#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:06 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., & Takamatsu S. 2015. Erysiphe takamatsui, a powdery mildew of lotus: rediscovery of teleomorph after 40 years, morphology and phylogeny. Mycoscience, 56(1): 159-167. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15506] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=56; TAXLABELS Erysiphe_aquilegiae_AB104523 Erysiphe_aquilegiae_Aq1_EU047569 Erysiphe_aquilegiae_Aq2_EU047570 Erysiphe_aquilegiae_BRIP46649_DQ335569 Erysiphe_aquilegiae_KUS_F24744_JN003594 Erysiphe_aquilegiae_VPRI18533_AY452804 Erysiphe_aquilegiae_VPRI18740_AY452805 Erysiphe_aquilegiae_VPRI20820_AY452800 Erysiphe_aquilegiae_VPRI21045_AY452801 Erysiphe_aquilegiae_var._ranunculi_AB000944 Erysiphe_aquilegiae_var._ranunculi_AB015929 Erysiphe_aquilegiae_var._ranunculi_AF154322 Erysiphe_blasti_AB015918 Erysiphe_catalpae_K127267_DQ359695 Erysiphe_circaeae_AB104517 Erysiphe_macleayae_AB016048 Erysiphe_macleayae_KUS_F24459_JQ681217 Erysiphe_magnoliae_voucher_KUS_F26388_JX235964 Erysiphe_sedi_KUS_F24587_JX173290 Erysiphe_sedi_KUS_F24911_JX173288 Erysiphe_sedi_KUS_F25536_JX173289 Erysiphe_sp._P3323_07_EF434394 Erysiphe_sp._VPRI19613_AY452802 Erysiphe_sp._VPRI22122_AY452803 Erysiphe_symphoricarpi_BPI747015_AB078969 Erysiphe_symphoricarpi_MUMH1428_AB078970 Erysiphe_takamatsui_ex_Nelumbo_nucifera_MUMH5659 Erysiphe_takamatsui_ex_Nelumbo_nucifera_TNS_F52102 Oidium_hortensiae_KUS_F25514_JQ669944 Oidium_lycopersici_strain_Et1_AF229019 Oidium_neolycopersici_AB094991 Oidium_neolycopersici_AB163927 Oidium_neolycopersici_BULG_AB163913 Oidium_neolycopersici_CAN_AB163914 Oidium_neolycopersici_H1_JQ972700 Oidium_neolycopersici_KTP02_AB551923 Oidium_neolycopersici_UK2_AB163916 Oidium_sp._BPI878258_EU377475 Oidium_sp._BPI878259_EU377474 Oidium_sp._Ch1_HQ286645 Oidium_sp._Ch2_HQ286646 Oidium_sp._DNA231_AB032484 Oidium_sp._HAL1842F_DQ665673 Oidium_sp._KMP01_AB808657 Oidium_sp._MUMH4922_AB473221 Oidium_sp._MUMH4936_AB522716 Oidium_sp._MUMH66_AB032483 Oidium_sp._MUMH775_AB034722 Oidium_sp._Pa1_EU047571 Oidium_sp._Se1_EU047572 Oidium_sp._VPRI20724_AF229015 Uncultured_Erysiphaceae_6887.12_EU185640 Uncultured_Erysiphaceae_HAL1844F_EU185641 Uncultured_Erysiphaceae_isolate_P6879_07_EU185638 Uncultured_Erysiphaceae_isolate_P6880_07_EU185637 Uncultured_Erysiphaceae_isolate_P6885_07_EU185639 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=39; TAXLABELS Erysiphe_abbreviata_ex_Quercus_AB271785 Erysiphe_adunca_ex_Salix_AB022374 Erysiphe_alphitoides_ex_Quercus_AB257431 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 Erysiphe_arcuata_ex_Carpinus_AB252473 Erysiphe_australiana_ex_Lagerstroemia_AB022407 Erysiphe_bremeri_ex_Alhagi_sp._AB103077 Erysiphe_corylopsidis_ex_Corylopsis_AB478988 Erysiphe_cruciferarum_ex_Cardaria_draba_AB102944 Erysiphe_epigena_ex_Quercus_AB292722 Erysiphe_friesii_ex_Rhamnus_AB022382 Erysiphe_glycines_ex_Desmodium_AB022397 Erysiphe_gracilis_ex_Quercus_AB022357 Erysiphe_heraclei_ex_Chaerophyllum_aureum_AB103067 Erysiphe_heraclei_ex_Daucus_AB022391 Erysiphe_hypogena_ex_Quercus_AB292727 Erysiphe_hypophylla_ex_Quercus_AB292716 Erysiphe_japonica_ex_Quercus_AB022415 Erysiphe_ligustri_ex_Ligustrum_AB015917 Erysiphe_lycopsidis_ex_Anchusa_ovata_AB103072 Erysiphe_monascogera_ex_Styrax_AB331645 Erysiphe_mori_ex_Morus_AB022418 Erysiphe_multappendicis_ex_Berberis_vulgaris_AB103076 Erysiphe_nomurae_ex_Symplocos_AB331648 Erysiphe_paeoniae_ex_Paeonia_AB257438 Erysiphe_pisi_ex_Medicago_AB102942 Erysiphe_pulchra_var_japonica_ex_Swida_AB022389 Erysiphe_pulchra_var_pulchra_ex_Benthamidia_AB015935 Erysiphe_quercicola_ex_Quercus_AB292694 Erysiphe_simulans_ex_Rosa_AB022395 Erysiphe_staphyleae_ex_Staphylea_AB015922 Erysiphe_syringae_ex_Syringa_AB015920 Erysiphe_takamatsui_ex_Nelumbo_nucifera_Niigata Erysiphe_takamatsui_ex_Nelumbo_nucifera_Tokyo Erysiphe_takamatsui_ex_Nelumbo_sp._MUMH5399_Osaka Erysiphe_trifolii_ex_Trifolium_pratense_AB103078 Erysiphe_trina_ex_Quercus_AB022350 Erysiphe_vanbruntina_ex_Sambucus_AB015925 Erysiphe_wallrothii_ex_Vaccinium_AB015930 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M21278] TITLE Nelumbo_PM_28S; LINK TAXA = Taxa2; DIMENSIONS NCHAR=817; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Erysiphe_abbreviata_ex_Quercus_AB271785 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACCCGGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGCAGGTG--------------------------------------------------------------------------------- Erysiphe_adunca_ex_Salix_AB022374 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACACCACTGATCCGCGAGGGTTCT-CTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC--GG--GGAGTG--TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTAAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTC-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_alphitoides_ex_Quercus_AB257431 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------------------------------------------------------- Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GG--GGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_arcuata_ex_Carpinus_AB252473 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGTTCT-CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GG--GGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACG{CT}AGGTG--------------------------------------------------------------------------------- Erysiphe_australiana_ex_Lagerstroemia_AB022407 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGGCTTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGGGCATCGCTGATCATCCGGGGGTAT-CTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC--GA--GGAGTG--TTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_bremeri_ex_Alhagi_sp._AB103077 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTT---------------------------------- Erysiphe_corylopsidis_ex_Corylopsis_AB478988 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG--------------------------------------------------------------AATCTGGCTCCGTC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCAGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCGTGAGTTCT-CTCTCGTGCACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GG--AGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTTCATTG---GAGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_cruciferarum_ex_Cardaria_draba_AB102944 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TT--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGTTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGGAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTT---------------------------------- Erysiphe_epigena_ex_Quercus_AB292722 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC-------- Erysiphe_friesii_ex_Rhamnus_AB022382 TTGACCTCGAATCAGGTAGGAATACCCGCTGAAC------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTACGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_glycines_ex_Desmodium_AB022397 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATCTAGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT--GG--GGAGTG--TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_gracilis_ex_Quercus_AB022357 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGGTTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCGGG--GGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATC-ACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_heraclei_ex_Chaerophyllum_aureum_AB103067 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGACGCTGCCGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTA?CTCTCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTTG---GGGGCGCATCATCGACCGATCCTGATGTCTT---------------------------------- Erysiphe_heraclei_ex_Daucus_AB022391 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTTG---GGGGCGCATCATCGACCGATCCTGA---------------------------------------- Erysiphe_hypogena_ex_Quercus_AB292727 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCAGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATACGCGGAATGAAAGTGAACG--------------------------------------------------------------------------------------- Erysiphe_hypophylla_ex_Quercus_AB292716 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT------------------------------------------------------------------------------------------------------------------- Erysiphe_japonica_ex_Quercus_AB022415 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA--------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCCAGAGTTCT-CTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTCGGG--GGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_ligustri_ex_Ligustrum_AB015917 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGT------------------------------------- Erysiphe_lycopsidis_ex_Anchusa_ovata_AB103072 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCACGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGTTCTGCGCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTT---------------------------------- Erysiphe_monascogera_ex_Styrax_AB331645 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG???????????????????????????GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TG--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCAGACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC-------- Erysiphe_mori_ex_Morus_AB022418 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCATCCAGAGTTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTCGGG--GGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGCAGGTG--------------------------------------------------------------------------------- Erysiphe_multappendicis_ex_Berberis_vulgaris_AB103076 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCATCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTT---------------------------------- Erysiphe_nomurae_ex_Symplocos_AB331648 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--CAGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCCATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCATCTCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC-------- Erysiphe_paeoniae_ex_Paeonia_AB257438 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGGGCACTGCCGATCACCCTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTA------------------------------------------------------------------------------------------------------------------ Erysiphe_pisi_ex_Medicago_AB102942 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCATGGCCCGCGCCTCTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGGAGGAATGTAGCTCCCCTC--GG--GGAGTG--TTATAGCCTACGGCGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCGTTCG--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTT----------------------- Erysiphe_pulchra_var_japonica_ex_Swida_AB022389 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCAGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC-------- Erysiphe_pulchra_var_pulchra_ex_Benthamidia_AB015935 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAG------------------------------------------------------------------------------------ Erysiphe_quercicola_ex_Quercus_AB292694 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_simulans_ex_Rosa_AB022395 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TG--CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCTGAGGCCCGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGCCGATCATTCCGAGTTCT-CTCTGATGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACCGGAGGAACGTAGCTCCCCCCTCGGGAGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAACCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_staphyleae_ex_Staphylea_AB015922 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--GGGAGTCCGAGTTGTAATTTGTAGAAGCTGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTATGTAAAGCGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGGGTGCACTCGTCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC--GG--GGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTT--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGT---------------------------------------------------------------------------------- Erysiphe_syringae_ex_Syringa_AB015920 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TA--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTCC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGAT------------------------- Erysiphe_takamatsui_ex_Nelumbo_nucifera_Niigata TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GG--GGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC-------- Erysiphe_takamatsui_ex_Nelumbo_nucifera_Tokyo TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GG--GGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC-------- Erysiphe_takamatsui_ex_Nelumbo_sp._MUMH5399_Osaka TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC--GG--GGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC-------- Erysiphe_trifolii_ex_Trifolium_pratense_AB103078 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA-------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TC--TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTT---------------------------------- Erysiphe_trina_ex_Quercus_AB022350 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCC-GT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGAATCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGCC---AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGACTTGGGCGCTGCCGATCATCCCGAGTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTCGGG--GCAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTGAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGACCGATCCTGATGT?TTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_vanbruntina_ex_Sambucus_AB015925 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TT--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCCGAGTTTT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCTCTC--GG--GGAGTG--TTATAGCCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC------------------------------------------------------------------------------------------------------------------------------------------------------ Erysiphe_wallrothii_ex_Vaccinium_AB015930 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TC--CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC--GG--GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTGGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC-------- ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Nelumbo_PM_28S) = N: 1-817; CODONPOSSET CodonPositions (CHARACTERS = Nelumbo_PM_28S) = N: 1-817; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M21280] TITLE Lotus_PM_56_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=555; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_aquilegiae_AB104523 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAAACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_Aq1_EU047569 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_Aq2_EU047570 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_BRIP46649_DQ335569 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_KUS_F24744_JN003594 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTAC-GACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACC-AACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_VPRI18533_AY452804 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_VPRI18740_AY452805 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_VPRI20820_AY452800 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_VPRI21045_AY452801 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_var._ranunculi_AB000944 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGGTTTATTATAGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_var._ranunculi_AB015929 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_aquilegiae_var._ranunculi_AF154322 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_blasti_AB015918 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGG-CCGGGTTACGTGGACGCTGCCCGTAAGGATATGCGTCGGCTGCCCACCGGTTTCGGCTGGAGCGCGTCCGCCAAAGACCCAATCAAAAACTCATGTTGTCTTTGCAGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGCAGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGACAGTGGCCTGCCAAAACCCCGTTTGTTCCAGTCATATGGATCACAGG Erysiphe_catalpae_K127267_DQ359695 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_circaeae_AB104517 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCTGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTACTGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_macleayae_AB016048 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACGCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_macleayae_KUS_F24459_JQ681217 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGAACCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_magnoliae_voucher_KUS_F26388_JX235964 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGTCCGCAAGGACATGCGTCGAGTGCCCACCGGCTTCGGCTGGAGCGCGTTCGCCAAAGACCCAACC-AAAACTCATGTTGTCTTTGCAGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGAAGCGGCGGCCCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sedi_KUS_F24587_JX173290 ---AGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sedi_KUS_F24911_JX173288 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sedi_KUS_F25536_JX173289 -------------------------------------TGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sp._P3323_07_EF434394 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sp._VPRI19613_AY452802 CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGACCATTAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCCAAAGACCTATAC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCACGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_sp._VPRI22122_AY452803 CAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGACCATTAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCCAAAGACCTATAC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCACGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_symphoricarpi_BPI747015_AB078969 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTATATTTTGTTGCTTTGGCGGG-CCGGGTTACGTCGTCGCTGTCCGCAAGGACAGACGTCGGCCTCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCCAATC-AAAACTCATGTTGTCTTTGCAGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTACCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAAAAACCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_symphoricarpi_MUMH1428_AB078970 CAGAGCGTGAGGCTCAGTCGTGGCGTCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTATATTTTGTTGCTTTGGCGGG-CCGGGTTACGTCGTCGCTGTCCGCAAGGACAGACGTCGGCCTCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCCAATC-AAAACTCATGTTGTCTTTGCAGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTACCTTTGTGTGGCTGCGGTGTTGGGGCACGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAAAAACCCATTTGTTCCAGTCACATGGATCACAGG Erysiphe_takamatsui_ex_Nelumbo_nucifera_MUMH5659 ----GCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACGCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Erysiphe_takamatsui_ex_Nelumbo_nucifera_TNS_F52102 -----CGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_hortensiae_KUS_F25514_JQ669944 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_lycopersici_strain_Et1_AF229019 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_neolycopersici_AB094991 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_neolycopersici_AB163927 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_neolycopersici_BULG_AB163913 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_neolycopersici_CAN_AB163914 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_neolycopersici_H1_JQ972700 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_neolycopersici_KTP02_AB551923 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_neolycopersici_UK2_AB163916 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._BPI878258_EU377475 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._BPI878259_EU377474 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTATGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCCTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._Ch1_HQ286645 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._Ch2_HQ286646 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._DNA231_AB032484 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._HAL1842F_DQ665673 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATACCGAGGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._KMP01_AB808657 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._MUMH4922_AB473221 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._MUMH4936_AB522716 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATGTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGCTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._MUMH66_AB032483 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._MUMH775_AB034722 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._Pa1_EU047571 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTACCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._Se1_EU047572 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Oidium_sp._VPRI20724_AF229015 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTACTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Uncultured_Erysiphaceae_6887.12_EU185640 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Uncultured_Erysiphaceae_HAL1844F_EU185641 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Uncultured_Erysiphaceae_isolate_P6879_07_EU185638 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Uncultured_Erysiphaceae_isolate_P6880_07_EU185637 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG Uncultured_Erysiphaceae_isolate_P6885_07_EU185639 CAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGG-CCGGGCTACGTCGTCGCTGCCCGTACGGACATGCGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACC-AAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGA-GGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Lotus_PM_56_ITS) = N: 1-555; CODONPOSSET CodonPositions (CHARACTERS = Lotus_PM_56_ITS) = N: 1-555; END; BEGIN TREES; TITLE Fig._1_from_Nelumbo_PM_28S; LINK TAXA = Taxa2; TRANSLATE 1 Erysiphe_takamatsui_ex_Nelumbo_nucifera_Tokyo, 2 Erysiphe_takamatsui_ex_Nelumbo_nucifera_Niigata, 3 Erysiphe_takamatsui_ex_Nelumbo_sp._MUMH5399_Osaka, 4 Erysiphe_multappendicis_ex_Berberis_vulgaris_AB103076, 5 Erysiphe_cruciferarum_ex_Cardaria_draba_AB102944, 6 Erysiphe_heraclei_ex_Chaerophyllum_aureum_AB103067, 7 Erysiphe_bremeri_ex_Alhagi_sp._AB103077, 8 Erysiphe_trifolii_ex_Trifolium_pratense_AB103078, 9 Erysiphe_lycopsidis_ex_Anchusa_ovata_AB103072, 10 Erysiphe_trina_ex_Quercus_AB022350, 11 Erysiphe_alphitoides_ex_Quercus_AB257431, 12 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405, 13 Erysiphe_arcuata_ex_Carpinus_AB252473, 14 Erysiphe_corylopsidis_ex_Corylopsis_AB478988, 15 Erysiphe_friesii_ex_Rhamnus_AB022382, 16 Erysiphe_glycines_ex_Desmodium_AB022397, 17 Erysiphe_gracilis_ex_Quercus_AB022357, 18 Erysiphe_heraclei_ex_Daucus_AB022391, 19 Erysiphe_hypophylla_ex_Quercus_AB292716, 20 Erysiphe_mori_ex_Morus_AB022418, 21 Erysiphe_paeoniae_ex_Paeonia_AB257438, 22 Erysiphe_pisi_ex_Medicago_AB102942, 23 Erysiphe_quercicola_ex_Quercus_AB292694, 24 Erysiphe_simulans_ex_Rosa_AB022395, 25 Erysiphe_japonica_ex_Quercus_AB022415, 26 Erysiphe_abbreviata_ex_Quercus_AB271785, 27 Erysiphe_epigena_ex_Quercus_AB292722, 28 Erysiphe_hypogena_ex_Quercus_AB292727, 29 Erysiphe_ligustri_ex_Ligustrum_AB015917, 30 Erysiphe_monascogera_ex_Styrax_AB331645, 31 Erysiphe_nomurae_ex_Symplocos_AB331648, 32 Erysiphe_pulchra_var_japonica_ex_Swida_AB022389, 33 Erysiphe_pulchra_var_pulchra_ex_Benthamidia_AB015935, 34 Erysiphe_staphyleae_ex_Staphylea_AB015922, 35 Erysiphe_syringae_ex_Syringa_AB015920, 36 Erysiphe_wallrothii_ex_Vaccinium_AB015930, 37 Erysiphe_vanbruntina_ex_Sambucus_AB015925, 38 Erysiphe_adunca_ex_Salix_AB022374, 39 Erysiphe_australiana_ex_Lagerstroemia_AB022407; TREE Fig._1 = [&R] ((((((((((1,2,3,12),22),(34,37)),(((((((11,36),(23,(30,31))),19),35),26),(27,28)),(14,33))),(((((4,(5,9),8),7),(6,18)),15),32),29),21),(((((10,24),17),25),20),16)),13),38),39); END; BEGIN TREES; TITLE Fig._2_from_Lotus_PM_56_ITS; LINK TAXA = Taxa1; TRANSLATE 1 Oidium_neolycopersici_CAN_AB163914, 2 Oidium_neolycopersici_AB094991, 3 Oidium_neolycopersici_UK2_AB163916, 4 Oidium_neolycopersici_AB163927, 5 Oidium_sp._VPRI20724_AF229015, 6 Oidium_lycopersici_strain_Et1_AF229019, 7 Oidium_neolycopersici_KTP02_AB551923, 8 Oidium_neolycopersici_H1_JQ972700, 9 Oidium_sp._MUMH66_AB032483, 10 Oidium_sp._DNA231_AB032484, 11 Oidium_sp._MUMH775_AB034722, 12 Oidium_neolycopersici_BULG_AB163913, 13 Oidium_sp._KMP01_AB808657, 14 Uncultured_Erysiphaceae_6887.12_EU185640, 15 Uncultured_Erysiphaceae_isolate_P6885_07_EU185639, 16 Uncultured_Erysiphaceae_isolate_P6879_07_EU185638, 17 Erysiphe_sedi_KUS_F24911_JX173288, 18 Uncultured_Erysiphaceae_isolate_P6880_07_EU185637, 19 Oidium_sp._MUMH4936_AB522716, 20 Oidium_hortensiae_KUS_F25514_JQ669944, 21 Erysiphe_sedi_KUS_F24587_JX173290, 22 Erysiphe_sp._P3323_07_EF434394, 23 Oidium_sp._MUMH4922_AB473221, 24 Oidium_sp._Se1_EU047572, 25 Uncultured_Erysiphaceae_HAL1844F_EU185641, 26 Erysiphe_sedi_KUS_F25536_JX173289, 27 Erysiphe_macleayae_AB016048, 28 Erysiphe_takamatsui_ex_Nelumbo_nucifera_MUMH5659, 29 Erysiphe_takamatsui_ex_Nelumbo_nucifera_TNS_F52102, 30 Erysiphe_aquilegiae_var._ranunculi_AF154322, 31 Erysiphe_aquilegiae_var._ranunculi_AB015929, 32 Oidium_sp._BPI878258_EU377475, 33 Erysiphe_catalpae_K127267_DQ359695, 34 Oidium_sp._HAL1842F_DQ665673, 35 Erysiphe_aquilegiae_Aq2_EU047570, 36 Erysiphe_aquilegiae_Aq1_EU047569, 37 Erysiphe_aquilegiae_var._ranunculi_AB000944, 38 Erysiphe_aquilegiae_BRIP46649_DQ335569, 39 Oidium_sp._Ch1_HQ286645, 40 Erysiphe_aquilegiae_VPRI18740_AY452805, 41 Oidium_sp._Ch2_HQ286646, 42 Erysiphe_aquilegiae_AB104523, 43 Erysiphe_macleayae_KUS_F24459_JQ681217, 44 Oidium_sp._BPI878259_EU377474, 45 Erysiphe_aquilegiae_KUS_F24744_JN003594, 46 Erysiphe_aquilegiae_VPRI18533_AY452804, 47 Oidium_sp._Pa1_EU047571, 48 Erysiphe_circaeae_AB104517, 49 Erysiphe_aquilegiae_VPRI21045_AY452801, 50 Erysiphe_aquilegiae_VPRI20820_AY452800, 51 Erysiphe_sp._VPRI22122_AY452803, 52 Erysiphe_sp._VPRI19613_AY452802, 53 Erysiphe_blasti_AB015918, 54 Erysiphe_magnoliae_voucher_KUS_F26388_JX235964, 55 Erysiphe_symphoricarpi_BPI747015_AB078969, 56 Erysiphe_symphoricarpi_MUMH1428_AB078970; TREE Fig._2 = [&R] (((((1,2,3,4,5,6,7,8,9,10,11,12,13),14,15,16,17,18,19,20,21,22,23,24,25,26),(27,28),29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50),(51,52)),((53,54),(55,56))); END;