessler 14303)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCTATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATGTACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATTATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACTCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCG-CGCTCCCGT-ACTC-TGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAAGAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATAGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTCTTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATATAAAGTAATTTTG-ATATACG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGC----------------------------------------------------------------------------------------------------------------------------------------GGATCCGCATAATTTGTTCGGA-AACG-AATACATAAACCACTTTCATTTA-TTTTTTGTCT-GTG--GTCTTTCGAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTTCACACTTCGCTTTA-----TTTACCACAAGCGATATTACATTAAACATATTAGTAGAAGCGAGATCAACGGTTTGACTAAGTAAA--AAACTAGAGTTGAAGGATATACTTAACTGATTTCTAA-TAACTTTTATTTGT-AAATGA 'Coveniella poecilophlebia (van der Werff 11478)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATGTACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATTATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACTCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAAGAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATAGGGCAG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTCTTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATATAAAGTAATTTTG-ATATACG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTG?TGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCC----CTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG-TGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACATAAACCACTTTCATTTA-TTTTTTGTCT-GTG--GTCTTTCGAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTTCACACTTCGCTTTA-----TTTACCACAAGCGATATTACATTAAACATATTAGTAGAAGCGAGATCAACGGTTTGACTAAGTAAA--AAACTAGAGTTGAAGGATATACTTAACTGATTTCTAATTAACTTTTATTTGT-AAATGA Ctenitis_eatonii_GB -----------------------------------ATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAAGAAGCTGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAACTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCTTTACGATTGGAAGACCTTCGAATTCCTCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAAGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACGATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGGCTTGATTTCACAAAGGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCGGAAGCTCTCTTCAAATCCCAGGCTGAAACAGGGGAAATCAAGGGGCATTACCTAAATGCCACTGCAGGTACGTGTGAGGAAATGTTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACTAGCTTAGCTTATTATTGTAGAGACAACGGACTGCTTCTTCATATTCATCGTGCAATGCATGCAGTGATCGATAGACAACGAAATCACGGTATGCATCTTCGTGTACTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACATGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTTGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGGATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAATTCGGTGGGGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGC----------------------------------------------------------ATTACTCCCGCAAAGCTTAGTGATCATTTATTAAATTAATAA-TTTAATCGAAG-----AAATTAATCAGAAAAAATGGAGGTCTCTGCAACGG--AAA-CCTAAGCAAAGGAC----TTGAGATGATGAAATTC------------------AATAAGCAGA-----TTATTT-AGGAAGTGGTAAAAATTTTTTGATCTAGCTTGTTCCTTTTTT-GGGGCAAAAATTAAATCATAATAAT-------------------TTACTT-----CATAGAA--------ATATTCTACTTATGAGCAAATTAATTTAGTACCC--TG------AAGTATCTGA-------ATTACCCGTCCACATTACTTCAACTAAATTCGT-----ACCGAGGGATTACCTATTTATCCTTATTGCTTCCATTGAGATGATCCTTCGGCTTCTCT------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACTCCA---GCCCGGCTTTTTCAA----ATCGGCAACTTAGCTAGATTCCGATGGGGGAAGTTGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATTCGCATAATTTATTCAGA-AGCAAAATACGAAAACCATTTCAAAATTTTTTT-------GG----TCTTCCGAAAACAGTTAGCAAGTGAGCCATTCAGGCTT----CTAA----TATGCATGAATGGCTCAGTCTGGCCCCCCCCCA--------TACCTTA-----TTTACTACAGGCAATTTTGCATCAAACATATCGATAAAAGCGAGATCAACAATTTAACTAGGTAAA--AAACTGGGGTTGAAAAATATACCTAACTGATTTCTAATTAACTTTTATCTAT-AAATGA 'Cyclodium heterodon var. heterodon (Labiak 3996)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTATGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATAAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCTGGTGCGGTAGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATTATTACTCCCGCAAAGCTTAGTGATCATTTATTAAATTTTTAA-TTTAATCAAAT-----AATT-------------TGGAGGTCTTTAAAATAAAGAAG-CCTAAGCAAAGGGC----TTGAAATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGCAAGATTTTCTCGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATAACAA---T-TCT-----CTATCTCTACTTACTT-----CAAAAAG--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACGATA------AGGTATCCGA-------ATTACCCGTCCGCGTCACCTCAAATAAGATCCTGATCAACCGAGGCATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAACCCCGATTCTA---GCCTGTCCTTTTCAA----ATCGGCAATTTAACTACATTTTTAGAAGAAGGAGGAGG-------ATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTCACTCTTGCACGTCGAAAGTCGTACCGGTTAATGACGAAGCGGGATTATTTTGGTATGCAAAAAACTTAGGACG------ATTTCAAAAAAAGAAAAAATTAGAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGTAGAA----AATCCAAGCTCAAAAGTTGCAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCAG-------GTTAT--TGGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTGCCTAAGGATTCTTGGAAGTAGAAATAAAGAACGAAGTAAAT----GAAAAAGAGATTGTTGAAACTA----------CTTCCTTTTTCGAAGGATCATCTAAG-AAGTATATCCCTG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATCTTATGGAAGCCATTTATTGAGA-TTGGAGAGG?TTCTCTCCT?TTC-----GAACGAGGGAAAGGGGGGGGGGG----CCATTTAATCCAATAT---GCGGAAAGCCTCGATCCCCATA-AAAGTAATCTTG-CTATACG----CTCCTTTCGC-----------TTGAAACAGGGG---ATGCGATCC--GC-CCA----TCTTTTGATT--GTTCCATTTTACT-------AAGTATATGCAGACAAATTC-TCCCCCAGTTTTGT------------ACTATGTATGTAGCCTTGCTTTATTTCCATAAGGGAGCCAAATGGGCGGAAACCTCCATGTTCGGTTCTGAATTAGCGGCGTCACAA-CCATTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTTATGATACTAAA-----AATACTGG-AGCC----CTAATCAAGTTAACCCCTTCACCCGCGGATTGGGTCGTGAACAAACTGGAGTTCTCGTTTGTTCACGAT-TTGATAACTAATCTATAA---------------TAATTTGTTCAGA-ACCAATATATGGAAATCGCTTCAAACT--TTTTTTTTCT-GG----TATTTCAAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCCTCCCA-----TACTTTA-----TGTTCTACAAGCGATATTGTATAATATATATTGATATAAGCGAGATCAACGATTTGACTAGGTAAA--GAGCTAGAGTTGAAAAATACACTTAACTGATTTCTAGGTAATTTTTATCCAC-AAATGA 'Cyclodium rheophilum (Granville 15523)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAAGGCCGATGCTATGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTTGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAAGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGCTCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTTCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCTGGTGCGGTAGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATTATTACTCCCGCAAAGCTTAGTGATCATTTCTTAAATTTTTAA-TTTAATCAAAT-----AATT-------------TGGAGGTCTTTAAAATAAAGAAG-CCTAAGCAAAGAGC----TTGGAATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGCAAGATTTTTTCGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATAACAA---T-TCTCTTTTTTATCTCTACTTACTT-----CAAAAAG--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACGATA------AGGTATCCGA-------ATTACCCGTCCGCGTCACCTCAAATAAAATCCTGATCAACCGAGGGATTACCCATT----CTTAGTGCTT-TACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAACCGCGATTTTA---GCCTGTCTTTTTCAA----ATCGGCAATTTAACTACATTCTTATAAGAAGGAGGAGG-------ATAACCTCGGGTAAGTAAAAATATAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTCACTCTTGCACGTCGAAAGTCGTACCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAAGCTTAGGAAG------ATTTCAAAAAAAGGAAAAATTAGAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGTAGAA----AATCCAAGCTCAAAAGTTGCAAGTAGATGAATCTTGGTTTATCAGGATTATCAAGTCAAGCAG-------GTTAT--TAGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTGCCTAAGGATTCTTGAAAGTAAAAATAAAGAACGAAGTAAAT----GAAAAAGAAATTGTTGAAACTA----------CTTCCTTTTTCGAAGGATCATCTAAG-AAGTATATTCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATATTATGGAAACCATTTATTGAAA-TTGGAGAGG-TTCTCTCCTCTTC-----AAACGGGAAGGAAAGGGGGGGGGG----CATTTAATCCAATAT---GCGGAAAGCCTCGATCCCCATA-AAAGGAATCTTG-CTATACA----CTCCTTTCGC-----------TTAAAACAGGGGAT-GTGCGATCC--GC-CTA----TCTTTTGATT--GCTCCATTTTACT-------AAGTATATGCAGACAAGTTC-TCCCCCAGTTTTGT------------ACTATGTATGTAGCCTTGCTTTATTTCCATAAGGGAGCCAAATGGACGGAAACCTCCATGTTCGGTTCTGAATTAGCGGCGTCACAA-CCAGTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTTATGATACTAAG-----AATCCCGG-AGCC----CTAATCGAGGTAACCCCTTCACCCGCAGATTGGGTCGTGAACAAACTGGAGTTCTCGTTTGTTCACGAT-TTGATAACTAATCTATAA------------------------CAGA-ACCCATATATGGAAATCGCTTCAAACTTTTTCTTTTT{CT}T-GG----TATTTCAAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCCA---------TACTTTA-----TGCTCTACAAGCGATATTGTATAATATATATTGATATAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAAAAATACACTTAACTGATTTCTAGGTAATTTTTATCCAC-AAATGA Dryopteris_crispifolia_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACTAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCGCAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAAGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATT-TAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGCGGACTTGATTTCACGAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCACATTCACCGTGCTATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGAGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCCCGCAACGAGGGTCGCGACCTCGCCC---------------------------------------------------------------TTTAATCAAAT-----AATT-------------TGGAGGTCTGTACGACGA--AAA-CCTAAGCAAAGGAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTCCGATCTAGCTTGTTCCTTTCTT-GGAGCATAAATTAAATCATAA---T-TTT---------------TTACTT-----TATATAA--------ATATTCCACTTTTGAGCAAATTAGTTTGGTACACGATG------AAGTATCTAA-------ATTAACCGTCCACATCACTTCAACTAAATTCCC-----AGCGAGGGATTACCTACT----CTTATTGCTTCTACTGAGATGGTCCCTCGGCCTCTCC------AAAG-TTGGACGACTTG-----ACTTGAAAT--------------CCCGCATTTTTCAA----GTCGGCAATTTAGCTAGATTTGGGTATGAGAAGA----------------------------------TTGAAAGGAAAA---------TGCGCCATTCCCGTTACTCCTGTACCTCGGAAGTCGTACCGGTTAATGACGAAGCAGAATTTTTTTGGTATGCAAAAAACTTGGAGAG------ATTCCGAAGAAAGGAAAAAGTGAGAATCTATGGGTAGACATCTAAGATATTTGCCTCATCGTCACTGAACCTTGGGAGAAA----AATCCAAGCTCAGAAGTTACAGATAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTCTTTTATTTCT--TGGTTAGGCAGTACTAGTTGCTTTCGACTCGGTGAGAAATATTTCCCTAAGGATTGTTGGAAGTAGAAATAAAGAACGAAGTAAGT----AGAAGAAAAATTAGTGAAACTAATTCT---------TTTTTTTAAAGGATCATCTAAG-AAGTATATCCGTG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACGCCATCTACTCAAA-TTGGGGCGG-CTCCGTCCCCCTC-----GAACAAAGGAAAAGGAAAAGGAAGCCCCCATATATTCCGATAT---GGAGGAAGTCTCGATCCCCGGA-GAAGTAATTTCG-ATATATG----CTCCCTTCGT-----------TTGAAACAAGGG---AGACAGTCC--AC-CCA----TTTTTCGATT--GTTCCATTTAACT-------AAATATATGCAGACAAATTC-TCCGCCAGTTTCGC------------AC----TATTTAGCCTTCCTCGATTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCAAG-----AATCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCATCCGTGGATTGGGTCGTGAACAAACTGAAATTCTTG-------------------------------TTGTTTGGATCCACATAACTTGTTCAGA----------------------------------------------------AGAAAATAGTTTGCAAGTGAGCCATTCAGGCTT----CTAA----TACGCATGAATGGCTCAATCTAGTCCTTCCCA---------TAATTTA-----TTTACTGCAAGCGATATTGTATCAGACATATCGATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAAAAATCTACTTAATTGATTTCTAGTTAACTTTTATCCGTAAAATGA Dryopteris_fragrans_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTTAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATCCGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATCCCCCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGCGGACTTGACTTCACGAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGGGAAATCAAGGGGCATTACTTAAATGCCACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTATTTTTGCTAGAGAGTTGGGTGTACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATACATTTCCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCACATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTCGGTGGGGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCCTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCCC---------------------------------------------------------------TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAACGA--AAA-CCTAAGCAAAGGAC----TTGGGATGATGAAATTT------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATCTAGCTTGTTCCTTTCTT-GGAGCATAATTCAAATCATAA---T-TTC---------------TTACTT-----TATAGAA--------ATATTCTACTTCTGAGCAAATTACTTTGGTACACGATG------AAGTATCTAA-------ATTAACCGTCCACACCACTTCAACTAAATTCCC-----ACCGGGGGATTACCTATC----CTTGTTGCTTCTACTGAGACGGCCCCTCGGCTTCTCC------AAAG-TTGGACGACTTG-----ACTTGAAAT--------------CTCGCATTTTTCAA----ATCGGCAATTTA-----------------------------------------------------------------------------TGCGCCATTCCCGTTACTCCTGTACTTCGGAAGTCGTACCGGTTAATAACGAAGCGGAATTATTTTGGTATGCAAAAAACTTGGGACG------ATTCCGAAGAAAGGAAAAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAGGAA----AATCCAAGCTCGAAAGTTGCAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAGGCACTCTTTCCTTTTT--TGGTTAAGCAGTACCAGTTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAAGTAAAAATAAAGAACGAAGTAAGT----AGAAGAAGAATTAGTTTCACTAATTCT---------TTTTCTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACGCCATTTACTCAAA-TTGGGGCGG-CTCCCTCCTCCTC-----GA--GGGGGAAAAGAAAAAGGAAGCCCCCATATATTCCGATGT---GGAAGAAGTCTTGGTCCCCGTG-AAAGTAATTTCG-ATATATG----CTCCCCTCGT-----------TTGAAACAAGGG---AGACGGTCC--AC-CCA----TTTTTCGATT--GTTCCATTTAACT-------AAATATATGCAGACGAATTC-TCCGCCAGTTTTGC------------AC----TATCTAGCCTTCCTCGATTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAG-CCATTTGCTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCGGA-----AATGCCGG-AGCCCTAGCTAGTCAAGTTAACCCCTTCATCCATGGATTGGGTCGTGAACAAACTGGAGTTCT---------------------------------TTGTTTGGATCCACATAACTTGTTCAGA-----------------------------------------GG----------CGAAATAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAATCCTTCCCA---------TAATTTA-----TTTACTGCAGGCGATGTTGTATTAAACATATCGATGAAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAAAAATCTACTTAACTGATTTC------------------------- 'Dryopteris patula (Sundue 1104)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTACTATACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTATGACATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCATATGTAGCTTATCCTTTAGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCTTTACGCTTAGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATACGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTTACCGGAGGGTTTACAGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCCATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAACGAGGGTCGCGACCTCGCCCGTGAAGGTAATGAAATTATCATTACTCCCGCAAAGCTTAGTGATAATTTATTAAATTTTTAA-TTTAATAAATT-----AATT-------------TGGAGGTCTCTGCGACGA--AAA-CCTAAGCAAAGGAC----TTGGGCTGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATCTAGCTTGTTCCTTTCTT-GGAGCATAAATTAAATCATAA-----TTT---------------TTACTT-----TATATAA--------ATATTCTACTTCTGAGCAAATTCTTTTAGTACACAATG------AAGTATCTAA-------ATTAACCGTCCACATCACTTCAACTAAATTCCC-----ACCGAGGGATTATCTATT----CTTATTGCTTCTATTGAGATGGTCCTTCGGCTTCTCC------AAAG-TTGGACGACTCG-----ACTTGAAAT--------------CCCGCATCTTTCAAGTCGGTCGGCAATTTAGCTAGAGTTGAGTATGAGGAGGTGAAA---AAAGAAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCTATTCCCGTTACTACGGTACCTCGGAAGTCGTACCGGTTAATGACGAAGCGGAATTATTTTGGTATGCAATAAACTTGGGAAG------ATTCCGAAGAAAGGAGGAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGGATGT----AATCCAAGCTCAAAAGTTACAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTCTTTTATTTTT--TGGTTAGACAGTACTAGTTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGAAAGTAAAAATAAAGAACGAAGTAAGT----AGAAGAAAAATTAGTTTCACTAATTCC---------TTTTCTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACACCATTTATTCAAA-TTGGGGCGG-CTCCGTCCTCCCC-----GAACGGGAA-AAATGAAAAGTAAGCCCCAATATATTACGACGC---GGAAGAAGTCTCGATTCCGGTA-GATGTAATTTTG-ATATATG----CTCCCCTCCC-----------TTGAAACAAGGG---AGACAGTCC--AC-CCA-----TTTTTGACT--GTTTTATTTAACT-------AAATATATACAGACAAATTA-TCTGCCAGTTTTGTAC----------AC----TATTTAGGCTTCCTCGATTTCCATAGAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTATTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCGAG-----AATCCCGG-{AG}ACT----CTAGTCA?GTTAACCCCTTCATCCGTGGATTAGATCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAGTTGTTTGGATTCACATAACCTGTTCAGA-AGC--------------------------------------------------AAAATAGTTCGCAAGTGAGCCATTCAGGCCT----TTAA----TATGCATGAATGGCTCAATCTAGTCCTTCCCA---------TAATTTA-----TTTACTGCAAGCAATATTGTAG-----ATATCGATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAAGTAGAGTTGAAAAATCTACTTAACTGATTTCTAGTTAACTTTTATCCGT-AAATGA Dryopteris_patula_GB --------------------------------TCGATTGACCTACTATACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCATATGTAGCTTATCCTTTAGATCTATTCGAAGAAGGTTCTGTCACCATAAAGTTCACCTCTATTGTAGGTAATGTTTTCGGATTTAAGGCTCTACGCGCTTTACGCTTAGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATACGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCTTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCTTTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCCGAAGCTCTTTTCAAATCCCAGGCTGAAACAGG-GGAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACAGCAAATACCAGCTTAGCTTTTTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCCATGCATGCTGTGATCGATAGACAACGAAATCACGGTATACATTTTCGCGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAACGAGGGTCGCGACCTTGCCC---------------------------------------------------------------TTTAATAAAAT-----AATT-------------TGGAGGTCTCTGCGACGA--AAA-CCTAAGCAAAGGAC----TTGGGCTGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATCTAGCTTGTTCCTTTCTT-GGAGCATAAATTAAATCATAA---T-TTT----------------TACTT-----TATATAA--------ATATTCTACTTTTGAGCAAAGTCTTTTGGTACACAATG------AAGTATCTAA-------ATTAACCGTCCACATCACTTCAACTAAATTCCC-----ACCGGGGGATTATCTATT----CTTATTGCTTCTATTGAGACGGTCCTTCGGCTTCTCC------AAAG-TTGGACGACTCG-----ACTTGAAAT--------------CCCGCATCTTTCAAGTCGGTCGGCAAT--------------------------------------------------------------------------------TGCGCTATTCCCGTTGCTGCGGTACCTCGGAAGTCGTACCGGTTAATGACGAAGCGGAATTATTTTGGTATGCAATAAACTTGGGAAG------ATTCCGAAGAAAGAAGGAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGGGGGT----GATCCAAGCTCAAAAGTTACAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTCTTTTCTTTTT--TGGTTAGACAGTACTAGTTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGAAAGTAAAAATAAAGAACGAAGTAAGT----AGAAAAAAAATTAGTTTCACTAAT---------TCCTTTTCTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAAACCATTTACTCAAA-TTGGGGCGG-CTCCGTCCCCCCC-----GAACGGGAAAAAATGAAAACGAAGCCCCAATATATTCCGACGT---GGAAGAAGTCTCGGTCCCGGTA-GATGTAATTTTG-ATATATG----CTCCCCTCCC-----------TTGAAACAAGGG---AGACAGTCC--AC-CCA----TTTTTTGACT--GTTTTATTTAACT-------AAATATATACAGACAAATTA-TCTGTCAGTTTTGTACTGT-------AC----TATTTAGGCTTCCTCGATTTCCATAGAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAG-CCATTTATTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCGAG-----AATCCCGG-AACT----CTAGTCAAGTTAACCCCTTCATCCGTGGATTAGATCGTGAACAAACTGGAGTTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dryopteris wallichiana (Labiak 4434)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGGGAGGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGCGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTGGCAGAAGCTCTTTTCAAAGCCCAGGCTGAAACGGGGGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTTAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTACTGCAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGCAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAACGAGGGTCGCGACCTCGCCCGTGAAGGTAATGAAATTATTATTACTCCCGCAAAGCTTAGTGACCATTTATTAAATTTTTAA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACGACGA--AAA-CCTAAGCAAAGGAC----TTCGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGCAAAAGTTTTTCGATCTAGCTTGTTCCTTTCTT-GGAGCATAAATTAAATCATAA---T-TTT---------------TCACTT-----TATATAA--------ATATTCCACTTTTAAGCAAATTATTTTGATACACGATG------AAGTATCTAA-------ATTAACCGTCCACATCACTTCAACTAAATTCCC-----ACCGAGGGATCACCTATT----CTTATTGCTTCTACTGAGATGGTCCTTCGGCTTCTCC------AAAG-TTGGACGACTTG-----ACTCGAAAT--------------CCCGCATCTTTCAA----GTCGGCAATTTAGCTAGATTTGGGTATGAGGAGGTGGAA---AGAAAAATCTCGGGTAGTTAAAAATAGGGAAAGGAAAGGGAGGGATT--------------------------------------------AATGACGAAGCAGAATTTTTTTGGTATGCAAAAAACTTGGGAAG------ATTCCGAAAAAAGGAAGAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGTGGAA----AATCCAAGCTCAGAAGTTACAGGTAGGTTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTCTTTTCTTTTT--TGGTTAGACAGTACTAGTTGCTTTCGACTCGGTGAGAAACATTTCCCTAAGGATTATTGGAAGTAGAAATAAAGAACGAAGTAAGT----AGAAGAAAAATTAGTGAAACTAATCCT---------TCTTCTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAAACTGACATAGATTTTATGGACGCCATTTACTCAAA-TTGGGGCGG-ATCCGTCCTCCTC-----GAACGGGAAGAGA--AAGAGGAAGTCCCCATATATTCCGATGT---GGAAGAAATCTTGATCCCCGTA-GAAGTAATTTTG-ATATATG----CTCCCTTCGC-----------TTGAAACAAGAG---AGACAGTCC--AC-CCA----TTTTTCGATT--GTTCCATTTAACT-------AAATATATGCAGACGAATTC-TTCGCCAGTTTCGC------------AC----TATTTAGCCTTCCTCGATTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATCTGTTGTCGTCGACTATAAC-CTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATCCACATAACTTGTTCAGA-AGC--------------------------------------------------AAAATAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TACGCATGAATGGCTCAATCTAGTCCTTCCCA---------TAATTTA-----TTTACTGCAAGCGATATTGTATCAAACATATCGATAAAAACGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGCTGAAAAATCTACTTAACTGATTTCCAGTTAACTTTTATCCGT-AAATGA 'Elaphoglossum amygdalifolium (Herrera 2063)' ---------------------------------------------TACACCCCCGAATACAAGAACAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAGCCCGGAGTACCGGCTGAAGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACATGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATAATTACAAGGGCCGATGCTACGATATTGAACCCGTTGCTGGAGAAGAAAATCAGTATATCGCATACGTAGCTTATCCTTTGGATCTCTTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTAGCCTTAGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATGGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATACGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTACGGTAAATCTAGCCACAATTGGGTCCGTGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTTATGCGTTGGAGAGATCGCTTCCTATTCGTGGCGGAAGCTCTTTTCAAATCTCAGGCTGAAACAGGAGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGAATAAGAGAGCTGTTTTCGCTAGAGAATTGGGCGCGCCAATTATCATGCATGACTACTTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCCCATTATGCTAGAGACAATGGGTTGCTTCTTCATATTCACCGTGCTATGCATGCTGTGATTAGTAGACAACGGAATCACGGTATGCACTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACATGCCGGAACTGTAGTGGGTAAACTAGAGGGAGAACGAGAAGTAACCCTTGGTTTCGTTGATTTACTTCGTGACGATTATATTGAGAAAGATCGTAGTCGTGGTGTATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCTGTAGCTTCGGGAGGTATCCACGTATGGCACATGCCTGCTCTAACCGAGATATTTGGAGACGATGCCGTATTACAGTTTGGTGGAGGAACCTTAGGACATCCTTGGGGAAACGCGCCCGGTGCAGTCGCTAACCGAGTTGCATTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTTGCTCGTGAAGGTAATGAAATTATTATTACTCTCGTAAAGCTTAGTGATCATTTAATAAATAATCAG-TCTAATAAATT-----AGAT-------------TAGAGGTCTATACAATGA--AAG-CTTAAGCTACGGAC----TTGCGATGCTTATAGTT------------------AATTAGCAGG-----TTACTT-AGGAGATGGTAAAAGTTTATCGGTCTAGCTTGTTTCTTTTTC-GAAGCAAAAATTAGATCATA-----------------------------------------------------------TTTTGATCAAATTAATTTGGTACATAATG------AAGTACCCGA-------ATTAA--ACCTACCCCATTTCAGCTAAATTTCTAATCAACCGAGGGATTACCGGTC----TTTATTGCTTCTATTAAGATAGTCCTTCGAATTCTTTACA---GTAG-TTGTACAACTTG-----ATTTGAATACGCGACTTCA---GCCCGTCTTTTTTAA----ATCAGAGATTTAATTACATTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTATTTGCAT-AACATAATTTGGTCAGTTTAAAAAATACGTAAACCACTTTAA-------TTCTGTTT-GG----TTTTTTGAAAATAGTTTGTAAGTGAGCCATTCATGCAC---ATTAA-----AAGTATGAATGGCTCGATCTAACCCTCCCCCTCTATACTTTCCTCTA-----TTTCC-----------------------TATTTATAAAAGTGAGATTAAC----------GGTAAAGAAGGCTAAAGTTGAAAAATAGGCTTAATTGACTTCTAGTTAACTACTATTCGT-AAATAA 'Elaphoglossum decoratum (NYBG391/77B)' ---------------------------------------------TACACCCCTGAGTACAAGACCAAAGATACCGATATATTAGCAGCGTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCTGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATTGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGGTCTGTCACCAATCTGTTCACTTCCATTGTAGGTAATGTTTTCGGATTTAAAGCCCTACGCGCTTTACGCTTAGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTTATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTAGGATGTACAATCAAGCCAAAGTTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGTCTCCGTGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTTGTGGCGGAAGCTCTTTTCAAATCTCAGGCTGAAACAGGCGAAATCAAGGGACACTACTTAAATGCTACCGCAGGTACGTGTGAAGAGATGATGAAGAGAGCTGTTTTTGCTAGAGAATTAGGTGCACCAATTGTCATGCATGACTACTTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGCGCTATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGGATGTCCGGTGGAGATCATATACACGCCGGAACCGTAGTGGGTAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTTGATTTACTTCGTGACGATTATATTGATAAAGATCGTAGTCGTGGTATATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCTGTAGCTTCGGGAGGTATACACGTCTGGCATATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAACGAGGGTCGTGACCTTGCTCGTGAAGGTAATGAAATTTTTATTACTCTCGTAAAGCTTAGTGATCATTTAATAAATAATCAA-ATTAATAGAGT-----AGAT-------------TAGAGGTCTATACAATGA--AAA-CCTAAGCTACGGAC----TTGGGATGCTGATATTT------------------AATTAGCAGG-----TTACTC-AGGAGATGGTAAAAGTTTCTCGGTCTATCTTGTTTCTTTTTC-AAAGCAAAAATCAAATCATA-----------------------------------------------------------TTTTGATCAAATTAATTTGGTATATGATG------AAGTACCCGA-------ATTAACTGCCTACCTCATTTCAGCTAAATCTCTAAT-AAACGAAGGATTACCAATT----TGTAATGCTTCTATTAAGATAGTCCTTCAAATTATTTAGA---GTAG-TTGTACAACTTG-----ATTTGAAACCGCGACTTCA---GCCCGTCTTTTTCAA----ACCAGAATTTTAACTATATTTTGACAAAAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTTTGAATCCGCAGAATTTTGTCGGTTTACAAAATATGTAAACCTA----------AATTCTGTTT-AG----TTTCTTAAAAATAGTTTGTAAGTGAGCCATTCATACCT----TTAA----TGTGCATGAATGGCTCAATCTAGCACCCCCTA---------TACTTT------TTTTATAAAAGCAATATTGTATTAAACGTATTTATAAGAGTCAGATTAGCAAT----------AAA--AAACTAAAGTTGAAAGATTTACTTAATTAATTTCTAGTTAACTTTTATTCGT-AAATAA 'Elaphoglossum hybridum (FR6421)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCTGAGTACAAGACCTTAGATACCGATATATTAGCAGCGTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCTGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATTGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCTGTCACCAATTTGTTCACTTCCATTGTAGGTAATGTTTTCGGATTTAAAGCCCTACGCGCTTTACGCTTAGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACCTTTATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTAGGATGTACAATCAAGCCAAAGTTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGTCTCCGTGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTTGTGGCGGAAGCTCTTTTCAAATCTCAGGCTGAAACAGGCGAAATCAAGGGACACTACTTAAATGCTACCGCAGGTACGTGTGAAGAGATGATGAAGAGAGCTGTTTTTGCTAGAGAATTAGGTGCACCAATTGTCATGCATGACTACTTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGCGCTATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGGATGTCCGGTGGAGATCATGTACACGCCGGAACCGTAGTGGGTAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTATATTGATAAAGATCGTAGTCGTGGTGTGTACTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCTGTAGCTTCGGGGGGTATACACGTCTGGCATATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAACGAGGGTCGTGACCTTGCTCGTGAAGGTAATGAAATTATTATTACTCTCGTAAAGCTTAGTGATCATTTAATAAATAATCAA-ATTAATAGAGT-----AGAT-------------TAGAGGTCTATACAATGA--AAA-CCTAAGCTACGGAC----TTGGGATGCTGACATTT------------------AATTAGCAGG-----TTACTC-AGGAGATGGTAAAAGTTTCTCGGTCTAGCTTGTTTCTTTTTC-AAAGCAAAAATTAAATCATA-----------------------------------------------------------TTTTGATCAAATTAATTTGGTATATGATG------AAGTACCCGA-------ATTAACTGCCTACCTCATTTCAGCTAAATCTCTAAT-AAACGAGGGATTACCGATT----TGTAATGCTTCTATTAAGATAGTCCTTCAAATTATTTAGA---GTAG-TTGTACAACTTG-----ATTTGAAACCGCGATTTCA---GCCCGTCTTTTTCAA----ACCATAATTTTAACTATATTTTGGCAAAAGAAGAGAAAG------ACAACCTCGGGTAGGTAAA-------------------------TACGCAATTCCCGTTACTTTTGTACTTCGAAAGTCGTACTGATTAGTGGCGAAGCAGAATTAGTTTGGTATTCTAAACACTTTGTATG------ATTACAAAAAGAGTAAGAATTAGGAATCTATGGGTAGACATCTAAGATATTTGCTTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCAAAAGTTAAAGGTGGATAAATCTTGGTTTATCAGGATTGTCAAGTCAAGCAT-------CTATT--TGTTTAAACAAAAAAGATTGCTTCCGACTCGGTGAAAAATAAATTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAGGTAA-----AAGAAAAAAGATTGGCTAAACTAATTCCCC--TCTTTTTTCTTTAAAGGATCATCTAAG-AAGTATATTGATG-CTAAATGAACAAAGCGTAAGCAAAACTGACATAGATCTTATGAATACCAATAACTAAAA--TGAAGAGGGCTCCCTCCTC--------AAACAAGATAGAAAAGGA----------------------------GGGGGAAGATTTGACACTCAGA-AATTGAATTCTG-ATATACG----CTTCCTCCGT-----------CTAAAACGGGGT---AAGCGGTCC------------------AGTT--GTTCTATTTCGAT-------AAATATATGCTGACAAAGTT-TATCTCAGCTTTGT------------AC----TAGTTAACCTTTCTCTATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCACGTTCGGTTCTGGATTAGCGATGTCATAA-TCATTTATTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGAATTTTTG-----AATTCCGA-ATTC----CTAGTCAAATTAACTGCTTCAATCACAAGTCGGGTCGTGAACAAACTGAAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTATCTGTTTGAATCCGCAGAATTTTGTCGGTTTACAAAATATGTAAACCACCCTAAAT------TCTGTTTAGT----TTTTTTAAAAATAGTTTGTAAGTGAGCCATTCATACCT----TTAA----TGTGCATGAATGGCTCAATCTAGCACCCCCTA---------TACTTT------CTTTGTAAAAGCAATATTGTATTAAACGTATTTATAAGAGTCAGATTAGCAAT--GAAAAAAAAAA--AGACTAAAGTTGAAAGATTTACTTAATTAATTTCTAGTTAACTTCTATTCGT-AAATAA 'Lastreopsis acuminata (Coveny 10182)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTATACGTCATTTTAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCAGTACG------GTTCCGAAAAGAGGAAAATTTAATAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------CCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATGAAGAACGAAGTAAAA---AAAAAAAAGAATTGG{GT}GGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTGGGGCAG-CTCCCTCCTCCCT-----GAACAGGTAAAAAGGGGAAATAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAGCCCCCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAGTGACACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTCACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGTCCCCCCCATTGATACCCCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATCTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis acuminata (Kessler 14227)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTGGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT---------------------------TTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTATACGTCATTTTAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACA-----------------------------------------TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCAGTACG------GTTCCGAAAAGAGGAAAATTTAATAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------CCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATGAAGAACGAAGTAAAA---AAAAAAAAGAATTGG{GT}GGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTGGGGCAG-CTCCCTCCTCCCT-----GAACAGGTAAAAAGGGGAAATAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAGCCCCCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAGTGACACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTCACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCCCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATCTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis acuta (Labiak 4913)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT------T--------ATATTT---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAAGTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAGTAGAAAG------ACAATTTCGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGTTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAACGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCTTTCTCCTT-----GAACAGGGGGAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GGGGGAAGACTCGATACCCATA-AAAGTATTTTTG-ATAGACG-------CCCCCCT-----------CTAAACCGGGGG---AGACAGTCC--AC-CCG----TCTATTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTACCCTTCCTTTTTGTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCTTTTGT?GTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACGAAAAATCCAGTTTGTTCACGAT-TTGGTAACTAATA{GT}GGAGTTGTTTGGATCCGCATAACTTGTTCAGA-GGCAAAATACGTAAACCACT--------------------GG----TATTTCAAAAATAGTGTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCCTCGATACCTCACTTTA-----TTTACTACAAGCGATA-TGTATTAAACATATCGATAAAAGCAATATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAATTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis amplissima (Labiak sn)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCACCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCAACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAACAAAAAAAAT-------------TGGAGGTTTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCAAA-AAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATTAACCGAGGGATTACCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGTGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAAGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTGCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAGAAAAAAATTGGTGAAACTAATT------TACCCTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAATCCCCATATATTTCAATAT---GAAGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA----CCTCCTCCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-CCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTCGAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCTCCCC----ATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATATTGATAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis amplissima (Prado & Hirai 2021)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCACCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCAACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAACAAAAAAAAT-------------TGGAGGTTTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCAAA-AAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATTAACCGAGGGATTACCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGTGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAAGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTGCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAGAAAAAAATTGGTGAAACTAATT------TACCCTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAATCCCCATATATTTCAATAT---GAAGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA----CCTCCTCCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-CCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTCGAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCTCCCC----ATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATATTGATAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis amplissima (Zardini 15991)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCACCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCAACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAACAAAAAAAAT-------------TGGAGGTTTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCAAA-AAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATTAACCGAGGGATTACCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGTGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGT{CG}GTACTGATTAGTGACGAAGC{AG}GGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAAGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTGCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAGAAAAAAATTGGTGAAACTAATT------TACCCTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAATCCCCATATATTTCAATAT---GAAGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATT----CCTCCTCCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTCGA{CT}T--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-CCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAG{AC}GACGTCATAA-CCATTTG-TGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTCGAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCTCCCC----ATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATATTGCTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis barteriana (Carvalho 5780)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTTATCATTTATGAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTATAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCTA-------ATTAATCGTTTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGCCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCACGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGG----------ATAGAGAAAGGAAAGGGAGGGATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis boivinii (RG470)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCG-TTGTTCACGAT-TTGGTAA-----------TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATGCCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis boivinii (Rouhan 1356)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis boivinii (Rouhan 1369)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTT----------------------------TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis confinis (Liogier 25604)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATAAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAGGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTATTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAAGAGAAAG------ACAAACTCGCATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGTCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCCTTCTCCTT-----GAACGAGGG------GGAAAGAAGTCCCCATATATATCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTATTTTTG-ATATATG-----CCCCCCCCT-----------CTAAACTGGGGG---AGACAGTCC--AC-CCG----TCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTTTTGTTCATAAAGGAGCCGAA{GT}GGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAACCCTTTTGTTGTCGTCGACTATAACTCTTTAGCTTCCCAAGCTACTGCTAGGGGTTGGATTCCCTCTACCCTCTCGTGCCACTAAG-----AATTCTGA-AGCC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGATTTTTCGTTTGTTCAC{AG}AT-TTGGTAACTAATATGGAG-----------CGCATAACTTGTTCAGA-GGCAAAATACGTAAACCACT--------------------GG----TATTTCAAAAATAGTGTCCAA{AG}TGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCATTCTGGCCCCCCCCCTCGATACCTCACTTTA-----TTTACTACAAGCGATA-TGTATTAAACATATCGATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAATTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis currori (Doursett-Lemaire 1906)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATT---TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAATATGTATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCAACTTT----TTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTATAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis currori (Fay 4804)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATCCGCATAACTTATTCAGA-AGCAAAATACGTAAACTACTTTAATT---TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAATATGTATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCAACTTT----TTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTATAGTTGAAAAAGAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis decomposita (Kessler 14191)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACTTAATACACCCCCGAGT?CAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTGGA-TTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGC----------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGACAGGGAGGGATTTGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACAAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCCCTAGCTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa (BP047)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGATTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCGAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTCGGGAGCAAAAATTAAATCATAA---T-TTA------T--------ATATTT-TATATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTATGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAATAGAAAG------ACAATTTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGTTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCCTTCTCCTT-----GAACAGGGGGAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTTTTTTTG-ATAGACG-------CCCCCCT-----------CTAAACCGGGGG---AGACAGTCC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTACCCTTCCTTTTTGTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCTTTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGATTTTTCGTTTGTTCACGAT-TTGGTAACTAATATGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa ssp dilatata (Hernandez 1906)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATAAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTCGGGAGCAAAAATTAAATCATAA---T-TTA------T--------ATATTT---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTATGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAATAGAAAG------ACAATTTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa ssp divergens (Villaroel 1597)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATAAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTATTT---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAAGTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGAGGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGA-----------------------------------------------------------------TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGTTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAACGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCTTTCTCCTT-----GAACGGGGG-AAAGGGGAAAGAAGTCCCCATATATATCAATAT---GGGGGAAGACTCGATACCCATA-AAAGTATTTTTG-ATAGACG-------CCCCCCT-----------CTAAACCGGGGG---AGACAGTCC--AC-CCG----TCTATTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTACCCTTCCTTTTTGTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCTTTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACGAAAAATCCAGTTTGTTCACGAT-TTGGTAACTAATATGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa ssp divergens (Walker 10612)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATAAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTATTT---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAAGTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGAGGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAATAGAAAG------ACAATTTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGTTAACAATTGCTTTCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAACGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCTTTCTCCTT-----GAACGGGGG-AAAGGGGAAAGAAGTCCCCATATATATCAATAT---GGGGGAAGACTCGATACCCATA-AAAGTATTTTTG-ATAGACG-------CCCCCCT-----------TTAAACCGGGGG---AGACAGTCC--AC-CCG----TCTATTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTACCCTTCCTTTTTGTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCTTTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CTAGTCAA?TTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACGAAAAATCCAGTTTGTTCACGAT-TTGGTAACTAATATGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis exculta ssp exculta (Moran 3239)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTGGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTTCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGCTTGACAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCGTTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGAAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATTTAATACAA-AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGTAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTATTT---TATATATAT--------ATATTCTATTTTTGATCAAATTAATTTGATACACAATG------AGGTATCCGA-------ATTAATTGTCTACGTCATTTCAGCTCAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTTA----ATTGGCAATTTAACTCGATTTCGATGG----------------------------------AAAAATAGGGAAAGGAAAGGGAGGGATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis glabella (Given 11847)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGGGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA-TATATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGATGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGTACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCAAAAGTAAAAATAAAGAACGAAGTAAA----AAAAAAAAGAATTGGTGGAACTAATTTC----TTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG?CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAATT?GGGGCAG-CTCCCTCCTCCCT-----GAACAGGAAAAAAGGGGAAAGAAGT?CCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAATTAATTTTG-ATATATG---?CCCCCCCCCTCTGT-------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCAAATTA?TTTTTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATCTGCAGAACTTGCTCAGA-AGCAAAATATGTAACCCACTTTAACTT--TTTTTTGTCT-GT----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATGCCCCACTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAATTTTGATCTGT-AAATGA 'Lastreopsis hispida (Given 11819)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTATCTGACCGGGGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAAA-----AAAT-------------TGGAGGTCTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCCAAAAAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAAGGATTATCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAT-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAAAAAAAAATTGGTGAAACTAATT------TACCTTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGATCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAGTCCCCATATATTTCAATAT---GAATGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA--------CTTCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTT-CCTATCAGTTTTGT------------AC----TATTTAGTCTTCCTTGATTTTCATAAAGGAGCCGAATGGGAGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CTATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCAG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTTGAAAAGAATTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCTCCCCCCCCCCATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATAGTAATAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis hispida (Schneider sn)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTATCTGACCGGGGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAAA-----AAAT-------------TGGAGGTCTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCCAAAAAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAAGGATTATCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAT-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAAAAAAAAATTGGTGAAACTAATT------TACCTTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGATCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAGTCCCCATATATTTCAATAT---GAATGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA--------CTTCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTT-CCTATCAGTTTTGT------------AC----TATTTAGTCTTCCTTGATTTTCATAAAGGAGCCGAATGGGAGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CTATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCAG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTTGAAAAGAATTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCTCCCCCCCCCCATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATAGTAATAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis killipii (Altamirano 952)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGACATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATTGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTTACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGGGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGCAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGACCGTAGCCGTGGTATCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAACAAAAAAAAG-------------TGGAGGTTTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAATTTAAATCATAA---T-TTT---------------TTATTA---TATATATAA--------ATATTACATTTTCGATCAAAAAAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACATCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGACTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTAAACCTTGGAACGAG----AATCCAAG-TCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAAGAAAGAACGAAGTAAAA---GAAGAAAAAAATTGGTGAAACTAAAT------TACTCTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGGGCGAAACGTAAGCAAGACTGACATAGATTTTATGAATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----AAACGGGGGAAAAGGAGAGGGAAGTCCCCATATATTTCAATAT---GAAGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA----CCTCCTCCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-CCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTAATTTTCATAAAGGAGCCGAATGGGCTGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis marginans (Kessler 14192)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTATCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACTAGCTGGTGACGCTAAT-----AATACCGG-AGCCCTAGCTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis marginans (Kessler 14354)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGG---------------------------------TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACAGGGGAAAAG-AGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CCTTATCCTTCCAAGCTACTGATGCGGGTTCGATACCCGCTAGTAGCTGGTGACGCAAAT-----AATACCGG-AGCCCTAGCTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG-------------------------------------ACATAAACCACTTTCATTTA-TTTTTTGTCT-GTG--GTCTTTCGAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGACCCCCCCCGTTCACACTTCGCTTTA-----TTTACCACAAGCGGTATTACATTAAACATATTGGTAGAAGCGAGATCAACGGTTTGACTAAGTAAA--AAACTAGAGTTGAAGGATATACTTAACTGATTTCTAA-TAACTTTTATTCGT-AAATGA 'Lastreopsis microsora (Coveny 9944)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTA------AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG----CCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATCTGCATAACTTGTTCAGA-AGCAAAATATGTAACCCATTTTCACTT--TTTTTTTGCT-GG----TATTTCGAGAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGTCCCCCCCCATTGATACCCCACTTT------------------------------------TCAATAAAAACAAGATCAACGGTTTGATTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis microsora (Gardner 5018)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTA------AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG----CCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATCTGCATAACTTGTTCAGA-AGCAAAATATGTAACCCATTTTCACTT--TTTTTTTGCT-GG----TATTTCGAGAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGTCCCCCCCCATTGATACCCCACTTT------------------------------------TCAATAAAAACAAGATCAACGGTTTGATTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis microsora (Kessler 14350)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTAGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGACGTACTGATTAGTGATGTAGCAGGATTAGTTCAGTATGCTAAAAACCCGGGACG-------TTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG---CCCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis microsora (Kessler 14355)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGACGTACTGATTAGTGATGTAGCAGGATTAGTTCAGTATGCTAAAAACCCGGGACG-------TTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG---CCCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATCCGCATAACTTGTTC?GA-GGCAAAATACGTAAACCA-------------------CT-GG----TATTTCAAAAATAGTGTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCCTCGATACCTCACTTTA-----TTTACTACAAGCGATA-TGTATTAAACATATCGATAAAAGCAATATCAACGGTTTGACTAGGTAAA--AAACTAGAGTT?AAAAATAAGCTTAATTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis munita (Clarke & Pickard 1814)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAATTTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis munita (Coveny 1303)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAATTTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis munita (Coveny 1906)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAATTTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis nigritiana (Thomas 8919)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis perrieriana (Rouhan 1318)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTATAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis perrieriana (Rouhan 1321)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGACAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACGTAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis pseudoperrieriana (Rouhan 1319)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis pseudoperrieriana (Rouhan 1323)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis pseudoperrieriana (Rouhan 1325)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis pseudoperrieriana (Rouhan 1364)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGGTTGCTGCTCCATATTCACCGCGCAATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCG-TTGTTCACGA--TTGGTAA-TAATC-----TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis rufescens (Kessler 14341)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCACTCTTTTGTCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTA-AAATGAAGAACGAAGTAAAA---AAAAAAAAGAATTGG{GT}GGAACTAATTTC----TTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTAGGGCAG-CTCCCTCCTCCCT-----GAACAGGGGAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAG-CCCCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACC-GCTGGTGCCACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG--------------ATAACTTGCTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AACATAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis rufescens (Kessler 14343)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCACTCTTTTGTCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATGAAGAACGAAGTA------AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTAGGGCAG-CTCCCTCCTCCCT-----GAACAGGGGAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAG---CCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCACGCTACC-GCTGGTGCCACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGGTTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis rufescens (Kessler 14347)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATTTGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCACTCTTTTGTCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATGAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTAGGGCAG-CTCCCTCCTCCCT-----GAACAGGGGAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAG---CCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACACTAAT-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCACGCTACC-GCTGGTGCCACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG---------------------------A-AGCA-AAAATGTAAGCCACTTTAA-CTC-TTTTTTGTCT-GT----TATTC--GAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACAAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis silvestris (Kessler 14222)' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAAGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT------T---------TACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTA--------TTACTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGAT-GGAAAAGAGAAAG------ACAACCTCGGGGGGG-----------------------------TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGTTTAGTGACGAAGCAGGATTAGCTCGGAATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAGCAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAAGAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTCTTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATAAATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTTCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTG-TGTCGTCGACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Lastreopsis smithiana (Coveny 9951)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGGGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGTACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCAAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTGGGGCAG-CTCCCTCCTCCCT-----GAACAGGAAAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAATTAATTTTG-ATATATG---CCCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCAAATTA-TTTTTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CGAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCTGCAGAACTTGTTCAGA-AGCAAAATATGTAACCCACTTTAACTT--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATGCCCCACTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAATTTTGATCTGT-AAATGA 'Lastreopsis smithiana (Kessler 14226)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGAC-TCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTCCCTATTCGTAGCAGAAGCTCTTTTCAA?TCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGTACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCAAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTGGGGCAG-CTCCCTCCTCCCT-----GAACAGGAAAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAATTAATTTTG-ATATATG---CCCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCAAATTA-TTTTTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CGAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG--------------------------GA-AGCAAAATATGTAACCCAATTTAACTT--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATGCCCCACTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAATTTTGATCTGT-AAATGA 'Lastreopsis sp nov (Kessler 14345)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACTAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTTTTATTCTCGCAAAGCTTAGTGATCGTTTAATAAATTATTAA-GTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATACATAAAGTAATATATATTATAATTTTGATCAAATTAATTTGGTACAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCACTTCTAT--------TCCTTCGGCTTTTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---ATCCGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGAAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGTCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCTTCTACCCAAA-TTGGGGCGG-CTCTCTCCCCCCT-----GAACGAAGGGAAAA-AAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGTATA-AAAGTAATTTTG-ATATACG----CTTCCTTCCT-----------TTAAAGCGGGGG---AGACAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAAGTAACCTCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATTCGGAGTTGTTTGGATCTGCAT?ACTTGCTCGGA-AGCAAAA{AT}ACATAAACTACTTTCATTTC-TTTTTTGTCT-GG----TCTTTCAAAAGCACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGCCC?TACCTCGCTTTA-----TTTACCACAAGCGATATTGCATTAGATATATTGGTAAACGCGAGATCAACGGTTTGATTAGGTAAA--AAACTAGAGTTGAATGA-------AACTGATTTCTAGTTAACTTTTATCTGT-AAATGA 'Lastreopsis subsericea (van der Werff 16118)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTTATCGTTTAATAAATTATTAA-GTTAATAAAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCTCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAAAGTAATATATATTATATTTTTGATCAAATTAATTTGATGCAAGATG------AGGTACCCCAATTCCCAATTAATTGTCTACCTCATTTCAACTAAATTCCTAATCAACCGAGGGATTACCCATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTTTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---ACCCGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGGAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCGCCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAAGAATTGGTGAAACTAATTA-----ACTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCATCTACCCAAA-TTGGGGCGG-CTCTCTCCTCCCT-----GAACGAGGGGAGAAAAGAAAGAAGTCCTCATATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATACGCTTCCTTCCTTCCT-----------TTAAAGCGGGGG---AGACAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAGGTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGATAACTAATTTGGAGTTGTTTGGATCCGCATAACTTGTTCGGA-AGCGAAATACATAAACTACTTTCATTTC-TTTTTTGTCT-GA----TCTTTCAAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGCTCATACTTCGCTTTA-----TTTACCACAAGCGATATTGCATTAGACATATTGGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAATGA-------AACTGATTTCTAGTTAACTTTTATCTGT-AAATGA 'Lastreopsis subsimilis (Fay 4802)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGGGAAAGGAAAGGGAGGGATT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis tenera (Kessler 14344)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAGATAGGGAAAGGAAAGGGAGGGATTTGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCCCTAGCTAGTCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis tenera (coll unkn)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATATACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCAAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAGATAGGGAAAGGAAAGGGAGGGATTTGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCCCTAGCTAGTCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG-------------------TTGTTCGGA-AGCGAAATACATAAACCACTTTCATTTA-TTTTTTGTCT-GTGG--TCTTTCGAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGACCCCCCCCGTTCACACTTCGCTTTA-----TTTACCACAAGCGGTATTACATTAAACATATTGGTAGAAGCGAGATCAACGGTTTGACTAAGTAAA--ATACTAGAGTTGAAGGATATACTTAACTGATTTCTAATTAACTTTTATTTGT-A----- 'Lastreopsis tinarooensis (Kessler 14340)' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------------------------TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGCCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAA{AT}CCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTAAAGGATCATTTAAGAAAGTATATTCATG-CTATACGAGCGAAATGTTAGCCAGACTGACCTAGATTTTATGGATGCCAATTAACCCAA-TTAGGGCAG-CTCCCTCCTCCCT-----GAACAGGGGAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCCCGATACCTATA-AAAGTAATTTTG-ATATAAGCCCCCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTG-------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATTTGCATAACTTGCTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis tinarooensis (Van der Werff 17036)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATAAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGCAAACTAGAGGGAGAACGAGATGTAACCCTGGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAAGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATTTGCATAACTTGCTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis vogelii (Visa 2498)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGTTTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTGGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAAATCGGGACA------GTTCCGAAAAGAAAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATCTTATGGATGCCATTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG--------CTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-CCG----CCTTTTGTCT--GCTTCATTTCGAT-------AAATATATACGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCAG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis vogelii (Visa 3706)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAAGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCAAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTACTATTGTAGAGACAATGGTTTGCTGCTCCATATTCACCGCGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGTATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAAGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTGTCTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTGGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATTTGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAAATCGGGACA------GTTCCGAAAAGAAAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATCTTATGGATGCCATTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG--------CTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-CCG----CCTTTTGTCT--GCTTCATTTCGAT-------AAATATATACGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCAG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis walleri (Kessler 14339)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCTTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAGGAAGGTTCCGTCACTAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCCTTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTATACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCTGGTGGAGACCATGTACACGCTGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTGGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATTTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTATACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TTCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGCCGCGCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTCTTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCAAGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCACGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCC----CTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis windsorensis (Kessler 14353)' GGTTTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACTCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGCCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGACTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAAAGAGCTGTCTTCGCGAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAACGGATTGCTGCTCCATATTCACCGCGCGATGCACGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATGTACACGCCGGAACTGTAGTCGGTAAACTAGAGGGAGAACGAGATGTAACCCTAGGTTTCGTTGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCCTGGGGAAATGCACCCGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AA?T-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG----?ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGCCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGG-------------------------------------------------------------------------------------------------------------------GGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG----CCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCAAAA-ATGTAACCC{AC}TTTTCACTT--TTTTTTTGCT-GG----T?TTTCGAGAATAGTTTCCAAGTGAGCCATTCAGGCTT----TT{AT}A----TATGCATGA{AG}TGGCTCAATCTGTCCCCCCCCATTGATACCCCACTTT------------------------------------TCAATAAAAACAAGATCAACGGTTTGATTAGGTAAA--AAACAATAGTTGAAAAATAAGCTTAACTGATTTCTAGT--------------------- 'Lastreopsis wurunuran (Kessler 14342)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACTAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTTGCTCGTGAAGGTAATGAAATTATTATTATTCTCGCAAAGCTTAGTGATCGTCTAATAAATTATTAA-GTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATACATAAAGTAATATATATTATAATTTTGATCAAATTAATTTGGTACAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCACTTCTAT--------TCCTTCGGCTTTTCC------AAAG-TTGTACGACT{AT}G-----ATTTGAAACCGCGACTCCA---ATCCGTCTTTCTCAA----ATCGGCAA{CT}TTAGCTAGATTTCGATGGGAAAGAGAAA--------ACAACCTCGGGTAGG-AAAAATAGGGAAAGGAAAGGGAGGGATTTGCGTCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCTTCTACCCAAA-TTGGGGCGG-CTCTCTCCCCCCT-----GAACGAAGGGAAAA-AAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGTATA-AAAGTAATTTTG-ATATACG----CTTCCTTCCT-----------TTAAAGCGGGGG---AGACAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAAGTAACCTCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATTCGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis wurunuran (Kessler 14348)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACTACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACTAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTTGCTCGTGAAGGTAATGAAATTATT-------------------------------------------GTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATACATAAAGTAATATATATTATAATTTTGATCAAATTAATTTGGTACAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCACTTCTAT--------TCCTTCGGCTTTTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---ATCCGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGAAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATTTGCGTCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCTTCTACCCAAA-TTGGGGCGG-CTCTCTCCCCCCT-----GAACGAAGGGAAAA-AAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGTATA-AAAGTAATTTTG-ATATACG----CTTCCTTCCT-----------TTAAAGCGGGGG---AGACAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAAGTAACCTCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATTCGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lomagramma matthewii (Wuzhisan 448)' ---------------------------------------------TACACCCCCGAATATAAGACTAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAAGAGAACCAGTATATCGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCTGTCACCAATCTGTTTACCTCCATTGTAGGTAATGTTTTCGGATTTAAGGCGCTACGCGCTTTACGTTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAACCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGGGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACCTGTGAAGAAATGTTGAAGAGAGCTATTTTCGCTAGAGAATTGGGTGCACCAAGGGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAACACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTAGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACCGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGATGATTACATTGAAAAAGACCGTAGTCGCGGTATATACTTCACCCAAGATTGGGTGTCTATGCCGGGTGTATTTCCTGTAGCTTCGGGAGGTATCCACGTTTGGCACATGCCAGCTCTAACCGAGATTTTTGGGGACGATTCCGTATTACAATTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATGAGATTATTATTACTCTCGCAAAGCTTAGTGATCATTTACTAAACAATCAA--TTTCTAAAAC-----AACT-------------TAGAGGTCTCTACAATGA--AAA-CCTAAGCAACGGAC----TTGGGATGCTGATA---------------------AGTAAGTAGG-----TTACTT-AGGAAATGGTAAAAGTTTATCGGTCTAGCTTGTTTCTTTTTC-GAAGCAAAAATTCAATCCTAA---T-TTT---------------TTAACT---TGTATAGAA--------ATATTCTCTTTTTTATCAAATTGATCTGGTACATGATG------GAATAGTTGA-------ATCAACTGCCTACGTAACTTCAGTGAAATTTCTAATAAACTGAGGGATTACCAATT----TTTAATGCTTATATCAAGATGGTCCTTCGGCTTATTTAGA---GTAG-TTGTATAACTTG-----ATTTGAAACCGTGACTCCA---GGCTGTCTTTTTCAA----ATCGGAAATTTAGCTAGATTTCGACGAAAAAAGATAAAGAGAAAGACAACCTCGGGTAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTTTGAATTCGTATAATTTGGTCGAA-AGCAAAAGATGTAAACCACCTAAT-----CTTTTTGTCT-CA----TTTTTTAAAAATAGTTTGCGAGTGAGCCATTCATACTT----TTTA----TATGCATGAATGGCTCGATCTAGCCCCCTCTA---------GACTTTA-----TTTCTTACATACAAGATTGTTTTAAACATATTGATAAAAGCGAGATCAGTACTTTAACTTAGTAAA--ACACTAAAATTGAAAGATATATTTGATTGATTTCGCTTGAAATCTTATTCGT-AAATAA Lomariopsis_marginata_GB ---------------------------------------------TACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCATTCCGAATGACCCCCCAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACTGTATGGACAGATGGATTGACCAGTCTTGACCGTTACAAGGGTCGATGCTACGACATAGAACCCGTCGCTGGAGAAGAAAACCAATATATCGCGTATGTAGCTTACCCCTTGGATTTGTTTGAAGAAGGTTCCGTCACCAATATGTTTACTTCTATTGTAGGTAACGTTTTTGGATTTAAGGCCCTACGTGCTTTACGTTTGGAAGACCTTCGAGTTCCCCCTTCTTATTCGAAAACTTTTATAGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTCTATTAGGATGTACAATCAAACCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGGGGACTTGATTTTACAAAAGATGATGAAAATGTGAATTCCCAGCCATTTATGCGTTGGAGAGATCGCTTCGTATTCGTAGCAGAAGCTCTTTTTAAAGCCCAGGCTGAAACAGGGGAAATCAAGGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCTGCTTTCGCCAGAGAGTTGGGTGCACCAATTGTCATGCACGACTATTTGACCGGAGGATTTACGGCAAATACCAGTTTAGCTTTCTATTGTAGAGATAATGGATTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTAGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAAGGGGAGCGAGAAGTCACCTTGGGTTTCGTCGATTTACTTCGTGACGATTACATCGAAAAGGATCGTAAGCGCGGTATCTATTTCACCCAAGATTGGGTGTCTATGCCGGGTGTATTCCCGGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAGATATTTGGGGATGACGCCGTATTACAATTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCGCCCGGTGCGGTAGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATTATTACTCACGCAAAGCTTAGTTCTCATTTAGTAAATCTTTTAATCTAATCAAAT-----AGAT-------------TGGAGGGTTTTACAAAAAAAAAG-CCAAGATAAGAGAC----TTGGGCTGATGGGATTAAATT--------------ACTTAGGAGATTAAATCACTT-AGGAAAGGGTAAAAGTTTTTCAGCCTAGCTTGTTCCTTTTTT-AGATAATAAAAAGAATCAGAA---T-TTT------T--------TAACTTATTTATCTAGAA--------ATACTCAAATTTTGCGCAAATTAATCTGATGTACGATGAAGTCTAAGTATCCGA-------ATCACCCGTCCACATCATTTTGAATAAATCTCTAATCAACCAAAGGATTACCGATT-------------------AATAGGATCCTTTGGCTTATTT------CAAG-TTGGATGACCTT-----ATTGAAAACCCCGATTTTA---GTCCGTCTTTCTCAA----ATTGTCAATTTGATTAGATTTGGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTGTGGATTTACACAATTTATTCAGA-AGCAAAATACATAAACTACTTTAAATAT-TTATGTCTTC-GG----TCTGCCAAAAATAGTTTGCAATTGAGCCATTCAAGCTT----CTAA----TATGCATGAATGGCTCGATTGAGTTTTCTCCCCA-------AGCTTTA-----CCTGCTACAAGCAATATTCTGTTGAACACATCGAGAAGAATGAGATAATCAATTTGGCTAGGCAAA----ACTAGCCTTGAGAAGTCTACTTAAATTATTTCTATTTGAGTCTTATCTGT-AAACAA 'Maxonia apiifolia (Moran 3541)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAATGTTTTTGGGTTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGGAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAGATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTTAAGCGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGCAGAGATAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCCGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGCGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTTGCTCGTGAAGGTAATCAAATTATTATTACTCCCGCAAAGCTTAGTTAGCATTTCTTAAATTTTTCA-TTTAATCAAAT-----AATT-------------TGGAGGTCTTTACAATAA--AAA-CCTAAGCAAAGGGC----TTGAAATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGCAAAAATTCCTCGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATCACAA---T-TTCTTTTTTTATCTCTACTTACTT-----CATAAGA--------ATATTCTACTTCTAAGCAAATGAATTTGGTACACGATA------AGGTATCCGA-------ATTACCCGTCCACGTCACCTCAAATAAGATCCTAATCAACCGAGGGATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAACCCCGATTCTA---GCCTGTCCTTCTCAA----ATCGGCAATTTAGCTATATTTCGATAAGAAGGAGGAGAA----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGGATCCACATAATTTGTTCAGA-AACAATATATGGAAATCGCTTCAACCTC-CTTTTTGTCT-GG----TCTTTCAAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----CTAA----TATGCATGACTGGCTCAATCTGGCCCCCCCCA---------TACTCTA-----TTTTCTACAAGCGATATTGTTTTACATATATTGATAAAAGCGAGATCAACGATTTGGTTAGGTAAA--TAGCTAGAGTTGAAAAATAGACTTAACTCATTTCTAGGTAATTCTTATCCAC-AAATGA 'Megalastrum abundans (Schwartsburd 1631)' GGTGTTGGATTTAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTGTCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCGGGGTTTCGTCGATTTGCTTCGCGACGATTTTATTGAAAAAGATCGCAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACAATAA--AAATCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGCCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCAATT----TTTATTGCTTTTAATGAGATGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGGCAATTTAGCTAAATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTCGTTCGGTATGCTAAAAACTTGGGACA------------ATAAAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAATCAAGCAC-------TTTTT--GGGTTAAACAGTAAAAATTGCTTTCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTAACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------TTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTCGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTATTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTTTTTGTCT-GG----TATTTCAAAAACAGTTCGAAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGTCCATACTTTGCTTTA-----TTTAATACAAGCAATATTGTATTAGACATATCTGTAAAAGCGAGATCAATGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATACTTAACTGATTTATAATTAACTTTTATCTGT-AAACGA 'Megalastrum atrogriseum (Sundue 1779)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCGAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTCATTGTGAAGAAATGATGAAGAGAGCTGTCTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATCGAAAAAGATCGTAGCCGTGGTATTTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATAATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATTAAATTC------------------AATAAGCAAA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAACTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTAATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCGATT----TTTATTGCTTCTAATGAGACGGTCCTTTGGCTTCTCCAAA---AAAA-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---ACCCGTCTTCTTCAA----ATTGTCAATTTAGCTAGATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTTAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTATTTTGGTATGCTAAAAACTTGGGACA--------------ATAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTTTTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTTTCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGGAGAAGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTATCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACACTAAG-----AATCCCGG-AGAC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGAATCCGCATAATTTGTTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTCTTTGTCT-GG----TCTTTCAAAAACAGTTCGAAAATGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCTCCCGTCCATACTTTACTTTA-----TTTAATACAAGTAATATTGTATTAGACATATCTGTAAAAACGAGATGAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATAGAACTGATTTATAATGAACTTTTATCTGT-AAATGA 'Megalastrum canacae (Grangaud 3)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGAACTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCCAAGACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTTGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACTGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCACGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCTTGTCCGGCGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGACGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTATGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGCGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGCAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCGCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTACTAAATTATTAA-TTTAATAAAAT-----AGAT-------------TGGAGGTCTTTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATAGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAC---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTATCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTATTTCTTCTAATGAGATGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTGATTTGATTTGAAACCGTGACCCCA---GCCCGTCTTCTTCAA----ATCGGCAATTTAGCTACATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCTCGTTACTCTTGTACTTCAAAAATCGTACTTATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACTTGAGACA------ATAAAAAAAAAAGGAAAAATTGGGAATCTATGGGGAGACATCTAAAATATTTGCCTCATCGTCACTAAACCTTGGAAAGCG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAAGATTACTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAGAGAGAATTGGTGAAACTCA-TTT----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGAGGCGG-CTCCCTCCCTTTA-----AAAC---------------------------------------------------------------------------------------------------------------TGAAACGGGAG---AGACAGTCCAAAC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTCGT------------AC----TATTTAGCCTTACTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTTTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----TTAGTCGAGTTAACCCCTTCACCGACGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCTGCATAATTTGTTCGGA-GGCGAAATATGTAAACCGCTTTAATTTC-TTTTTTGTCT-GG----TCTTTCAAAAACAGTTCGCAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTCCA-----TGCTTTA------CTAATACAAGCAATATTGTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCTAATTAACTTTTATCTGT-AAATGA 'Megalastrum connexum (Labiak 4260)' GGTGTTGGATTTAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTATACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAAGCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTATCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACTAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCGGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAAAAAGATCGTAACCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATGCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCCCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCTTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTTTCTACAATAA--AAATCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTAAATATTTGATGAAATTAATTTGGTAAACGATG------AGGTATCCAA-------ATTAATTGCCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCTATT----TTTATTGCTTTTAATGAGGTGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGGCAATTTAGCTAGATTTTGACGGGAAAATAGAAAT------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTATTGCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------AT------AAAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--GGGTTAAACAGTAAAAATTGCTTTCAACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTCAATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTATTCGGA-AGCGAAATATGTAAACCCCTTTAATTTC-TTTTTTGTCT-GG----TATTTCAAAAACAGTTCGAAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGCCCATATTTTGCTTTA-----TTTAATACAAGCAATATTGTATTCGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGATAAA--AAACTAGAGTTAAAAAATAGACTTAACTGATTTATAATTAACTTTTATCTGT-AAATGA 'Megalastrum fugaceum (Jimenez 1203)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGCTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGCTACGTGTGAAGAAATGCTCAAGAGAGCTGTCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTTTTAA-TTTAATAAAAG-----AAAT-------------TGGAGGTCTCTACAATAA--AAATCCTAAGCAAAGAAC----TTGGGACGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATGAAATTAATTTGGTAGACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTAAACTGAATTCCTAATCAACTGAGGGATTACCAATT----TTTATTGCTTTTAATGAGATGGTCCTTCGTCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGGCAATTTAGCTAAATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTTGGTATGCTAAAAACTTGGGACA------------ATAAAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AA-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGG-CGAATTA-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AACGAAATATGTAAACCACTTTAATTTC-TTTTTTGTCT-GG----TCTTTCAAAAACAGTTCGAAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTCCATACTTTACTTTA-----TTTAATACAAGTAATATTGTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATATAACTGATT-------AACTTTTATCTGT-AAATGA 'Megalastrum lanatum (Grangaud 6)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGAACTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCCAAGACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTTGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACTGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCACGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGCGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCTTGTCCGGCGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGACGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTATGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGCGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGCAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCGCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTACTAAATTATTAA-TTTAATAAAAT-----AGAT-------------TGGAGGTCTTTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATAGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAC---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTATCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTATTTCTTCTAATGAGATGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTGATTTGATTTGAAACCGTGACCCCA---GCCCGTCTTCTTCAA----ATCGGCAATTTAGCTACATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCTCGTTACTCTTGTACTTCAAAAATCGTACTTATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACTTGAGACA------ATAAAAAAAAAAGGAAAAATTGGGAATCTATGGGGAGACATCTAAAATATTTGCCTCATCGTCACTAAACCTTGGAAAGCG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAAGATTACTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAGAGAGAATTGGTGAAACTCA-TTT----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGAGGCGG-CTCCCTCCCTTTA-----AAAC---------------------------------------------------------------------------------------------------------------TGAAACGGGAG---AGACAGTCCAAAC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTCGT------------AC----TATTTAGCCTTACTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTTTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----TTAGTCGAGTTAACCCCTTCACCGACGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCTGCATAATTTGTTCGGA-GGCGAAATATGTAAACCGCTTTAATTTC-TTTTTTGTCT-GG----TCTTTCAAAAACAGTTCGCAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTCCA-----TGCTTTA------CTAATACAAGCAATATTGTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCTAATTAACTTTTATCTGT-AAATGA 'Megalastrum macrotheca (Christenhuzs 4181)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTCTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATTTATTTCACCCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATAATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATTAAATTC------------------AATAAGCAAA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAACTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGACGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCAATG----TTTACTGCTTCTAATGAGATGGTCCTTTGGCTTCTCCAAA---AAAA-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGTCAATTTAGCTAGATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTTAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCTGGATTATTTTGGTATGCTAAAAACTTGGGACA-------------ATAAAAAAAAATTTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTGCGACTCGGTGAGAAATATTTCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTTTTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTTCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTATCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACACTAAG-----AATCCCGG-AGAC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTAGAGTTCTTGCTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTCTTTGTCT-GG----TCTTTCAAAAACAGTTCGAAAATGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCTCCCGTCCATATTTTACTTTA-----TCTAATACAAGTAATATTGTATTAGACATATCTGCAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATAGAACTGATTTATAATGAACTTTTATCTGT-AAATGA 'Megalastrum retrorsum (Labiak 4356)' GGTGTTGGATTTAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTATACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAAGCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTATCTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACTAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCGGGGTTTCGTCGATTTACTTCGCGACGATTATATTGAAAAAGATCGTAACCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATGCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCCCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCTTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTTTCTACAATAA--AAATCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTAAATATTTGATGAAATTAATTTGGTAAACGATG------AGGTATCCAA-------ATTAATTGCCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCTATT----TTTATTGCTTTTAATGAGGTGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGGCAATTTAGCTAGATTTTGACGGGAAAATAGAAAT------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTATTGCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------AT-----AAAAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--GGGTTAAACAGTAAAAATTGCTTTCAACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTCAATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTATTCGGA-AGCGAAATATGTAAACCCCTTTAATTTC-TTTTTTGTCT-GG----TATTTCAAAAACAGTTCGAAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGCCCATATTTTGCTTTA-----TTTAATACAAGCAATATTGTATTCGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGATAAA--AAACTAGAGTTAAAAAATAGACTTAACTGATTTATAATTAACTTTTATCTGT-AAATGA 'Megalastrum subtile (Moran 7608)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCCTAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTCTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGACGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAACCGTGGTATTTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATAATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATTAAATTC------------------AATAAGCAAA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAACTTGTTCCCTTTTC-GGAGCAAAAATTAAATCCTAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTCGACGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCAATT----TTTATTGCTTCTAATGAGATGGTGCTTTGGCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGTCAATTTAGCTAGATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTTAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGACTAGTGACGAAGCAGGATTATTTTGGTATGCTAAAAACTTGGGACA--------------ATAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAATCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--CGGTTAAGCAGTAGAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTTTTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCACGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCCTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACAAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTATCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACACTAAG-----AATCTCGG-AGAC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGCTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTCTTTGTCT-GG----TCTTTCAGAAACAGTTCGAAAATGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCTCCCGTCCATACTTTACTTTA-----TTTAATACAGGTAATATTGCATCAGACATATCTGTAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATAGAACTGATTTATAATGAACTTTTATCTGT-AAATGA 'Megalastrum vastum (Cornejo 8163)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGGGAGGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTCACAAAAGATGATGAAAATGTTAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGTGAAATCAAGGGGCATTACTTAAACGCTACTGCAGGTACGTGTGAAGAAATGATGAAGCGAGCTGTCTTTGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTCATTATTGTAGAGACAATGGGTTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATTTATTTCACACAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATAATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACACTAA--AAACCCTAAACAAAGAAC----TTGGTATGATTAAATTC------------------AATAAGCAAA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAACCTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTACATTTTTGATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACTGAGAGATTACCGATT----TTTATTGCTTCTAATGAGATGGTCCTTTGGCTTCTCCAAA---AAAA-TTGTACGACTTG-----ATTTGAAACCGCGATCCCA---GCCCGTCTTCTTCAA----TTTGTCAATTTAGCTAGATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTTAAAATAGAGAAAGGAAGGGGAGGGATTTGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTATTTTGGTATGCTAAAAACTTAGGACA--------------ATAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTC{AC}CTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--GGGTTAAACAGTAAAAATTGCTTTCAACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGAAACTAATTT-----TCCTTTTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTTTCCCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTATCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACACTAAG-----AATCTAAG-AATCCCGGCTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTCTTTGTCT-GG----TCTTTCAAAAACAGTTCGAAAATGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCTCCCGTCCATACTTTACTTTA-----TCTAATACAGGTAATATTGCATTAGACATATCTGTAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATAGAACTGATTTATAATGAACTTTTATCTGT-AAATGA 'Mickelia guianensis (Prado 2025)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGGATGACCCCACAACCCGGGGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATCGAACCCGTCGCTGGAGAAGAGAATCAGTATATCGCATATGTAGCTTATCCTTTAGATCTCTTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTTGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAACTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTTTACGAATGCCTCCGCGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATTAAGGGACATTACTTAAATGCTACCGCGGGCACGTGTGAAGAGATGTTGAAGAGAGCTATTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCACGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCCTATTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAAAGAAACCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACCGTAGTGGGTAAACTAGAGGGAGAACGCGAAGTAACCCGGGGTTTCGTCGATTTACTTCGTGACGATTATATTGAGAAAGATCGTAGTCGTGGTATATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTCCCTGTAGCTTCGGGAGGTATCCACGTCTGGCATATGCCTGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAACGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCCTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCCCGTGAAGGTAATGAAATTATTATTATTCTCGTAAAGCTTAGTGATCATTTTCTCAATCATCAA-TTTAATTCAAT-----AAAT-------------TAGAGGTCTACACAATGA--AAA-CCTAAGCAACGGACTTGGTTGAGATGCTGATATTT------------------AATAAGCAGG-----TTACTT-AAGAAACGAGAAAAGTTTATCGGTCTAGCCTGTTTCTTTTTT-GAAGCAAAAATTGAATCATAA---T--GT------T--------TTAACT---TATATATAA--------ATACTCTATTTTTGATCAAATTAATTTGGTACATGATG------AAGTACCCTC-------ATTAACTGCCTACGCCATTTCAACTAAATTTCTAATCAACCGAGGGCTTACCAATC----TCTAATTGTTCTATTAAGATAGTCCTTCGGCTTATTTAGC---CAAG-TTGTACAACTTG-----ATTTGAAACCGCGACTTCA---ACCCGTCTTTTTCAA----ATTGGAAATTTAGCTAGATTTCGACGGAAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGACAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTTGAATCTGCATAATCTGGTCGGG-AGCAAAATATGTAAACTATCTTAATTAT-TCTTTTGTCT-GG----CCTTTTG-------TTTGTAAGTGAGCCATTCATACCTCTAATTAA----TGTGCATGAATGGCTCGATCTAGCCCCTCCCCTCTATATTTTACTCTG-----CTTTATACAAGCAATATTGTATTAAACATATTGATAAAAGCTAGATCAGC-------TTTAGTAAG--AGACTAAAGCTGAGAAATATATGTAATTGATTTCTAGTTAACTTTTATTCGT-AAATAA 'Mickelia oligarchica (Smith 2236)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGAACTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGACGATGCTACGATATCGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCATATGTAGCTTATCCTTTAGATCTCTTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCTCTACGTGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCTCTTATTCTAAGACTTTCATTGGACCGCCTCATGGTATTCAAGTTGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTATCTGCTAAAAATTATGGTAGAGCCGTGTACGAATGCCTCCGTGGTGGACTCGATTTCACAAAAGATGATGAAAATGTAAATTCTCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACGTGTGAAGAGATGTTGAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGATTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGTTGCTTCTTCATATTCATCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACCGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTTGATTTACTTCGTGACGATTATATTGAGAAAGATCGTAGTCGTGGTATATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTATTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGACGATGCCGTATTACAATTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGGAATGAGGGCCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTACTCTCGTAAAGCTTAGTGATCATTTACTAAATTATCAA-TTTAATAAAAT-----AGCT-------------TCGAGGTTTATACAATGA--GAG-CCTAAGCAGCGGGCTTGGTTGGGATGCTGATATTT------------------AATAAGCAGG-----TTACTT-AGGAAATG--AAAAGTTTATCAGTCTAGCTTGTCTCTTTTTC-AAAGCAAAAATTAAATCATAA---T-CTT------T--------TTAACT---TATATAGAA--------ATATTCTATTTTTTATCAAATTAATCTGGTACATAATG------AAGTACCCGA-------ATTAACTACCTACATCATTTCAACAAAATTTCTAATCAACCGAGGAATTACCAATT----TTTAATGGTTCTATTAAGATAGTCCTTTGGCTTCTTTGGA---GTAG-TTGTACAACTTG-----ATTTGAGACCGCAACTTCA---GCTCGTCTTCTTCAA----ATCGAAAATTTAGCTAGATTTTGACGGAAAAAGAGAGAGAAAAACACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTGAATCCGCATAATTTGTTCGGA-AGCAAAATATGTAAACTACCTTAATTAT-TTTTTTGTCT-GG----TCTTTTGAAAATACTTTGTAAGTGAGCCATTCATATCT----TTAG----TGTGCATGAATGGCTCGATCTAGACCCCTCTA---------TACTTTA-----TTTTCTACAAGCAGTATTGTATTATAAATATTGATAAAAGCGAGATCAGC----------GGTAAA--GTACTAAAGCTGAAAAATATACGTAATCAATTTTGAGGTAACTCTTATATGT-AAATAA 'Mickelia pergamentacea (Sanchez 124)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATACATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTCGACCGTTACAAGGGACGATGCTACGATATCGAACCCGTCGCTGGGGAGGAGAACCAGTATATCGCATATGTAGCTTATCCTCTGGATCTCTTTGAAGAAGGTTCTGTCACCAATTTGTTCACTTCCATTGTAGGTAATGTTTTCGGATTTAAAGCCCTACGCGCTTTACGCTTGGAAGACCTCCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTATGAATGCCTCCGCGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAACCATTCATGCGTCGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCCGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTCGCTAGAGAATTGGGCGCACCAATTGTCATGCATGACTACCTAACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTATTGTAGAGACAACGGGTTGCTTCTTCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTAGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACCGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGTGACGATTATATCGAGAAAGATCGTAGTCGTGGTATATACTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCTGTAGCTTCGGGAGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATTTTTGGAGACGATGCCGTATTACAGTTTGGTGGAGGAACCTCGGGACATCCTTGGGGAAATGCACCCGGTGCGGTTGCTAACCGAGTTGCGTTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGATCTCGCTCGTGAAGGTAATGAAATTATTATTACCCTCGTAAGGCTTAGTGATCATTTACTAAATCACCAA-TTTAATAAAAT-----AGCC-------------TCGAGATCTATATAATGA--AAA-CCTAAACAACGGACTTGGCCGGGATGCTGATATCT------------------AATAAGCAGG-----TTACTT-CGGAGATAGAAAAAGTTTATTGGTCCAGCTTGTTTCTTTTTC-GAGGTGAAGATTAAATCATAA---T--CT------T--------TTAACT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTACATGATG------AAGTACCCGA-------ATTAACTACCTACGTCATTTCAACTAAATCTCCAATCAACCGAGGGATTACCAACT----TTTGAAGGTTCTGCTGAGATAGTCCCTTGGCTTCTTCGGA---GTAG-CTGTACAACTTG-----ATTTGAGACCGCAACTTAA---GCCTGTCTTTCTCAA----ATCAAGAATTTAGCTAGATTTCGACGGAAAGAGAGAGAGGGAGAGACAACCCCGGGTAGGTAAAAATATAAAAAGGAAGGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGTTTAAATCCGTATAATTTGGTCGGA-AGCAAAATATGTAAACTACCTCAACTAT-TTTCTTGTCC-GG----TCTTTTG-------TTTGTAAGTTAGCCATTCATACCT----CTAA----TGTGCATGAATGGCTCGATCTGGCCTACCCTTTTTATACTTTAATCTA-----TTTTCTACAAGCAGTATTGTATCGAAAATATCGATAAAAGCGAGATCGGCGGT--------GAGAA--GTACCAAAGCTGAGAAATATACGTAATTGATTTCTAGTTAACTTTTATCCGT-AAATAA 'Oenotrichia tripinnata (Kessler 14352)' GGTGTTGGATTCAAAGCCGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCACCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT------------------------------------------------TAAAAT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA-----TATATATTATATTTTTGATCAAATTAATTTGGTGCAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTTTCC------AGAG-TTGTACGACTTG-----ATTTGAAACCGCGACTTCA---ACCTGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGAAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------ATTCC-AAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGATTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGATAATTGATGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCATC--CCCAAAATTGGGGCGG-CTCTCTCCTCCCT-----GAACGAGGGGAAAATAAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGCATA-AAAGTAATTTTG-ATATACG----CTTCCTTCTT-----------TTGAAGCGGGGG---AGGCAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATTTATGCGGACGAATTC-TCTCTTAGTTTTGT------------AC----TATTTAGCCTTCCTTTATCTTCATAAAGGAGCCGAATGGGCAGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAGGTAACCCCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATTTGGAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Oenotrichia tripinnata (van der Werff 13809)' GGTGTTGGATTCAAAGCCGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAACCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCCTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCTGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTTCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCGATTGTCATGCATGACTACCTGACCGGAGGGTTCACCGCAAACACCACCTTAGCTTTTTATTGTAGAGACAACGGGTTGCTTCTCCATATCCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTGGTAGGCAAACTAGAGGGGGAACGAGATGTAACCCTGGGTTTCGTCGATTTACTTCGCGATGATTACATTGAAAAAGATCGTAACCGTGGTATCTATTTCACGCAAGATTGGGTATCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTTGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGGCATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGCAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCGTTTAATCAATTACTAA-GTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA-----TATATATTATATTTTTGATCAAATTAATTTGGTGCAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTTTCC------AGAG-TTGTACGACTTG-----ATTTGAAACCGCGACTTCA---ACCTGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGAAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATTTGCACCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------ATTCC-AAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGATTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGATAATTGATGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCATC--CCCAAAATTGGGGCGG-CTCTCTCCTCCCT-----GAACGAGGGGAAAATAAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGCATA-AAAGTAATTTTG-ATATACG----CTTCCTTCTT-----------TTGAAGCGGGGG---AGGCAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATTTATGCGGACGAATTC-TCTCTTAGTTTTGT------------AC----TATTTAGCCTTCCTTTATCTTCATAAAGGAGCCGAATGGGCAGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCC?AGGTAACCCCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAA?TTGGAA-----------------------------------------------------------------------------------AAGCACTTCGCAAGAGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTTGCCCCCCCCGCCCATACCTCGCTTTA-----TTTACC{AC}CAAGCGATATTGCCTTAGACATATTGGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAATTGAATGA-------AACTGATTTCTAGTTAACTTCTATCTGT-AAATGA 'Olfersia cervina (Labiak 5220)' GGTGTTGGATTCAAAGCCGGTGTCAAAGATTATCGACTGAACTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTTATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGCGAAATCAAAGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCACGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCAATGCACGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCTGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATTATTACTCCCGCAAAGCTTAGTAATCATTTATGAAATTTTTAA-TTTAATCAAAT-----AATT-------------TGAAGGTCTCTACAATAA--AAA-CCTAAGCAAAGCAC----TTGGAATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTCTCGATCTAGCTTGTTCCTTTTTC-AGAGCAGAAATTTAATCACAA---T-TCTTCCCTAC--------TTATTT-----CATAGAA--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACGATA------AGGTATCCGA-------ATTACCCGTCCACGTCACCTCAAATAAGATCCTAATCAACCGAGGGATTACCTAATTACTCTTAGTGCTTCTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGACACCCCGATTCTA---GCCTATCCTTTTCAA----ATTGGCAATTTAGCTATATCTCGATAAGAAAGAGGAGAT----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATTTGCGTCATTCCCGTCACTCTTGTACTTCGAAAGTCGTATCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTAGGACG------ATT-------AAATAATAATTAGAAATCTATGGATAGACATCTAAGATATTTGCCTCATCGTCACTGAATCTTGGGTAGAA----AATCCAAGCTCGAAAGTTGCAGGTAGATCAATCTTGGTTTATCAGGATTATCAAGTCAAGCAC-------GTTAT--TGGTTAAACAATAACAATTGCTTTCGACTCGGTGAGAAATATTTACCTAAGGGTTTTTAGAAGTAGAAATAAAGAACGAAGTAAAT----GAAAAAGAGATTATTGAAACTA----------CTTCTTTTTTCGAAGGATCATCTAAG-AAGTATATCCACG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAAACCATTTATTGGAA-TTGGGGCGG-TTCCCTCCTCTTC-----GAACAGGGAAAAAAGGGGGGGGGG----CATTTATATCAATAT---GGGGGAAGCCTCGATCTCCATA-AGAATAATTTTG-CTATATA----CTCCTTTCAT-----------TTGAAACAGGGG---CTACGATCC--AC-CCA----TCTTTTGATT--GCTCCATTTTACTAAGTATAAAGTATATGCAGACGGATTT-GCCCCCAGTTTTGT------------AC----TATGTAGCCGTCCTTGATTTCCATAAGGGAGCCAAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGTCACAA-CCAGTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGATGATACTAAG-----AATCCCGG-AACC----CTAATCAAGTTAACCCCTTCACCCGCGGATTAGGTCGTGAACAAACTGGAGTTCTCGTTTGTTCACGATATTGGTAACTAATCTATAGTTGTTTGGATCCACATAATTTGTTAAGA-AACAATACATGGAAATTGCTTCAAACT--TTTTTTGTCT-GG----TCTTTCAAAAACAGTTTGCAAATGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCCCCTA----CATACTTCA-----TTTTCTACAAGCGATATTGTATTATACATATTGATAATAGTGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAAAA------------------------------------------- Phanerophlebia_nobilis_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAGTCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGCCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGGGAAGAAAACCAATATATCGCGTATGTAGCTTATCCCTTGGATCTATTCGAAGAAGGTTCCGTCACCAACTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCCAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGCGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGAGAAGTAAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGTTGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGGCAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCTTTACGCATGTCCGGTGGTGATCATATACACGCCGGAACTGTAGTAGGTAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTTGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTGCAGGCTCGTAATGAGGGTCGCGACCTTGCTC---------------------------------------------------------------TTTCATCATAA-----CAAT-------------TGGAGGTCTCTACAATGG--AAA-CCTAAGCAAACGAC----TTGACATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGTAAAAGTTTTTCGATCTAGCTTGTTCCTTTTTT-GGGGCAGAAATTAAATTGTAG---T--AA------T--------TTATTT-----CATAGAA--------ATATTCTATTTCTGAGCAAATTAATTTAGTAC---ATG------AAGTATCTGA-------ATTACCCGTCCACATCACTTCAACTAAATTTGT-----ACCGAGGGATTACCTATTTATTTTTATTGCTTCCATTGAGATGATCCTTCGGCTTCTCT------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACTCCA---GCCCGTCTCTTTCAA---------------------------------------------------------------------------------------------TGCGCCATTCCCGTTACTCTTGTACTTCGGAAGTCGTACCGGTTGATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTGGGACG------ATTCCAAAAAGAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGGAGAC----AATCCAAGCTCGGAAGTTGCAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACT------TTTTT--TGGTTAAGCAGTAGCAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAGGTAGAAATAAAGAACGAAGTAAT----GAAAAAAAAAATTGGTGAAACTC---------CCTTTTTTTTTCAAAGGATCATCTAGG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACACCATTTA--CAAA-TCGGGGCGG-CTCCCTCCTCTTC-----GGACGGGAGAGAAA-AGAGAGAAGCCCCCATATATTCCGATAT---AGAGGAAGTCTAAACCCACATA-GAAGTAATTTTG-ACATATG----CTCCCGTCGT-----------TTGAAACAAGGG---AAACAGTCC--AC-CCA----CTTTTCGATT--GTTC-ATATAACT-------AAATATATGCGGACAATTTA-TCCACCGATTTTGTACCAGATTTTTGAC----TATCTAGCCTTTCTCGATTTCCATAAGGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTAATATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCCGAG-----AATCCCGG-AGCT----C----------------------------------------------------------------------------------------------------------CTC------------------------------------TTCTCCGTGT-GG----TCTTTTGAAAACGATTTGCAAGTGAGCCATTCAGGTTT----TTAA----TATGCATGAATGGCTCAACCTAGTCCCCCCCA---------TAATTTA-----TCGACTACAGGCGATATTGTATTAAACATATCGATAGAAGCGAGATCAACGATTTGACTAGGTGAA--AAATTGGAGTTGAAAAATATACTTAACTGATTTCTAGTTAACTTCTAT----------- 'Pleocnemia irregularis (Sundue 2245)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTACCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGGCCGCCTCATGGTATTCAGGTTGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAACGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTATTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGCTTTACCGCTAATACCAGCTTAGCTATTTATTGTAGAGACAATGGGTTGCTCCTCCATATTCACCGTGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCACATACACGCTGGAACTGTAGTAGGAAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCGTTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTACTAAATCATTAA-TTTAATAAAATAATAGAATT-------------TGGAGATCTATACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATGCTGAAATGC------------------AATAAGCAGA-----TTACTT-CGGAAATGGTAAAAGTTTTTC----------------------GAAGCAAAAATAAAATCATAA---T-TTT---------------TTACTT-TATATATATATATATATAAATATGTCATTTTCAATTCAATTAATTTGGTACACGATC------AAGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTAAACCCCTAACCAACCGGGAGATTACCAATT----TTTGCTACTTCTACTGAGATAGCCCCTTGGCTTCTTTATCTTCAAAG-TTATACGACTTG-----ATTTGAAATCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGGCAGTTTAGTTAGATTTCTATGGAAAAAGAGAAAG------ACAACTGCGGGTAGATAAAAATAAAGAAAGGAAAGGGAGGGATTTACGCCATTCCCGTTACTCTTGTACTTTGCAAATCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACG------ATTCCAAAAAAAGGAAAAAGTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTCGATTAATCTTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TTTTTTATTGCTAAACAATAGCAATTGCTTCCAACTCGGTGGGAAATATTTCCCTAAGGATTTTTGAACGTAAAAATAAAGAACGAGGTAAAA--------AAAAAATTGGCAAAACTAATTTCCTCTTTTTTTTTCCTTAAAGGATGATCTAAG-AAGTATATTCATG-CTATATGAACAAAACATAAGCAAGACTGACATAGATTTTATGGATGCCTTTTACTAAAA-AGGGGGCGG-CTACCTCCTACTT-----GAACGATAGAAAAAGA-----AGATTTTCATAGATTTCAACCT---GGGGAAAGGCTCGATACGCGTA-AAAGTAATTTTT-GTATATG----CCCCCTCGCC-----------CTAAAGCGGAGG---AAACAGTCC--AC-GCA----TCTTTTGACT--GTTTCATTTTAATAAATATAAAATATATGCAAACGAATTT-TCTCTCAATTTTGT------------AC----TATTTAGCCTTCTTCTCCTTTCATGAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGTATTAGCGACGTCATAA-TCATTTG-TGTCGTCGACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Pleocnemia olivacea (WADE1991)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACAGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTACCCTTTGGATCTATTTGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGGCCGCCTCATGGTATTCAGGTTGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAACGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGCTTTACCGCTAATACCAGCTTAGCTATTTATTGTAGAGACAATGGGTTGCTCCTCCATATTCACCGTGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCACATACACGCTGGAACTGTAGTAGGAAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCGTTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTACTAAACCATTAA-TTTAATAAAC------AATT-------------TGGAGATCTATACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATGCTGAAATGC------------------AATAAGCAGA-----TTACTT-CGGAAATGGTAAAAGTTTTTC----------------------GAAGCAAAAATAAAATCATAA---T-TTTTTACTTT--------TTATATATATATATATAA--------ATATGTCATTTTCAATTCAATTAATTTGGTACACAATC------AAGTATCCAA-------ATTAATCGTCTACGTCATTTCAACTAAACTCCTAACCAACCGGGAGATTACCAATT----TTTGCTACTTCTATTGAGATAGCCCTTTGGCTTCTTTATCTTCAAAG-TTATACGACTTG-----ATTTGAAATCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGGCAATTTAGTTAGATTTCTATGGAAAAAGAGAAAG------ACAACTGCGGGTAGATAAAAATAAAGAAAGGAAAGGGAGGGATTTACGCCATTCCCGTTACTCTTGTACTTTGCAAATCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACG------ATTCCAAAAAAAGGAAAAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTCGATTAATCTTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TTGTT--TTGTTAAACAATAGCAATTGCTTCCAACTCGGTGGGAAATATTTTCCTAAGGATTTTTGAACGTAAAAATAAAGAACGAGGTAAAA--------AAAAAATTGGCAAAACTAATTTCCTC-TTTTTTTTCCTTAAAGGATGATCTAAG-AAGTATATTCATG-CTATATGAACAAAACATAAGCAAGACTGACATAGATTTTATGGATGCCTTTTACTAAAA-AGGGGGCGG-CTACCTCCTACTT-----GAACGATAGAAAAAGA-----AGATTTTCATAGATTTCAACCT---GGGGAAAGACTCGATACGCGTA-AAATTAATTTTT-GTATATG----CTCCCTCTCC-----------CTAAAGCGGAGG---AAACAGTCC--AC-GCA----TCTTTTGACT--GTTTCATTTTAATAAATATAAAATATATGCAAACGAATTT-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCTTCTCCTTTCATGAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGTATTAGCGACGTCATAA-TCATTTG?TGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAATGATACTAAGCTAAAAGTCCAGGAGGCC----CTGGTCGAGTTAACCCCTTCACCCATAAATTGGGTCGTGAACAAACTAAAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTAGAT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleocnemia presliana (Kuo 1955)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGGGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAGGGCCGATGCTACGATATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATTGCGTATGTAGCTTACCCTTTGGATCTCTTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTAAGAGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGGCCGCCTCATGGTATTCAGGTTGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTGGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAACGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACGGGAGGCTTTACCGCAAATACCAGCTTAGCTATTTATTGTAGAGACAATGGTTTGCTCCTCCATATTCACCGTGCGATGCATGCTGTGATTGACAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCACATACACGCTGGAACTGTAGTAGGAAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCCCTAACCGAAATTTTCGGGGACGATTCCGTATTACAGTTTGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCGTTAGAAGCTTGTGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATCATTTACTAAATCATTAA-TTTAGTAAAC------AATT-------------TGGAGATCTATACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATGCTGAAATGC------------------AATAAGCAGA-----TTACTT-CGGAAATGGTAAAAGTTTTTC----------------------GAAGCAAAAATAAAATCATAA---T-TTT---------------TTACTTTATACTTTATAT--------ATATGTCATTTTCAATTCAATTAATTTGGTACACGATC------AAGTATCCAAATTAATTATTAATTGTCTACGTCATTTCAACTAAACTCCTAACCAACCGGGAGATTACCAATT----TTTACTGCTTTTACTGAGATAGTCCTTTGGCTTCTTTATCTTCAAAG-TTATACGACTTG-----ATTTGAAATCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGGCAATTTAGTTAGATTTCTATGGAAAAATAGAAAG------ACAACTGCGGGTAGATAAAAATAAAGAAAGGAAAGGGAGGGATTTACGCCATTCCCGTTACTCTTGTACTTTGCAAATCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACG------ATTCCAAAAAAAGGAAAAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AAGCCAAGCTCGAAAGTTACAGGTCGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCAC-------TTTTTTATTGTTAAACAATAGCAATTGCTTTCAACTCGGTGGGAAATATTTTCCTAAGGATTTTTGAACGTAAAAATAAAGAACGAGGTAA-----AAAAAAAAAAATTGGCAAAACTAATTTCCTC-TTTTTTTTCCTTAAAGGATGATCTAAG-AAGTATATTCATG-CTATATGAACAAAACATAAGCAAGACTGACATAGATTTTATGGATGCCTTCTACTAAAA-AGGGGGCGG-CTACCTCCTACTT-----GAACG-----ATAGAAGAAGAAGATTTTCATAGATTTCAACCT---GGGGAAAGACTCGATACGCGTA-AAAGTAATTTTT-GTATATG----CTCCCTCTCT-----------CTAAAGCGGAGG---AAACAGTCC--AC-GCA----TCTTTTGACT--GTTTCATTTTAAT-------AAATATATGCAAACGAATTT-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCTTCTCTTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGTATTAGCGACGTCATAA-TCATTGGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAATAATACTAAGCTAAAAGTCTAGGAAGCC----CTGGTCAAGTTAACCCCTTCACCCATAAATTGGGTCGTGAACAAACTGAAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTAGAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Polybotrya alfredii (Moran 7612)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCTCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACTGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCAATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAACGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTCCAGGCTCGTAATGAAGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATTATTACTCCCGCAAAGCTTAGTGATCATTTATTAAGTTTTTGA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAATAA--AAA-CCTAAGCAAAGGAC----TTGGAATGATGAAATTC------------------AATAAGCAGATTACTTTACTT-AGGAAATGGCAAAATTTTCTTGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATCACAA---T-TTTATTTTTTATCTCTACTTACTT-----CATAAGA--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACAATA------AGGTATCCAA-------ATTAGCCGTCCACGTCACCTCAAATAAAATCCTAATCAACCGAGGGATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGGCTTG-----ATCTGAAACCCCGAATCTA---GCCTGTCCTTTTCAA----ATTGGCAATTTAGCTATATTTCGATAAGAAGTAAGAGAA----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTCACTCTTGTACGTCGAAAGTCGTACCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTAGGACG------ATTAAAAAAGAAGGAAAAATTAGAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTTACTGAACCTTGGGTAGAA----AATCCAAGCTCGGAAGTTGCAAGTAGATTAATCTTGGTTTATCAGGATTCTCAAGTCAAGCAC-------GTTAT--TGGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTACCTAAGGATTTTTGGAAGTAGAAATGAAGAACGAAGTAAAT----GAAAAAGAAATTGTTGAAACTAGTTCC----------TTTTTCGAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAAGCCATTT-TTGAAA-TTGGGGCGG-TTCTCTCCTCTTC-----GAACGGGAAAAAGGGGGGGGG------CCATCTAATCCAATAT---GGGGAAAGCCTCGACCCCCATA-AAAGTAATTTTG-CTATATG----CTCCTTTCGT-----------TTGAAACAGGGG---ACCCGATCC--AC-CCA----TCTTTTGATTATGCTCCATTTAACT-------AAGTATATGCAGACAAATTC-TCCCCCAGTTTTGT------------AC----TATGTAGCCTTCCTTAATTTCCATAAGGGAGCCAAATGGGCGGAAACTCCCATGTTTGGTTCTGAATTAGCGGCGTCACAA-CCATTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGATGATACTAAT-----AATTTTGT-AGCC----CTAATCGAGTTAACCCCTTCACCCACGGATTGGGTCGTGAACAAACTGAAGTTCTCGTTTGTTCACGAT-TTGGTAACTAATCTATAATTGTTTGGATCCACATAATTTGTTCAGA-AACAATATATGGAAATCGCTTCAAA{AC}TTATTTTTTGTCT-GG----TTTTTCAAAAACAGTTTGCAAGTGAGCCATTCAGACTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCCCTCCA-----TACTTTA-----TTTTCTACAAACGATATTGTATTATATATATTGATAAAAACGAGATCAACGATTTTACTGGGTAAA--GAGCTAGAGTTAAAAAATATACTTAATTGATTTCTAGGTAATTTGTATCCAC-AAATGA 'Polybotrya andina (Moran 6729)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCGCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATCGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTACCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCAATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTCCAGGCTCGTAATGAAGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATTATTACTCCCGCAAAGCTTAGTGATCATTTATTAAGTTTTTGA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAATAA--AAA-CCTAAGCAAAGGAC----TTGGAATGATGAAATTC------------------AATAAGCAGATTACTTTACTT-AGGAAATGGCAAAATTTTCCTGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATCACAA---T-TCTCTTTTTTATCTCTACTTACTT-----CATAAGA--------ATATTCCACTTCTGAGCAAATGAATTTGGTACACAATA------AGGTATCCAA-------ATTAACCGTCCACGTCACCTCAAGTAAAATCCTAATCAACCGAGGGATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGGCTTG-----ATCTGAAACCCCGAATCTA---GCCTGTCCTTTTCAA----ATTGGCAATTTAGCTATATTTCGATAAGAAGTAAGAGAA----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTCACTCTTGTACGTCGAAAGTCGTACCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAGACTTAGGACG------ATTAAAAAAGAAGGAAAAATTATAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTTACTGAACCTTGGGTAGAA----AATCCAAGCTCGACAGTTGCAAGTAGATTAATCTTGGTTTATCAGGATTCTCAAGTCAAGCAC-------GTTAT--TGGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTACCTAAGGATTTTTGGAAGTAAAAATGAAGAACGAAGTAAAT----GAAAAAGAAATTGTTGAAACTAG----------TTCCTTTTTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAAGCCACTT-TTGAAA-TTGGGGCGG-TTCTCTCCTCTTC-----GAACGGGAAAAAGGGGGGGG-------CCATCTAATCCAATAT---GGGGAAAGCCTCGACCCCCATA-AAAGTAATTTTG-CTATATG----CTCCTTTCGT-----------TTGAAAAAGGGG---ACCCGATCC--AC-CCA----TCTTTTGATTGTGCTCCATTTAACT-------AAGTATATGCAGACAAATTC-TCCCCCAGTTTTGT------------AC----TATGTAGCCTTCCTTAATTTCCATAAGGGAGCCAAATGGGCGGAAACTCCCATGTTTGGTTCTGAATTAGCGGCGTCACAA-CCATTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAATGATAATAAT-----AATTTTGT-AGCC----CTAATCAAGTTAACCCCTTCATCCACGGATTGGGTCGTGAACAAACTGAAGTTCTCGTTTGTTCACGAT-TTGGTAACTAATCTATAATTGTTTGG{AG}TCC{AC}CATAATTTGTTCAGA-AACAATATATGGAAATCGCTTCAAACT--TTTTTTGTCT-GG----T{CT}TTTCAAAAACAGTTTGCAAGTGAGCCCTTCAGACTT----TTAA----TATGAATGAATGG{CG}TCAATCTAGCCCCCTCCA---------TACTTTA-----TTTTCTACAAACGATATTGTATTATATATATTGATAAAAACGAGATCAACGATTTTACTAGGTAAA--GAGCTAGAGTTAAAAAATATACTTAATTGATTTCTAGGTAATTTGTATCCAC-AAATGA 'Polybotrya pubens (Moran 6063)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCCCAACCCGGAGTACCGGCTGAGGAAGCTGGAGCCGCGGTAGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCCGGAGAGGAAAATCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATTGGACCACCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTTTGTCTGCTAAAAATTATGGTAGAGCCGTCTATGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAACCATTCA{AT}GCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAGAGAGCTGTTTTCGCTAGAGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCAGCTTAGCTTATTACTGCAGAGACAATGGGCTGCTTCTCCATATTCACCGCGCAATGCATGCTGTGATCGATAGACAACGAAATCACGGCATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGCGGAGATCATGTACACGCTGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAGGATCGTAGTCGTGGTGTCTATTTCACACAAGATTGGGTGTCTATGCCGGGTGTAATCCCCGTAGCTTCGGGGGGTATTCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAAGGTCGTGACCTCGCTCGTGAAGGTAATCAAATTATTATTACTCCCGCAAAGCTTAGTGATCATTTATTAAGTTTTTGA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAATAA--AAA-CCTAAGCAAAGGAC----TTGGAATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAATTTTCTTGATCTAGCCTGTTCCTTTTTC-GGAGCAGAAATTTAATCACAA---T-TCTCTTTTTTATCTCTACTTACTT-----CATAAGA--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACAATA------AGGTATCCGA-------ATTAACCGTCCACGTCACCTCAAATAAAATCCTAATCAACCGAGGGATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGGCTTG-----ATTTGAAATCCCGAATCTA---GCCTGTCCTTTTCAA----ATTGGCAATTTAGCTATATTTCGATAAGAAGTAAGAGAA----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTCACTCTTGTACGTCAAAAGTCGTACCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTAGGACG------ATT-AAAAAAGAGTAAAAATTAGAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTTACTGAACCTTGGGTAGAA----AATCCAAGCTCGAAAGTTGCAAGTAGATTAATCTTGGTTTATCAGGATTCTCAAGTCAAGCAC-------GTTAT--TGGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTACCTAAGGATTTTTGGAAGTAGAAATGAAGAACGAAGTAAAT----GAAAAAGAAATTGTTGAAACTAGTTCC----------TTTTTCGAAGGATCATCTAAG-AAGTATATCC{AC}TG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAATCCGTTT-TTGAAA-TTGGGGCGG-TTCTCTCCTCTTC-----GAACGGGAAAAAGGGGGGGGGGGG---CCATCTAATCCAATAA---GGGAAAAGCCTCGACCCCCATA-AAAGTAATTTTG-CTATATG----CTCCTTTCGT-----------TTGAAACAGGGG---ATCCGATCC--AC-CCA----TCTTTTGATTGCGCTCCATTTCACT-------AAGTATATGCAGACAAATTC-TCCCCCAGTTTTGT------------AC----TATGTAGCCTCCCTTAATTTCCATAAGGGAGCCAAATGGGCGGAAACTCCCATGTTTGGTTCTGAATTAGCGGCGTCACAA-CCATTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGATGATACTAAG-----AATCCCGG-AGCC----CTAATCAAGTTAACCCCTTTACCCACGGATTGGGTCGTGAACAAACTGGAGTTCTCGTTTGTTCACGAT-TTGGTAACTAATCTATAA--------------------------------------------------------------------------------CACAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAATATGCATGAATGAATGGCTCAATCTAGCCCCCTCCA---------TACTTTA-----TTTTCTACAAATGATATTGTATTATATAT{AT}TTGATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAAAAAAAGCT------------------------------------------------ Polystichum_andersonii_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTATGACATCGAACCCGTCGCCGGGGAAGAAAACCAATATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCTATCGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGCGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGAGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAGGAAATGTTGAAGAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGTAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGGCAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGTAAACTGGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTACAGTTCGGTGGAGGAACCTTAGGACATCCTTGGGGAAACGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTC----------------------------------------------------------------------------------T-------------TGGAGGTCTCTGCAATGG--AAA-CCTAAGCAAAGGAC----TTGAGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGCAAAAGTTTTTTGATCTAGCTTGTTCCTTTATTTGGGGCAAAAATTAAATCATAA---T-AAT---------------TTACTT-----CATAGAA--------CTATTCTACTTCTGAGCAAATTAATTTAGTACATG---------AAGTATCTGA-------ATTACCCGTCCACATCACTTCAACTAAATCCGT-----ACTGAGGGATTACCTATTTATTTTTATTGCTTCTACTGAGACGATCCTTCGGCT-----------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACTCCA---GCCCGTCTTCTTCAA----ATCGGCAAG--------------------------------------------------------------------------------TGCGCCATTCCCGTTACTCTCGTACTTCGGAAGTCGTACTGGTTGATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTGGGACG------ATTCCAGAAAGAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAGATAA----AATCCAAGCTCGGAAGTTACAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACT------TTTTT--TGGTTAAGCAGTAGCAGCTGCTTTCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAGGTAGAAATAAAGAACGAAGTAAAT---AGAAATGAAAATTGGTGAAACTAAT-------TTTTATTTTTTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGGCCAAGACGTAAGCAAGACTGACATAGATTTTATGGACGCCATTTACTAAAA-TTGGGGCGG-CTCTCTCCTGTTC-----GGACGGGGGAAAAA-AGAGAGAAGCCCCCGTATATTCCGATAT---AGAGGAAGTCTAAATCCCCGTA-GAAGTAATTTTG-ACATACG----CTCCCTTCGT-----------TTGAAACAAGGG---AGACAGTCC--AC-CCA----TTTTTTTATT--GTCCCATTTAACT-------AAATATATGCGGACAAAATC-TCCACCGATTTTGTACCAGATTTTATAC----TACCTAGCTTCCCTCGATTTCCATAAGGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTC------------------------------------TTTTCCGTGT-GG----TCTTTTGAAAACGATTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAGCCTAGTCCCCCCA----------TAAGTTA-----TTGACTACAAGCGATATTGTATTAAACATATCAATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAGAAATATACTTAACTGATTTTT------------------------ Polystichum_munitum_GB --------------------------------TCGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTATGACATCGAACCCGTCGCCGGGGAAGAAAACCAATATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCTATCGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGCGGACTTGA-TTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACAGGAGAAATTAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAGGAAATGTTGAAGAGAGCTGTTTTCGCTAGGGAGTTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCAGCTTAGCTTATTACTGTAGAGACAATGGGCTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATCGATAGGCAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGGGATCATATACACGCCGGAACTGTAGTAGGTAAACTGGAGGGAGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAAAAAGATCGTAGTCGTGGTATCTATTTCACACAAGATTGGGTATCTATGCCGGGTGTACTCCCCGTAGCTTCGGGGGGTATCCACGTCTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGACGACTCCGTATTGCAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAACGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTC---------------------------------------------------------------ATTAATCAAAA-----AAAT-------------TGGAGGTCTCTGCAATGG--AAA-CCTAAGCAAAGGAC----TTGAGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGCAAAAGTTTTTTGATCTAGCTTGTTCCTTTATTTGGGGCAAAATTTAAATCATAA---T-AAT---------------TTACTT-----CATAGAA--------CTATTCTACTTCTGAGCAAATTAATTTAGTACATG---------AAGTATCTGA-------ATTACCCGTCCACATCACTTCAACTAAATTCGT-----ACTGAGGGATTACCTATTTATTTTTATTGCTTCTACTGAGACGATCCTTCGGCT-----------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACCCCA---GCCCGTCTTCTTCAA----ATCG-------------------------------------------------------------------------------------TGCGCCATTCCCGTTACTCTCGTACTTCGGAAGTCGTACTGGTTGATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTGGGACG------ATTCCAGAAAGAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTCGCCTCATCGTCACTGAACCTTGGAGATA-----AATCCAAGCTCGGAAGTTACAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACT------TTTTT--TGGTTAAGTAGTAGCAGCTGCTTTCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAGGTAGAAATAAAGAACGAAGTAAAT---AGAAATAAAAGTTGGTGAAACTAAT-------TTTTATTTTTTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGGCCAAGACGTAAGCAAGACTGACATAGATTTTATGGACGCCATCTACTAAAA-TTGGGGCGG-CTCCCTCCTGTTC-----GGACGGGAGAGAAG-AGAGAGAAGCCCCCGTATATTCCGATAT---AGAGGAAGTCTAAATCCCCGTG-GAAGTAATTTTG-ACATACG----CCCCCTTCGT-----------TTGAAACAAGGG---AGGCAGTCC--AC-CCA----TTTTTTGATT--GTCCCGTTTAACT-------AAATATATGCGGACAAAATC-TCCACCGATTTCGTACCAGATTTTCTAC----TACCTAGCTTCCCCCGATTTCCATAAGGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGAGATTATAA-CCATTTATTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTC------------------------------------TTCTCCGTGT-GG----TCATTTGAAAACGATTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCATCCTAGTCCCCCCA----------TAACTTA-----TTGACTACAAGCGATATTGTATTAAACATATCAATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAGAAATATACTTAACTGATTTCT------------------------ 'Rumohra adiantiformis (Jansen & Rouhan 2550)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGAGACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAATCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTTGAAGAAGGTTCCGTCACCAATATGTTAACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGTGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAGGCTCTTTTTAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGCGAAGAAATGCTCAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCACCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATGTACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAGCGAGAAGTAACCCTGGGTTTCGTCGATTTGCTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGATGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACCGCTCCCGTTACCCTTGTACTTTGAAAGTCGTACTAATTAGTGACGAAGCAGGATGAGTTCGGTATGCTAAAAACTTGGTACA------ATT----AAAAAAGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAT----AATCTGAGCTCAAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAA-------TTTTTTTTGGTTAAACGATAACAATTGTTTCCGACTCGGTGAGAAATATTTTCCTACGGATTCCTTAAAGTAGAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTC-----TCTCCTTTTTCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACTCAAA-TTGGGGCGG-ATCGCTACTCCTT-----GAACGAGGGAAATCGAGAAAAAAGTACCCATATATTTCAATAT---GAAGGAAGCCTCGATAGCCATA-AAAATAATTTTG-ATATACG----CCTCTTCCCTTTGAATGAAACTTGAAACGGGGG---AGATCGTCC--AC-CCA----CCTTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAATTTTGT------------AG----TACTTAGCCTTCCT----TTCCATAAAGGAGCCGAATGGGAGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCCGGTGACGTTAAG-----AATCCCCT-AGCC----CTAGCCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCCTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGTGAAATACGTAAACCACTTGAATTCC-TTTTTTGTCT-GG----TCTTTCAGAAAGAGTTTGCAAGTGAGCCATTCAGGACT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGTCCATACTTTACTTTA-----TTTACTACAAGCGATACTTTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAAGTAAA--AAATTACAGTTGAAAAATATACTTAACTGATTTCTAGTTAACCCTTATCTGT-ATCTGT 'Rumohra adiantiformis (Kessler sn)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAATCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAGAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAGGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCACCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAGCGAGAAGTAACCCTAGGTTTCGTCGATTTGCTTCGCGATGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGTGGTATCCATGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGATGATTCCATATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATTTTTTACTAAATTATTAA-TTTAATAAAAT-----TAAT-------------TGGAGGTCTCTACAACGA--AAG-CTTAAGCAAAAGAC----TTGGGATGGTGAGATTC------------------AATAAACAGA-----TTACTT-AGGAAATGGTAAAAGTTTCTCGGTCTAACTCGTTC------------CAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATAAAGTTTTTGATCAAATTAATTTGGTACATTTTG------AAGTATCCAA-------ATTAATTGTCTACGTCATTTCGACTGAATCCCTAATCAACCGAGGGATTACCTATT----TTTATTGCTTCTATTGAGATGGTTCTTCGGTTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGGGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGACGGAAAACTATAAAA------ACAACCTCGGGTACGTAAAAATATAAAAAGGAAAGGGAGGGATTAGTGCCGCTCCCGTTACCCCTGTACTTTGAAAATCGTACTGATTAGTGACGAAGCAGGATGAGTTCGGTATGCTAAAAACTTGGTACA------ATT----AAAAAAGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAT----AATCTAAGCTCAAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTACCAAGTCAAGCAT-------TTTTT--TGGTTAAACAGTAACAATTGTTTCCGACTCGGTGAGAAATATTTACCTAAGGATTCCTGAAAGTAGAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTTAATTCTCTCCTTTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACTCAAA-TTGGGGCGG-ATCCCTACTCCTT-----GAACGAGGGAAATCGAGAAAGAAGTACCCATATATTTCAATAT---GAAGGAAGCCTCGATAGCCATA-AAAATAATTTTG-ATATACG----CCCCCTCCCTTTGAATGAAACTTGAAACGGGGG---AGATCGTCC--AC-CTA----CCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTATCAATTTTGT------------AG----TACTTAGCCTTCCT----TTCCATAAAGGAGCCGAATGGGAGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGA-ACGGGTTCGATTCCCCCTACACGCCGGTGACGTTAA------ACCCCCCT-AGCC----CTAGCCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCCTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Rumohra adiantiformis (Prado & Hirai 2022)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAATCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATATGTTAACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAGGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCACCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTAATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTGCTTCGCGACGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGATGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCTAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGCAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATTTTTTACTAAATTATTAA-TTTGATAAAAT-----TAAT-------------TGGAGGTCTCTACAACGA--AAG-CTTAAGCAAAAGAC----TTGGGATGATGAAATTC------------------AATAAACAGA-----TTACTT-AGGAAATGGTAAAAGTTTCTCGTTCTAACTTGTTC------------CAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATCAAATTCATTTGGTACATGATA------AAGTATCCAA-------ATTAATCGTCTACGTCATTTCGACTGAATCCCTAATCAACCGAGGGATTACCTATT----TTTCTTGCTTCTATTGAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGGGACTCCA---GCCCGTCTTCTTCAA----ACCGACAATTTAGCTAGATTTCGACGGAAAACTATAAAA------ACAACCTCGGGTACGTAAAAATATAAAAAGGAAAGGGAGGGATTTGTGCCGCTCCCGTTACCCTTGTACTTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATGAGTTCGGTATGCTAAAAACTTGGTACA------ATT----AAAAAAGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAT----AATCTAAGCTCAAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAT-------TTTTT--TGGTTAAACAGTAACAATTGTTTCCGACTCGGTGAGAAATATTTCCCTAAGGATTCCTGAAAGTAGAAATAAAGAACGAAGTAAAA---AAGAAAGAGGATTGGTGAAACTAATTC-----TCCCCTTTTTCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTAATCAAA-TTGGGGCGG-ATCCCTACTCTTT-----GAACGAGGGAAATCGAGAAAGAAGTACCCATATATTTCAATAT---GAAAGAAGCCCCGATAGCCATA-AAAATAATTTTG-ATATACG----CCCCCTCCCCTTGAATGAAACTTGAAACGGGGA---AGATCGTCC--AC-CCA----CCTTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAATTTTGT------------AG----TACTTAGCCTTCCTTG----CCATAAAGGAGCCGAATGGGAGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCCGGTGACGTTAAA-----AATCTCCT-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCCTGTTTGTTCACGAT-TTGGTCACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGTGAAATACGTAAACCACTTTAATTCC-TTTTTTGTCT-GG----TCTTTCATAAAGAGTTTGCAAGTGAGCCATTCAGGCCT----TTAA----TGTGCATGAATGGCTCAATCTGGACTCCCCCGTCCATACTTTACTTTA-----TTTACTACAAGCGGTACTCTATTAGATATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAATTACAGTTGAAAAATATACTTAACTGATTTCTAGTTAACCCTTATCTGT-ATCTGT 'Rumohra berteroana (Danton 1964)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGGCTGACCTATTACACCCCCGAGTACAAGACCAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTGGCTGCAGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAATCTTGACCGCTACAAGGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAAGAAAATCAGTATATCGCGTACGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTTAAAGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAAACTTTCATTGGACCGCCTCACGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCAGAGGCTCTTTTCAAATCCCAGGCTGAAACAGGCGAAATCAAGGGGCATTACTTAAATGCTACTGCAGGTACGTGTGAAGAAATGCTCAAGAGAGCTGTTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACTGCAAATACCACCTTAGCTTTTTATTGTAGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGAAATCACGGTATACATTTTCGTGTATTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCCGGAACTGTAGTAGGCAAACTAGAGGGGGAGCGAGAAGTAACCCTGGGTTTCGTCGATTTGCTTCGCGATGATTACATTGAAAAAGATCGTAGCCGTGGTATCTATTTCACACAAGATTGGGTCTCTATGCCGGGTGTATTCCCCGTAGCTTCGGGGGGTATCCATGTCTGGCACATGCCTGCTCTAACCGAAATTTTCGGGGATGATTCCATATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTATTCCCGCAAAGCTTAGTGATTTTTTACTAAATTATTAA-TTTAATAAAAT-----TAAT-------------TGGAGGTCTCTACAACGA--AAG-CTTAAGCAAAAGAC----TTGGGATGATAAAATTC------------------AATAAACAGA-----TTATTT-AGGAAATGGTAAAAGTTTCTCGGTCTAACTTGTTC------------CAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTAAATTTTTGATCAAATTAATTTGGTACATGATG------AAGTATCCAA-------ATTAATCGTCTACGTCATTTCGACTGAATCCCTAATCAACCGAGGGATTACCTATT----TTTATTGCTTCTATTGAGATGGTTCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGGGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGACGGAAAACTATAAAA------ACAACCTCGGGTACGTAAAAATATAAAAAGGAAAGGGAGGGATTCGTGCCGCTCCCGTTACCCTTGTACTTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATGAGTTCGGTATGCTAAAAACTTGGTACA------ATT----AAAAAATAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAT----AATCTAAGCTCAAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAT-------TTTTT--TGGTTAAACAGTAACAATTGTTTCCGACTCGGTGAGAAATATTTCCCTAAGGATTCCTGAAAGTAGAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTTAATTCTCTCCTTTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACTCAAA-TTGGGGCGG-ATCCCTACTCCTT-----GAACGAGGGAAATCGAGAAAGAAGTACCCATATATTTCAATAT---GAAGGAAGCCTCGATAGCCATA-AAAATAATTTTG-ATATACG----CCCCCTCCCTTTGAATGAAACTTGAAACGGGGG---AGATCGTCC--AC-CTA----CCTTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAATTTTGT------------AG----TACTTAGCCTTCCT----TTCCATAAAGGAGCCGAATGGGAGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCCGGTGACGTTAAA-----AATCCCCT-AGCC----CTAGCCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCCTGTTTGTTCACGAT-TTGGTAACTAATCTGGAGTTGTTTGGATCCGCATAATTTGTTCGGA-AGTGAAATACGTAAACCAC---AATTCC-TTTTTTGTCT-GG----TCTTTCATAAAGAGTTTGCAAGTGAGCCATTCAGGCCT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGTCCATACTTTACTTTA-----TTTACTACAAGCGATACTTTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAATTACAGTTGAAAAATATACTTAACTGATTTCTAGTTAACCCTTATCTGT-AAATGA 'Stigmatopteris ichtiosma (Moran 6752)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACTCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCTTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCCGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTATAAGGGCCGATGCTACGACCTTGAACCCGTCGCTGGAGAGGAGAACCAGTACATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATATGTTAACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAAAGAGCTGTTTTTGCTAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCTCCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTACTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCAGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGACGATTACATTGAAAAAGACCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCCATGCCAGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGATGATTCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTACTCCCGTAAAGCCTAGTGATTATTTACTAAATTTTTAA-TTGAATCAAAT-----AATT-------------TGAAGGTCTCTACGATGA--AAA-CCTAGGCAAAGGAT----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAGGTTTCTCGATCTAGCTTGTTCCCTTTTT-GGAGCATAAATTCAATCATAA---T-TTT---------------TTACTT-----TGTATAA--------ATCTTTTAATTTTGAGCCAATTAATTTGGTACACGATG------ACGTATCCAA-------ATTACCCGTCCACGTCACTTCAACTAAATTTCCAATCAGCCAAGGGATTACCTATT----CCTATTGCTTTTACCGGGATGGTC----GGCTTCTTT------AAGGTTTGGACGACTCG-----ATTTGAAACCCCGACTCCA---GTTGATCCTTCTCAA----ATCGGTAATTTAGCTAGATTTCAATAAAGTAAAAGAAAG------ATAACCTCGGGTAGGTAAAAATGGAGAAGGGAAAGGGAGGGATTTGCGCCATTCCCGTTATTCCGGTACTTCGGAAGTCGTACCGGTTAATGACGAAGCTGGATTATTTTGGTATGCAAAAAACTTTGTACG------ATTCCAAAAAAAATAAAAATTGGGAATCCATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAAAC----AGTCCAAGCTCGAAAGTGACAGGTGGATCTTTCTTGGTTTATCAAGATTATCAAGTCAAGCAC-------TTCTT--TTGCTAAACAGTAACAATTGCTTCCAACTCGGTGAGAAATATTGACCTAAGGATTTTTGGAAGTAGAAATAAAGAACGAAGTAAAT---AAAAAGAAAAATTGGTGAAACTAATTATTTA-TTTTTATTTTTCAAAGGATAATCTAAG-AAGTATACCCACG-CTATATGGCCAAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCGTTTACCCGAA-TTGGGGTAG-CTCCCTACTCTTT-----GAAAGGGAGGAAAAAAG-GGGAAGCTCCCATATATTCCAACAT---GGAGGGAGCCTTGATCCCCATA-AAAATAATTTGGAATATATG----GGAGCTTCGT-----------TTAAAACAGGGG---ATACAGTAC--AC-TTA----TCTTTTGATT--GTTCCATATAACT-------AAATATATGCAGACAAATTC-TCCACCAGTTTTAA------------AT----TACTTAGCATTCCTCCCCTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCACAA-CCA?TTGTCGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATACTAAG-----AATCCCGG-AGCC----CTAGTCAAATTAAACCCTTCACCCATGGATTGGGTCGTGAACAAACTGAAATTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAGTTGTTCGGATCCACATAATTTGTTCAGA-AGCAAAAGTCGGAAACCACTTTTAAACT-TTTCTTATCT-GT----TCTTCGGTAAACGGTTTGCAAGTGAGCCATTCAAGCTT----TTAA----TATGCATAAATGGCTCATTCTAGCCCCCTCCA---------TACTTTA-----TTTACTGTAAGCAATACCGTGCTAAACATATTGATAAAAGCGAGATTAACGGTTTGACTAGGTAAA--AAACTAAAGTTGAAAAATAGACTTAACTGATTTCTAGTTAACTTTTATCCGT-AAATGA 'Stigmatopteris killipiana (Moran 6924)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACTCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCTTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCCGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACCTTGAACCCGTCGCTGGAGAGGAGAACCAGTACATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTTACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGAGAAATCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGTTGAAAAGAGCTGTTTTTGCTAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCTCCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCCGTAATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTACTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCAGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGACGATTACATTGAAAAAGACCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCCATGCCAGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGATGATGCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTACTCCCGTAAAGCCTAGTGATTATTTACTAAATTTTTAA-TTGAGTCAAAT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCTAGGCAAAGGAT----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAGGTTTCTCGATCTAGCTTGTTCCCTTTTT-GGAGCATAAATTCAATCATAA---T-TTT---------------TTACTT-----TGTATAA--------ATATTTTAATTTTGAGCAAATTAATTTGGTACACGATG------ACGTATCCAA-------ATTACCCGTCCACGTCACTTCAACTCAATTTCCAATCAGCCAAGGGATTACCTATT----CCTATTGCTTTTACCGGGATGGTC----GGCTTCTTT------AAGGTTTGGACGACTCG-----ATTTGAAACCCCGACTCCA---GTTGATCCTTCTCAA----ATCGGTAATTTAGCTAGATTTCAATAAAGTAAAAGAAAG------ATAACCTCGGGTAGGTAAAAATGGAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTATTCCGGTACTTCGGAAGTCGTACCGGTTAATGACGAAGCTGGATTATTTTGGTATGCAAAAAACTTTGTACG------ATTCAAAAAAAAATAAAAATTGGGAATACATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAAAC----AGTCCAAGCTCGAAAGTGACAGGTGGATCTTTCTTGGTTTATCAAGATTATCAAGTCAAGCAC-------TTCTT--TTGCTAAACAGTAACAATTGCTTCCAACTCGGTGAGAAATATTGACCTAAGGATTTTTGGAAGTAGAAATAAAGAACGAAGTAAAT---AAAAAGAAAAATTGGTGAAACTAATTATTTA-TTTTTATTTTTCAAAGGATAATCTAAG-AAGTATACCCACG-CTATATGGCCAAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATTTACCCGAA-TTGGGGTAG-CTCCCTACTCTTT-----GAAAGGGAGGAAGAAAG-GGGAAGCTCCCATATATTCCAACAT---GGAGGGAGCCTCGATCTCCATA-AAAGTAATTTTGAATATATG----TTCCCTTCGT-----------TTAAAACAGGGG---ATACAGTAC--AC-CCA----TCTTTTGATT--GTTCCATATAACT-------AAATATATGCAGACAAATTC-TCCACCAGTTTTCA------------AT----TACTTAGCATTCCTCCCCTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTCGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATACTAAG-----AATTCCAG-AGCC----CTAGTCAAATTAAACCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAATTCTTGTTTGTTCACGAT-TTGGTA-----TCTGTAG------------------------CAGA-AGCAAAAGTCGGAAACCACTTTTAAACTTTTCCTTATCT-GT----TCTTCGGTAAACGGTTTGCAAGTGAGCCATTCAAGCTT----TTAA----TATGCATAAATGGCTCATTCTAGCCCCCTCCA---------TACTTTA-----TTTACTGTAAGCAATACCGTGCTAAACATATTGATAAAAGCGAGATTAACGTTTTGACTAGGTAAA--AAACTAAAGTTGAAAAATAGACTTAACTGATTTCTAGTTAACTTTTATCCGT-AAATGA 'Stigmatopteris lechlerii (Moran 6942)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACTCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCTTTCAGAATGACCCCACAACCTGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCCGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACCTTGAACCCGTCGCTGGAGAGGAGAACCAGTACATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATATGTTAACCTCCATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTCACAAAAGATGATGAAAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGGGAAATCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGATGAAAAGAGCTGTTTTTGCTAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCTCCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCCGTGATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTACTGGCCAAAGCATTACGCATGTCCGGTGGAGATCATATACACGCAGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGACGATTACATTGAAAAAGACCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCCATGCCAGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGATGATGCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTACTCTCGTAAAGCCTAGTGATTATTTACTCAATTTTTAA-TTGAATCAAAT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCTAGGCAAAGGAT----TTGGGATGATGAAATTC------------------AATAAGCGGA-----TTACTT-AGGAAATGGCAAAGGTTTCTCGATCTAGCTTGTTCCCTTTTT-GGAGCATAAATTCAATCATAA---T-TTT---------------TTACTT-----TGTATAA--------ATATTTTAATTTTGAGCGAATTAATTTGGTACACGATG------ACGTATCCAA-------ATTACCCGTCCACGTCACTTCAACTAAATCTCCAATCAGCCAAGGGATTACCTATT----CCTATTGCTTTTACCGGGATGGTC----GGCTTCTTT------AAGGTTTGGACGACTCG-----ATTTGAAACCCCGACTCTA---GTTGATCCTTCTCAA----ATCGGTAATTTAGCTAGATTTCAATAAAATAAAAGAAAG------ATAACCTCGGGTAGGTAAAAATGGAGAAGGGAAAGGGAGGGATTTGCGCCATTCCCGTTATTCCGGTACTTCGGAAGTCGTACCGGTTAATGACGAAGCTGGATTATTTTGGTATGCAAAAAACTTTGTACG------ATTCAAAAAAAAATAAAAATTGGGAATCCATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAAAC----AGTCCAAGCTCAAAAGTGACAGGTGGATCTTTCTTGGTTTATCAAGATTATCAAGTCAAGCAC-------TTCTT--TTGCTAAACAGTAACAATTGCTTCCAACTCGGTGAGAAATATTGACCTAAGGATTTATGGAAGTAGAAATAAAGAACGAAGTAAAT---AAAAAGAAAAATTGGTGAAACTAATTATTTA-TTTTTCTTTTTCAAAGGATAATCTAAG-AAGTATACCCACG-CTATATGGCCAAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATTTACCCGAA-TTGGGGTAG-CTCCCTACTCTTT-----GAAAGGGAGGAAAAAAG-GGGAAGCTCCCATATATTCCAACAT---GGAGGGAGCCTCGATCCCCATA-AAAGTAATTTTGAATATATG----CTCCCTTCGT-----------TTAAAACAGGGG---ATACAGTAC--AC-CCA----TCTTTTGATT--GTTCCATATAACT-------AAATATATGCAGACAAATTC-TCCACCAGTTTTAA------------AT----TACTTAGCATTCCTCCCCTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTCGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATACTAAG-----AATCCCGG-AGCC----CTAGTCAAATTAAACCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAATTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAGTTGTTCGGATCTACATAATTTGTTCAGA-AGCAAAAGTTGGAAACCACTTTTAAACT-TTTCTTATCT-GT----TCTTCGGTAAACAGTTTGCAAGTGAGCCATTCAAGCTT----TTAA----TATGCATGAATGGCTCATTCTAGCCCCCTCCC---------TACTTTA-----TTTACTGTAAGCAATACCGTGCTAACCATATTGATAAAAGCGAGATTAACGGTTTGACTAGGTAAA--AAACTAAAGTTGAAAAATAGACTTAACTGATTTCTAGTTAATTTTTATCCGT-AAATGA 'Stigmatopteris sordida (Moran 6946)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACTCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCTTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCCGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACCTTGAACCCGTCGCTGGAGAGGAGAACCAGTACATTGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAGGCTCTACGCGCTTTACGCCTGGAAGACCTTCGAATTCCTCCTGCTTATTCTAAAACTTTCATGGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGCGGTGGACTTGATTTTACAAAAGATGATGAGAATGTGAATTCCCAGCCATTCATGCGTTGGAGAGATCGCTTCTTATTCGTAGCAGAAGCTCTTTTCAAATCCCAGGCTGAAACGGGAGAAATCAAGGGGCATTACTTAAATGCTACTGCGGGTACGTGTGAAGAAATGTTGAAAAGAGCTGTTTTTGCTAGAGAGTTGGGCGCACCAATTGTCATGCATGACTACCTGACCGGAGGGTTTACCGCAAATACCTCCTTAGCTTTTTACTGCCGAGACAATGGGCTGCTTCTCCATATTCACCGTGCGATGCATGCCGTAATCGATAGACAACGAAATCACGGTATGCATTTTCGTGTACTGGCCAAAGGATTACGCATGTCCGGTGGAGATCATATACACGCAGGAACTGTAGTAGGCAAACTAGAAGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGGGACGATTACATTGAAAAAGACCGTAGTCGCGGTATCTATTTCACACAAGATTGGGTATCCATGCCAGGTGTAATCCCCGTAGCTTCGGGGGGTATCCACGTTTGGCACATGCCTGCTCTAACCGAAATCTTCGGGGATGATGCCGTATTACAGTTCGGTGGAGGAACCTTGGGACATCCTTGGGGAAATGCACCTGGTGCGGTAGCCAACCGAGTCGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGCGACCTCGCTCGTGAAGGTAATGAAATTATTATTACTCCCGTAAAGCCTAGTGATTATTTACTAAATTTTTAA-TTGAATCAAAT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCTAGGCAAAGGAT----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAAGGGCAAAGGTTTCTCGATCTAGCTTGTTCCCTTTTT-GGAGCATAAATTCAATCATAA---T-TTT---------------TTACTT-----TGTATAA--------ATATTTTAATTTTGAGCAAATTAATTTGGTACACGATG------ACGTATCCAA-------ATTACCCGTCCACGTCACTTCAACTCAATTTCCAATCAGCCAAGGGATTACCTATT----CCTATTGCTTTTACCGGGATGGTC----GGCTTCTTT------AAGGTTTGGACGACTCG-----ATTTGAAACCCCGACTCCA---GTTGATCCTTCTCAA----ATCGGTAATTTAGCTAGATTTCAATAAAGTAAAAGAAAG------ATAACCTCGGGTAGGTAAAAATGGAGAAAGGAAAGGGAGGGATTTGCGCCATTCCCGTTATTCCGGTACTTCGGAAGTCGTACCGGTTAATGACGAAGCTGGATTATTTTGGTATGCAAAAAACTTTGTACG------ATTCAAAAAAAAATAAAAATTGGGAATCCATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAC----AGTCCAAGCTCGAAAGTGACAGGTGGATCTTTCTTGGTTTATCAAGATTATCAAGTCAAGCAC-------TTCTT--TTGCTAAACAGTAACAATTGCTTCCAACTCGGTGAGAAATATTGACCTAAGGATTTTTGGAAGTAGAAATAAAGAACGAAGTAAAT---AAAAAGAAAAATTGGTGAAACTAATTATTTA-TTTTTATTTTTCAAAGGATAATCTAAG-AAGTATACCCACG-CTATATGGCCAAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATTTACCCGAA-TTGGGGTAG-TTCCCTACTCTTT-----GAAAGGGAGGAAGAAAG-GGGAAGCTCCCATATATTCCAACAT---GGAGGGAGCCTCGATCTCCATA-AAAGTAATTTTGAATATATG----TTCCCTTCGT-----------TTAAAACAGGGG---ATACAGTAC--AC-CCA----TCTTTTGATT--GTTCCATATAACT-------AAATATATGCAGACAAATTA-TCCACCAGTTTTCA------------AT----TACTTAGCATTCCTCCCCTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTCGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATACTAAG-----AATCCCGG-AGCC----CTAGTC?AATTAAACCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAATTCTTGTTTGTTCACGAT-TTGGTA-----TCTGTAG------------------------CAGA-AGCAAAAGTCGGAAACCCCTTTTAAACTTTTCCTTATCT-GT----TCTTCGGTAAACGGTTTGCAAGTGAGCCATTCAAGCTT----TTAA----TATGCATAAATGGCTCATTCTAGCCCCCTCCA---------TACTTTA-----TTTACTGTAAGCAATACCGTGCTAAACATATTGATAAAAGCGAGATTAACGGTTTGACTAGGTAAA--AAACTAAAGTTGAAAAATAGACTTAACTGATTTCTAGTTAACTTTTATCCGT-AAATGA 'Teratophyllum wilkesianum (Ranker 1937)' GGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGACTGACCTATTACACCCCCGAATACAAGACTAAAGATACCGATATATTAGCAGCCTTCAGAATGACCCCACAACCCGGAGTACCAGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAGAATCCTCTACGGGTACGTGGACCACCGTATGGACAGATGGGTTGACTAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTGCTGGAGAAGAAAACCAGTATATCGCATATGTAGCTTATCCTTTGGATCTCTTCGAAGAAGGTTCTGTCACCAATCTGTTCACCTCCATTGTAGGTAATGTTTTCGGATTTAAAGCGCTACGTGCTTTACGCTTGGAAGACCTTCGAATTCCTCCCGCTTATTCTAAGACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAATTGAACAAATATGGACGCCCCTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTCCGCGGTGGACTCGATTTCACAAAAGATGATGAAAATGTGAATTCTCAGCCATTCATGCGTTGGAGAGATCGCTTCCTATTCGTAGCGGAAGCTCTTTTCAAATCCCAGTCTGAAACAGGCGAAATCAAGGGACATTACTTAAATGCTACCGCAGGTACGTGCGAAGAAATGTTGAAGAGAGCTATTTTCGCTAGAGAATTGGGTGCACCAATTGTCATGCATGACTACCTTACCGGAGGATTTACCGCAAATACCAGCTTAGCTTATTATTGTAGAGACAATGGGTTGCTTCTTCATATTCACCGTGCGATGCATGCTGTGATTGATAGACAACGGAATCACGGTATGCATTTTCGTGTATTGGCCAAAGCACTACGCATGTCCGGTGGAGATCATGTACATGCCGGAACCGTAGTGGGCAAACTAGAGGGGGAACGAGAAGTAACCCTGGGTTTCGTCGATTTACTTCGCGACGATTACATTGAGAAAGATCGTAGTCGTGGTGTATACTTCACCCAAGATTGGGTGTCTATGCCGGGTGTACTTCCTGTAGCTTCGGGAGGTATCCACGTTTGGCACATGCCAGCTCTAACCGAAATTTTCGGGGACGATTCCGTATTACAATTTGGTGGAGGAACATTGGGACATCCTTGGGGAAATGCACCCGGTGCGGTCGCTAACCGAGTTGCATTAGAAGCTTGCGTACAGGCTCGTAATGAGGGTCGTGACCTCGCTCGTGAAGGTAATGAGATTATTATTACTCTCGCAAAGCTTAGTGATCAGTTACTAAATAATCAA-TTTTATAAAAT-----AAAT-------------TAGAAGTCTATACAATGA--AAA-TCTAAGCAACGGGC----TTGGGATGCTGATATTT------------------AATAAGCAGG-----TTACTT-AGGAAATGGTAAAAGTTTATCGGTCTAGCTTGTTTCTTTTTC-GAAGCAAAAATTAAATCATAA---T-TTC---------------TTAATT---TATATAGAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACATGATA------AAGTATCCGA-------ATCAACTGCCTACGTCATTTCAGTTAAATTTCTAATCAACTGAGGAATTACCAATC----TTTAATGCTTTTATCAAGATAGTCCTTCGGCTTCTTTAGA---GTAG-TTGTACAACTTT-----ATTTGAAACCGCGGCTCCA---GCCCG-CTTTTTCAA----ATTGGAAAGTTAGCTAGACTTCTACGGAAAAAGAGAAAGATAAAAACAACCTCGGGCAGATAAAAAGAGAGAAAGGAAAGGGAGGGATT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGTTTGAATCCGTATAATTTGGTCGAA-AGCAAAATGCGTAAATAATTTTGAAT---TTTTTTTTCT-GA----TCTTTTGAAAATAGTTTGCGAGTGAGCCATTCATACCT----TTAA----TATGCATGGATGGCTCCATCTAGTCCCCCCTA---------TACTCTT-----ATTTCTATATATAAGATTGTATTAAACATATTGATAAAAGCGAGATCAGC----------GGTAAAAAATACTAAAGTTGAAAAATAGACTTAATTGACTCTTATTTAACCCTTTTCCAT-AAATAA ; END; BEGIN SETS; CHARSET trnGR6 (CHARACTERS = Lastreopsid_DNA_data_concatenated) = 1913-2931; CHARSET trnLF25 (CHARACTERS = Lastreopsid_DNA_data_concatenated) = 2932-3236; CHARSET rbcL17 (CHARACTERS = Lastreopsid_DNA_data_concatenated) = 1-1308; CHARSET rps419 (CHARACTERS = Lastreopsid_DNA_data_concatenated) = 1309-1912; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M31543] TITLE 'Lastreopsid rps4-trnS'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=604; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] 'Arachniodes aristata (Lorence 9314)' ATTACTCCCGCAAAGCTTAGTGATCATTTATCAAATTTTCAA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAATGG--AAA-CCTAAGCAAAGGAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATCTAGCTTGTTCCCCTTTC-GGAACAGAAATTAAACCATAA---T-TTT------C--------TTACTT-----TACAAAA--------ATATTCTACCTTCGAGCAAATTAATTTGGTACACGATG------AAGTATCTAA-------ATTACTCGTCCACATCACTCCAACTAAATTCCC-----GCCGAGGGATTACCTATT----CCCATTGCTTCTACTGAGATAGTCCTTCGGCTTCTTT------GAAG-TTGGATGACTTG-----ATTTGAAAT--------------CCCGTCTCTTTCAA----ATCGGCAATTTAGCTAGATTTCGATATGAAGGGGTAGGG---GATAAAACTTCGGGTAGGTAGAAATAGAGAAAGGAAAGGGAGGGATT 'Arachniodes denticulata (Mynssen 549)' ATTACTCCCGCAAAGCTTAGTTATCATTTATCAAATTTATAA-TTTAATCAAAT-----AATT-------------TGGAGATCTCTACAATGA--AAA-CCTAAGCAGGGGAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGACAGAAGTTTTTTGATCTAGCCTGTTCCCCTTCT-GGAGCGGAAATTAAACCATAA---T-TTT------T--------TTACTT-----CACAAGA--------ATATTCTACTTCTGAGCAAATTAATTTGGTACACGATG------AAGTATCTAA-------ATTACTCGTCCACATCACTTCAACTAAATTCCT-----ACCGAGGGATTACCTATT----CCTCTTGCTTCTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACTCCA---GCCCGTCTCTTTCGA----ATCGGCAATTTAGCTAGATTTCAATATGAAGGGGTGAAA---GAGAAAACTTCGGGTAGGTAAAAATAGAGGAAGGAAAGGGAGGGATT Arachniodes_rhomboidea_GB -------------------------------------------TTTAATCGAAT-----AAAT-------------TGGAGGTCTCTACAATGA--AAA-CCTAAGCAAGGGAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATATAGCTTGTTCCTTTTTC-AGAGCAAAAATTAAACCATAA---T-CTT------C--------TTACTT-----CATGAAA--------ATATTCCACTTTTGAGCAAATTAATTTGGTACACGATG------AAGTATCTAA-------ATTACCCGTCCACATCACTTCAACTAAATTCCC-----ACCGAGGGATTACCTATT----TCTGTCGCTTTTACCGAGATGGTTCTTTGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAATCCCAACTCCA---GCCTGTCTCTTTCAA--------------------------------------------------------------------------------------------- Arthropteris_altescandens_GB ATTACTCCCGCAAAGCCTAGTAATCATTT-------------------------------------------------------------ATGA--AAA-TTTAGGCAAAAGGC----TTGGGATGATAGAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTTGCACGAGTTTTTTGGTTTAGCTTGTTCTTTTTTT-TGAGCATAATTTAAATCATAA---T-TCT------T--------TAACTTTCAAATATAGAA--------ATATTTGACTTTTGACCCAATTAATTTGGTGCACGATGGAATGCAAGTATCTGA-------ATCAACTGTCTATGTCACTTTAACTAAATTGTTAATCAACCGAAGGATTACCCATT----------GTTCGTAGTGAGATGGTCCTTCGGCTTTTTT------ACAG-TTGTATGACTTA-----ATTTGAAACCCCGATTCTA---GCCTGTATTTTTTGA----ATCGACAATTTAGCTAGATTTCATTACGAATAAACAAAG------ATAACTT-GGGTAGGCAAAAATAAAGAAAGGAAAGGGAGGG--- 'Bolbitis acrostichoides (Fay 1068)' ATTACTCTCGCAAAGCTTAGTGATCATTTATTAAATAATCAA-TTTAATAAGAT-----AAAT-------------TATAGGTCTATACAGTAG--AAA-CCTAAGCGACGGAC----TCGGGATACTGATATTT------------------AATAAGCAGG-----TTACTT-AAGAAATGATGAAAGTTTATCGGTCTAGCTTGTTTCTTTTTC-GACGCAGAAGTTAGATCATAG---T-TTT---------------TTAATT---TATATAAAA--------ATATTCCATTTCCGATCAAATTAATTTGGTACATGATG------AGGTATCTAA-------ATTAACCGCCTACGTAATTTCAGATAAATTTCCAATCAACAGAGAGATTACTAATT----TTTGATGCTTCTACTGAGATAGTCCCTCGGCTTCTTCGGA---GTAG-TTGCACGACTTG-----ATTTGAAATCGCGACTCCAGCCGCCCGCCTTTTTCGA----ATCGGAAATTTAACTAGATTTCGACGTAAGAAGAGAGAG------ACAACCTAGAGTAGGTAGAAATATAAAAAGGAAAGGGAGGGATT 'Bolbitis auriculata (Fay 110)' ATTACTCTCGCAAAGCTTAGTGATCATTTATTAAATAATCAA-TTTAATAAAAT-----TAAC-------------TAGAGGTTTACACAATGA--AAA-CCTAAGCAACGGAC----TTGGGATACCGATATTT------------------AATAAGCAGG-----TTACAT-AGAAAATGGTAAGAGTTTATCGGTTTAGCTTGTTTTC------GAAGCAAAAATTAGAGCATAG---CCTT----------------TTAATT---TATATAGAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACATGATG------AAGTATCTGA-------ATTAACCGCCTACCTCATTTCAGCTCAATTTCTAATCAACAGATGGATTACTAATT----TCTGATGCTTCTACTAAGATAATCTCTCGGCTTCTTCGGA---GTAG-TTGCACGACTTG-----ATTTGAAGCCGCAACTCCAGCCGCCCGTCTCTTTCAA----ATCGAAAATTTAACTAGATTTCGGTGGAAAAAGAGAGAGAGAGAGGTAACCTCGGGTAGATAGAAATATAAAAAGGAAAGGGAGGGATT 'Bolbitis humblotii (Razafitsalana 115)' ATTACTCTCGCAAAGCTTAGTGATCATTTATTAAATAATCAA-TCTAATAAAAT-----AGAT-------------TAGAGGTCTATACAATGA--AAA-CCTAAGTAACGGAC----TTAGGATACTGATATTT------------------AATAAGCAGG-----TTACTC-AGTAAATGGTAGAATTCTCTCGGTCTAGCTTGTTTCTTTATC-GAAGCAAGAATTAGAGCCTAG---C-TCT---------------TTAATC---TATATAAAA--------AAGTTCTATTTTTGATCAAATTAATTTGGTACATGATG------AAGCATCTTA-------ATTAACTGCCTAGACCATTTCAGCGAAATTCCTAATCAAGGGAGGGATTAGTAATT----TTTAATGCT------AAGATAGTCCCTCGGCTTCTTCGGA---ATAG-TTGCACGACTTG-----GTTTGAAATCACGACTCCAACCGCCCGTCTTTCTCAG----ATTGGAAATCTAACTACATTTCGAAGGAAAAGGAGAAAGAGAAAGACAACCTCGGG--------------------------------- 'Coveniella poecilophlebia (Kessler 14303)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATTATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACTCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Coveniella poecilophlebia (van der Werff 11478)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATTATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACTCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT Ctenitis_eatonii_GB ATTACTCCCGCAAAGCTTAGTGATCATTTATTAAATTAATAA-TTTAATCGAAG-----AAATTAATCAGAAAAAATGGAGGTCTCTGCAACGG--AAA-CCTAAGCAAAGGAC----TTGAGATGATGAAATTC------------------AATAAGCAGA-----TTATTT-AGGAAGTGGTAAAAATTTTTTGATCTAGCTTGTTCCTTTTTT-GGGGCAAAAATTAAATCATAATAAT-------------------TTACTT-----CATAGAA--------ATATTCTACTTATGAGCAAATTAATTTAGTACCC--TG------AAGTATCTGA-------ATTACCCGTCCACATTACTTCAACTAAATTCGT-----ACCGAGGGATTACCTATTTATCCTTATTGCTTCCATTGAGATGATCCTTCGGCTTCTCT------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACTCCA---GCCCGGCTTTTTCAA----ATCGGCAACTTAGCTAGATTCCGATGGGGGAAGTTGA---------------------------------------------------- 'Cyclodium heterodon var. heterodon (Labiak 3996)' ATTACTCCCGCAAAGCTTAGTGATCATTTATTAAATTTTTAA-TTTAATCAAAT-----AATT-------------TGGAGGTCTTTAAAATAAAGAAG-CCTAAGCAAAGGGC----TTGAAATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGCAAGATTTTCTCGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATAACAA---T-TCT-----CTATCTCTACTTACTT-----CAAAAAG--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACGATA------AGGTATCCGA-------ATTACCCGTCCGCGTCACCTCAAATAAGATCCTGATCAACCGAGGCATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAACCCCGATTCTA---GCCTGTCCTTTTCAA----ATCGGCAATTTAACTACATTTTTAGAAGAAGGAGGAGG-------ATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATT 'Cyclodium rheophilum (Granville 15523)' ATTACTCCCGCAAAGCTTAGTGATCATTTCTTAAATTTTTAA-TTTAATCAAAT-----AATT-------------TGGAGGTCTTTAAAATAAAGAAG-CCTAAGCAAAGAGC----TTGGAATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGCAAGATTTTTTCGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATAACAA---T-TCTCTTTTTTATCTCTACTTACTT-----CAAAAAG--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACGATA------AGGTATCCGA-------ATTACCCGTCCGCGTCACCTCAAATAAAATCCTGATCAACCGAGGGATTACCCATT----CTTAGTGCTT-TACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAACCGCGATTTTA---GCCTGTCTTTTTCAA----ATCGGCAATTTAACTACATTCTTATAAGAAGGAGGAGG-------ATAACCTCGGGTAAGTAAAAATATAGAAAGGAAAGGGAGGGATT Dryopteris_crispifolia_GB -------------------------------------------TTTAATCAAAT-----AATT-------------TGGAGGTCTGTACGACGA--AAA-CCTAAGCAAAGGAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTCCGATCTAGCTTGTTCCTTTCTT-GGAGCATAAATTAAATCATAA---T-TTT---------------TTACTT-----TATATAA--------ATATTCCACTTTTGAGCAAATTAGTTTGGTACACGATG------AAGTATCTAA-------ATTAACCGTCCACATCACTTCAACTAAATTCCC-----AGCGAGGGATTACCTACT----CTTATTGCTTCTACTGAGATGGTCCCTCGGCCTCTCC------AAAG-TTGGACGACTTG-----ACTTGAAAT--------------CCCGCATTTTTCAA----GTCGGCAATTTAGCTAGATTTGGGTATGAGAAGA----------------------------------TTGAAAGGAAAA--------- Dryopteris_fragrans_GB -------------------------------------------TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAACGA--AAA-CCTAAGCAAAGGAC----TTGGGATGATGAAATTT------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATCTAGCTTGTTCCTTTCTT-GGAGCATAATTCAAATCATAA---T-TTC---------------TTACTT-----TATAGAA--------ATATTCTACTTCTGAGCAAATTACTTTGGTACACGATG------AAGTATCTAA-------ATTAACCGTCCACACCACTTCAACTAAATTCCC-----ACCGGGGGATTACCTATC----CTTGTTGCTTCTACTGAGACGGCCCCTCGGCTTCTCC------AAAG-TTGGACGACTTG-----ACTTGAAAT--------------CTCGCATTTTTCAA----ATCGGCAATTTA----------------------------------------------------------------------------- 'Dryopteris patula (Sundue 1104)' ATTACTCCCGCAAAGCTTAGTGATAATTTATTAAATTTTTAA-TTTAATAAATT-----AATT-------------TGGAGGTCTCTGCGACGA--AAA-CCTAAGCAAAGGAC----TTGGGCTGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATCTAGCTTGTTCCTTTCTT-GGAGCATAAATTAAATCATAA-----TTT---------------TTACTT-----TATATAA--------ATATTCTACTTCTGAGCAAATTCTTTTAGTACACAATG------AAGTATCTAA-------ATTAACCGTCCACATCACTTCAACTAAATTCCC-----ACCGAGGGATTATCTATT----CTTATTGCTTCTATTGAGATGGTCCTTCGGCTTCTCC------AAAG-TTGGACGACTCG-----ACTTGAAAT--------------CCCGCATCTTTCAAGTCGGTCGGCAATTTAGCTAGAGTTGAGTATGAGGAGGTGAAA---AAAGAAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT Dryopteris_patula_GB -------------------------------------------TTTAATAAAAT-----AATT-------------TGGAGGTCTCTGCGACGA--AAA-CCTAAGCAAAGGAC----TTGGGCTGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAAGTTTTTCGATCTAGCTTGTTCCTTTCTT-GGAGCATAAATTAAATCATAA---T-TTT----------------TACTT-----TATATAA--------ATATTCTACTTTTGAGCAAAGTCTTTTGGTACACAATG------AAGTATCTAA-------ATTAACCGTCCACATCACTTCAACTAAATTCCC-----ACCGGGGGATTATCTATT----CTTATTGCTTCTATTGAGACGGTCCTTCGGCTTCTCC------AAAG-TTGGACGACTCG-----ACTTGAAAT--------------CCCGCATCTTTCAAGTCGGTCGGCAAT-------------------------------------------------------------------------------- 'Dryopteris wallichiana (Labiak 4434)' ATTACTCCCGCAAAGCTTAGTGACCATTTATTAAATTTTTAA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACGACGA--AAA-CCTAAGCAAAGGAC----TTCGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGCAAAAGTTTTTCGATCTAGCTTGTTCCTTTCTT-GGAGCATAAATTAAATCATAA---T-TTT---------------TCACTT-----TATATAA--------ATATTCCACTTTTAAGCAAATTATTTTGATACACGATG------AAGTATCTAA-------ATTAACCGTCCACATCACTTCAACTAAATTCCC-----ACCGAGGGATCACCTATT----CTTATTGCTTCTACTGAGATGGTCCTTCGGCTTCTCC------AAAG-TTGGACGACTTG-----ACTCGAAAT--------------CCCGCATCTTTCAA----GTCGGCAATTTAGCTAGATTTGGGTATGAGGAGGTGGAA---AGAAAAATCTCGGGTAGTTAAAAATAGGGAAAGGAAAGGGAGGGATT 'Elaphoglossum amygdalifolium (Herrera 2063)' ATTACTCTCGTAAAGCTTAGTGATCATTTAATAAATAATCAG-TCTAATAAATT-----AGAT-------------TAGAGGTCTATACAATGA--AAG-CTTAAGCTACGGAC----TTGCGATGCTTATAGTT------------------AATTAGCAGG-----TTACTT-AGGAGATGGTAAAAGTTTATCGGTCTAGCTTGTTTCTTTTTC-GAAGCAAAAATTAGATCATA-----------------------------------------------------------TTTTGATCAAATTAATTTGGTACATAATG------AAGTACCCGA-------ATTAA--ACCTACCCCATTTCAGCTAAATTTCTAATCAACCGAGGGATTACCGGTC----TTTATTGCTTCTATTAAGATAGTCCTTCGAATTCTTTACA---GTAG-TTGTACAACTTG-----ATTTGAATACGCGACTTCA---GCCCGTCTTTTTTAA----ATCAGAGATTTAATTACATTT-------------------------------------------------------------------- 'Elaphoglossum decoratum (NYBG391/77B)' ATTACTCTCGTAAAGCTTAGTGATCATTTAATAAATAATCAA-ATTAATAGAGT-----AGAT-------------TAGAGGTCTATACAATGA--AAA-CCTAAGCTACGGAC----TTGGGATGCTGATATTT------------------AATTAGCAGG-----TTACTC-AGGAGATGGTAAAAGTTTCTCGGTCTATCTTGTTTCTTTTTC-AAAGCAAAAATCAAATCATA-----------------------------------------------------------TTTTGATCAAATTAATTTGGTATATGATG------AAGTACCCGA-------ATTAACTGCCTACCTCATTTCAGCTAAATCTCTAAT-AAACGAAGGATTACCAATT----TGTAATGCTTCTATTAAGATAGTCCTTCAAATTATTTAGA---GTAG-TTGTACAACTTG-----ATTTGAAACCGCGACTTCA---GCCCGTCTTTTTCAA----ACCAGAATTTTAACTATATTTTGACAAAAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Elaphoglossum hybridum (FR6421)' ATTACTCTCGTAAAGCTTAGTGATCATTTAATAAATAATCAA-ATTAATAGAGT-----AGAT-------------TAGAGGTCTATACAATGA--AAA-CCTAAGCTACGGAC----TTGGGATGCTGACATTT------------------AATTAGCAGG-----TTACTC-AGGAGATGGTAAAAGTTTCTCGGTCTAGCTTGTTTCTTTTTC-AAAGCAAAAATTAAATCATA-----------------------------------------------------------TTTTGATCAAATTAATTTGGTATATGATG------AAGTACCCGA-------ATTAACTGCCTACCTCATTTCAGCTAAATCTCTAAT-AAACGAGGGATTACCGATT----TGTAATGCTTCTATTAAGATAGTCCTTCAAATTATTTAGA---GTAG-TTGTACAACTTG-----ATTTGAAACCGCGATTTCA---GCCCGTCTTTTTCAA----ACCATAATTTTAACTATATTTTGGCAAAAGAAGAGAAAG------ACAACCTCGGGTAGGTAAA------------------------- 'Lastreopsis acuminata (Coveny 10182)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTATACGTCATTTTAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis acuminata (Kessler 14227)' ---------------------------TTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTATACGTCATTTTAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACA----------------------------------------- 'Lastreopsis acuta (Labiak 4913)' ATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT------T--------ATATTT---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAAGTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAGTAGAAAG------ACAATTTCGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis amplissima (Labiak sn)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAACAAAAAAAAT-------------TGGAGGTTTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCAAA-AAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATTAACCGAGGGATTACCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGTGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis amplissima (Prado & Hirai 2021)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAACAAAAAAAAT-------------TGGAGGTTTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCAAA-AAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATTAACCGAGGGATTACCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGTGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis amplissima (Zardini 15991)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAACAAAAAAAAT-------------TGGAGGTTTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCAAA-AAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATTAACCGAGGGATTACCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGTGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis barteriana (Carvalho 5780)' ATTATTCCCGCAAAGCTTAGTTATCATTTATGAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTATAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCTA-------ATTAATCGTTTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGCCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCACGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGG----------ATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis boivinii (RG470)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis boivinii (Rouhan 1356)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis boivinii (Rouhan 1369)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis confinis (Liogier 25604)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAGGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTATTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAAGAGAAAG------ACAAACTCGCATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis currori (Doursett-Lemaire 1906)' ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATT 'Lastreopsis currori (Fay 4804)' ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATT 'Lastreopsis decomposita (Kessler 14191)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGACAGGGAGGGATT 'Lastreopsis effusa (BP047)' ATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTCGGGAGCAAAAATTAAATCATAA---T-TTA------T--------ATATTT-TATATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTATGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAATAGAAAG------ACAATTTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis effusa ssp dilatata (Hernandez 1906)' ATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTCGGGAGCAAAAATTAAATCATAA---T-TTA------T--------ATATTT---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTATGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAATAGAAAG------ACAATTTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis effusa ssp divergens (Villaroel 1597)' ATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTATTT---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAAGTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGAGGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGA----------------------------------------------------------------- 'Lastreopsis effusa ssp divergens (Walker 10612)' ATTATTCCCGCAAAGCTTAGTGATCATGTATTAAATTATTAA-TTTAATACAAT-----AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTATTT---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCAA-------ATTAAGTGTCTACGTCATTTCAGCTAAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGAGGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAACTAGATTTCGATGGAAAAATAGAAAG------ACAATTTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis exculta ssp exculta (Moran 3239)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATTTAATACAA-AAGT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGTAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTATTT---TATATATAT--------ATATTCTATTTTTGATCAAATTAATTTGATACACAATG------AGGTATCCGA-------ATTAATTGTCTACGTCATTTCAGCTCAATTCCTAATCAATCGCGGGATTACCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCAGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTTA----ATTGGCAATTTAACTCGATTTCGATGG----------------------------------AAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis glabella (Given 11847)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA-TATATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGATGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis hispida (Given 11819)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAAA-----AAAT-------------TGGAGGTCTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCCAAAAAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAAGGATTATCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis hispida (Schneider sn)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAAA-----AAAT-------------TGGAGGTCTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTACATTTTCGATCCAAAAAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAAGGATTATCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis killipii (Altamirano 952)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTAGTAA-TTTAGCAAAACAAAAAAAAG-------------TGGAGGTTTCTACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATCATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAGAATTTAAATCATAA---T-TTT---------------TTATTA---TATATATAA--------ATATTACATTTTCGATCAAAAAAATTTGGTACACGATG------AGGTATCCCAATTAA--ATTAATTGTCTACATCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAAAA----ATTATCGCTTCTATTAAGATGGTCCTTCGACTTCTCC------AAAG-TTGTACAACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGACAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAACCTCAGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis marginans (Kessler 14192)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis marginans (Kessler 14354)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGG--------------------------------- 'Lastreopsis microsora (Coveny 9944)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis microsora (Gardner 5018)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis microsora (Kessler 14350)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis microsora (Kessler 14355)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis munita (Clarke & Pickard 1814)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAATTTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis munita (Coveny 1303)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAATTTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis munita (Coveny 1906)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAATTTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis nigritiana (Thomas 8919)' ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATT 'Lastreopsis perrieriana (Rouhan 1318)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTATAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis perrieriana (Rouhan 1321)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis pseudoperrieriana (Rouhan 1319)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis pseudoperrieriana (Rouhan 1323)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis pseudoperrieriana (Rouhan 1325)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis pseudoperrieriana (Rouhan 1364)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTCAATAAGCAAATTACTTACAATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT--TTTTT--------TTATTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACGATG------AGGTATCCCA-------ATTAATCGTCTATGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATATAGAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis rufescens (Kessler 14341)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis rufescens (Kessler 14343)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis rufescens (Kessler 14347)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis silvestris (Kessler 14222)' -----------------------------------------A-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAAGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT------T---------TACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTA--------TTACTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGAT-GGAAAAGAGAAAG------ACAACCTCGGGGGGG----------------------------- 'Lastreopsis smithiana (Coveny 9951)' ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis smithiana (Kessler 14226)' ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis sp nov (Kessler 14345)' TTTATTCTCGCAAAGCTTAGTGATCGTTTAATAAATTATTAA-GTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATACATAAAGTAATATATATTATAATTTTGATCAAATTAATTTGGTACAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCACTTCTAT--------TCCTTCGGCTTTTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---ATCCGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGAAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis subsericea (van der Werff 16118)' ATTATTCCCGCAAAGCTTAGTTATCGTTTAATAAATTATTAA-GTTAATAAAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCTCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAAAGTAATATATATTATATTTTTGATCAAATTAATTTGATGCAAGATG------AGGTACCCCAATTCCCAATTAATTGTCTACCTCATTTCAACTAAATTCCTAATCAACCGAGGGATTACCCATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTTTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---ACCCGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGGAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Lastreopsis subsimilis (Fay 4802)' ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis tenera (Kessler 14344)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAGATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis tenera (coll unkn)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAGATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis tinarooensis (Kessler 14340)' A------------------------------------------TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGCCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAA{AT}CCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis tinarooensis (Van der Werff 17036)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAGA-----TTACTT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGGATTATCTATT----TTTATTGCTTTTGTTGAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCTCGTCTTTTTTAA----ATTGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTTGGATAGGGAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis vogelii (Visa 2498)' ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATT 'Lastreopsis vogelii (Visa 3706)' ATTATTCCCGCAAAGCTTAGTGATCGTTTATTAAATTATTAA-TTTAATACAGT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAGGAC----TTGGGATGATGAAAGTC------------------AATAAGCAAA-----TTACTT-AGTAAATGGTAAAAGTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAATTTT-TTT------T--------TTACTT---TATACATAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACACAATG------AGGTATCCTA-------ATTAATTGTCTACGTCATTTTAGCTAAACTCCTAATCAACCGAGGGATTACCCATT----TTTATTGCTTCTGTTAAGATGATCCTTCGGCTTCTTT------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATCGGCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGATAGAGAAAAATAGAGACAGGAAAGGGAGGGATT 'Lastreopsis walleri (Kessler 14339)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AATT-------------TGGAGGTCTATACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTTAAGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGGGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTGCGGGATG------AGGTACCCCA-------ACTAATCGTCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTGTCGCTTCTAT--------TTCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis windsorensis (Kessler 14353)' ATTATTCCCGCAAAGCTTAGTGATCATTTATTAAATTATTAA-TTTAATACAAT-----AA?T-------------TGGAGGTCTCTACAATGA--AAA-CCCAAGCAAAAGAC----TTGGGATGATGAAAATC------------------AATAAGCAG----------TT-AGGAAATGTTAAAATTTTTTTGGTCTAGCTTGTTTCCTTTTC-GGAGCAAAATTTAAATCATAA---T-TTT---------------TTACTA---TATATATAA--------ATATTCTATTTTTGATCAAATTAATTTGTTACACAATG------AGGTATCCGA-------ATTAATCGTCTACGTCATTTCAGCTAAATT-CTAATCAATCGAGGAATTATTTATT----TTTATTGCTTTTGTTTAGATGGTCCTTCGGCTTCTTT------CAAG-TTGTACGACTTG----?ATTTGAAACCGCGAATCCA---GCCCGTCTTTTTTAA----ATTGCCAATTTAGCTAGATTTCGATGGAAAAAGAGAAAG------ACAATCTCGGG--------------------------------- 'Lastreopsis wurunuran (Kessler 14342)' ATTATTCTCGCAAAGCTTAGTGATCGTCTAATAAATTATTAA-GTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATACATAAAGTAATATATATTATAATTTTGATCAAATTAATTTGGTACAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCACTTCTAT--------TCCTTCGGCTTTTCC------AAAG-TTGTACGACT{AT}G-----ATTTGAAACCGCGACTCCA---ATCCGTCTTTCTCAA----ATCGGCAA{CT}TTAGCTAGATTTCGATGGGAAAGAGAAA--------ACAACCTCGGGTAGG-AAAAATAGGGAAAGGAAAGGGAGGGATT 'Lastreopsis wurunuran (Kessler 14348)' -------------------------------------------GTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATACATAAAGTAATATATATTATAATTTTGATCAAATTAATTTGGTACAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCACTTCTAT--------TCCTTCGGCTTTTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACTCCA---ATCCGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGAAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGGGAAAGGAAAGGGAGGGATT 'Lomagramma matthewii (Wuzhisan 448)' ATTACTCTCGCAAAGCTTAGTGATCATTTACTAAACAATCAA--TTTCTAAAAC-----AACT-------------TAGAGGTCTCTACAATGA--AAA-CCTAAGCAACGGAC----TTGGGATGCTGATA---------------------AGTAAGTAGG-----TTACTT-AGGAAATGGTAAAAGTTTATCGGTCTAGCTTGTTTCTTTTTC-GAAGCAAAAATTCAATCCTAA---T-TTT---------------TTAACT---TGTATAGAA--------ATATTCTCTTTTTTATCAAATTGATCTGGTACATGATG------GAATAGTTGA-------ATCAACTGCCTACGTAACTTCAGTGAAATTTCTAATAAACTGAGGGATTACCAATT----TTTAATGCTTATATCAAGATGGTCCTTCGGCTTATTTAGA---GTAG-TTGTATAACTTG-----ATTTGAAACCGTGACTCCA---GGCTGTCTTTTTCAA----ATCGGAAATTTAGCTAGATTTCGACGAAAAAAGATAAAGAGAAAGACAACCTCGGGTAGGGAAAAATAGAGAAAGGAAAGGGAGGGATT Lomariopsis_marginata_GB ATTACTCACGCAAAGCTTAGTTCTCATTTAGTAAATCTTTTAATCTAATCAAAT-----AGAT-------------TGGAGGGTTTTACAAAAAAAAAG-CCAAGATAAGAGAC----TTGGGCTGATGGGATTAAATT--------------ACTTAGGAGATTAAATCACTT-AGGAAAGGGTAAAAGTTTTTCAGCCTAGCTTGTTCCTTTTTT-AGATAATAAAAAGAATCAGAA---T-TTT------T--------TAACTTATTTATCTAGAA--------ATACTCAAATTTTGCGCAAATTAATCTGATGTACGATGAAGTCTAAGTATCCGA-------ATCACCCGTCCACATCATTTTGAATAAATCTCTAATCAACCAAAGGATTACCGATT-------------------AATAGGATCCTTTGGCTTATTT------CAAG-TTGGATGACCTT-----ATTGAAAACCCCGATTTTA---GTCCGTCTTTCTCAA----ATTGTCAATTTGATTAGATTTGGAT---------------------------------------------------------------- 'Maxonia apiifolia (Moran 3541)' ATTACTCCCGCAAAGCTTAGTTAGCATTTCTTAAATTTTTCA-TTTAATCAAAT-----AATT-------------TGGAGGTCTTTACAATAA--AAA-CCTAAGCAAAGGGC----TTGAAATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGCAAAAATTCCTCGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATCACAA---T-TTCTTTTTTTATCTCTACTTACTT-----CATAAGA--------ATATTCTACTTCTAAGCAAATGAATTTGGTACACGATA------AGGTATCCGA-------ATTACCCGTCCACGTCACCTCAAATAAGATCCTAATCAACCGAGGGATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGAAACCCCGATTCTA---GCCTGTCCTTCTCAA----ATCGGCAATTTAGCTATATTTCGATAAGAAGGAGGAGAA----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATT 'Megalastrum abundans (Schwartsburd 1631)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACAATAA--AAATCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGCCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCAATT----TTTATTGCTTTTAATGAGATGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGGCAATTTAGCTAAATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum atrogriseum (Sundue 1779)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATTAAATTC------------------AATAAGCAAA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAACTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTAATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCGATT----TTTATTGCTTCTAATGAGACGGTCCTTTGGCTTCTCCAAA---AAAA-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---ACCCGTCTTCTTCAA----ATTGTCAATTTAGCTAGATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTTAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum canacae (Grangaud 3)' ATTATTCCCGCAAAGCTTAGTGATCATTTACTAAATTATTAA-TTTAATAAAAT-----AGAT-------------TGGAGGTCTTTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATAGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAC---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTATCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTATTTCTTCTAATGAGATGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTGATTTGATTTGAAACCGTGACCCCA---GCCCGTCTTCTTCAA----ATCGGCAATTTAGCTACATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum connexum (Labiak 4260)' ATTATTCCCGCAAAGCTTAGTGATCTTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTTTCTACAATAA--AAATCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTAAATATTTGATGAAATTAATTTGGTAAACGATG------AGGTATCCAA-------ATTAATTGCCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCTATT----TTTATTGCTTTTAATGAGGTGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGGCAATTTAGCTAGATTTTGACGGGAAAATAGAAAT------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum fugaceum (Jimenez 1203)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTTTTAA-TTTAATAAAAG-----AAAT-------------TGGAGGTCTCTACAATAA--AAATCCTAAGCAAAGAAC----TTGGGACGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATGAAATTAATTTGGTAGACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTAAACTGAATTCCTAATCAACTGAGGGATTACCAATT----TTTATTGCTTTTAATGAGATGGTCCTTCGTCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGGCAATTTAGCTAAATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum lanatum (Grangaud 6)' ATTATTCCCGCAAAGCTTAGTGATCATTTACTAAATTATTAA-TTTAATAAAAT-----AGAT-------------TGGAGGTCTTTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATAGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAC---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTATCTACGTCATTTCAACTGAATTCCTAATCAACCGAGGGATTACCAATT----TTTATTTCTTCTAATGAGATGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTGATTTGATTTGAAACCGTGACCCCA---GCCCGTCTTCTTCAA----ATCGGCAATTTAGCTACATTTCGATGGGAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum macrotheca (Christenhuzs 4181)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATTAAATTC------------------AATAAGCAAA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAACTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGACGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCAATG----TTTACTGCTTCTAATGAGATGGTCCTTTGGCTTCTCCAAA---AAAA-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGTCAATTTAGCTAGATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTTAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum retrorsum (Labiak 4356)' ATTATTCCCGCAAAGCTTAGTGATCTTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTTTCTACAATAA--AAATCCTAAGCAAAGAAC----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTAAATATTTGATGAAATTAATTTGGTAAACGATG------AGGTATCCAA-------ATTAATTGCCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCTATT----TTTATTGCTTTTAATGAGGTGGTCCTTCGGCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGGCAATTTAGCTAGATTTTGACGGGAAAATAGAAAT------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum subtile (Moran 7608)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACAATAA--AAACCCTAAGCAAAGAAC----TTGGGATGATTAAATTC------------------AATAAGCAAA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAACTTGTTCCCTTTTC-GGAGCAAAAATTAAATCCTAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTCGACGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACTGAGGGATTACCAATT----TTTATTGCTTCTAATGAGATGGTGCTTTGGCTTCTCCAAA---AAAG-TTGTACGACTTG-----ATTTGAAACCGCGACCCCA---GCCCGTCTTCTTCAA----ATTGTCAATTTAGCTAGATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTTAAAATAGAGAAAGGAAGGGGAGGGATT 'Megalastrum vastum (Cornejo 8163)' ATTATTCCCGCAAAGCTTAGTGATCGTTTACTAAATTATTAA-TTTAATAAAAT-----AAAT-------------TGGAGGTCTCTACACTAA--AAACCCTAAACAAAGAAC----TTGGTATGATTAAATTC------------------AATAAGCAAA-----TTACTT-AGGAAATGGTAAAATTTTTTTGGTCTAACCTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTACATTTTTGATGAAATTAATTTGGTACACGATG------AGGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTGAATTCCTAATCAACTGAGAGATTACCGATT----TTTATTGCTTCTAATGAGATGGTCCTTTGGCTTCTCCAAA---AAAA-TTGTACGACTTG-----ATTTGAAACCGCGATCCCA---GCCCGTCTTCTTCAA----TTTGTCAATTTAGCTAGATTTCGACGGGAAAATAGAAAG------ACAACCTCGGGTAGGTTAAAATAGAGAAAGGAAGGGGAGGGATT 'Mickelia guianensis (Prado 2025)' ATTATTCTCGTAAAGCTTAGTGATCATTTTCTCAATCATCAA-TTTAATTCAAT-----AAAT-------------TAGAGGTCTACACAATGA--AAA-CCTAAGCAACGGACTTGGTTGAGATGCTGATATTT------------------AATAAGCAGG-----TTACTT-AAGAAACGAGAAAAGTTTATCGGTCTAGCCTGTTTCTTTTTT-GAAGCAAAAATTGAATCATAA---T--GT------T--------TTAACT---TATATATAA--------ATACTCTATTTTTGATCAAATTAATTTGGTACATGATG------AAGTACCCTC-------ATTAACTGCCTACGCCATTTCAACTAAATTTCTAATCAACCGAGGGCTTACCAATC----TCTAATTGTTCTATTAAGATAGTCCTTCGGCTTATTTAGC---CAAG-TTGTACAACTTG-----ATTTGAAACCGCGACTTCA---ACCCGTCTTTTTCAA----ATTGGAAATTTAGCTAGATTTCGACGGAAAAAGAGAAAG------ACAACCTCGGGTAGGTAAAAATAGACAAAGGAAAGGGAGGGATT 'Mickelia oligarchica (Smith 2236)' ATTACTCTCGTAAAGCTTAGTGATCATTTACTAAATTATCAA-TTTAATAAAAT-----AGCT-------------TCGAGGTTTATACAATGA--GAG-CCTAAGCAGCGGGCTTGGTTGGGATGCTGATATTT------------------AATAAGCAGG-----TTACTT-AGGAAATG--AAAAGTTTATCAGTCTAGCTTGTCTCTTTTTC-AAAGCAAAAATTAAATCATAA---T-CTT------T--------TTAACT---TATATAGAA--------ATATTCTATTTTTTATCAAATTAATCTGGTACATAATG------AAGTACCCGA-------ATTAACTACCTACATCATTTCAACAAAATTTCTAATCAACCGAGGAATTACCAATT----TTTAATGGTTCTATTAAGATAGTCCTTTGGCTTCTTTGGA---GTAG-TTGTACAACTTG-----ATTTGAGACCGCAACTTCA---GCTCGTCTTCTTCAA----ATCGAAAATTTAGCTAGATTTTGACGGAAAAAGAGAGAGAAAAACACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Mickelia pergamentacea (Sanchez 124)' ATTACCCTCGTAAGGCTTAGTGATCATTTACTAAATCACCAA-TTTAATAAAAT-----AGCC-------------TCGAGATCTATATAATGA--AAA-CCTAAACAACGGACTTGGCCGGGATGCTGATATCT------------------AATAAGCAGG-----TTACTT-CGGAGATAGAAAAAGTTTATTGGTCCAGCTTGTTTCTTTTTC-GAGGTGAAGATTAAATCATAA---T--CT------T--------TTAACT---TATATATAA--------ATATTATATTTTTGATCAAATTAATTTGGTACATGATG------AAGTACCCGA-------ATTAACTACCTACGTCATTTCAACTAAATCTCCAATCAACCGAGGGATTACCAACT----TTTGAAGGTTCTGCTGAGATAGTCCCTTGGCTTCTTCGGA---GTAG-CTGTACAACTTG-----ATTTGAGACCGCAACTTAA---GCCTGTCTTTCTCAA----ATCAAGAATTTAGCTAGATTTCGACGGAAAGAGAGAGAGGGAGAGACAACCCCGGGTAGGTAAAAATATAAAAAGGAAGGGGAGGGATT 'Oenotrichia tripinnata (Kessler 14352)' ------------------------------------------------TAAAAT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA-----TATATATTATATTTTTGATCAAATTAATTTGGTGCAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTTTCC------AGAG-TTGTACGACTTG-----ATTTGAAACCGCGACTTCA---ACCTGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGAAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Oenotrichia tripinnata (van der Werff 13809)' ATTATTCCCGCAAAGCTTAGTGATCGTTTAATCAATTACTAA-GTTAATAAAAT-----AATT-------------TGGAGGTCTCTACAATGA--AAA-CCTAGTCAAAGGAC----TTGGGATGATGAAATTC------------------AACAAGCAGA-----TTACTT-AGGAAATGGTAAAAGTTTTTCGGTCTAGCTTGTTCCCTTTTC-GGAGCAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATATAA-----TATATATTATATTTTTGATCAAATTAATTTGGTGCAAGATG------AGGTACCCCAATTCCCAATTAATCGTCTACCTCATTTCAACTAAATTACTAATCAACCGAGGGATTACCCATT----TTTGTCGCTTCTAT--------TCCTTCGGCTTTTCC------AGAG-TTGTACGACTTG-----ATTTGAAACCGCGACTTCA---ACCTGTCTTTCTCAA----ATCGGCAATTTAGCTAGATTTCGATGGGAAAAGAGAAAA------ACAACCTCGGGTAGGTAAAAATAGAGAAAGGAAAGGGAGGGATT 'Olfersia cervina (Labiak 5220)' ATTACTCCCGCAAAGCTTAGTAATCATTTATGAAATTTTTAA-TTTAATCAAAT-----AATT-------------TGAAGGTCTCTACAATAA--AAA-CCTAAGCAAAGCAC----TTGGAATGATGAAATTC------------------AAGAAGCAGA-----TTACTT-AGGAAATGGTAAAATTTTCTCGATCTAGCTTGTTCCTTTTTC-AGAGCAGAAATTTAATCACAA---T-TCTTCCCTAC--------TTATTT-----CATAGAA--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACGATA------AGGTATCCGA-------ATTACCCGTCCACGTCACCTCAAATAAGATCCTAATCAACCGAGGGATTACCTAATTACTCTTAGTGCTTCTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGACTTG-----ATTTGACACCCCGATTCTA---GCCTATCCTTTTCAA----ATTGGCAATTTAGCTATATCTCGATAAGAAAGAGGAGAT----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATT Phanerophlebia_nobilis_GB -------------------------------------------TTTCATCATAA-----CAAT-------------TGGAGGTCTCTACAATGG--AAA-CCTAAGCAAACGAC----TTGACATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGTAAAAGTTTTTCGATCTAGCTTGTTCCTTTTTT-GGGGCAGAAATTAAATTGTAG---T--AA------T--------TTATTT-----CATAGAA--------ATATTCTATTTCTGAGCAAATTAATTTAGTAC---ATG------AAGTATCTGA-------ATTACCCGTCCACATCACTTCAACTAAATTTGT-----ACCGAGGGATTACCTATTTATTTTTATTGCTTCCATTGAGATGATCCTTCGGCTTCTCT------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACTCCA---GCCCGTCTCTTTCAA--------------------------------------------------------------------------------------------- 'Pleocnemia irregularis (Sundue 2245)' ATTATTCCCGCAAAGCTTAGTGATCATTTACTAAATCATTAA-TTTAATAAAATAATAGAATT-------------TGGAGATCTATACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATGCTGAAATGC------------------AATAAGCAGA-----TTACTT-CGGAAATGGTAAAAGTTTTTC----------------------GAAGCAAAAATAAAATCATAA---T-TTT---------------TTACTT-TATATATATATATATATAAATATGTCATTTTCAATTCAATTAATTTGGTACACGATC------AAGTATCCAA-------ATTAATTGTCTACGTCATTTCAACTAAACCCCTAACCAACCGGGAGATTACCAATT----TTTGCTACTTCTACTGAGATAGCCCCTTGGCTTCTTTATCTTCAAAG-TTATACGACTTG-----ATTTGAAATCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGGCAGTTTAGTTAGATTTCTATGGAAAAAGAGAAAG------ACAACTGCGGGTAGATAAAAATAAAGAAAGGAAAGGGAGGGATT 'Pleocnemia olivacea (WADE1991)' ATTATTCCCGCAAAGCTTAGTGATCATTTACTAAACCATTAA-TTTAATAAAC------AATT-------------TGGAGATCTATACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATGCTGAAATGC------------------AATAAGCAGA-----TTACTT-CGGAAATGGTAAAAGTTTTTC----------------------GAAGCAAAAATAAAATCATAA---T-TTTTTACTTT--------TTATATATATATATATAA--------ATATGTCATTTTCAATTCAATTAATTTGGTACACAATC------AAGTATCCAA-------ATTAATCGTCTACGTCATTTCAACTAAACTCCTAACCAACCGGGAGATTACCAATT----TTTGCTACTTCTATTGAGATAGCCCTTTGGCTTCTTTATCTTCAAAG-TTATACGACTTG-----ATTTGAAATCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGGCAATTTAGTTAGATTTCTATGGAAAAAGAGAAAG------ACAACTGCGGGTAGATAAAAATAAAGAAAGGAAAGGGAGGGATT 'Pleocnemia presliana (Kuo 1955)' ATTATTCCCGCAAAGCTTAGTGATCATTTACTAAATCATTAA-TTTAGTAAAC------AATT-------------TGGAGATCTATACAATGA--AAA-CCTAAGCAAAGGAC----TTGGGATGCTGAAATGC------------------AATAAGCAGA-----TTACTT-CGGAAATGGTAAAAGTTTTTC----------------------GAAGCAAAAATAAAATCATAA---T-TTT---------------TTACTTTATACTTTATAT--------ATATGTCATTTTCAATTCAATTAATTTGGTACACGATC------AAGTATCCAAATTAATTATTAATTGTCTACGTCATTTCAACTAAACTCCTAACCAACCGGGAGATTACCAATT----TTTACTGCTTTTACTGAGATAGTCCTTTGGCTTCTTTATCTTCAAAG-TTATACGACTTG-----ATTTGAAATCGCGACTCCA---GCCCGTCTTTTTCAA----ATTGGCAATTTAGTTAGATTTCTATGGAAAAATAGAAAG------ACAACTGCGGGTAGATAAAAATAAAGAAAGGAAAGGGAGGGATT 'Polybotrya alfredii (Moran 7612)' ATTACTCCCGCAAAGCTTAGTGATCATTTATTAAGTTTTTGA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAATAA--AAA-CCTAAGCAAAGGAC----TTGGAATGATGAAATTC------------------AATAAGCAGATTACTTTACTT-AGGAAATGGCAAAATTTTCTTGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATCACAA---T-TTTATTTTTTATCTCTACTTACTT-----CATAAGA--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACAATA------AGGTATCCAA-------ATTAGCCGTCCACGTCACCTCAAATAAAATCCTAATCAACCGAGGGATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGGCTTG-----ATCTGAAACCCCGAATCTA---GCCTGTCCTTTTCAA----ATTGGCAATTTAGCTATATTTCGATAAGAAGTAAGAGAA----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATT 'Polybotrya andina (Moran 6729)' ATTACTCCCGCAAAGCTTAGTGATCATTTATTAAGTTTTTGA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAATAA--AAA-CCTAAGCAAAGGAC----TTGGAATGATGAAATTC------------------AATAAGCAGATTACTTTACTT-AGGAAATGGCAAAATTTTCCTGATCTAGCTTGTTCCTTTTTC-GGAGCAGAAATTTAATCACAA---T-TCTCTTTTTTATCTCTACTTACTT-----CATAAGA--------ATATTCCACTTCTGAGCAAATGAATTTGGTACACAATA------AGGTATCCAA-------ATTAACCGTCCACGTCACCTCAAGTAAAATCCTAATCAACCGAGGGATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGGCTTG-----ATCTGAAACCCCGAATCTA---GCCTGTCCTTTTCAA----ATTGGCAATTTAGCTATATTTCGATAAGAAGTAAGAGAA----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATT 'Polybotrya pubens (Moran 6063)' ATTACTCCCGCAAAGCTTAGTGATCATTTATTAAGTTTTTGA-TTTAATCAAAT-----AATT-------------TGGAGGTCTCTACAATAA--AAA-CCTAAGCAAAGGAC----TTGGAATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAATTTTCTTGATCTAGCCTGTTCCTTTTTC-GGAGCAGAAATTTAATCACAA---T-TCTCTTTTTTATCTCTACTTACTT-----CATAAGA--------ATATTCTACTTCTGAGCAAATGAATTTGGTACACAATA------AGGTATCCGA-------ATTAACCGTCCACGTCACCTCAAATAAAATCCTAATCAACCGAGGGATTACCCATT----CTTAGTGCTTTTACTGAGATGGTCCTTCGGCTTCTTT------AAAG-TTGGATGGCTTG-----ATTTGAAATCCCGAATCTA---GCCTGTCCTTTTCAA----ATTGGCAATTTAGCTATATTTCGATAAGAAGTAAGAGAA----GGATAACCTCGGGTAGGTAAAAATATAGAAAGGAAAGGGAGGGATT Polystichum_andersonii_GB --------------------------------------------------------------T-------------TGGAGGTCTCTGCAATGG--AAA-CCTAAGCAAAGGAC----TTGAGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGCAAAAGTTTTTTGATCTAGCTTGTTCCTTTATTTGGGGCAAAAATTAAATCATAA---T-AAT---------------TTACTT-----CATAGAA--------CTATTCTACTTCTGAGCAAATTAATTTAGTACATG---------AAGTATCTGA-------ATTACCCGTCCACATCACTTCAACTAAATCCGT-----ACTGAGGGATTACCTATTTATTTTTATTGCTTCTACTGAGACGATCCTTCGGCT-----------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACTCCA---GCCCGTCTTCTTCAA----ATCGGCAAG-------------------------------------------------------------------------------- Polystichum_munitum_GB -------------------------------------------ATTAATCAAAA-----AAAT-------------TGGAGGTCTCTGCAATGG--AAA-CCTAAGCAAAGGAC----TTGAGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAGTGGCAAAAGTTTTTTGATCTAGCTTGTTCCTTTATTTGGGGCAAAATTTAAATCATAA---T-AAT---------------TTACTT-----CATAGAA--------CTATTCTACTTCTGAGCAAATTAATTTAGTACATG---------AAGTATCTGA-------ATTACCCGTCCACATCACTTCAACTAAATTCGT-----ACTGAGGGATTACCTATTTATTTTTATTGCTTCTACTGAGACGATCCTTCGGCT-----------AAAG-TTGGATGACTTG-----ATTTGAAATCCCGACCCCA---GCCCGTCTTCTTCAA----ATCG------------------------------------------------------------------------------------- 'Rumohra adiantiformis (Jansen & Rouhan 2550)' ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Rumohra adiantiformis (Kessler sn)' ATTATTCCCGCAAAGCTTAGTGATTTTTTACTAAATTATTAA-TTTAATAAAAT-----TAAT-------------TGGAGGTCTCTACAACGA--AAG-CTTAAGCAAAAGAC----TTGGGATGGTGAGATTC------------------AATAAACAGA-----TTACTT-AGGAAATGGTAAAAGTTTCTCGGTCTAACTCGTTC------------CAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATAAAGTTTTTGATCAAATTAATTTGGTACATTTTG------AAGTATCCAA-------ATTAATTGTCTACGTCATTTCGACTGAATCCCTAATCAACCGAGGGATTACCTATT----TTTATTGCTTCTATTGAGATGGTTCTTCGGTTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGGGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGACGGAAAACTATAAAA------ACAACCTCGGGTACGTAAAAATATAAAAAGGAAAGGGAGGGATT 'Rumohra adiantiformis (Prado & Hirai 2022)' ATTATTCCCGCAAAGCTTAGTGATTTTTTACTAAATTATTAA-TTTGATAAAAT-----TAAT-------------TGGAGGTCTCTACAACGA--AAG-CTTAAGCAAAAGAC----TTGGGATGATGAAATTC------------------AATAAACAGA-----TTACTT-AGGAAATGGTAAAAGTTTCTCGTTCTAACTTGTTC------------CAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTATATTTTTGATCAAATTCATTTGGTACATGATA------AAGTATCCAA-------ATTAATCGTCTACGTCATTTCGACTGAATCCCTAATCAACCGAGGGATTACCTATT----TTTCTTGCTTCTATTGAGATGGTCCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGGGACTCCA---GCCCGTCTTCTTCAA----ACCGACAATTTAGCTAGATTTCGACGGAAAACTATAAAA------ACAACCTCGGGTACGTAAAAATATAAAAAGGAAAGGGAGGGATT 'Rumohra berteroana (Danton 1964)' ATTATTCCCGCAAAGCTTAGTGATTTTTTACTAAATTATTAA-TTTAATAAAAT-----TAAT-------------TGGAGGTCTCTACAACGA--AAG-CTTAAGCAAAAGAC----TTGGGATGATAAAATTC------------------AATAAACAGA-----TTATTT-AGGAAATGGTAAAAGTTTCTCGGTCTAACTTGTTC------------CAAAAATTAAATCATAA---T-TTT---------------TTACTT---TATATTTAA--------ATATTAAATTTTTGATCAAATTAATTTGGTACATGATG------AAGTATCCAA-------ATTAATCGTCTACGTCATTTCGACTGAATCCCTAATCAACCGAGGGATTACCTATT----TTTATTGCTTCTATTGAGATGGTTCTTCGGCTTCTCC------AAAG-TTGTACGACTTG-----ATTTGAAACCGGGACTCCA---GCCCGTCTTTTTCAA----ATCGACAATTTAGCTAGATTTCGACGGAAAACTATAAAA------ACAACCTCGGGTACGTAAAAATATAAAAAGGAAAGGGAGGGATT 'Stigmatopteris ichtiosma (Moran 6752)' ATTACTCCCGTAAAGCCTAGTGATTATTTACTAAATTTTTAA-TTGAATCAAAT-----AATT-------------TGAAGGTCTCTACGATGA--AAA-CCTAGGCAAAGGAT----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAGGTTTCTCGATCTAGCTTGTTCCCTTTTT-GGAGCATAAATTCAATCATAA---T-TTT---------------TTACTT-----TGTATAA--------ATCTTTTAATTTTGAGCCAATTAATTTGGTACACGATG------ACGTATCCAA-------ATTACCCGTCCACGTCACTTCAACTAAATTTCCAATCAGCCAAGGGATTACCTATT----CCTATTGCTTTTACCGGGATGGTC----GGCTTCTTT------AAGGTTTGGACGACTCG-----ATTTGAAACCCCGACTCCA---GTTGATCCTTCTCAA----ATCGGTAATTTAGCTAGATTTCAATAAAGTAAAAGAAAG------ATAACCTCGGGTAGGTAAAAATGGAGAAGGGAAAGGGAGGGATT 'Stigmatopteris killipiana (Moran 6924)' ATTACTCCCGTAAAGCCTAGTGATTATTTACTAAATTTTTAA-TTGAGTCAAAT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCTAGGCAAAGGAT----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAATGGCAAAGGTTTCTCGATCTAGCTTGTTCCCTTTTT-GGAGCATAAATTCAATCATAA---T-TTT---------------TTACTT-----TGTATAA--------ATATTTTAATTTTGAGCAAATTAATTTGGTACACGATG------ACGTATCCAA-------ATTACCCGTCCACGTCACTTCAACTCAATTTCCAATCAGCCAAGGGATTACCTATT----CCTATTGCTTTTACCGGGATGGTC----GGCTTCTTT------AAGGTTTGGACGACTCG-----ATTTGAAACCCCGACTCCA---GTTGATCCTTCTCAA----ATCGGTAATTTAGCTAGATTTCAATAAAGTAAAAGAAAG------ATAACCTCGGGTAGGTAAAAATGGAGAAAGGAAAGGGAGGGATT 'Stigmatopteris lechlerii (Moran 6942)' ATTACTCTCGTAAAGCCTAGTGATTATTTACTCAATTTTTAA-TTGAATCAAAT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCTAGGCAAAGGAT----TTGGGATGATGAAATTC------------------AATAAGCGGA-----TTACTT-AGGAAATGGCAAAGGTTTCTCGATCTAGCTTGTTCCCTTTTT-GGAGCATAAATTCAATCATAA---T-TTT---------------TTACTT-----TGTATAA--------ATATTTTAATTTTGAGCGAATTAATTTGGTACACGATG------ACGTATCCAA-------ATTACCCGTCCACGTCACTTCAACTAAATCTCCAATCAGCCAAGGGATTACCTATT----CCTATTGCTTTTACCGGGATGGTC----GGCTTCTTT------AAGGTTTGGACGACTCG-----ATTTGAAACCCCGACTCTA---GTTGATCCTTCTCAA----ATCGGTAATTTAGCTAGATTTCAATAAAATAAAAGAAAG------ATAACCTCGGGTAGGTAAAAATGGAGAAGGGAAAGGGAGGGATT 'Stigmatopteris sordida (Moran 6946)' ATTACTCCCGTAAAGCCTAGTGATTATTTACTAAATTTTTAA-TTGAATCAAAT-----AATT-------------TGGAGGTCTCTACGATGA--AAA-CCTAGGCAAAGGAT----TTGGGATGATGAAATTC------------------AATAAGCAGA-----TTACTT-AGGAAAGGGCAAAGGTTTCTCGATCTAGCTTGTTCCCTTTTT-GGAGCATAAATTCAATCATAA---T-TTT---------------TTACTT-----TGTATAA--------ATATTTTAATTTTGAGCAAATTAATTTGGTACACGATG------ACGTATCCAA-------ATTACCCGTCCACGTCACTTCAACTCAATTTCCAATCAGCCAAGGGATTACCTATT----CCTATTGCTTTTACCGGGATGGTC----GGCTTCTTT------AAGGTTTGGACGACTCG-----ATTTGAAACCCCGACTCCA---GTTGATCCTTCTCAA----ATCGGTAATTTAGCTAGATTTCAATAAAGTAAAAGAAAG------ATAACCTCGGGTAGGTAAAAATGGAGAAAGGAAAGGGAGGGATT 'Teratophyllum wilkesianum (Ranker 1937)' ATTACTCTCGCAAAGCTTAGTGATCAGTTACTAAATAATCAA-TTTTATAAAAT-----AAAT-------------TAGAAGTCTATACAATGA--AAA-TCTAAGCAACGGGC----TTGGGATGCTGATATTT------------------AATAAGCAGG-----TTACTT-AGGAAATGGTAAAAGTTTATCGGTCTAGCTTGTTTCTTTTTC-GAAGCAAAAATTAAATCATAA---T-TTC---------------TTAATT---TATATAGAA--------ATATTCTATTTTTGATCAAATTAATTTGGTACATGATA------AAGTATCCGA-------ATCAACTGCCTACGTCATTTCAGTTAAATTTCTAATCAACTGAGGAATTACCAATC----TTTAATGCTTTTATCAAGATAGTCCTTCGGCTTCTTTAGA---GTAG-TTGTACAACTTT-----ATTTGAAACCGCGGCTCCA---GCCCG-CTTTTTCAA----ATTGGAAAGTTAGCTAGACTTCTACGGAAAAAGAGAAAGATAAAAACAACCTCGGGCAGATAAAAAGAGAGAAAGGAAAGGGAGGGATT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M31544] TITLE 'Lastreopsid trnG-trnR'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1019; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Arachniodes aristata (Lorence 9314)' TGCGCCATTCCCGTTACTCCTGTACTTCGGAAGTCGTACCGGTTGATGACGAAGCGGAATTATTCTGGTACGCAAAAAACTTGGGACG------ATTCCGGAAAGAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAGGGA----AATCCAAGCTCGGAAGTTGCGGGTGGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTTTTCTATCTTT--TGGTTAAACAGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAAGTAGAAATAAAGAACGAAGTAAAT---GAAGAAAGAAATTGGTGAAACTAATTCT---------TTTTCTCAAGGGATCATCTAAG-AAGTGTATCCATG-CTATGCGACCAAAACGTAGGCAAGACTGACATAGATTTTATGGACGCCATTTCCTAAAA-TTGGGACGG-CTCCCTCCTCTCC-----GAACGGGGGGAAA--AGAAGGAAGCCCCAATATATTCTGATGT---GGAAGAAGTATCGATCCCC------AGTAATTTTT-ATATATG----CCCTCTTCCC-----------TTAAAACAAGGG---AGACAGTCC--AC-CCA----TTTCTTGATT--GTTCTATCTAACC-------AAATATATGCAGACGAATTC-TCGACCAGTTTTGT------------AC----TATTTAGCCTTCCTTGACTTCCATAAAGGAGCCGAATGGGCGGAAACCTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTAGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCTAAG-----AACCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAG 'Arachniodes denticulata (Mynssen 549)' TGCGTCATTCCCGTTACTCCCGTACTTCGGAAGTCGTACCGGTTGATGACGAAGCGGAATTATTCTGGTACGCAAGAAACTTGGGACG------ATTCCAGAGAGAGGAAAAATTGCGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAGATA----AATCCAAGCTCGAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTTTTCTATCTTT--TGGTTAAACAGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAAGTAGAAGTAAGGAACGAAGTAAGT---GAAGAAAGAAATTGGTGAAACTAATTCT---------TTTTATCGAGGGATCATCTAAG-AAGTGTATCCATG-CTATGCAACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACGCCATTTACTAAAA-TTGGGGTGG-TTCTCTCCTCCCC-----GAACGGGGAGAAT--GGAAGGAAACCCCGATATATTCCGATGT---GGAAGAAGTATCGATCCCC------AGTAATTTTT-ATATATG----CCCCCTTCGT-----------TTAAAACAAGGG---AGACAGTCC--AC-CCG----TTTCTTGATT--GTCCCATTTGACC-------AAAAATATGCAGACGAATTC-TTGACCAGTTTTGT------------AC----TATTTAGTCTCCCTGGACTTCCATAAGGGAGCCGAATGGGCGGAAACCTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGGTGTAGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCTAAA-----AATCCCGA-AGCC----CTAGTCGAGTTAACCCCTTCATCCATGGATCGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAACCTGTAG Arachniodes_rhomboidea_GB TGCGCCATTCCCGTCACTCCTGTACTTCGGAAGTCGTATTGGTTAATGACGAAGCGGAATTATTCTGGTACGCAAAAAACTTGGGACG------ATTCCAAAAAGAGGAAAATTTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTAACTGAACCTTGGGATAGA----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTTTTTTACCTTT--TGGTTAAACAGTAACAATTGCTTCCGACTCGGTGAGAAATATTCTCCTAAGGATTGTTGAAAGTAGAGATAAAGAACGAAGTAAGT----AAGAAAGAAATTGGTGAAACTAATTCT---------TTTTCTCGAGGGATCATCTAAG-AAGTGTATCCATG-CTATGCGACCAAAACGTAGGCGAGACTGACATAGATTTTATGGACGCCATTTACTGAAATTTGGGGCGG-CTCCCTCCTCTCT-----GAACGGGGGAGGGGAATAAGGAAGTCCCAATATATTCCGACGT---GGAAAAAGTCTTGATCCCC------AGTAATTTTC-ATATACG----CCCCCTTCGT-----------TTGAAACAAGGG---AAACGGTCC--AC-CCA----TTTCTCGACT--GTTCCATTTAACC-------AGATATATGCAGACGAATTC-TCGACCAGTTTTGT------------AC----CATGTAGCCTTCCTTGACTTCCATAAGGGAGCCGAATGGGCGGAAACCTCCATGTTCGGTTCTGAATTAGCGACGTTATAA-CCATTTGTTGTAGTC-ACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCAAG-----AATCC---------------------------------------------------------------------------------------------------- Arthropteris_altescandens_GB --------------------------TCGAAAGTCGTACCGCTTAGTAACGAAGCAGGATTATTTAGGTCTGCAAAAAACTTAGGACGCCTCCAAGTCCAAAAGGAGGAAAAATTAGGAATCTATGGGTAAACATCTAAAATATTTGTCTTATCGTCACTGAACCGTGGAAAAAAAAAGAATCCAAGCTCGAAAGTTCTAACTAGATGAATCTTGGTTTATCAGGATTATCAAGTCAAGGAC-------TGTTT--TGGCTAAGCAGCAGCAGTTGCTTTCGACTCGGTGAGAAATATTTCCCTAAAGATTTT---GAGTAAAAATAAAGAACGAAGTAAATTAGAAAAAAAAAGAGTGATGAAACTA---------CTTTTTTCCTTCAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGACTAAAACGTAAGTAAGACTGACATAGATTTTATGGATGACGCTTACTCAAA-TTGGGCCGG-TTTTCTGTTCTTC-----GAACAGGAGATAAAAAAAAGACCCGACTTTCTTTTTTCGATATGGAGGAGGAAGCCTCGATCCTCATA-AAAAGAATTTTG-ATATATG----CCTCCTTTAA-----------AGAAAGCAGGGG---AGACGATTC--AC-TTATCTTTCTTTTTATT--GTTCCATTTACCT-------AAACAAAT-------------TATACCAGTTTTGT---------------------TTAGCTTTACTTTCTCTCCATAAAGGAGCCGAATGGGCGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTCATGA-TCAGCTGCCGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTATCCGCTGTTGATACGATACTAAGAAT-CCGG-AGCCCCAGCTAACTCAATTAAGCCCTTCACTTATAAATTGCGTCGTGAACAAACAAGAACTTTAGTTTGTTCACGAT-TTGCTAACTAATCCGTCG 'Bolbitis acrostichoides (Fay 1068)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Bolbitis auriculata (Fay 110)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Bolbitis humblotii (Razafitsalana 115)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Coveniella poecilophlebia (Kessler 14303)' TGCG-CGCTCCCGT-ACTC-TGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAAGAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATAGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTCTTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATATAAAGTAATTTTG-ATATACG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGC---------------------------------------------------------------------------------------------------------------------------------- 'Coveniella poecilophlebia (van der Werff 11478)' TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAAGAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATAGGGCAG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTCTTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATATAAAGTAATTTTG-ATATACG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTG?TGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCC----CTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG Ctenitis_eatonii_GB ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Cyclodium heterodon var. heterodon (Labiak 3996)' TGCGCCATTCCCGTCACTCTTGCACGTCGAAAGTCGTACCGGTTAATGACGAAGCGGGATTATTTTGGTATGCAAAAAACTTAGGACG------ATTTCAAAAAAAGAAAAAATTAGAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGTAGAA----AATCCAAGCTCAAAAGTTGCAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCAG-------GTTAT--TGGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTGCCTAAGGATTCTTGGAAGTAGAAATAAAGAACGAAGTAAAT----GAAAAAGAGATTGTTGAAACTA----------CTTCCTTTTTCGAAGGATCATCTAAG-AAGTATATCCCTG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATCTTATGGAAGCCATTTATTGAGA-TTGGAGAGG?TTCTCTCCT?TTC-----GAACGAGGGAAAGGGGGGGGGGG----CCATTTAATCCAATAT---GCGGAAAGCCTCGATCCCCATA-AAAGTAATCTTG-CTATACG----CTCCTTTCGC-----------TTGAAACAGGGG---ATGCGATCC--GC-CCA----TCTTTTGATT--GTTCCATTTTACT-------AAGTATATGCAGACAAATTC-TCCCCCAGTTTTGT------------ACTATGTATGTAGCCTTGCTTTATTTCCATAAGGGAGCCAAATGGGCGGAAACCTCCATGTTCGGTTCTGAATTAGCGGCGTCACAA-CCATTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTTATGATACTAAA-----AATACTGG-AGCC----CTAATCAAGTTAACCCCTTCACCCGCGGATTGGGTCGTGAACAAACTGGAGTTCTCGTTTGTTCACGAT-TTGATAACTAATCTATAA 'Cyclodium rheophilum (Granville 15523)' TGCGCCATTCCCGTCACTCTTGCACGTCGAAAGTCGTACCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAAGCTTAGGAAG------ATTTCAAAAAAAGGAAAAATTAGAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGTAGAA----AATCCAAGCTCAAAAGTTGCAAGTAGATGAATCTTGGTTTATCAGGATTATCAAGTCAAGCAG-------GTTAT--TAGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTGCCTAAGGATTCTTGAAAGTAAAAATAAAGAACGAAGTAAAT----GAAAAAGAAATTGTTGAAACTA----------CTTCCTTTTTCGAAGGATCATCTAAG-AAGTATATTCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATATTATGGAAACCATTTATTGAAA-TTGGAGAGG-TTCTCTCCTCTTC-----AAACGGGAAGGAAAGGGGGGGGGG----CATTTAATCCAATAT---GCGGAAAGCCTCGATCCCCATA-AAAGGAATCTTG-CTATACA----CTCCTTTCGC-----------TTAAAACAGGGGAT-GTGCGATCC--GC-CTA----TCTTTTGATT--GCTCCATTTTACT-------AAGTATATGCAGACAAGTTC-TCCCCCAGTTTTGT------------ACTATGTATGTAGCCTTGCTTTATTTCCATAAGGGAGCCAAATGGACGGAAACCTCCATGTTCGGTTCTGAATTAGCGGCGTCACAA-CCAGTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTTATGATACTAAG-----AATCCCGG-AGCC----CTAATCGAGGTAACCCCTTCACCCGCAGATTGGGTCGTGAACAAACTGGAGTTCTCGTTTGTTCACGAT-TTGATAACTAATCTATAA Dryopteris_crispifolia_GB TGCGCCATTCCCGTTACTCCTGTACCTCGGAAGTCGTACCGGTTAATGACGAAGCAGAATTTTTTTGGTATGCAAAAAACTTGGAGAG------ATTCCGAAGAAAGGAAAAAGTGAGAATCTATGGGTAGACATCTAAGATATTTGCCTCATCGTCACTGAACCTTGGGAGAAA----AATCCAAGCTCAGAAGTTACAGATAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTCTTTTATTTCT--TGGTTAGGCAGTACTAGTTGCTTTCGACTCGGTGAGAAATATTTCCCTAAGGATTGTTGGAAGTAGAAATAAAGAACGAAGTAAGT----AGAAGAAAAATTAGTGAAACTAATTCT---------TTTTTTTAAAGGATCATCTAAG-AAGTATATCCGTG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACGCCATCTACTCAAA-TTGGGGCGG-CTCCGTCCCCCTC-----GAACAAAGGAAAAGGAAAAGGAAGCCCCCATATATTCCGATAT---GGAGGAAGTCTCGATCCCCGGA-GAAGTAATTTCG-ATATATG----CTCCCTTCGT-----------TTGAAACAAGGG---AGACAGTCC--AC-CCA----TTTTTCGATT--GTTCCATTTAACT-------AAATATATGCAGACAAATTC-TCCGCCAGTTTCGC------------AC----TATTTAGCCTTCCTCGATTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCAAG-----AATCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCATCCGTGGATTGGGTCGTGAACAAACTGAAATTCTTG------------------------------- Dryopteris_fragrans_GB TGCGCCATTCCCGTTACTCCTGTACTTCGGAAGTCGTACCGGTTAATAACGAAGCGGAATTATTTTGGTATGCAAAAAACTTGGGACG------ATTCCGAAGAAAGGAAAAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAGGAA----AATCCAAGCTCGAAAGTTGCAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAGGCACTCTTTCCTTTTT--TGGTTAAGCAGTACCAGTTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAAGTAAAAATAAAGAACGAAGTAAGT----AGAAGAAGAATTAGTTTCACTAATTCT---------TTTTCTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACGCCATTTACTCAAA-TTGGGGCGG-CTCCCTCCTCCTC-----GA--GGGGGAAAAGAAAAAGGAAGCCCCCATATATTCCGATGT---GGAAGAAGTCTTGGTCCCCGTG-AAAGTAATTTCG-ATATATG----CTCCCCTCGT-----------TTGAAACAAGGG---AGACGGTCC--AC-CCA----TTTTTCGATT--GTTCCATTTAACT-------AAATATATGCAGACGAATTC-TCCGCCAGTTTTGC------------AC----TATCTAGCCTTCCTCGATTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAG-CCATTTGCTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCGGA-----AATGCCGG-AGCCCTAGCTAGTCAAGTTAACCCCTTCATCCATGGATTGGGTCGTGAACAAACTGGAGTTCT--------------------------------- 'Dryopteris patula (Sundue 1104)' TGCGCTATTCCCGTTACTACGGTACCTCGGAAGTCGTACCGGTTAATGACGAAGCGGAATTATTTTGGTATGCAATAAACTTGGGAAG------ATTCCGAAGAAAGGAGGAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGGATGT----AATCCAAGCTCAAAAGTTACAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTCTTTTATTTTT--TGGTTAGACAGTACTAGTTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGAAAGTAAAAATAAAGAACGAAGTAAGT----AGAAGAAAAATTAGTTTCACTAATTCC---------TTTTCTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACACCATTTATTCAAA-TTGGGGCGG-CTCCGTCCTCCCC-----GAACGGGAA-AAATGAAAAGTAAGCCCCAATATATTACGACGC---GGAAGAAGTCTCGATTCCGGTA-GATGTAATTTTG-ATATATG----CTCCCCTCCC-----------TTGAAACAAGGG---AGACAGTCC--AC-CCA-----TTTTTGACT--GTTTTATTTAACT-------AAATATATACAGACAAATTA-TCTGCCAGTTTTGTAC----------AC----TATTTAGGCTTCCTCGATTTCCATAGAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTATTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCGAG-----AATCCCGG-{AG}ACT----CTAGTCA?GTTAACCCCTTCATCCGTGGATTAGATCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAG Dryopteris_patula_GB TGCGCTATTCCCGTTGCTGCGGTACCTCGGAAGTCGTACCGGTTAATGACGAAGCGGAATTATTTTGGTATGCAATAAACTTGGGAAG------ATTCCGAAGAAAGAAGGAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGGGGGT----GATCCAAGCTCAAAAGTTACAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTCTTTTCTTTTT--TGGTTAGACAGTACTAGTTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGAAAGTAAAAATAAAGAACGAAGTAAGT----AGAAAAAAAATTAGTTTCACTAAT---------TCCTTTTCTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAAACCATTTACTCAAA-TTGGGGCGG-CTCCGTCCCCCCC-----GAACGGGAAAAAATGAAAACGAAGCCCCAATATATTCCGACGT---GGAAGAAGTCTCGGTCCCGGTA-GATGTAATTTTG-ATATATG----CTCCCCTCCC-----------TTGAAACAAGGG---AGACAGTCC--AC-CCA----TTTTTTGACT--GTTTTATTTAACT-------AAATATATACAGACAAATTA-TCTGTCAGTTTTGTACTGT-------AC----TATTTAGGCTTCCTCGATTTCCATAGAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAG-CCATTTATTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATGCCGAG-----AATCCCGG-AACT----CTAGTCAAGTTAACCCCTTCATCCGTGGATTAGATCGTGAACAAACTGGAGTTC---------------------------------- 'Dryopteris wallichiana (Labiak 4434)' --------------------------------------------AATGACGAAGCAGAATTTTTTTGGTATGCAAAAAACTTGGGAAG------ATTCCGAAAAAAGGAAGAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGTGGAA----AATCCAAGCTCAGAAGTTACAGGTAGGTTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACTCTTTTCTTTTT--TGGTTAGACAGTACTAGTTGCTTTCGACTCGGTGAGAAACATTTCCCTAAGGATTATTGGAAGTAGAAATAAAGAACGAAGTAAGT----AGAAGAAAAATTAGTGAAACTAATCCT---------TCTTCTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAAACTGACATAGATTTTATGGACGCCATTTACTCAAA-TTGGGGCGG-ATCCGTCCTCCTC-----GAACGGGAAGAGA--AAGAGGAAGTCCCCATATATTCCGATGT---GGAAGAAATCTTGATCCCCGTA-GAAGTAATTTTG-ATATATG----CTCCCTTCGC-----------TTGAAACAAGAG---AGACAGTCC--AC-CCA----TTTTTCGATT--GTTCCATTTAACT-------AAATATATGCAGACGAATTC-TTCGCCAGTTTCGC------------AC----TATTTAGCCTTCCTCGATTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATCTGTTGTCGTCGACTATAAC-CTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Elaphoglossum amygdalifolium (Herrera 2063)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Elaphoglossum decoratum (NYBG391/77B)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Elaphoglossum hybridum (FR6421)' TACGCAATTCCCGTTACTTTTGTACTTCGAAAGTCGTACTGATTAGTGGCGAAGCAGAATTAGTTTGGTATTCTAAACACTTTGTATG------ATTACAAAAAGAGTAAGAATTAGGAATCTATGGGTAGACATCTAAGATATTTGCTTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCAAAAGTTAAAGGTGGATAAATCTTGGTTTATCAGGATTGTCAAGTCAAGCAT-------CTATT--TGTTTAAACAAAAAAGATTGCTTCCGACTCGGTGAAAAATAAATTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAGGTAA-----AAGAAAAAAGATTGGCTAAACTAATTCCCC--TCTTTTTTCTTTAAAGGATCATCTAAG-AAGTATATTGATG-CTAAATGAACAAAGCGTAAGCAAAACTGACATAGATCTTATGAATACCAATAACTAAAA--TGAAGAGGGCTCCCTCCTC--------AAACAAGATAGAAAAGGA----------------------------GGGGGAAGATTTGACACTCAGA-AATTGAATTCTG-ATATACG----CTTCCTCCGT-----------CTAAAACGGGGT---AAGCGGTCC------------------AGTT--GTTCTATTTCGAT-------AAATATATGCTGACAAAGTT-TATCTCAGCTTTGT------------AC----TAGTTAACCTTTCTCTATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCACGTTCGGTTCTGGATTAGCGATGTCATAA-TCATTTATTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGAATTTTTG-----AATTCCGA-ATTC----CTAGTCAAATTAACTGCTTCAATCACAAGTCGGGTCGTGAACAAACTGAAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAT 'Lastreopsis acuminata (Coveny 10182)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCAGTACG------GTTCCGAAAAGAGGAAAATTTAATAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------CCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATGAAGAACGAAGTAAAA---AAAAAAAAGAATTGG{GT}GGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTGGGGCAG-CTCCCTCCTCCCT-----GAACAGGTAAAAAGGGGAAATAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAGCCCCCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAGTGACACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis acuminata (Kessler 14227)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCAGTACG------GTTCCGAAAAGAGGAAAATTTAATAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------CCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATGAAGAACGAAGTAAAA---AAAAAAAAGAATTGG{GT}GGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTGGGGCAG-CTCCCTCCTCCCT-----GAACAGGTAAAAAGGGGAAATAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAGCCCCCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAGTGACACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis acuta (Labiak 4913)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGTTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAACGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCTTTCTCCTT-----GAACAGGGGGAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GGGGGAAGACTCGATACCCATA-AAAGTATTTTTG-ATAGACG-------CCCCCCT-----------CTAAACCGGGGG---AGACAGTCC--AC-CCG----TCTATTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTACCCTTCCTTTTTGTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCTTTTGT?GTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACGAAAAATCCAGTTTGTTCACGAT-TTGGTAACTAATA{GT}GGAG 'Lastreopsis amplissima (Labiak sn)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAAGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTGCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAGAAAAAAATTGGTGAAACTAATT------TACCCTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAATCCCCATATATTTCAATAT---GAAGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA----CCTCCTCCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-CCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis amplissima (Prado & Hirai 2021)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAAGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTGCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAGAAAAAAATTGGTGAAACTAATT------TACCCTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAATCCCCATATATTTCAATAT---GAAGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA----CCTCCTCCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-CCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis amplissima (Zardini 15991)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGT{CG}GTACTGATTAGTGACGAAGC{AG}GGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAAGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTGCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAGAAAAAAATTGGTGAAACTAATT------TACCCTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAATCCCCATATATTTCAATAT---GAAGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATT----CCTCCTCCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTCGA{CT}T--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-CCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAG{AC}GACGTCATAA-CCATTTG-TGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis barteriana (Carvalho 5780)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis boivinii (RG470)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCG-TTGTTCACGAT-TTGGTAA----------- 'Lastreopsis boivinii (Rouhan 1356)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis boivinii (Rouhan 1369)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTT---------------------------- 'Lastreopsis confinis (Liogier 25604)' TGCGTCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCCTTCTCCTT-----GAACGAGGG------GGAAAGAAGTCCCCATATATATCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTATTTTTG-ATATATG-----CCCCCCCCT-----------CTAAACTGGGGG---AGACAGTCC--AC-CCG----TCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTTTTGTTCATAAAGGAGCCGAA{GT}GGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAACCCTTTTGTTGTCGTCGACTATAACTCTTTAGCTTCCCAAGCTACTGCTAGGGGTTGGATTCCCTCTACCCTCTCGTGCCACTAAG-----AATTCTGA-AGCC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGATTTTTCGTTTGTTCAC{AG}AT-TTGGTAACTAATATGGAG 'Lastreopsis currori (Doursett-Lemaire 1906)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis currori (Fay 4804)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis decomposita (Kessler 14191)' TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACAAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCCCTAGCTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis effusa (BP047)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGTTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCCTTCTCCTT-----GAACAGGGGGAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTTTTTTTG-ATAGACG-------CCCCCCT-----------CTAAACCGGGGG---AGACAGTCC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTACCCTTCCTTTTTGTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCTTTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGATTTTTCGTTTGTTCACGAT-TTGGTAACTAATATGGAG 'Lastreopsis effusa ssp dilatata (Hernandez 1906)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa ssp divergens (Villaroel 1597)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGTTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAACGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCTTTCTCCTT-----GAACGGGGG-AAAGGGGAAAGAAGTCCCCATATATATCAATAT---GGGGGAAGACTCGATACCCATA-AAAGTATTTTTG-ATAGACG-------CCCCCCT-----------CTAAACCGGGGG---AGACAGTCC--AC-CCG----TCTATTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTACCCTTCCTTTTTGTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCTTTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACGAAAAATCCAGTTTGTTCACGAT-TTGGTAACTAATATGGAG 'Lastreopsis effusa ssp divergens (Walker 10612)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACCCGGGACG------GTTCCGAAAAAAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTGGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTAGATTAATCCTGGTTTATCAGGATT-----GTCAAGCAC-------TCTTT--TGGTTAAATGTTAACAATTGCTTTCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAACGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGGAACTAATTTT----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGGGGCGA-CTCCTTTCTCCTT-----GAACGGGGG-AAAGGGGAAAGAAGTCCCCATATATATCAATAT---GGGGGAAGACTCGATACCCATA-AAAGTATTTTTG-ATAGACG-------CCCCCCT-----------TTAAACCGGGGG---AGACAGTCC--AC-CCG----TCTATTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TCTCTCAGTTTTGT------------AC----TATTTACCCTTCCTTTTTGTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCTTTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CTAGTCAA?TTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACGAAAAATCCAGTTTGTTCACGAT-TTGGTAACTAATATGGAG 'Lastreopsis exculta ssp exculta (Moran 3239)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis glabella (Given 11847)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGTACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCAAAAGTAAAAATAAAGAACGAAGTAAA----AAAAAAAAGAATTGGTGGAACTAATTTC----TTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG?CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAATT?GGGGCAG-CTCCCTCCTCCCT-----GAACAGGAAAAAAGGGGAAAGAAGT?CCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAATTAATTTTG-ATATATG---?CCCCCCCCCTCTGT-------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCAAATTA?TTTTTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis hispida (Given 11819)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAT-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAAAAAAAAATTGGTGAAACTAATT------TACCTTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGATCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAGTCCCCATATATTTCAATAT---GAATGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA--------CTTCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTT-CCTATCAGTTTTGT------------AC----TATTTAGTCTTCCTTGATTTTCATAAAGGAGCCGAATGGGAGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CTATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCAG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis hispida (Schneider sn)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAACGAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAT-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---GAAAAAAAAAATTGGTGAAACTAATT------TACCTTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGATCGAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----GAACGGGGGAAAAGGAGAGGGAAGTCCCCATATATTTCAATAT---GAATGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA--------CTTCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTT-CCTATCAGTTTTGT------------AC----TATTTAGTCTTCCTTGATTTTCATAAAGGAGCCGAATGGGAGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CTATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCAG-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis killipii (Altamirano 952)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTAAACCTTGGAACGAG----AATCCAAG-TCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAAGAAAGAACGAAGTAAAA---GAAGAAAAAAATTGGTGAAACTAAAT------TACTCTTTTTCAAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGGGCGAAACGTAAGCAAGACTGACATAGATTTTATGAATGCCATCTACCCAAA-TTGGGGCGG-CTCCCTCCTCCTT-----AAACGGGGGAAAAGGAGAGGGAAGTCCCCATATATTTCAATAT---GAAGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATA----CCTCCTCCCT-----------TTAAAACGGGGA---AGACAGTCC--AC-CCA----TATTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-CCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTAATTTTCATAAAGGAGCCGAATGGGCTGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis marginans (Kessler 14192)' TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTATCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACTAGCTGGTGACGCTAAT-----AATACCGG-AGCCCTAGCTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis marginans (Kessler 14354)' TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACAGGGGAAAAG-AGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CCTTATCCTTCCAAGCTACTGATGCGGGTTCGATACCCGCTAGTAGCTGGTGACGCAAAT-----AATACCGG-AGCCCTAGCTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis microsora (Coveny 9944)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTA------AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG----CCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis microsora (Gardner 5018)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTA------AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG----CCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis microsora (Kessler 14350)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGACGTACTGATTAGTGATGTAGCAGGATTAGTTCAGTATGCTAAAAACCCGGGACG-------TTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG---CCCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis microsora (Kessler 14355)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGACGTACTGATTAGTGATGTAGCAGGATTAGTTCAGTATGCTAAAAACCCGGGACG-------TTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG---CCCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis munita (Clarke & Pickard 1814)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis munita (Coveny 1303)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis munita (Coveny 1906)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis nigritiana (Thomas 8919)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis perrieriana (Rouhan 1318)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis perrieriana (Rouhan 1321)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGACAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACGTAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis pseudoperrieriana (Rouhan 1319)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis pseudoperrieriana (Rouhan 1323)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis pseudoperrieriana (Rouhan 1325)' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis pseudoperrieriana (Rouhan 1364)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTAGTACTGATTAGTGACGAAGCAGAATTAGTTCGGTATGCTAAAAACTCGGGACA------GTTCCGAAAAGAGAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAGGTGGATGAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTA------AAAAAAAATAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGTTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGAGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG----CTCCCTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-TCG----TCTTTTGGCT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCGG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCG-TTGTTCACGA--TTGGTAA-TAATC----- 'Lastreopsis rufescens (Kessler 14341)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCACTCTTTTGTCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTA-AAATGAAGAACGAAGTAAAA---AAAAAAAAGAATTGG{GT}GGAACTAATTTC----TTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTAGGGCAG-CTCCCTCCTCCCT-----GAACAGGGGAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAG-CCCCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACC-GCTGGTGCCACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis rufescens (Kessler 14343)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCACTCTTTTGTCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATGAAGAACGAAGTA------AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTAGGGCAG-CTCCCTCCTCCCT-----GAACAGGGGAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAG---CCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCACGCTACC-GCTGGTGCCACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis rufescens (Kessler 14347)' TGCACCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGAATAGTTCAGTATGCTAAAAACCCGGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCACTCTTTTGTCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATGAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTAGGGCAG-CTCCCTCCTCCCT-----GAACAGGGGAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCGCGATACCTATA-AAAGTAATTTTG-ATATAAG---CCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACACTAAT-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCACGCTACC-GCTGGTGCCACTAAG-----AATTCCGG-AGCC----CTAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis silvestris (Kessler 14222)' TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGTTTAGTGACGAAGCAGGATTAGCTCGGAATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAGCAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAAGAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTCTTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATAAATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTTCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTG-TGTCGTCGACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis smithiana (Coveny 9951)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGTACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCAAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTGGGGCAG-CTCCCTCCTCCCT-----GAACAGGAAAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAATTAATTTTG-ATATATG---CCCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCAAATTA-TTTTTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CGAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis smithiana (Kessler 14226)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACCCGGTACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAATAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCAAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCAATTAACCAAA-TTGGGGCAG-CTCCCTCCTCCCT-----GAACAGGAAAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAATTAATTTTG-ATATATG---CCCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCAAATTA-TTTTTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AATTCCGG-AGCC----CGAGTAAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis sp nov (Kessler 14345)' TGCGTCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCTTCTACCCAAA-TTGGGGCGG-CTCTCTCCCCCCT-----GAACGAAGGGAAAA-AAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGTATA-AAAGTAATTTTG-ATATACG----CTTCCTTCCT-----------TTAAAGCGGGGG---AGACAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAAGTAACCTCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATTCGGAG 'Lastreopsis subsericea (van der Werff 16118)' TGCGCCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAAGAATTGGTGAAACTAATTA-----ACTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCATCTACCCAAA-TTGGGGCGG-CTCTCTCCTCCCT-----GAACGAGGGGAGAAAAGAAAGAAGTCCTCATATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATACGCTTCCTTCCTTCCT-----------TTAAAGCGGGGG---AGACAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAGGTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGATAACTAATTTGGAG 'Lastreopsis subsimilis (Fay 4802)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis tenera (Kessler 14344)' TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCCCTAGCTAGTCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis tenera (coll unkn)' TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTATTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCGGGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCCCTAGCTAGTCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis tinarooensis (Kessler 14340)' -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTAAAGGATCATTTAAGAAAGTATATTCATG-CTATACGAGCGAAATGTTAGCCAGACTGACCTAGATTTTATGGATGCCAATTAACCCAA-TTAGGGCAG-CTCCCTCCTCCCT-----GAACAGGGGAAAAGGGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCCCGATACCTATA-AAAGTAATTTTG-ATATAAGCCCCCCCCCCCTCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------CAATATATGCGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTG------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis tinarooensis (Van der Werff 17036)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis vogelii (Visa 2498)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAAATCGGGACA------GTTCCGAAAAGAAAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATCTTATGGATGCCATTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG--------CTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-CCG----CCTTTTGTCT--GCTTCATTTCGAT-------AAATATATACGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCAG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis vogelii (Visa 3706)' TGCGCCATTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAAATCGGGACA------GTTCCGAAAAGAAAAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTCCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAACGAAATGTAAGCAAGACTGACATAGATCTTATGGATGCCATTTAACCAAA-TTGAGGCAG-CTCCCTCCGCCTTGACTTGAACGGGGAAAAAGGGGAAAGAAGTCCCCATATATCTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAGTAATTTTG-ATATATG--------CTCCCT-----------CTGAAACGGGGG---AGACAGTCC--AC-CCG----CCTTTTGTCT--GCTTCATTTCGAT-------AAATATATACGGGCGAATTA-TTTCTCAGTTTTGT------------AC----TAGTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGCTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACACTAAG-----AGTTCCAG-AGTC----CTAGTCAAATTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTTTCGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis walleri (Kessler 14339)' TGCGCCGCGCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGCTCGGTATGCTAAAAACTTAGGACA------ATTTCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAT----AATCCAAGCTCGAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGTTTAAACAGTAACAATTGCTCCCGACTCGGTGGGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAAATAATTGGTGAAACTAATTA-----CATTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATCTACCCAAA-ATGGGGCGG-CTCCCTCCTCCCT-----GAACGAGGGGAAAAGAGAAAGAAGTCTTCCTATATTTCAATAT---GGGGGAAGCCTCGATACCCATA-AAAATAATTTTG-ATATATG----CTTCCTCCCT-----------TTAAAGCAAGGG---AGACAGTCC--AC-CCA----TCTTTTGACC--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCACGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGACGCTAAT-----AATGCCGG-AGCC----CTAGCCGAGTTAACCCCTTCACTCATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Lastreopsis windsorensis (Kessler 14353)' ----------------------------------------------------------------------------------GGGACG------GTTCCGAAAAGAGGAAAAATTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAGAA----AATCCAAGCTCGAAAGTTACAAGTGGATTAATCCTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TCTTT--TGGTTAAATGGTAACAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTTTCGAAAGTAAAAATGAAGAACGAAGTAA-----AAAAAAAAGAATTGGTGGAACTAATTTC----CTTTCTATTTTTAAAGGATCATCTAAG-AAGTATATTCATG-CTATACGAGCGAAATGTAAGCAAGACTGACATAGATTTTATGGATGCCGATTAACCAAA-TTGGGCCAG-CTCCCTCCTCCCC-----GAACAGGGGAAAAGAGGAAAGAAGTCCCCATATATATCAATAT---GAGGGAAGCCTCGATACCTATA-AAAGTAATTTTG-ATATATG----CCCCCCCCCT-----------CTGAAACGGGGA---ATACAGTTC--AC-CCG----TCTTTTGACT--GCTCCATTTCGAT-------AAATATATGCGGGCGAATTA-TTTATCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGGCGCGACAA-CCATTTGTTATCGTCGACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis wurunuran (Kessler 14342)' TGCGTCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCTTCTACCCAAA-TTGGGGCGG-CTCTCTCCCCCCT-----GAACGAAGGGAAAA-AAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGTATA-AAAGTAATTTTG-ATATACG----CTTCCTTCCT-----------TTAAAGCGGGGG---AGACAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAAGTAACCTCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATTCGGAG 'Lastreopsis wurunuran (Kessler 14348)' TGCGTCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTAGGACA------ATTCCAAAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCTTCTACCCAAA-TTGGGGCGG-CTCTCTCCCCCCT-----GAACGAAGGGAAAA-AAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGTATA-AAAGTAATTTTG-ATATACG----CTTCCTTCCT-----------TTAAAGCGGGGG---AGACAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCCTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAAGTAACCTCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATTCGGAG 'Lomagramma matthewii (Wuzhisan 448)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lomariopsis_marginata_GB ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Maxonia apiifolia (Moran 3541)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Megalastrum abundans (Schwartsburd 1631)' TGCGCCGCTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTCGTTCGGTATGCTAAAAACTTGGGACA------------ATAAAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAATCAAGCAC-------TTTTT--GGGTTAAACAGTAAAAATTGCTTTCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTAACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------TTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTCGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum atrogriseum (Sundue 1779)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTATTTTGGTATGCTAAAAACTTGGGACA--------------ATAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTTTTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTTTCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGGAGAAGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTATCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACACTAAG-----AATCCCGG-AGAC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum canacae (Grangaud 3)' TGCGCCGTTCTCGTTACTCTTGTACTTCAAAAATCGTACTTATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACTTGAGACA------ATAAAAAAAAAAGGAAAAATTGGGAATCTATGGGGAGACATCTAAAATATTTGCCTCATCGTCACTAAACCTTGGAAAGCG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAAGATTACTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAGAGAGAATTGGTGAAACTCA-TTT----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGAGGCGG-CTCCCTCCCTTTA-----AAAC---------------------------------------------------------------------------------------------------------------TGAAACGGGAG---AGACAGTCCAAAC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTCGT------------AC----TATTTAGCCTTACTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTTTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----TTAGTCGAGTTAACCCCTTCACCGACGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum connexum (Labiak 4260)' TGCGCCGTTCCCGTTACTCTTGTATTGCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------AT------AAAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--GGGTTAAACAGTAAAAATTGCTTTCAACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTCAATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum fugaceum (Jimenez 1203)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTTGGTATGCTAAAAACTTGGGACA------------ATAAAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AA-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGG-CGAATTA-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum lanatum (Grangaud 6)' TGCGCCGTTCTCGTTACTCTTGTACTTCAAAAATCGTACTTATTAGTGACGAAGCAGGATTAGTTCAGTATGCTAAAAACTTGAGACA------ATAAAAAAAAAAGGAAAAATTGGGAATCTATGGGGAGACATCTAAAATATTTGCCTCATCGTCACTAAACCTTGGAAAGCG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAAGATTACTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAGAGAGAATTGGTGAAACTCA-TTT----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGAGGCGG-CTCCCTCCCTTTA-----AAAC---------------------------------------------------------------------------------------------------------------TGAAACGGGAG---AGACAGTCCAAAC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTCGT------------AC----TATTTAGCCTTACTTGATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTTTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----TTAGTCGAGTTAACCCCTTCACCGACGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum macrotheca (Christenhuzs 4181)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCTGGATTATTTTGGTATGCTAAAAACTTGGGACA-------------ATAAAAAAAAATTTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGGTTAAACAGTAAAAATTGCTTGCGACTCGGTGAGAAATATTTCCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTTTTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTTCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTATCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACACTAAG-----AATCCCGG-AGAC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTAGAGTTCTTGCTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum retrorsum (Labiak 4356)' TGCGCCGTTCCCGTTACTCTTGTATTGCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------AT-----AAAAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--GGGTTAAACAGTAAAAATTGCTTTCAACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTCCTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTCAATTTTCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACGCTAAG-----AATCCCGG-AGCC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum subtile (Moran 7608)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGACTAGTGACGAAGCAGGATTATTTTGGTATGCTAAAAACTTGGGACA--------------ATAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAATCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--CGGTTAAGCAGTAGAAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAGAGAATTGGTGAAACTAATTT-----TCCTTTTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCACGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTCCCTCCCCTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACAAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTATCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACACTAAG-----AATCTCGG-AGAC----CTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGCTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Megalastrum vastum (Cornejo 8163)' TGCGCCGTTCCCGTTACTCTTGTACTTCGAAAGTCGTACTGATTAGTGACGAAGCAGGATTATTTTGGTATGCTAAAAACTTAGGACA--------------ATAAAAAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTC{AC}CTGAACCTTGGAAAGAG----AATCCAAGCTCAAAAGTTGCAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--GGGTTAAACAGTAAAAATTGCTTTCAACTCGGTGAGAAATATTTTCCTAAGGATTCCTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAAAAAAAGAATTGGTGAAACTAATTT-----TCCTTTTTTCTTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATACCATCTACTCAAA-CTGGGGCAG-CTTTCCCCCTTTA--------------------------------------------------------------------------AAA------------------------------------------CTGAAACGGGGG---AGACAGTCC--AC-CCA----TCTTTCAACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTACTTGATTATCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATTTGTTATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGTTGACACTAAG-----AATCTAAG-AATCCCGGCTAGTCGAGTTAACCCCTTCACCGATGGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Mickelia guianensis (Prado 2025)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Mickelia oligarchica (Smith 2236)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Mickelia pergamentacea (Sanchez 124)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Oenotrichia tripinnata (Kessler 14352)' TGCACCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------ATTCC-AAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGATTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGATAATTGATGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCATC--CCCAAAATTGGGGCGG-CTCTCTCCTCCCT-----GAACGAGGGGAAAATAAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGCATA-AAAGTAATTTTG-ATATACG----CTTCCTTCTT-----------TTGAAGCGGGGG---AGGCAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATTTATGCGGACGAATTC-TCTCTTAGTTTTGT------------AC----TATTTAGCCTTCCTTTATCTTCATAAAGGAGCCGAATGGGCAGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCCAAGGTAACCCCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATTTGGAA 'Oenotrichia tripinnata (van der Werff 13809)' TGCACCGCTCCCGTTACTCTTGTACGTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACA------ATTCC-AAAAAAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAC-------TTTTT--TGATTAAACAGTAATAATTGCTTCCGACTCGGTGAGAAATATTCCCCTAAGGATTTTTGAAAGTAAAAATAAAGAACGAAGTAAAA---AAGAAAGATAATTGATGAAACTAATTA-----CCTTTCCTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCGAAACGTAAGCAAGACTGACATAGATTTTACGGATGCCATC--CCCAAAATTGGGGCGG-CTCTCTCCTCCCT-----GAACGAGGGGAAAATAAAAAGAAGTCCTCATATATCTCAATAT---GGGGGAAGCCTCGATACGCATA-AAAGTAATTTTG-ATATACG----CTTCCTTCTT-----------TTGAAGCGGGGG---AGGCAGTCC--AAGCCA----TCTTTCGACT--GCTTCATTTCGAT-------AAATTTATGCGGACGAATTC-TCTCTTAGTTTTGT------------AC----TATTTAGCCTTCCTTTATCTTCATAAAGGAGCCGAATGGGCAGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCATAA-CCATATGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCTAAG-----AATCCCGG-ATCC----CTAGCC?AGGTAACCCCTTCACCCATAGATTGGGTCGTGAACAAACTGGAGTTCTTGTTTGTTCACGAT-TTGGTAACTAA?TTGGAA 'Olfersia cervina (Labiak 5220)' TGCGTCATTCCCGTCACTCTTGTACTTCGAAAGTCGTATCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTAGGACG------ATT-------AAATAATAATTAGAAATCTATGGATAGACATCTAAGATATTTGCCTCATCGTCACTGAATCTTGGGTAGAA----AATCCAAGCTCGAAAGTTGCAGGTAGATCAATCTTGGTTTATCAGGATTATCAAGTCAAGCAC-------GTTAT--TGGTTAAACAATAACAATTGCTTTCGACTCGGTGAGAAATATTTACCTAAGGGTTTTTAGAAGTAGAAATAAAGAACGAAGTAAAT----GAAAAAGAGATTATTGAAACTA----------CTTCTTTTTTCGAAGGATCATCTAAG-AAGTATATCCACG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAAACCATTTATTGGAA-TTGGGGCGG-TTCCCTCCTCTTC-----GAACAGGGAAAAAAGGGGGGGGGG----CATTTATATCAATAT---GGGGGAAGCCTCGATCTCCATA-AGAATAATTTTG-CTATATA----CTCCTTTCAT-----------TTGAAACAGGGG---CTACGATCC--AC-CCA----TCTTTTGATT--GCTCCATTTTACTAAGTATAAAGTATATGCAGACGGATTT-GCCCCCAGTTTTGT------------AC----TATGTAGCCGTCCTTGATTTCCATAAGGGAGCCAAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGGCGTCACAA-CCAGTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGATGATACTAAG-----AATCCCGG-AACC----CTAATCAAGTTAACCCCTTCACCCGCGGATTAGGTCGTGAACAAACTGGAGTTCTCGTTTGTTCACGATATTGGTAACTAATCTATAG Phanerophlebia_nobilis_GB TGCGCCATTCCCGTTACTCTTGTACTTCGGAAGTCGTACCGGTTGATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTGGGACG------ATTCCAAAAAGAGGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGGAGAC----AATCCAAGCTCGGAAGTTGCAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACT------TTTTT--TGGTTAAGCAGTAGCAATTGCTTCCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAGGTAGAAATAAAGAACGAAGTAAT----GAAAAAAAAAATTGGTGAAACTC---------CCTTTTTTTTTCAAAGGATCATCTAGG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGACACCATTTA--CAAA-TCGGGGCGG-CTCCCTCCTCTTC-----GGACGGGAGAGAAA-AGAGAGAAGCCCCCATATATTCCGATAT---AGAGGAAGTCTAAACCCACATA-GAAGTAATTTTG-ACATATG----CTCCCGTCGT-----------TTGAAACAAGGG---AAACAGTCC--AC-CCA----CTTTTCGATT--GTTC-ATATAACT-------AAATATATGCGGACAATTTA-TCCACCGATTTTGTACCAGATTTTTGAC----TATCTAGCCTTTCTCGATTTCCATAAGGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGACGTCATAA-CCATTTAATATCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTAACGCCGAG-----AATCCCGG-AGCT----C--------------------------------------------------------------------------------------- 'Pleocnemia irregularis (Sundue 2245)' TACGCCATTCCCGTTACTCTTGTACTTTGCAAATCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACG------ATTCCAAAAAAAGGAAAAAGTAAGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTCGATTAATCTTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TTTTTTATTGCTAAACAATAGCAATTGCTTCCAACTCGGTGGGAAATATTTCCCTAAGGATTTTTGAACGTAAAAATAAAGAACGAGGTAAAA--------AAAAAATTGGCAAAACTAATTTCCTCTTTTTTTTTCCTTAAAGGATGATCTAAG-AAGTATATTCATG-CTATATGAACAAAACATAAGCAAGACTGACATAGATTTTATGGATGCCTTTTACTAAAA-AGGGGGCGG-CTACCTCCTACTT-----GAACGATAGAAAAAGA-----AGATTTTCATAGATTTCAACCT---GGGGAAAGGCTCGATACGCGTA-AAAGTAATTTTT-GTATATG----CCCCCTCGCC-----------CTAAAGCGGAGG---AAACAGTCC--AC-GCA----TCTTTTGACT--GTTTCATTTTAATAAATATAAAATATATGCAAACGAATTT-TCTCTCAATTTTGT------------AC----TATTTAGCCTTCTTCTCCTTTCATGAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGTATTAGCGACGTCATAA-TCATTTG-TGTCGTCGACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleocnemia olivacea (WADE1991)' TACGCCATTCCCGTTACTCTTGTACTTTGCAAATCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACG------ATTCCAAAAAAAGGAAAAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AATCCAAGCTCGAAAGTTACAGGTCGATTAATCTTGGTTTATCAGGATTGTCAAGTCAAGCAC-------TTGTT--TTGTTAAACAATAGCAATTGCTTCCAACTCGGTGGGAAATATTTTCCTAAGGATTTTTGAACGTAAAAATAAAGAACGAGGTAAAA--------AAAAAATTGGCAAAACTAATTTCCTC-TTTTTTTTCCTTAAAGGATGATCTAAG-AAGTATATTCATG-CTATATGAACAAAACATAAGCAAGACTGACATAGATTTTATGGATGCCTTTTACTAAAA-AGGGGGCGG-CTACCTCCTACTT-----GAACGATAGAAAAAGA-----AGATTTTCATAGATTTCAACCT---GGGGAAAGACTCGATACGCGTA-AAATTAATTTTT-GTATATG----CTCCCTCTCC-----------CTAAAGCGGAGG---AAACAGTCC--AC-GCA----TCTTTTGACT--GTTTCATTTTAATAAATATAAAATATATGCAAACGAATTT-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCTTCTCCTTTCATGAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGTATTAGCGACGTCATAA-TCATTTG?TGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAATGATACTAAGCTAAAAGTCCAGGAGGCC----CTGGTCGAGTTAACCCCTTCACCCATAAATTGGGTCGTGAACAAACTAAAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTAGAT 'Pleocnemia presliana (Kuo 1955)' TACGCCATTCCCGTTACTCTTGTACTTTGCAAATCGTACTGATTAGTGACGAAGCAGGATTAGTTCGGTATGCTAAAAACTTGGGACG------ATTCCAAAAAAAGGAAAAAGTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAG----AAGCCAAGCTCGAAAGTTACAGGTCGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCAC-------TTTTTTATTGTTAAACAATAGCAATTGCTTTCAACTCGGTGGGAAATATTTTCCTAAGGATTTTTGAACGTAAAAATAAAGAACGAGGTAA-----AAAAAAAAAAATTGGCAAAACTAATTTCCTC-TTTTTTTTCCTTAAAGGATGATCTAAG-AAGTATATTCATG-CTATATGAACAAAACATAAGCAAGACTGACATAGATTTTATGGATGCCTTCTACTAAAA-AGGGGGCGG-CTACCTCCTACTT-----GAACG-----ATAGAAGAAGAAGATTTTCATAGATTTCAACCT---GGGGAAAGACTCGATACGCGTA-AAAGTAATTTTT-GTATATG----CTCCCTCTCT-----------CTAAAGCGGAGG---AAACAGTCC--AC-GCA----TCTTTTGACT--GTTTCATTTTAAT-------AAATATATGCAAACGAATTT-TCTCTCAGTTTTGT------------AC----TATTTAGCCTTCTTCTCTTTTCATAAAGGAGCCGAATGGACGGAAACTTCCATGTTCGGTTCTGTATTAGCGACGTCATAA-TCATTGGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAATAATACTAAGCTAAAAGTCTAGGAAGCC----CTGGTCAAGTTAACCCCTTCACCCATAAATTGGGTCGTGAACAAACTGAAGTTCTTGTTTGTTCACGAT-TTGGTAACTAATCTAGAC 'Polybotrya alfredii (Moran 7612)' TGCGCCATTCCCGTCACTCTTGTACGTCGAAAGTCGTACCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTAGGACG------ATTAAAAAAGAAGGAAAAATTAGAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTTACTGAACCTTGGGTAGAA----AATCCAAGCTCGGAAGTTGCAAGTAGATTAATCTTGGTTTATCAGGATTCTCAAGTCAAGCAC-------GTTAT--TGGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTACCTAAGGATTTTTGGAAGTAGAAATGAAGAACGAAGTAAAT----GAAAAAGAAATTGTTGAAACTAGTTCC----------TTTTTCGAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAAGCCATTT-TTGAAA-TTGGGGCGG-TTCTCTCCTCTTC-----GAACGGGAAAAAGGGGGGGGG------CCATCTAATCCAATAT---GGGGAAAGCCTCGACCCCCATA-AAAGTAATTTTG-CTATATG----CTCCTTTCGT-----------TTGAAACAGGGG---ACCCGATCC--AC-CCA----TCTTTTGATTATGCTCCATTTAACT-------AAGTATATGCAGACAAATTC-TCCCCCAGTTTTGT------------AC----TATGTAGCCTTCCTTAATTTCCATAAGGGAGCCAAATGGGCGGAAACTCCCATGTTTGGTTCTGAATTAGCGGCGTCACAA-CCATTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGATGATACTAAT-----AATTTTGT-AGCC----CTAATCGAGTTAACCCCTTCACCCACGGATTGGGTCGTGAACAAACTGAAGTTCTCGTTTGTTCACGAT-TTGGTAACTAATCTATAA 'Polybotrya andina (Moran 6729)' TGCGCCATTCCCGTCACTCTTGTACGTCGAAAGTCGTACCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAGACTTAGGACG------ATTAAAAAAGAAGGAAAAATTATAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTTACTGAACCTTGGGTAGAA----AATCCAAGCTCGACAGTTGCAAGTAGATTAATCTTGGTTTATCAGGATTCTCAAGTCAAGCAC-------GTTAT--TGGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTACCTAAGGATTTTTGGAAGTAAAAATGAAGAACGAAGTAAAT----GAAAAAGAAATTGTTGAAACTAG----------TTCCTTTTTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAAGCCACTT-TTGAAA-TTGGGGCGG-TTCTCTCCTCTTC-----GAACGGGAAAAAGGGGGGGG-------CCATCTAATCCAATAT---GGGGAAAGCCTCGACCCCCATA-AAAGTAATTTTG-CTATATG----CTCCTTTCGT-----------TTGAAAAAGGGG---ACCCGATCC--AC-CCA----TCTTTTGATTGTGCTCCATTTAACT-------AAGTATATGCAGACAAATTC-TCCCCCAGTTTTGT------------AC----TATGTAGCCTTCCTTAATTTCCATAAGGGAGCCAAATGGGCGGAAACTCCCATGTTTGGTTCTGAATTAGCGGCGTCACAA-CCATTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTAATGATAATAAT-----AATTTTGT-AGCC----CTAATCAAGTTAACCCCTTCATCCACGGATTGGGTCGTGAACAAACTGAAGTTCTCGTTTGTTCACGAT-TTGGTAACTAATCTATAA 'Polybotrya pubens (Moran 6063)' TGCGCCATTCCCGTCACTCTTGTACGTCAAAAGTCGTACCGGTTAATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTAGGACG------ATT-AAAAAAGAGTAAAAATTAGAAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTTACTGAACCTTGGGTAGAA----AATCCAAGCTCGAAAGTTGCAAGTAGATTAATCTTGGTTTATCAGGATTCTCAAGTCAAGCAC-------GTTAT--TGGCTAAACAATAACAATTGCTCTCGACTCGGTGAGAAATATTTACCTAAGGATTTTTGGAAGTAGAAATGAAGAACGAAGTAAAT----GAAAAAGAAATTGTTGAAACTAGTTCC----------TTTTTCGAAGGATCATCTAAG-AAGTATATCC{AC}TG-CTATACGACCAAAACGTAAGCAAGACTGACATAGATTTTATGGAATCCGTTT-TTGAAA-TTGGGGCGG-TTCTCTCCTCTTC-----GAACGGGAAAAAGGGGGGGGGGGG---CCATCTAATCCAATAA---GGGAAAAGCCTCGACCCCCATA-AAAGTAATTTTG-CTATATG----CTCCTTTCGT-----------TTGAAACAGGGG---ATCCGATCC--AC-CCA----TCTTTTGATTGCGCTCCATTTCACT-------AAGTATATGCAGACAAATTC-TCCCCCAGTTTTGT------------AC----TATGTAGCCTCCCTTAATTTCCATAAGGGAGCCAAATGGGCGGAAACTCCCATGTTTGGTTCTGAATTAGCGGCGTCACAA-CCATTTGTTGCCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGATGATACTAAG-----AATCCCGG-AGCC----CTAATCAAGTTAACCCCTTTACCCACGGATTGGGTCGTGAACAAACTGGAGTTCTCGTTTGTTCACGAT-TTGGTAACTAATCTATAA Polystichum_andersonii_GB TGCGCCATTCCCGTTACTCTCGTACTTCGGAAGTCGTACTGGTTGATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTGGGACG------ATTCCAGAAAGAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAGATAA----AATCCAAGCTCGGAAGTTACAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACT------TTTTT--TGGTTAAGCAGTAGCAGCTGCTTTCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAGGTAGAAATAAAGAACGAAGTAAAT---AGAAATGAAAATTGGTGAAACTAAT-------TTTTATTTTTTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGGCCAAGACGTAAGCAAGACTGACATAGATTTTATGGACGCCATTTACTAAAA-TTGGGGCGG-CTCTCTCCTGTTC-----GGACGGGGGAAAAA-AGAGAGAAGCCCCCGTATATTCCGATAT---AGAGGAAGTCTAAATCCCCGTA-GAAGTAATTTTG-ACATACG----CTCCCTTCGT-----------TTGAAACAAGGG---AGACAGTCC--AC-CCA----TTTTTTTATT--GTCCCATTTAACT-------AAATATATGCGGACAAAATC-TCCACCGATTTTGTACCAGATTTTATAC----TACCTAGCTTCCCTCGATTTCCATAAGGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Polystichum_munitum_GB TGCGCCATTCCCGTTACTCTCGTACTTCGGAAGTCGTACTGGTTGATGACGAAGCAGGATTATTTTGGTATGCAAAAAACTTGGGACG------ATTCCAGAAAGAGGAAAAATTAGGAATCTATGGGTAGACATCTAAAATATTCGCCTCATCGTCACTGAACCTTGGAGATA-----AATCCAAGCTCGGAAGTTACAGGTAGATTAATCTTGGTTTATCAGGATTATCAAGTCAAGCACT------TTTTT--TGGTTAAGTAGTAGCAGCTGCTTTCGACTCGGTGAGAAATATTTTCCTAAGGATTGTTGGAGGTAGAAATAAAGAACGAAGTAAAT---AGAAATAAAAGTTGGTGAAACTAAT-------TTTTATTTTTTCAAAGGATCATCTAAG-AAGTATATCCATG-CTATACGGCCAAGACGTAAGCAAGACTGACATAGATTTTATGGACGCCATCTACTAAAA-TTGGGGCGG-CTCCCTCCTGTTC-----GGACGGGAGAGAAG-AGAGAGAAGCCCCCGTATATTCCGATAT---AGAGGAAGTCTAAATCCCCGTG-GAAGTAATTTTG-ACATACG----CCCCCTTCGT-----------TTGAAACAAGGG---AGGCAGTCC--AC-CCA----TTTTTTGATT--GTCCCGTTTAACT-------AAATATATGCGGACAAAATC-TCCACCGATTTCGTACCAGATTTTCTAC----TACCTAGCTTCCCCCGATTTCCATAAGGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGAATTAGCGAGATTATAA-CCATTTATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Rumohra adiantiformis (Jansen & Rouhan 2550)' TGTACCGCTCCCGTTACCCTTGTACTTTGAAAGTCGTACTAATTAGTGACGAAGCAGGATGAGTTCGGTATGCTAAAAACTTGGTACA------ATT----AAAAAAGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAT----AATCTGAGCTCAAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAA-------TTTTTTTTGGTTAAACGATAACAATTGTTTCCGACTCGGTGAGAAATATTTTCCTACGGATTCCTTAAAGTAGAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTC-----TCTCCTTTTTCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACTCAAA-TTGGGGCGG-ATCGCTACTCCTT-----GAACGAGGGAAATCGAGAAAAAAGTACCCATATATTTCAATAT---GAAGGAAGCCTCGATAGCCATA-AAAATAATTTTG-ATATACG----CCTCTTCCCTTTGAATGAAACTTGAAACGGGGG---AGATCGTCC--AC-CCA----CCTTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAATTTTGT------------AG----TACTTAGCCTTCCT----TTCCATAAAGGAGCCGAATGGGAGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCCGGTGACGTTAAG-----AATCCCCT-AGCC----CTAGCCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCCTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Rumohra adiantiformis (Kessler sn)' AGTGCCGCTCCCGTTACCCCTGTACTTTGAAAATCGTACTGATTAGTGACGAAGCAGGATGAGTTCGGTATGCTAAAAACTTGGTACA------ATT----AAAAAAGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAT----AATCTAAGCTCAAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTACCAAGTCAAGCAT-------TTTTT--TGGTTAAACAGTAACAATTGTTTCCGACTCGGTGAGAAATATTTACCTAAGGATTCCTGAAAGTAGAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTTAATTCTCTCCTTTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACTCAAA-TTGGGGCGG-ATCCCTACTCCTT-----GAACGAGGGAAATCGAGAAAGAAGTACCCATATATTTCAATAT---GAAGGAAGCCTCGATAGCCATA-AAAATAATTTTG-ATATACG----CCCCCTCCCTTTGAATGAAACTTGAAACGGGGG---AGATCGTCC--AC-CTA----CCTTTTGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTATCAATTTTGT------------AG----TACTTAGCCTTCCT----TTCCATAAAGGAGCCGAATGGGAGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGA-ACGGGTTCGATTCCCCCTACACGCCGGTGACGTTAA------ACCCCCCT-AGCC----CTAGCCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCCTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Rumohra adiantiformis (Prado & Hirai 2022)' TGTGCCGCTCCCGTTACCCTTGTACTTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATGAGTTCGGTATGCTAAAAACTTGGTACA------ATT----AAAAAAGAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAT----AATCTAAGCTCAAAAGTTACAGGTGGGTTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAT-------TTTTT--TGGTTAAACAGTAACAATTGTTTCCGACTCGGTGAGAAATATTTCCCTAAGGATTCCTGAAAGTAGAAATAAAGAACGAAGTAAAA---AAGAAAGAGGATTGGTGAAACTAATTC-----TCCCCTTTTTCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTAATCAAA-TTGGGGCGG-ATCCCTACTCTTT-----GAACGAGGGAAATCGAGAAAGAAGTACCCATATATTTCAATAT---GAAAGAAGCCCCGATAGCCATA-AAAATAATTTTG-ATATACG----CCCCCTCCCCTTGAATGAAACTTGAAACGGGGA---AGATCGTCC--AC-CCA----CCTTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAATTTTGT------------AG----TACTTAGCCTTCCTTG----CCATAAAGGAGCCGAATGGGAGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCCGGTGACGTTAAA-----AATCTCCT-AGCC----CTAGTCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCCTGTTTGTTCACGAT-TTGGTCACTAATCTGGAG 'Rumohra berteroana (Danton 1964)' CGTGCCGCTCCCGTTACCCTTGTACTTTGAAAGTCGTACTGATTAGTGACGAAGCAGGATGAGTTCGGTATGCTAAAAACTTGGTACA------ATT----AAAAAATAAAAATTGGGAATCTATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAGAT----AATCTAAGCTCAAAAGTTACAGGTGGATTAATCTTGGTTTATCAGGATTGCCAAGTCAAGCAT-------TTTTT--TGGTTAAACAGTAACAATTGTTTCCGACTCGGTGAGAAATATTTCCCTAAGGATTCCTGAAAGTAGAAATAAAGAACGAAGTAAAA---AAGAAAGAGAATTGGTGAAACTAATTTAATTCTCTCCTTTTCCTAAAGGATCATCTAAG-AAGTATATTCACG-CTATACGAGCAAAACGTAAGCAAGACTGACATAGATTTTATGGATGCCATCTACTCAAA-TTGGGGCGG-ATCCCTACTCCTT-----GAACGAGGGAAATCGAGAAAGAAGTACCCATATATTTCAATAT---GAAGGAAGCCTCGATAGCCATA-AAAATAATTTTG-ATATACG----CCCCCTCCCTTTGAATGAAACTTGAAACGGGGG---AGATCGTCC--AC-CTA----CCTTTCGACT--GCTCCATTTCAAT-------AAATATATGCGGACGAATTC-TCTCTCAATTTTGT------------AG----TACTTAGCCTTCCT----TTCCATAAAGGAGCCGAATGGGAGGAAACTTCCACGTTCGGTTCTGGATTAGCGACGTTACAA-CCATTTGTTGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCCGGTGACGTTAAA-----AATCCCCT-AGCC----CTAGCCAAGTTAACCCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAGTTCCTGTTTGTTCACGAT-TTGGTAACTAATCTGGAG 'Stigmatopteris ichtiosma (Moran 6752)' TGCGCCATTCCCGTTATTCCGGTACTTCGGAAGTCGTACCGGTTAATGACGAAGCTGGATTATTTTGGTATGCAAAAAACTTTGTACG------ATTCCAAAAAAAATAAAAATTGGGAATCCATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAAAC----AGTCCAAGCTCGAAAGTGACAGGTGGATCTTTCTTGGTTTATCAAGATTATCAAGTCAAGCAC-------TTCTT--TTGCTAAACAGTAACAATTGCTTCCAACTCGGTGAGAAATATTGACCTAAGGATTTTTGGAAGTAGAAATAAAGAACGAAGTAAAT---AAAAAGAAAAATTGGTGAAACTAATTATTTA-TTTTTATTTTTCAAAGGATAATCTAAG-AAGTATACCCACG-CTATATGGCCAAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCGTTTACCCGAA-TTGGGGTAG-CTCCCTACTCTTT-----GAAAGGGAGGAAAAAAG-GGGAAGCTCCCATATATTCCAACAT---GGAGGGAGCCTTGATCCCCATA-AAAATAATTTGGAATATATG----GGAGCTTCGT-----------TTAAAACAGGGG---ATACAGTAC--AC-TTA----TCTTTTGATT--GTTCCATATAACT-------AAATATATGCAGACAAATTC-TCCACCAGTTTTAA------------AT----TACTTAGCATTCCTCCCCTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCACAA-CCA?TTGTCGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATACTAAG-----AATCCCGG-AGCC----CTAGTCAAATTAAACCCTTCACCCATGGATTGGGTCGTGAACAAACTGAAATTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAG 'Stigmatopteris killipiana (Moran 6924)' TGCGCCATTCCCGTTATTCCGGTACTTCGGAAGTCGTACCGGTTAATGACGAAGCTGGATTATTTTGGTATGCAAAAAACTTTGTACG------ATTCAAAAAAAAATAAAAATTGGGAATACATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAAAC----AGTCCAAGCTCGAAAGTGACAGGTGGATCTTTCTTGGTTTATCAAGATTATCAAGTCAAGCAC-------TTCTT--TTGCTAAACAGTAACAATTGCTTCCAACTCGGTGAGAAATATTGACCTAAGGATTTTTGGAAGTAGAAATAAAGAACGAAGTAAAT---AAAAAGAAAAATTGGTGAAACTAATTATTTA-TTTTTATTTTTCAAAGGATAATCTAAG-AAGTATACCCACG-CTATATGGCCAAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATTTACCCGAA-TTGGGGTAG-CTCCCTACTCTTT-----GAAAGGGAGGAAGAAAG-GGGAAGCTCCCATATATTCCAACAT---GGAGGGAGCCTCGATCTCCATA-AAAGTAATTTTGAATATATG----TTCCCTTCGT-----------TTAAAACAGGGG---ATACAGTAC--AC-CCA----TCTTTTGATT--GTTCCATATAACT-------AAATATATGCAGACAAATTC-TCCACCAGTTTTCA------------AT----TACTTAGCATTCCTCCCCTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTCGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATACTAAG-----AATTCCAG-AGCC----CTAGTCAAATTAAACCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAATTCTTGTTTGTTCACGAT-TTGGTA-----TCTGTAG 'Stigmatopteris lechlerii (Moran 6942)' TGCGCCATTCCCGTTATTCCGGTACTTCGGAAGTCGTACCGGTTAATGACGAAGCTGGATTATTTTGGTATGCAAAAAACTTTGTACG------ATTCAAAAAAAAATAAAAATTGGGAATCCATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGGAAAAC----AGTCCAAGCTCAAAAGTGACAGGTGGATCTTTCTTGGTTTATCAAGATTATCAAGTCAAGCAC-------TTCTT--TTGCTAAACAGTAACAATTGCTTCCAACTCGGTGAGAAATATTGACCTAAGGATTTATGGAAGTAGAAATAAAGAACGAAGTAAAT---AAAAAGAAAAATTGGTGAAACTAATTATTTA-TTTTTCTTTTTCAAAGGATAATCTAAG-AAGTATACCCACG-CTATATGGCCAAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATTTACCCGAA-TTGGGGTAG-CTCCCTACTCTTT-----GAAAGGGAGGAAAAAAG-GGGAAGCTCCCATATATTCCAACAT---GGAGGGAGCCTCGATCCCCATA-AAAGTAATTTTGAATATATG----CTCCCTTCGT-----------TTAAAACAGGGG---ATACAGTAC--AC-CCA----TCTTTTGATT--GTTCCATATAACT-------AAATATATGCAGACAAATTC-TCCACCAGTTTTAA------------AT----TACTTAGCATTCCTCCCCTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTCGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATACTAAG-----AATCCCGG-AGCC----CTAGTCAAATTAAACCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAATTCTTGTTTGTTCACGAT-TTGGTAACTAATCTGTAG 'Stigmatopteris sordida (Moran 6946)' TGCGCCATTCCCGTTATTCCGGTACTTCGGAAGTCGTACCGGTTAATGACGAAGCTGGATTATTTTGGTATGCAAAAAACTTTGTACG------ATTCAAAAAAAAATAAAAATTGGGAATCCATGGGTAGACATCTAAAATATTTGCCTCATCGTCACTGAACCTTGGAAAAAC----AGTCCAAGCTCGAAAGTGACAGGTGGATCTTTCTTGGTTTATCAAGATTATCAAGTCAAGCAC-------TTCTT--TTGCTAAACAGTAACAATTGCTTCCAACTCGGTGAGAAATATTGACCTAAGGATTTTTGGAAGTAGAAATAAAGAACGAAGTAAAT---AAAAAGAAAAATTGGTGAAACTAATTATTTA-TTTTTATTTTTCAAAGGATAATCTAAG-AAGTATACCCACG-CTATATGGCCAAAACGTAAGCAAAACTGACATAGATTTTATGGATGCCATTTACCCGAA-TTGGGGTAG-TTCCCTACTCTTT-----GAAAGGGAGGAAGAAAG-GGGAAGCTCCCATATATTCCAACAT---GGAGGGAGCCTCGATCTCCATA-AAAGTAATTTTGAATATATG----TTCCCTTCGT-----------TTAAAACAGGGG---ATACAGTAC--AC-CCA----TCTTTTGATT--GTTCCATATAACT-------AAATATATGCAGACAAATTA-TCCACCAGTTTTCA------------AT----TACTTAGCATTCCTCCCCTTCCATAAAGGAGCCGAATGGGCGGAAACTTCCATGTTCGGTTCTGGATTAGCGACGTCACAA-CCATTTGTCGTCGTCGACTATAAC-CTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTGGTGATACTAAG-----AATCCCGG-AGCC----CTAGTC?AATTAAACCCTTCACCCATGGATTGGGTCGTGAACAAACTGGAATTCTTGTTTGTTCACGAT-TTGGTA-----TCTGTAG 'Teratophyllum wilkesianum (Ranker 1937)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M31545] TITLE 'Lastreopsid trnL-trnF'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=305; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Arachniodes aristata (Lorence 9314)' TTGTTTAGATCCACATAATTTG--------CCAAAATACGGAAACCGTTTCAAACTTCTTCTCCGTCT-GG----TCCCTCGAAAGCAGTTTGCAAGTGAGCCATTCAGGCTT----CTAA----TATGCATGAATGGCTCAATCTAGTCCCCCCA----------GAATTTA-----TCTACTACAAGCGATATTGTATCAAGCATATCGACAGAAGCGAGATCAACGATTTGACTAGGTAAG--AAACTAGAGTTGAAAAATATACTTAACTGATTTCTAGTTAAATTTTATCCAT-AAATGA 'Arachniodes denticulata (Mynssen 549)' TTGTTTGGATCCATATAATTTG--------TCAAGATACGGAAACCGCTTTAAACTTCTTCTCCGTCT-GG----TCTCTCGAAAGCACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCA----------TAATTTA-----TTTACTACAGGCGATATTGTATCAAGCATATCGATGAAAGCGAGATCGACGATTTGACTAGGTAAA--AAACTAGAGTTGAGAAATATACTTAACTGATTTCTAGTTAACTTCTATCCGT-AAATGA Arachniodes_rhomboidea_GB -------------------------------------------------------TTTTTCTCTGTCTGGG----TCTCTCGAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----CTAA----TATGCATGAATGGCTCAATCTAGTCCTCCCA----------CAATTTA-----CCTACTACAAGCGATATTGTATCAAGCATATCGATAAAAGCGAGATCAACGATTTGACTAGGTAAG--AAACTAGAGTTGAGAAATGTACTTAACTGATTTGTAGTTAACTTCTAT----------- Arthropteris_altescandens_GB -------------------TTGCTCATA-AAAGCAATACATAAACC--TTTCAACTCTTTTTGCCCCT-GG----ATTTTCAAAAAGAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TAGGCATGAATGGCTTAGTTGACCCCCCTC-----------TACTATA-----TTTTTTACAAGCGCTATT----------------TTAAAGCGAGATCAACAATTTAACTAGGCAAA--AAACTGGAGTTGAAGCAGATACTTAGCTGATTGATAGTTCAGTTTTATACGT-AAGTGA 'Bolbitis acrostichoides (Fay 1068)' -----------------------TCGGA-AGCAAGATATGTAAGACACCTTAATTTC-TTATTTGTCT-GG----TCCTTTGAAAACAGTTTGCAAGTGAGCCATTCATACTT----CTAA----TATGCATGAATGGCTCGATCTAGCCCCCCCCTTCTATACTTTACTGTA-----TTGCTTATAAGCAATATTGTATCAAACATATGGATAAAAGTGAGATCAGCGGTTTAACTAGGTAAA--AGACTAAAGTTGAGAAATATACTTAATTGATTTCTAGTTAACTTATATCCAT-AAATAA 'Bolbitis auriculata (Fay 110)' CTGTGTGAATCCGCATAATTTAATTGGA-AGCAAAATATGTAAACCACCTTAATT---TTGTTTGTCT-GA----TCTTTCGAAAACACTTTGCAAGTGAGCCATTCATACTT----TTAA----TATGCATGAATGGCTCGATCTAGACCCCCCCTT-TATACTTTACTTCA-----TTTCCTACAAACAATATTGTATTAAACATATGGATAAAAGTGAGATCAGCGGTTTAACTAGGTAAA--AGACTAAAATTGAAAAATATACTTAATTGATTTCTAGTTAACTTATATCCAT-AAATAA 'Bolbitis humblotii (Razafitsalana 115)' CTGTATGAATCCGCATAATTTAGTCGGA-AGCAAAATATGCAAACCACCCTAATT---CTGTTTGTCT-GG----TCTTTCGAAAACAGTTTGCAGGTGAGCCATTCATACTT----TTAA----TATACATGAATGGCTCGACCTAGCCCCCTCTA---------TACTTTA-----TTTGCTACAAGCAATATTGTATTAAACATATGGATAAAAGTTAGATCAGCGGTTTAACTACGTAAA--AGACTAAAGTTGAGAAAAGGAAATAATTGATTTCTAGTTAGCTTCTATCCAT-AAATAA 'Coveniella poecilophlebia (Kessler 14303)' ------GGATCCGCATAATTTGTTCGGA-AACG-AATACATAAACCACTTTCATTTA-TTTTTTGTCT-GTG--GTCTTTCGAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTTCACACTTCGCTTTA-----TTTACCACAAGCGATATTACATTAAACATATTAGTAGAAGCGAGATCAACGGTTTGACTAAGTAAA--AAACTAGAGTTGAAGGATATACTTAACTGATTTCTAA-TAACTTTTATTTGT-AAATGA 'Coveniella poecilophlebia (van der Werff 11478)' -TGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACATAAACCACTTTCATTTA-TTTTTTGTCT-GTG--GTCTTTCGAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTTCACACTTCGCTTTA-----TTTACCACAAGCGATATTACATTAAACATATTAGTAGAAGCGAGATCAACGGTTTGACTAAGTAAA--AAACTAGAGTTGAAGGATATACTTAACTGATTTCTAATTAACTTTTATTTGT-AAATGA Ctenitis_eatonii_GB TTGTTTGGATTCGCATAATTTATTCAGA-AGCAAAATACGAAAACCATTTCAAAATTTTTTT-------GG----TCTTCCGAAAACAGTTAGCAAGTGAGCCATTCAGGCTT----CTAA----TATGCATGAATGGCTCAGTCTGGCCCCCCCCCA--------TACCTTA-----TTTACTACAGGCAATTTTGCATCAAACATATCGATAAAAGCGAGATCAACAATTTAACTAGGTAAA--AAACTGGGGTTGAAAAATATACCTAACTGATTTCTAATTAACTTTTATCTAT-AAATGA 'Cyclodium heterodon var. heterodon (Labiak 3996)' ---------------TAATTTGTTCAGA-ACCAATATATGGAAATCGCTTCAAACT--TTTTTTTTCT-GG----TATTTCAAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCCTCCCA-----TACTTTA-----TGTTCTACAAGCGATATTGTATAATATATATTGATATAAGCGAGATCAACGATTTGACTAGGTAAA--GAGCTAGAGTTGAAAAATACACTTAACTGATTTCTAGGTAATTTTTATCCAC-AAATGA 'Cyclodium rheophilum (Granville 15523)' ------------------------CAGA-ACCCATATATGGAAATCGCTTCAAACTTTTTCTTTTT{CT}T-GG----TATTTCAAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCCA---------TACTTTA-----TGCTCTACAAGCGATATTGTATAATATATATTGATATAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAAAAATACACTTAACTGATTTCTAGGTAATTTTTATCCAC-AAATGA Dryopteris_crispifolia_GB TTGTTTGGATCCACATAACTTGTTCAGA----------------------------------------------------AGAAAATAGTTTGCAAGTGAGCCATTCAGGCTT----CTAA----TACGCATGAATGGCTCAATCTAGTCCTTCCCA---------TAATTTA-----TTTACTGCAAGCGATATTGTATCAGACATATCGATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAAAAATCTACTTAATTGATTTCTAGTTAACTTTTATCCGTAAAATGA Dryopteris_fragrans_GB TTGTTTGGATCCACATAACTTGTTCAGA-----------------------------------------GG----------CGAAATAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAATCCTTCCCA---------TAATTTA-----TTTACTGCAGGCGATGTTGTATTAAACATATCGATGAAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAAAAATCTACTTAACTGATTTC------------------------- 'Dryopteris patula (Sundue 1104)' TTGTTTGGATTCACATAACCTGTTCAGA-AGC--------------------------------------------------AAAATAGTTCGCAAGTGAGCCATTCAGGCCT----TTAA----TATGCATGAATGGCTCAATCTAGTCCTTCCCA---------TAATTTA-----TTTACTGCAAGCAATATTGTAG-----ATATCGATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAAGTAGAGTTGAAAAATCTACTTAACTGATTTCTAGTTAACTTTTATCCGT-AAATGA Dryopteris_patula_GB ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Dryopteris wallichiana (Labiak 4434)' TTGTTTGGATCCACATAACTTGTTCAGA-AGC--------------------------------------------------AAAATAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TACGCATGAATGGCTCAATCTAGTCCTTCCCA---------TAATTTA-----TTTACTGCAAGCGATATTGTATCAAACATATCGATAAAAACGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGCTGAAAAATCTACTTAACTGATTTCCAGTTAACTTTTATCCGT-AAATGA 'Elaphoglossum amygdalifolium (Herrera 2063)' CTATTTGCAT-AACATAATTTGGTCAGTTTAAAAAATACGTAAACCACTTTAA-------TTCTGTTT-GG----TTTTTTGAAAATAGTTTGTAAGTGAGCCATTCATGCAC---ATTAA-----AAGTATGAATGGCTCGATCTAACCCTCCCCCTCTATACTTTCCTCTA-----TTTCC-----------------------TATTTATAAAAGTGAGATTAAC----------GGTAAAGAAGGCTAAAGTTGAAAAATAGGCTTAATTGACTTCTAGTTAACTACTATTCGT-AAATAA 'Elaphoglossum decoratum (NYBG391/77B)' CTGTTTGAATCCGCAGAATTTTGTCGGTTTACAAAATATGTAAACCTA----------AATTCTGTTT-AG----TTTCTTAAAAATAGTTTGTAAGTGAGCCATTCATACCT----TTAA----TGTGCATGAATGGCTCAATCTAGCACCCCCTA---------TACTTT------TTTTATAAAAGCAATATTGTATTAAACGTATTTATAAGAGTCAGATTAGCAAT----------AAA--AAACTAAAGTTGAAAGATTTACTTAATTAATTTCTAGTTAACTTTTATTCGT-AAATAA 'Elaphoglossum hybridum (FR6421)' CTGTTTGAATCCGCAGAATTTTGTCGGTTTACAAAATATGTAAACCACCCTAAAT------TCTGTTTAGT----TTTTTTAAAAATAGTTTGTAAGTGAGCCATTCATACCT----TTAA----TGTGCATGAATGGCTCAATCTAGCACCCCCTA---------TACTTT------CTTTGTAAAAGCAATATTGTATTAAACGTATTTATAAGAGTCAGATTAGCAAT--GAAAAAAAAAA--AGACTAAAGTTGAAAGATTTACTTAATTAATTTCTAGTTAACTTCTATTCGT-AAATAA 'Lastreopsis acuminata (Coveny 10182)' TTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTCACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGTCCCCCCCATTGATACCCCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATCTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis acuminata (Kessler 14227)' TTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTCACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCCCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATCTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis acuta (Labiak 4913)' TTGTTTGGATCCGCATAACTTGTTCAGA-GGCAAAATACGTAAACCACT--------------------GG----TATTTCAAAAATAGTGTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCCTCGATACCTCACTTTA-----TTTACTACAAGCGATA-TGTATTAAACATATCGATAAAAGCAATATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAATTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis amplissima (Labiak sn)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTCGAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCTCCCC----ATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATATTGATAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis amplissima (Prado & Hirai 2021)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTCGAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCTCCCC----ATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATATTGATAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis amplissima (Zardini 15991)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTCGAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCTCCCC----ATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATATTGCTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis barteriana (Carvalho 5780)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis boivinii (RG470)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATGCCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis boivinii (Rouhan 1356)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis boivinii (Rouhan 1369)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis confinis (Liogier 25604)' -----------CGCATAACTTGTTCAGA-GGCAAAATACGTAAACCACT--------------------GG----TATTTCAAAAATAGTGTCCAA{AG}TGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCATTCTGGCCCCCCCCCTCGATACCTCACTTTA-----TTTACTACAAGCGATA-TGTATTAAACATATCGATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAATTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis currori (Doursett-Lemaire 1906)' ----TTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATT---TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAATATGTATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCAACTTT----TTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTATAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis currori (Fay 4804)' TTGTTTGGATCCGCATAACTTATTCAGA-AGCAAAATACGTAAACTACTTTAATT---TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAATATGTATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCAACTTT----TTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTATAGTTGAAAAAGAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis decomposita (Kessler 14191)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa (BP047)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa ssp dilatata (Hernandez 1906)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa ssp divergens (Villaroel 1597)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis effusa ssp divergens (Walker 10612)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis exculta ssp exculta (Moran 3239)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis glabella (Given 11847)' TTGTTTGGATCTGCAGAACTTGCTCAGA-AGCAAAATATGTAACCCACTTTAACTT--TTTTTTGTCT-GT----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATGCCCCACTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAATTTTGATCTGT-AAATGA 'Lastreopsis hispida (Given 11819)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTTGAAAAGAATTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCTCCCCCCCCCCATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATAGTAATAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis hispida (Schneider sn)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATACGTAAACCACTTTAATTTA-TTTTTTGTCT-GGGTTTTCTTTTGAAAAGAATTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCTCCCCCCCCCCATACTTTACTTTA-----TTTACTACAAGCGATGTTGTATTAAACATAGTAATAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCCAGTTAATTTTTATCTGT-AAATGA 'Lastreopsis killipii (Altamirano 952)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis marginans (Kessler 14192)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis marginans (Kessler 14354)' -------------------------------------ACATAAACCACTTTCATTTA-TTTTTTGTCT-GTG--GTCTTTCGAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGACCCCCCCCGTTCACACTTCGCTTTA-----TTTACCACAAGCGGTATTACATTAAACATATTGGTAGAAGCGAGATCAACGGTTTGACTAAGTAAA--AAACTAGAGTTGAAGGATATACTTAACTGATTTCTAA-TAACTTTTATTCGT-AAATGA 'Lastreopsis microsora (Coveny 9944)' TTGTTTGGATCTGCATAACTTGTTCAGA-AGCAAAATATGTAACCCATTTTCACTT--TTTTTTTGCT-GG----TATTTCGAGAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGTCCCCCCCCATTGATACCCCACTTT------------------------------------TCAATAAAAACAAGATCAACGGTTTGATTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis microsora (Gardner 5018)' TTGTTTGGATCTGCATAACTTGTTCAGA-AGCAAAATATGTAACCCATTTTCACTT--TTTTTTTGCT-GG----TATTTCGAGAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGTCCCCCCCCATTGATACCCCACTTT------------------------------------TCAATAAAAACAAGATCAACGGTTTGATTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis microsora (Kessler 14350)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis microsora (Kessler 14355)' TTGTTTGGATCCGCATAACTTGTTC?GA-GGCAAAATACGTAAACCA-------------------CT-GG----TATTTCAAAAATAGTGTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCCTCGATACCTCACTTTA-----TTTACTACAAGCGATA-TGTATTAAACATATCGATAAAAGCAATATCAACGGTTTGACTAGGTAAA--AAACTAGAGTT?AAAAATAAGCTTAATTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis munita (Clarke & Pickard 1814)' TTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis munita (Coveny 1303)' TTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis munita (Coveny 1906)' TTGTTTGGATTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis nigritiana (Thomas 8919)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis perrieriana (Rouhan 1318)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis perrieriana (Rouhan 1321)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis pseudoperrieriana (Rouhan 1319)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis pseudoperrieriana (Rouhan 1323)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis pseudoperrieriana (Rouhan 1325)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis pseudoperrieriana (Rouhan 1364)' TTGTTTGGATCCGCATAACTTGTTCAGA-AGCAAAATACGTAAACCACTTTAATTT--TTTTTCGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGCCCCCCCCCCTCGATACCTCACTTTACTTTTTTGACTAAAAGCGATATTGTAGTAAACGTATCAATAAAAGCAAGATCAACGGTTTGACTAG------------------------------------------------------TCTGT-AAATGA 'Lastreopsis rufescens (Kessler 14341)' --------------ATAACTTGCTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AACATAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis rufescens (Kessler 14343)' TTGTTTGGGTTTGCATAACTTGTTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis rufescens (Kessler 14347)' ---------------------------A-AGCA-AAAATGTAAGCCACTTTAA-CTC-TTTTTTGTCT-GT----TATTC--GAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACAAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis silvestris (Kessler 14222)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis smithiana (Coveny 9951)' TTGTTTGGATCTGCAGAACTTGTTCAGA-AGCAAAATATGTAACCCACTTTAACTT--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATGCCCCACTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAATTTTGATCTGT-AAATGA 'Lastreopsis smithiana (Kessler 14226)' --------------------------GA-AGCAAAATATGTAACCCAATTTAACTT--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATGCCCCACTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAATTTTGATCTGT-AAATGA 'Lastreopsis sp nov (Kessler 14345)' TTGTTTGGATCTGCAT?ACTTGCTCGGA-AGCAAAA{AT}ACATAAACTACTTTCATTTC-TTTTTTGTCT-GG----TCTTTCAAAAGCACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGCCC?TACCTCGCTTTA-----TTTACCACAAGCGATATTGCATTAGATATATTGGTAAACGCGAGATCAACGGTTTGATTAGGTAAA--AAACTAGAGTTGAATGA-------AACTGATTTCTAGTTAACTTTTATCTGT-AAATGA 'Lastreopsis subsericea (van der Werff 16118)' TTGTTTGGATCCGCATAACTTGTTCGGA-AGCGAAATACATAAACTACTTTCATTTC-TTTTTTGTCT-GA----TCTTTCAAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGCTCATACTTCGCTTTA-----TTTACCACAAGCGATATTGCATTAGACATATTGGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAATGA-------AACTGATTTCTAGTTAACTTTTATCTGT-AAATGA 'Lastreopsis subsimilis (Fay 4802)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis tenera (Kessler 14344)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis tenera (coll unkn)' -------------------TTGTTCGGA-AGCGAAATACATAAACCACTTTCATTTA-TTTTTTGTCT-GTGG--TCTTTCGAAAACACTTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGACCCCCCCCGTTCACACTTCGCTTTA-----TTTACCACAAGCGGTATTACATTAAACATATTGGTAGAAGCGAGATCAACGGTTTGACTAAGTAAA--ATACTAGAGTTGAAGGATATACTTAACTGATTTCTAATTAACTTTTATTTGT-A----- 'Lastreopsis tinarooensis (Kessler 14340)' TTGTTTGGATTTGCATAACTTGCTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis tinarooensis (Van der Werff 17036)' TTGTTTGGATTTGCATAACTTGCTCAGA-AGCAAAAAATGTAATCCACTTTAACTC--TTTTTTGTCT-GG----TATTTCGAAAATAGTTTCCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCATTGATACCTCATTTT------------------------------------TCAATAAAAGCAAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATAAGCTTAACTGATTTCTAGTTAACTTTGATCTGT-AAATGA 'Lastreopsis vogelii (Visa 2498)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis vogelii (Visa 3706)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis walleri (Kessler 14339)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis windsorensis (Kessler 14353)' -----------------------------AGCAAAA-ATGTAACCC{AC}TTTTCACTT--TTTTTTTGCT-GG----T?TTTCGAGAATAGTTTCCAAGTGAGCCATTCAGGCTT----TT{AT}A----TATGCATGA{AG}TGGCTCAATCTGTCCCCCCCCATTGATACCCCACTTT------------------------------------TCAATAAAAACAAGATCAACGGTTTGATTAGGTAAA--AAACAATAGTTGAAAAATAAGCTTAACTGATTTCTAGT--------------------- 'Lastreopsis wurunuran (Kessler 14342)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lastreopsis wurunuran (Kessler 14348)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Lomagramma matthewii (Wuzhisan 448)' CTGTTTGAATTCGTATAATTTGGTCGAA-AGCAAAAGATGTAAACCACCTAAT-----CTTTTTGTCT-CA----TTTTTTAAAAATAGTTTGCGAGTGAGCCATTCATACTT----TTTA----TATGCATGAATGGCTCGATCTAGCCCCCTCTA---------GACTTTA-----TTTCTTACATACAAGATTGTTTTAAACATATTGATAAAAGCGAGATCAGTACTTTAACTTAGTAAA--ACACTAAAATTGAAAGATATATTTGATTGATTTCGCTTGAAATCTTATTCGT-AAATAA Lomariopsis_marginata_GB TTGTGTGGATTTACACAATTTATTCAGA-AGCAAAATACATAAACTACTTTAAATAT-TTATGTCTTC-GG----TCTGCCAAAAATAGTTTGCAATTGAGCCATTCAAGCTT----CTAA----TATGCATGAATGGCTCGATTGAGTTTTCTCCCCA-------AGCTTTA-----CCTGCTACAAGCAATATTCTGTTGAACACATCGAGAAGAATGAGATAATCAATTTGGCTAGGCAAA----ACTAGCCTTGAGAAGTCTACTTAAATTATTTCTATTTGAGTCTTATCTGT-AAACAA 'Maxonia apiifolia (Moran 3541)' TTGTTTGGATCCACATAATTTGTTCAGA-AACAATATATGGAAATCGCTTCAACCTC-CTTTTTGTCT-GG----TCTTTCAAAAACAGTTTGCAAGTGAGCCATTCAGGCTT----CTAA----TATGCATGACTGGCTCAATCTGGCCCCCCCCA---------TACTCTA-----TTTTCTACAAGCGATATTGTTTTACATATATTGATAAAAGCGAGATCAACGATTTGGTTAGGTAAA--TAGCTAGAGTTGAAAAATAGACTTAACTCATTTCTAGGTAATTCTTATCCAC-AAATGA 'Megalastrum abundans (Schwartsburd 1631)' TTGTTTGGATCCGCATAATTTATTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTTTTTGTCT-GG----TATTTCAAAAACAGTTCGAAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGTCCATACTTTGCTTTA-----TTTAATACAAGCAATATTGTATTAGACATATCTGTAAAAGCGAGATCAATGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATACTTAACTGATTTATAATTAACTTTTATCTGT-AAACGA 'Megalastrum atrogriseum (Sundue 1779)' TTGTTTGAATCCGCATAATTTGTTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTCTTTGTCT-GG----TCTTTCAAAAACAGTTCGAAAATGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCTCCCGTCCATACTTTACTTTA-----TTTAATACAAGTAATATTGTATTAGACATATCTGTAAAAACGAGATGAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATAGAACTGATTTATAATGAACTTTTATCTGT-AAATGA 'Megalastrum canacae (Grangaud 3)' TTGTTTGGATCTGCATAATTTGTTCGGA-GGCGAAATATGTAAACCGCTTTAATTTC-TTTTTTGTCT-GG----TCTTTCAAAAACAGTTCGCAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTCCA-----TGCTTTA------CTAATACAAGCAATATTGTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCTAATTAACTTTTATCTGT-AAATGA 'Megalastrum connexum (Labiak 4260)' TTGTTTGGATCCGCATAATTTATTCGGA-AGCGAAATATGTAAACCCCTTTAATTTC-TTTTTTGTCT-GG----TATTTCAAAAACAGTTCGAAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGCCCATATTTTGCTTTA-----TTTAATACAAGCAATATTGTATTCGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGATAAA--AAACTAGAGTTAAAAAATAGACTTAACTGATTTATAATTAACTTTTATCTGT-AAATGA 'Megalastrum fugaceum (Jimenez 1203)' TTGTTTGGATCCGCATAATTTGTTCGGA-AACGAAATATGTAAACCACTTTAATTTC-TTTTTTGTCT-GG----TCTTTCAAAAACAGTTCGAAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTCCATACTTTACTTTA-----TTTAATACAAGTAATATTGTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATATAACTGATT-------AACTTTTATCTGT-AAATGA 'Megalastrum lanatum (Grangaud 6)' TTGTTTGGATCTGCATAATTTGTTCGGA-GGCGAAATATGTAAACCGCTTTAATTTC-TTTTTTGTCT-GG----TCTTTCAAAAACAGTTCGCAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCCCCCGTCCA-----TGCTTTA------CTAATACAAGCAATATTGTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTGAAAAATATACTTAACTGATTTCTAATTAACTTTTATCTGT-AAATGA 'Megalastrum macrotheca (Christenhuzs 4181)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTCTTTGTCT-GG----TCTTTCAAAAACAGTTCGAAAATGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCTCCCGTCCATATTTTACTTTA-----TCTAATACAAGTAATATTGTATTAGACATATCTGCAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATAGAACTGATTTATAATGAACTTTTATCTGT-AAATGA 'Megalastrum retrorsum (Labiak 4356)' TTGTTTGGATCCGCATAATTTATTCGGA-AGCGAAATATGTAAACCCCTTTAATTTC-TTTTTTGTCT-GG----TATTTCAAAAACAGTTCGAAAGTGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGCCCATATTTTGCTTTA-----TTTAATACAAGCAATATTGTATTCGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGATAAA--AAACTAGAGTTAAAAAATAGACTTAACTGATTTATAATTAACTTTTATCTGT-AAATGA 'Megalastrum subtile (Moran 7608)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTCTTTGTCT-GG----TCTTTCAGAAACAGTTCGAAAATGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCTCCCGTCCATACTTTACTTTA-----TTTAATACAGGTAATATTGCATCAGACATATCTGTAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATAGAACTGATTTATAATGAACTTTTATCTGT-AAATGA 'Megalastrum vastum (Cornejo 8163)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGCGAAATATGTAAACCACTTTAATTTC-TTCTTTGTCT-GG----TCTTTCAAAAACAGTTCGAAAATGAGCCATTCAGGCGT----TTAA----TATGCATGAATGGCTCAATCTGGCCCCTCCCGTCCATACTTTACTTTA-----TCTAATACAGGTAATATTGCATTAGACATATCTGTAAAAACGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAGTTAAAAAATATATAGAACTGATTTATAATGAACTTTTATCTGT-AAATGA 'Mickelia guianensis (Prado 2025)' TTATTTGAATCTGCATAATCTGGTCGGG-AGCAAAATATGTAAACTATCTTAATTAT-TCTTTTGTCT-GG----CCTTTTG-------TTTGTAAGTGAGCCATTCATACCTCTAATTAA----TGTGCATGAATGGCTCGATCTAGCCCCTCCCCTCTATATTTTACTCTG-----CTTTATACAAGCAATATTGTATTAAACATATTGATAAAAGCTAGATCAGC-------TTTAGTAAG--AGACTAAAGCTGAGAAATATATGTAATTGATTTCTAGTTAACTTTTATTCGT-AAATAA 'Mickelia oligarchica (Smith 2236)' TTGTTTGAATCCGCATAATTTGTTCGGA-AGCAAAATATGTAAACTACCTTAATTAT-TTTTTTGTCT-GG----TCTTTTGAAAATACTTTGTAAGTGAGCCATTCATATCT----TTAG----TGTGCATGAATGGCTCGATCTAGACCCCTCTA---------TACTTTA-----TTTTCTACAAGCAGTATTGTATTATAAATATTGATAAAAGCGAGATCAGC----------GGTAAA--GTACTAAAGCTGAAAAATATACGTAATCAATTTTGAGGTAACTCTTATATGT-AAATAA 'Mickelia pergamentacea (Sanchez 124)' TTGTTTAAATCCGTATAATTTGGTCGGA-AGCAAAATATGTAAACTACCTCAACTAT-TTTCTTGTCC-GG----TCTTTTG-------TTTGTAAGTTAGCCATTCATACCT----CTAA----TGTGCATGAATGGCTCGATCTGGCCTACCCTTTTTATACTTTAATCTA-----TTTTCTACAAGCAGTATTGTATCGAAAATATCGATAAAAGCGAGATCGGCGGT--------GAGAA--GTACCAAAGCTGAGAAATATACGTAATTGATTTCTAGTTAACTTTTATCCGT-AAATAA 'Oenotrichia tripinnata (Kessler 14352)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Oenotrichia tripinnata (van der Werff 13809)' -----------------------------------------------------------------------------------AAGCACTTCGCAAGAGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTTGCCCCCCCCGCCCATACCTCGCTTTA-----TTTACC{AC}CAAGCGATATTGCCTTAGACATATTGGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAACTAGAATTGAATGA-------AACTGATTTCTAGTTAACTTCTATCTGT-AAATGA 'Olfersia cervina (Labiak 5220)' TTGTTTGGATCCACATAATTTGTTAAGA-AACAATACATGGAAATTGCTTCAAACT--TTTTTTGTCT-GG----TCTTTCAAAAACAGTTTGCAAATGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCCCCTA----CATACTTCA-----TTTTCTACAAGCGATATTGTATTATACATATTGATAATAGTGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAAAA------------------------------------------- Phanerophlebia_nobilis_GB -------------------CTC------------------------------------TTCTCCGTGT-GG----TCTTTTGAAAACGATTTGCAAGTGAGCCATTCAGGTTT----TTAA----TATGCATGAATGGCTCAACCTAGTCCCCCCCA---------TAATTTA-----TCGACTACAGGCGATATTGTATTAAACATATCGATAGAAGCGAGATCAACGATTTGACTAGGTGAA--AAATTGGAGTTGAAAAATATACTTAACTGATTTCTAGTTAACTTCTAT----------- 'Pleocnemia irregularis (Sundue 2245)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleocnemia olivacea (WADE1991)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleocnemia presliana (Kuo 1955)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Polybotrya alfredii (Moran 7612)' TTGTTTGGATCCACATAATTTGTTCAGA-AACAATATATGGAAATCGCTTCAAA{AC}TTATTTTTTGTCT-GG----TTTTTCAAAAACAGTTTGCAAGTGAGCCATTCAGACTT----TTAA----TATGCATGAATGGCTCAATCTAGCCCCCCCCCTCCA-----TACTTTA-----TTTTCTACAAACGATATTGTATTATATATATTGATAAAAACGAGATCAACGATTTTACTGGGTAAA--GAGCTAGAGTTAAAAAATATACTTAATTGATTTCTAGGTAATTTGTATCCAC-AAATGA 'Polybotrya andina (Moran 6729)' TTGTTTGG{AG}TCC{AC}CATAATTTGTTCAGA-AACAATATATGGAAATCGCTTCAAACT--TTTTTTGTCT-GG----T{CT}TTTCAAAAACAGTTTGCAAGTGAGCCCTTCAGACTT----TTAA----TATGAATGAATGG{CG}TCAATCTAGCCCCCTCCA---------TACTTTA-----TTTTCTACAAACGATATTGTATTATATATATTGATAAAAACGAGATCAACGATTTTACTAGGTAAA--GAGCTAGAGTTAAAAAATATACTTAATTGATTTCTAGGTAATTTGTATCCAC-AAATGA 'Polybotrya pubens (Moran 6063)' --------------------------------------------------------------------------------CACAAACAGTTTGCAAGTGAGCCATTCAGGCTT----TTAATATGCATGAATGAATGGCTCAATCTAGCCCCCTCCA---------TACTTTA-----TTTTCTACAAATGATATTGTATTATATAT{AT}TTGATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAAAAAAAGCT------------------------------------------------ Polystichum_andersonii_GB -------------------CTC------------------------------------TTTTCCGTGT-GG----TCTTTTGAAAACGATTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCAGCCTAGTCCCCCCA----------TAAGTTA-----TTGACTACAAGCGATATTGTATTAAACATATCAATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAGAAATATACTTAACTGATTTTT------------------------ Polystichum_munitum_GB -------------------TTC------------------------------------TTCTCCGTGT-GG----TCATTTGAAAACGATTTGCAAGTGAGCCATTCAGGCTT----TTAA----TATGCATGAATGGCTCATCCTAGTCCCCCCA----------TAACTTA-----TTGACTACAAGCGATATTGTATTAAACATATCAATAAAAGCGAGATCAACGATTTGACTAGGTAAA--AAACTAGAGTTGAGAAATATACTTAACTGATTTCT------------------------ 'Rumohra adiantiformis (Jansen & Rouhan 2550)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGTGAAATACGTAAACCACTTGAATTCC-TTTTTTGTCT-GG----TCTTTCAGAAAGAGTTTGCAAGTGAGCCATTCAGGACT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGTCCATACTTTACTTTA-----TTTACTACAAGCGATACTTTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAAGTAAA--AAATTACAGTTGAAAAATATACTTAACTGATTTCTAGTTAACCCTTATCTGT-ATCTGT 'Rumohra adiantiformis (Kessler sn)' ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Rumohra adiantiformis (Prado & Hirai 2022)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGTGAAATACGTAAACCACTTTAATTCC-TTTTTTGTCT-GG----TCTTTCATAAAGAGTTTGCAAGTGAGCCATTCAGGCCT----TTAA----TGTGCATGAATGGCTCAATCTGGACTCCCCCGTCCATACTTTACTTTA-----TTTACTACAAGCGGTACTCTATTAGATATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAATTACAGTTGAAAAATATACTTAACTGATTTCTAGTTAACCCTTATCTGT-ATCTGT 'Rumohra berteroana (Danton 1964)' TTGTTTGGATCCGCATAATTTGTTCGGA-AGTGAAATACGTAAACCAC---AATTCC-TTTTTTGTCT-GG----TCTTTCATAAAGAGTTTGCAAGTGAGCCATTCAGGCCT----TTAA----TATGCATGAATGGCTCAATCTGGCCTCCCCCGTCCATACTTTACTTTA-----TTTACTACAAGCGATACTTTATTAGACATATCTGTAAAAGCGAGATCAACGGTTTGACTAGGTAAA--AAATTACAGTTGAAAAATATACTTAACTGATTTCTAGTTAACCCTTATCTGT-AAATGA 'Stigmatopteris ichtiosma (Moran 6752)' TTGTTCGGATCCACATAATTTGTTCAGA-AGCAAAAGTCGGAAACCACTTTTAAACT-TTTCTTATCT-GT----TCTTCGGTAAACGGTTTGCAAGTGAGCCATTCAAGCTT----TTAA----TATGCATAAATGGCTCATTCTAGCCCCCTCCA---------TACTTTA-----TTTACTGTAAGCAATACCGTGCTAAACATATTGATAAAAGCGAGATTAACGGTTTGACTAGGTAAA--AAACTAAAGTTGAAAAATAGACTTAACTGATTTCTAGTTAACTTTTATCCGT-AAATGA 'Stigmatopteris killipiana (Moran 6924)' ------------------------CAGA-AGCAAAAGTCGGAAACCACTTTTAAACTTTTCCTTATCT-GT----TCTTCGGTAAACGGTTTGCAAGTGAGCCATTCAAGCTT----TTAA----TATGCATAAATGGCTCATTCTAGCCCCCTCCA---------TACTTTA-----TTTACTGTAAGCAATACCGTGCTAAACATATTGATAAAAGCGAGATTAACGTTTTGACTAGGTAAA--AAACTAAAGTTGAAAAATAGACTTAACTGATTTCTAGTTAACTTTTATCCGT-AAATGA 'Stigmatopteris lechlerii (Moran 6942)' TTGTTCGGATCTACATAATTTGTTCAGA-AGCAAAAGTTGGAAACCACTTTTAAACT-TTTCTTATCT-GT----TCTTCGGTAAACAGTTTGCAAGTGAGCCATTCAAGCTT----TTAA----TATGCATGAATGGCTCATTCTAGCCCCCTCCC---------TACTTTA-----TTTACTGTAAGCAATACCGTGCTAACCATATTGATAAAAGCGAGATTAACGGTTTGACTAGGTAAA--AAACTAAAGTTGAAAAATAGACTTAACTGATTTCTAGTTAATTTTTATCCGT-AAATGA 'Stigmatopteris sordida (Moran 6946)' ------------------------CAGA-AGCAAAAGTCGGAAACCCCTTTTAAACTTTTCCTTATCT-GT----TCTTCGGTAAACGGTTTGCAAGTGAGCCATTCAAGCTT----TTAA----TATGCATAAATGGCTCATTCTAGCCCCCTCCA---------TACTTTA-----TTTACTGTAAGCAATACCGTGCTAAACATATTGATAAAAGCGAGATTAACGGTTTGACTAGGTAAA--AAACTAAAGTTGAAAAATAGACTTAACTGATTTCTAGTTAACTTTTATCCGT-AAATGA 'Teratophyllum wilkesianum (Ranker 1937)' CTGTTTGAATCCGTATAATTTGGTCGAA-AGCAAAATGCGTAAATAATTTTGAAT---TTTTTTTTCT-GA----TCTTTTGAAAATAGTTTGCGAGTGAGCCATTCATACCT----TTAA----TATGCATGGATGGCTCCATCTAGTCCCCCCTA---------TACTCTT-----ATTTCTATATATAAGATTGTATTAAACATATTGATAAAAGCGAGATCAGC----------GGTAAAAAATACTAAAGTTGAAAAATAGACTTAATTGACTCTTATTTAACCCTTTTCCAT-AAATAA ; END; BEGIN TREES; TITLE Lastreopsid_Bayesian_Analysis; LINK TAXA = Taxa1; TRANSLATE 1 Arthropteris_altescandens_GB, 2 'Lastreopsis killipii (Altamirano 952)', 3 'Bolbitis auriculata (Fay 110)', 4 'Bolbitis humblotii (Razafitsalana 115)', 5 'Bolbitis acrostichoides (Fay 1068)', 6 'Lastreopsis effusa (BP047)', 7 'Lastreopsis barteriana (Carvalho 5780)', 8 'Lastreopsis munita (Clarke & Pickard 1814)', 9 'Lastreopsis acuminata (Coveny 10182)', 10 'Lastreopsis munita (Coveny 1303)', 11 'Lastreopsis munita (Coveny 1906)', 12 'Lastreopsis microsora (Coveny 9944)', 13 'Lastreopsis smithiana (Coveny 9951)', 14 'Megalastrum macrotheca (Christenhuzs 4181)', 15 Ctenitis_eatonii_GB, 16 'Lastreopsis currori (Doursett-Lemaire 1906)', 17 'Elaphoglossum amygdalifolium (Herrera 2063)', 18 'Elaphoglossum decoratum (NYBG391/77B)', 19 'Megalastrum subtile (Moran 7608)', 20 'Megalastrum fugaceum (Jimenez 1203)', 21 'Lastreopsis subsimilis (Fay 4802)', 22 'Lastreopsis currori (Fay 4804)', 23 'Elaphoglossum hybridum (FR6421)', 24 'Lastreopsis microsora (Gardner 5018)', 25 'Lastreopsis hispida (Schneider sn)', 26 'Lastreopsis hispida (Given 11819)', 27 'Lastreopsis glabella (Given 11847)', 28 'Cyclodium rheophilum (Granville 15523)', 29 'Lastreopsis effusa ssp dilatata (Hernandez 1906)', 30 'Lastreopsis decomposita (Kessler 14191)', 31 'Lastreopsis marginans (Kessler 14192)', 32 'Lastreopsis silvestris (Kessler 14222)', 33 'Lastreopsis smithiana (Kessler 14226)', 34 'Lastreopsis acuminata (Kessler 14227)', 35 'Coveniella poecilophlebia (Kessler 14303)', 36 'Lastreopsis walleri (Kessler 14339)', 37 'Lastreopsis tinarooensis (Kessler 14340)', 38 'Lastreopsis rufescens (Kessler 14341)', 39 'Lastreopsis wurunuran (Kessler 14342)', 40 'Lastreopsis rufescens (Kessler 14343)', 41 'Lastreopsis tenera (Kessler 14344)', 42 'Lastreopsis sp nov (Kessler 14345)', 43 'Lastreopsis rufescens (Kessler 14347)', 44 'Lastreopsis wurunuran (Kessler 14348)', 45 'Lastreopsis microsora (Kessler 14350)', 46 'Oenotrichia tripinnata (Kessler 14352)', 47 'Lastreopsis windsorensis (Kessler 14353)', 48 'Lastreopsis marginans (Kessler 14354)', 49 'Lastreopsis microsora (Kessler 14355)', 50 'Rumohra adiantiformis (Kessler sn)', 51 'Pleocnemia presliana (Kuo 1955)', 52 'Lastreopsis confinis (Liogier 25604)', 53 'Arachniodes aristata (Lorence 9314)', 54 Lomariopsis_marginata_GB, 55 'Mickelia guianensis (Prado 2025)', 56 'Lomagramma matthewii (Wuzhisan 448)', 57 'Mickelia oligarchica (Smith 2236)', 58 'Mickelia pergamentacea (Sanchez 124)', 59 'Lastreopsis exculta ssp exculta (Moran 3239)', 60 'Maxonia apiifolia (Moran 3541)', 61 'Polybotrya pubens (Moran 6063)', 62 'Polybotrya andina (Moran 6729)', 63 'Stigmatopteris ichtiosma (Moran 6752)', 64 'Stigmatopteris killipiana (Moran 6924)', 65 'Stigmatopteris lechlerii (Moran 6942)', 66 'Stigmatopteris sordida (Moran 6946)', 67 'Polybotrya alfredii (Moran 7612)', 68 'Dryopteris patula (Sundue 1104)', 69 'Pleocnemia irregularis (Sundue 2245)', 70 'Arachniodes denticulata (Mynssen 549)', 71 'Cyclodium heterodon var. heterodon (Labiak 3996)', 72 'Dryopteris wallichiana (Labiak 4434)', 73 'Lastreopsis acuta (Labiak 4913)', 74 'Olfersia cervina (Labiak 5220)', 75 'Lastreopsis amplissima (Labiak sn)', 76 'Megalastrum atrogriseum (Sundue 1779)', 77 'Megalastrum connexum (Labiak 4260)', 78 'Megalastrum retrorsum (Labiak 4356)', 79 'Megalastrum abundans (Schwartsburd 1631)', 80 'Megalastrum canacae (Grangaud 3)', 81 'Megalastrum lanatum (Grangaud 6)', 82 'Rumohra adiantiformis (Prado & Hirai 2022)', 83 'Lastreopsis amplissima (Prado & Hirai 2021)', 84 'Rumohra adiantiformis (Jansen & Rouhan 2550)', 85 'Rumohra berteroana (Danton 1964)', 86 'Megalastrum vastum (Cornejo 8163)', 87 'Lastreopsis boivinii (RG470)', 88 'Lastreopsis perrieriana (Rouhan 1318)', 89 'Lastreopsis pseudoperrieriana (Rouhan 1319)', 90 'Lastreopsis perrieriana (Rouhan 1321)', 91 'Lastreopsis pseudoperrieriana (Rouhan 1323)', 92 'Lastreopsis pseudoperrieriana (Rouhan 1325)', 93 'Lastreopsis boivinii (Rouhan 1356)', 94 'Lastreopsis pseudoperrieriana (Rouhan 1364)', 95 'Lastreopsis boivinii (Rouhan 1369)', 96 Dryopteris_crispifolia_GB, 97 Dryopteris_patula_GB, 98 Dryopteris_fragrans_GB, 99 Arachniodes_rhomboidea_GB, 100 Phanerophlebia_nobilis_GB, 101 Polystichum_andersonii_GB, 102 Polystichum_munitum_GB, 103 'Teratophyllum wilkesianum (Ranker 1937)', 104 'Lastreopsis nigritiana (Thomas 8919)', 105 'Lastreopsis tenera (coll unkn)', 106 'Lastreopsis effusa ssp divergens (Villaroel 1597)', 107 'Lastreopsis vogelii (Visa 2498)', 108 'Lastreopsis vogelii (Visa 3706)', 109 'Lastreopsis effusa ssp divergens (Walker 10612)', 110 'Pleocnemia olivacea (WADE1991)', 111 'Coveniella poecilophlebia (van der Werff 11478)', 112 'Oenotrichia tripinnata (van der Werff 13809)', 113 'Lastreopsis subsericea (van der Werff 16118)', 114 'Lastreopsis tinarooensis (Van der Werff 17036)', 115 'Lastreopsis amplissima (Zardini 15991)'; TREE 'con 50 majrule+' = [&R] (1:1.075276407629409,54:1.508860107919178,(((((((2:0.0729730293191551,(75:0.00208534165527498,83:0.002086704522742185,115:0.007923645490624178):0.04319350889034972):0.01289142242592206,(25:0.00201495588928467,26:0.002104478852473813):0.09119991162339428):0.200755833089128,(((((30:0.02721502818516155,(31:0.005939951030465223,48:0.02889253256185458):0.01507468748957142,(41:0.002435518796974188,105:0.0026993736938333):0.01014834760670635):0.01590912598130555,36:0.03124176505542971):0.02575226378121937,32:0.05362136408827256):0.006285081590062926,(35:0.008392764075102593,111:0.004966446601230698):0.01869969779019205):0.1300862053747032,((((39:0.0191206751950726,44:0.002522653760571063):0.006662190208023376,42:0.006388986905131829):0.07261868810192235,(46:0.005875803147246684,112:0.002887347875300822):0.1094906421648187):0.04104959504503192,113:0.05157002963693089):0.1247565043421935):0.1454567077479952):0.02453798808338657,((((((14:0.05271170730239229,(76:0.04418896321842744,86:0.09549398901138542):0.01477675827598893):0.01468946934401824,19:0.08171022030089968):0.1108342180701653,20:0.0481367376719658):0.02469477808813916,((77:0.002183249534649324,78:0.00217879706004369):0.09519969163676352,79:0.04375987670101499):0.03872970576087769):0.04904610458998344,(80:0.002259950681714835,81:0.002217646661794056):0.1823521618952839):0.1462901342296449,((50:0.09018428002798588,85:0.01192822833117836):0.02516398828482858,(82:0.08649880096367336,84:0.09999618275973886):0.02714446048469875):0.3254628904720342):0.04552618711827448):0.09502263147348848,((((((6:0.02399977871325974,29:0.004758164938759935):0.01359704978760128,(73:0.01888495620161398,(106:0.002549054641137455,109:0.009706611726647829):0.009040154762648394):0.0429893659799141):0.03072543881036786,52:0.07542766687632808):0.02585183510590444,59:0.09417121363431843):0.1078934411757229,((((8:0.00551930238889172,10:0.00553616334616164,11:0.005623873921226481):0.01445688142823501,(9:0.005067651038135289,34:0.005133556003474925):0.04798185355948454,(((37:0.04205063356149977,114:0.003595033730406488):0.006821070098252505,38:0.009994071331030549):0.005999111693036737,(40:0.002812207511802389,43:0.03322072808069503):0.01035527395602038):0.01128820671077703):0.04976896185888606,((12:0.002248983005362427,24:0.002264675623453494,47:0.02030155274839289):0.02077980608843131,(45:0.006754644936892529,49:0.0155751942010447):0.03799770937257022):0.05833148190927414):0.009015207855823333,((13:0.002719146812163838,27:0.01307810033150375):0.005931578608733024,33:0.01061076889409512):0.05323404321203615):0.1171081214520222):0.05057427404056963,((7:0.09108193913143467,(87:0.005681916271028157,(88:0.007530395764114052,(89:0.002019214907398605,94:0.002111504205809082):0.005063617759636842,90:0.007998497652455855,91:0.002072707589352289,92:0.002661913276345743,93:0.002044915676305963,95:0.002126597936881709):0.005162718263182862):0.02861876678904593):0.022642144490694,((16:0.005170889446779817,22:0.0175956990464663,104:0.008471044571811434,107:0.002448502431778604,108:0.002473012202384064):0.01736470198865881,21:0.02034871471404143):0.04256164149111095):0.1176450101002379):0.2598600208144201):0.03469408212191792,(((3:0.2908576924493876,4:0.6477616135947604,5:0.3731822259413766):0.2456525638708758,(((17:0.7722173361306318,(18:0.0815726875502976,23:0.1037371058691517):0.3819160229114207):0.2354871061799646,(55:0.4444561223989468,(57:0.3439074815326189,58:0.5385203345222602):0.08303034646873234):0.07858454236718972):0.05631478796602732,(56:0.5293887015194159,103:0.3488637755890784):0.1688052899310767):0.0618734470006792):0.3809943186706978,(51:0.09875551719829859,(69:0.05260908158691335,110:0.0493859257428313):0.03809505920680929):0.5221630362722925):0.100020031347954):0.2437936329246534,(((15:0.5035941340852752,(100:0.2590785217033358,(101:0.03416462982949717,102:0.08666382445368605):0.2051315384833132):0.1322545209415171):0.1325052284645041,(((53:0.1875270454906821,70:0.2733806235526028):0.05041816872474611,99:0.3073797448029454):0.1697451330097582,(((68:0.05416101660836336,97:0.1085582741201958):0.2664953388634639,(72:0.186507215105419,96:0.1987110804718885):0.02928245374340037):0.05368139396113482,98:0.248345051075526):0.1639392410251068):0.07155606240402448):0.08384741039468589,((((28:0.1479399953379841,71:0.06387320791327235):0.1574620732714391,(61:0.09000925698246084,(62:0.05221059533300884,67:0.03874676489305779):0.06549506287731362):0.1142482798025405):0.02197925890085449,60:0.2341833829355409):0.049245663209159,74:0.2527129054708098):0.365610567560296,((63:0.05332752944908421,(64:0.01734636469764256,66:0.02035394057146091):0.04399764665967098):0.01436669452365434,65:0.04876620914332354):0.6146628774875039):0.04927446732860219):0.2265350574075203); END;