#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 23:08 GMT TreeBASE (cc) 1994-2008 Study reference: Norup M., Dransfield J., Chase M., Barfod A.S., Fernando E., & Baker W.J. 2006. Homoplasious character combinations and generic delimitation: a case study from the Indo-Pacific arecoid palms (Arecaceae: Areceae). American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1554] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=101; TAXLABELS Acanthophoenix_rubra Actinokentia_huerlimannii Actinorhytis_calapparia Adonidia_merrillii Alloschmidia_glabrata Alsmithia_longipes_Baker_1180 Alsmithia_longipes_Zona_1039 Archontophoenix_purpurea Areca_catechu Asterogyne_martiana Balaka_longirostris Basselinia_velutina Bentinckia_condapanna Brassiophoenix_drymophloeoides Brongniartikentia_lanuginosa Burretiokentia_vieillardii Calyptrocalyx_hollrungii Calyptrogyne_costatifrons Campecarpus_fulcitus Carpentaria_acuminata Carpoxylon_macrospermum Chamaerops_humilis Chambeyronia_macrocarpa Clinosperma_bracteale Clinostigma_savoryanum Cyphokentia_macrostachya Cyphophoenix_nucele Cyphosperma_balansae Cyrtostachys_renda Deckenia_nobilis Dictyosperma_album Drymophloeus_litigiosus Dypsis_lutescens Geonoma_deversa Hedyscepe_canterburyana Heterospathe_cagayanensis Heterospathe_delicatula Heterospathe_elata_Chapin_55 Heterospathe_elata_Houg_Hubb_1024 Heterospathe_elata_Lewis_99034 Heterospathe_humilis Heterospathe_macgregorii Heterospathe_philippinensis Heterospathe_phillipsii Heterospathe_scitula Heterospathe_sibuyanensis Heterospathe_sp_Baker_1115 Heterospathe_sp_Baker_1130 Heterospathe_sp_Baker_1142 Heterospathe_sp_Banka_2008 Heterospathe_sp_nov_Fernando_1624 Howea_belmoreana Hydriastele_beguinii Hydriastele_brassii Hydriastele_costata Hydriastele_microspadix Iguanura_wallichiana Kentiopsis_oliviformis Laccospadix_australasicus Lavoixia_macrocarpa Lemurophoenix_halleuxii Leopoldinia_pulchra Lepidorrhachis_mooreana Linospadix_albertisiana Loxococcus_rupicola Manicaria_saccifera Marojejya_darianii Masoala_madagascariensis Moratia_cerifera Nenga_pumila_var_pachystachya Neonicholsonia_watsonii Neoveitchia_storckii Nephrosperma_vanhoutteanum Normanbya_normanbyi Oncosperma_tigillarium Pelagodoxa_henryana Phoenicophorium_borsigianum Pholidostachys_pulchra Physokentia_rosea Pinanga_coronata Podococcus_barteri Ponapea_palauensis Ptychococcus_paradoxus Ptychosperma_micranthum Ptychosperma_salomonense Rhopaloblaste_augusta Rhopaloblaste_ceramica Rhopaloblaste_ledermanniana_Heatubun_191 Rhopaloblaste_ledermanniana_Maturbongs_650 Rhopaloblaste_singaporensis Rhopalostylis_baueri Roscheria_melanochaetes Satakentia_liukiuensis Socratea_exorrhiza Solfia_samoensis Sommieria_leucophylla Tectiphiala_ferox Veillonia_alba Veitchia_spiralis Verschaffeltia_splendida Wodyetia_bifurcata ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1197] TITLE PRK_&_RPB2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2101; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Acanthophoenix_rubra ?????????????????????????????????????????????????????????????????????????????TCCATAGAACCTTC{AC}TGCAAGCTTTACCTGAGTTGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCTAA--------GGCACTGTATCTGATGTTAAAGAACATTATGGAAGGTTGCGATGTTAAAGAACATTATGGAAGGTTGCTTTTG-TTCAGC---TCCAGGAGAAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATCAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATAACTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTTCCCTGTAGACAGAAATGTGGCTTTGAAGCATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACCGAGG-------TCTCCCCTAAATTATATATT---AGACTATCACC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATATGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATATCATCACAGA???????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAACTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTTACTTTGCCACAGCACCTAGTTGTTAGTATTCCAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCGATATCTACCAAATGCTTCATGAAAAAA--CTAATCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATGGTGGACTGACAATGTGATATTA-----CT-TCATGTGTAATTTTTTT-----GG-TACCT--TTTTTCAA---AAGAA---------------------------------------------------------TGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTG--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCGCAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGATGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Actinokentia_huerlimannii ?????????????????????????????????????????????????TCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCCGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGCAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCACATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGGG------------TCGTCT---AGAACCCTTCCAACAT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGATGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACCATTTTTACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCC-TT{CT}AAAAAA--TGCTTA-TTTATC????????????????????????????????????????????????????????????????????????????GTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTTGAAGAA---TTGGCAGA----GCACAAACCTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGGTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATGAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCAAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTGTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCCGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCT????????????????? Actinorhytis_calapparia ???????????????????????????????????????????????????????TACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTGACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCCGGAGCTATTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCACATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGAGGGG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTTACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGAAGTTTAATATGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAACAAA--TGCTTATTTTATCACAAAT????????????????????????????????????????????????????????????????????????????????????????????????????????AAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGC{AG}CATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAACATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA-------------------------------TGGG{CG}GGG------------------------AGGGCGAGCCACACCTGATTCAC-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCATCTCATGTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAA???????????????????????????????????????????????????????????????????? Adonidia_merrillii GCATCATGGGAAAGGTTGCTGCCCATATGGGAAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCGTAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCGTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATCATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACGGGGGGG------------TCATCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------TATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATACTCCTGCTATTTGAAGTCTACTTTAGATATCTTTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTCGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATAATATTTTGACTGAGG-------TCTCTCCTAAATTTTATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGTAGTTCCATCCTAAGTAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAATTTAATACGTA-ATTGTGCTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG???TGAT-ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATGGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GTACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATCAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATAACAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACTCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGACGACAATGAAAGGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTTGATCCAGTTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? Alloschmidia_glabrata ????????????????????????????????????????????????CTCCTT----------------------------AGAACCTTCATGCCAGCTTTACCTGAGTAGCA-TGTCACAATTTAACCT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTACGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCTTCCAATTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTT-------CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTATGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTGGGCACAGTCTCGAGAGCGTCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGCT-------------------GAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAGCAAAGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAAGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGGAATAA?? Alsmithia_longipes_Baker_1180 ????????????????????????????????????????????????????????????????????????????????????????TCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCAGATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACTGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCC??????????????????????????????????????????????????????????????????????????TGTGAT-ATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------TA-----CT-TCATGTGCAATTTATTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGACA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAAA-TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATAACCCTGGGAATA? Alsmithia_longipes_Zona_1039 GCATCATGGGAAAGGTTGCAGCCCATATGGGAAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TC-AGGAGGAAGGAATA---TTTGCAGATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACTGAAATGTGACTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCCCTTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG??GTGAT-ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------TA-----CT-TCATGTGCAATTTATTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGACA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAAA-TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGGAAT???? Archontophoenix_purpurea ????????????????????????????????????????????????????????????????????????????ATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGCCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTTC---TCCAGGAGGAAGGAATA---TTTGCACATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTCGATAC-GATTT-AATAAATATGTTTGAGAA-----ACACAGGGGGG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACCATTTTTACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATATATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATAGGTAAGTTGTACTC----------------------------------------------------------------------------------TTGTAATTTCCCCC????????????????????????????????????????????????????????????????????????TTGTGAT-ATGGAAGGAACGTGGGCACAGTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTTGAAGAA---TTGGCAGA----GCACAAACTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGGTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAGCAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCAAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTGTTGGATTGCTGACAGCTTA-TACG--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATC-----------------GGAG----------TTT?????????????????????????????????????????????????????? Areca_catechu ?????????????????????????????????????????GATGCTACTCCTTTTACCGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGATGGAGCTTTTTTGCTTATTCAGTTTAAGAATTTCAA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---ATCAGGAGGAAGGAATA---TTTGCATATTTCTAGCTAAAAGACA-TTGTTAATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACA-GGAAG------------TTGTCT---AGAACCCTT----CTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTTTTTTGAAGTTCTTGATATGCAA-GTTTACCCTGTAGACTGAAATGTGGCTTTGGAGAATGACCTTGGACGAGTGTTTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATGTTGACTGAGG-------TCTCTCGTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TTACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATAAATTCTGATGTAGGAGTTTATTACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATCTTATCACAAATTTC???????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTACGTTGGTATGTTACTTTGCCACAGCCCCTAGCTGTTAGTATTGGAATAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGATCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCC----GATCAATAAGTCAAATAATGCTCAAATCATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTAATTTGG-TACCT--TTTTTCAA---GAGAAAGAGGGAGCGTTGTGGGGGGGTGGGGGCGGGGGTGTTGGGGGAGGGCGTGCCACACCTGATTCAT-TGAGACAG----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTATTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAACTACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACCG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Asterogyne_martiana ????????????????????????????????????????????????????????????????CACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTGCCTGAGAAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATG{CG}TGGAGCTTTTTTG{CG}TTATTCAGTTTAAGAATTCCAA--------GG{CG}ACTGTACCTGATGTTAAAGAA----------------------------CATCATGGAAAGTTTCTTTTG-TTCTGC---TCCAGGAGGA-GG--TAA-TTTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATAGAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATTAATATGTTTGAGAA-------ACAAGGGGG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-------------------------TTTTTTTTGAGGGGGAG-------CACTTGCCTTTAGAGTT-CATATTTT---CCTTCGGATTAGTTAA-TTATAATCATGTTATTTGAAGTATTCTTTAAATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTAC--TGT-------AACGTGGCTT-GAAGAATGACTTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAGGACATACTATTT-GACCGATC-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGCTTTTCCAGTTCAATGATCTATCAGGAGTTCTGTCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAG?TTAATAGG??-GGGGTACTT----------------------------------------------------------------------------------TTCTAATTTCCCCATTGCAAAAAA??GCTTATATTATCACAAATTTC???????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGCGCCTAGTTGTTAGTGCTCGAAGAA---TTGGCAGA----GCACTAATTTGTCGGTATAATATAGAGCAATGTCATTAGTCTT---GATTGTTGA-TACAGTAA----TATACTTCAATATCTACCAAATGCTTCATAT-----------CCCAACTA--------TCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACGATATAATATTA-----CT-TCATGTGCAATTTTTTTT----AG-TACTTT-TTTTTCAA---AAGAAAGAGGGAGAGTGGGGGGG------------------------AGGGCGAGCCCCGCCTGATTCAT-TGAGATAA----CAAGACAATTAGATA-TGTC--GAGTCTCAT--CATGTTCTTCTAATATCAGAA--TCCAGTGT--CTTTAGCACTCTTGGATTGCTGACAGCTTATAACA--TTGCTACCCTTGGCAGACCTGCAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTACCGACACAATTAATTCCTGATGACAATGAAAGGAAAGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCAGTTTACCTCTTCGACGAAGGCTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Balaka_longirostris ??????????????????????????????????????????????????CCTTTTACTGATGTCACAGTAAGTAAATCCGTAGAACCTTCATGCAAGCTTTACCTGAGTAGCACTGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATCATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGGTAT-GGTTT-AATAAATATGTTTGAGAA-----ACATT-GGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATACTCCTGCTATTTGAAGCCTACTTTAGATATCTTTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAGCTTGTATAAAGTTTCAAGGCATGCTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTA-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGTAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTGA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGGGGCACAGTCTCGAGAACATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTGCGATGCTTATGTTGGTATGTCACTTTGCCATGGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGATATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGACTATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAATAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CT-TCATATGCATTTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----ATTCTTCTGATAACAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGACGACAATGAAAGGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAATTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCAT?????????????? Basselinia_velutina ????????????????????????????????????????????????????????????????????????G-AAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACCT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTACGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCTTCCAATTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTT-------CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTATGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCC????????????????????????????????????????????????????????????????????????????????????GAAGGAACGTGGGCACAGTCTCGAGAGCGTCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTACGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAACAAGTCAAATAATGCACAAAACATACTGGACTAGCAAAGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCT????????? Bentinckia_condapanna ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACTGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCACCGTATCTGATATTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCGGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTCATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-AGTTTTAATAAATATGTTTGAGAA-----ACACAAGGGAG------------TCATCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTTTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAAGTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCA????????????????????????????????????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTCGGTAGGTTACTTTGCCACAGCGCCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGCCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAGTATCTACCAAATGCTTCATAAAAGAA--CTAACCAAACTAACAAAGCATCT----GATCGATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATCTTA-----CT-TCATGTGCAATTTTTTT-----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTTCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Brassiophoenix_drymophloeoides GCATCATGGGAAAGGTTGCTGCCCATATGGGAAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAGTTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGG-------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTT-AA------------------TTTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCTTGCTATTTAAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCTTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGATGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGCATGAGG-------TCTCTCCTAAATTATATAAT---AGACTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----CAAC-ATTGATTTCAGATAAATTCTGATGTAGGAGTTAAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATTTCATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG???TGAT-ATGGAA-GAACGTGGGCACAGTTTCGAGAGCATCAAAGTTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATGGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CT-AAATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATAACAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGACGACAATGAAAGGATGGTACTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? Brongniartikentia_lanuginosa ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATCATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------CCATCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGAGGAGTGTCTTGTAAGTTGTTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTAAGG-------TCTCTCCTAAATTGTATAATAATGGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTTAGATATATGCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAATT??????????????????????????????????????????????????????????ACGTGGGCACAGTCTTGAGGGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACGAATTTGTTGGTATAATATGGAGCAATGCCATTAGTCTT---GACCGCTGAATATAGTAA----TATACTTCAATACCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACGAAACATACTGGACTAACAATGTAGTATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCGAGCCACACCTGATTCTT-TGAGACAA----CGAAACAATTAGATA-TGTG--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCGGATGACGATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGAGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTTAC?????????????????????? Burretiokentia_vieillardii ????????????????????????????????????GAGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCCTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTACTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCATCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTGGAGTT-CATACTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAG----CTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACATA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCA?????????????????????????????????????????????????????????????????????????TGTGAT-ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCACATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAACATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATGCTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCATCTGAGACAA----TGAGACAATTAGATA-TGTC--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TAC{AG}--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTG???????? Calyptrocalyx_hollrungii ????????????????????????????????????????AGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCGAGGAGGAAGGAATA---TTTGCACATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGGG------------TCGTCT---AGAACCCTTCAAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CTTCTAGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGGTATGTAA-GTTTACCGTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTTAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATATTATTTTTACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCGTTTAAAAAAA-TGCTTATTTTATCACAAA??????????????????????????????????????????????????????????????????????AGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTAGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACCTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TGCCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA--GCA--TTGCTAACCTTGGCAGACCCACAGAAGCAATACGCTGATGTTGTAATTGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCA????????????????????????????????????????????????????????????? Calyptrogyne_costatifrons ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????TGAG-------------CCCTTGCCTTTAGAGTT-CATATTTT---CCTTTGGATTAGTTAA-TTATAATCCTGTTATTTGAAGTCTACTTTAAATATCTCTTTTGAAGTTCTTGATTTGTGA-GTTTACC--GT-------AATGTGGCTTTGAAGAATGACTTTGGACGAGTGTCTTGTAAGTTAGTCTGATGATCCTAAACTTGTATAAAGTTTCAAGACATACTATTTTGACCAATC-------TCTCTCCTAAATTATATAAT---AGACTACCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCTATCGGGAGTTCTGTCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGCTATATTCTGATGTAGGAGTTTAATAGGTA-ATGGTACTT----------------------------------------------------------------------------------TTATAATT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGTGCCTAGTTGTTAGTGCTCGAAGAA---TTGGCAGA----GCACTAATTTGTCGGTATGATATAGAGCAATGTCATTAGTCTT---GATTGCTGA-TACAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCTAACTA--------TCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATATAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTCTCAA---AAGAAAGAGGGAGAGTGGGGGGG------------------------AGGGCGAGCCCCGCCTGATTCAT-TGAGATAA----TGAGACAATTAGATA-TGTC--GAGTCTCAT-----GTTCTTCTAGTATCTGAA--TCCACCATGTCTTTAGCACTCTTGGATTGCTAACAGCTTA-TACA--TTGCTACCCTTGGCAGACCTGCAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTACCGACACAATTAATTCCTGATGACAATGAAAGGAAAGTGCTAAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCAGTTTACCTCTTCGACGAAGGCTCCACTG-TTTCTT-GGATA-C??????????????????????????????????????????? Campecarpus_fulcitus ????????????????????????????????AAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCCTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTACTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGAGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGAATAAAGTTTCAAGGCACACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATTTTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACA???????????????????????????????????????????????????T-ATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCTTAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGAATAATATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGTTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATGCTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-CGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACCG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTC???????????????? Carpentaria_acuminata ??????????????????????CCATATGGGAAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAAACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTGGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACA-GGGGG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTAAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGACTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGCAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGGTGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAAAGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----CAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTAAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCAATTAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCA?????????????????????????TGAT-ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATGGCACATGGTTATTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAACGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GGTCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATAACAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGACGACAATGAAAGGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTCACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? Carpoxylon_macrospermum ?????????????????????????????????GG-AGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCGGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTGGCATATGTCTAACTAAAAGACA-TTGTTGATAGCT{CG}ATACAAAAACACGCGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCTAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGGTATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAGACTTGTATAAAGTTTCAAGGCATACTATTTTGACTTAGG-------TCTCTTCTAAATTATATAAT---AGACTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATCGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAATTT????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATGAGTCAAATAAT---------ACACCGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTTTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACGATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Chamaerops_humilis ?????TCAGGAAGGTTGCTGCCCATATGGGAAAGG-AGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATACATAAAACCTTTGTGCAAGCTTTACCTGAGAAGCG-TGCCATAATTTAACCT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGATTATTCAGTTTAAGAATTCC?A--------GTCACTGTATCTGATGTTAAAGAA----------------------------CATTAAGGAAAGTTTCTTTTG-TTCTGC---TCCAGGAAGAAG---TAATTTTTGCATATGTCTAGCTAAAAGACA-TTGTTGATGGTTTATACAAAAACAGAAGGTTATTCAATTTTCATTACCATTAAGGATTTGTATTAGATAT-GGTTT-AGTTAATTAT-----------------------------------------------AATCCTTTCGACTT--CATACCTGGATTTG-A---------------------TTTTCTTATTGAGGGG-AG-------CGTTTGCCTTTGGAGTT-CATATTTT---CCTCTGGTTTAGTTAA-TTATAATCCTGTTATTTGAAGTCTACTTTGAATATCTCTTTTGAAGTTCTTGAGATGTAA-ATTTACCCTGTAGACAG{AT}AACGTGGCTTTGAAGAATGACTTTGGACGAGTGT----TAAGTTATTCTGATG{AT}TCCTAAACTTTTAT-AAGTTTCAAGACATACTATTTTGACTAAGG-------TCTCTTATAAATTATATAGT---AGACTATCTCC-TTGTAACTGGCCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAATTCGATGATCTATCAGGA{GT}TTGTATCCTAAATAATGTTTC-----GAAC-ATTGATTTCAGATGCATTCTGATATAGGAGTTCAATATGTA-ATTGTTCTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TACTTATATTATCACAAATTTCCTAGGTGGACAATATCAGCAAAG????????????????????????????????????????????GTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCCCGACTTTGACGCTTATGTTGGTATGTCACTTTGCCACAGTGCCTAGTTGTTAGTACTTGAAGAA---TCGGCAGA----GCACTATTTTGTTGGTATAATATAGAGCATTGTCATTAGTGGC---GATTGCTATATATAGTAA----TCTACTTCTACATATGGCAAATGCTTCATAAATGAA--CTAACCTAACAAACAAAGCATCT----GATCGATAAGTCGAATAATGCACAAAACATACCGGACTCGAAATATACTCTTA-----CT-TCATGTGCAATTTTTGTT----GA-TACCT--TTTTTCAAGAAAAGAAAGAGGGAGAGGGGGGG--------------------------AGGGTGAGCCGCACCTGATTTAT-TGAAATAA----TGAGACAATCACATA-TGTT--GAGTCTCAT-----GTTCTTCAGATAGCAGAATATCCATTCTTTCTTTAGCACTCTTGGATTACTGACAGCTTG-TAGA--TTGTTGCCCTTGGCAGACCCACAGAAGCAATATGCTGATGCCGTAATCGAAGTTTTACCGACACAATTAATTCCTGGTGACAATGAAAGGAAGGTGCTGAGAGTTCGAATGGTGATTAAAGAAGGGGTGAAGTACTTCAATCCAGTTTACCTCTTCGATGAAGGCTCCAATG-TTTCAT-GGATA-CCTTG??????????????????????????????????????? Chambeyronia_macrocarpa ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGGTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGAATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCACATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGGG------------TTGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGATGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACCATTTTTACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATAGGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCTTTAAAAAA---TGCTTATTTTATCACAAA???????????????????????????????????????????????GAT-ATGGAAGGAACGTGGGCACAGTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATGGTTGTTAGTATTTGAAGAA---TTGGCAGA----GCACAAACTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGGTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCAAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTGTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTTGATGAAGG-TCCACTG-TT-CAT-GGATA--CCTGTGGG--AGGAAACTAAGCTGCC????????????????? Clinosperma_bracteale ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------CCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTTTCATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTGTATAATAATAGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATGCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAATTCCTAGGGGACCAA?????????????????????????????????????????????ACGTGGGCACAGTCCTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACGAATTTGTTGGTATTATATGGAGCAATGTCATTAGTCTT---GATCGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACGAAACATACTGGACTGACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGG------------------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAACGTACGAGACAATTAGATA-TGTC--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACG--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCGGATGACGATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGAGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AG??????????????????????????????? Clinostigma_savoryanum ????????????????????????????????????????????????CTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTAAGCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGGTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTATCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTC-AATTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------TATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTAGAATCCTGCTATTTGAAATCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-ATTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACAAGTGTCTTGTAAGTTATTCGGATGATCCTAAACTTGTATTAAGTTTCAAGGCATACTATTTGGACTGAGG-------TCTCTCCTAAATTATATAGT---AGACTGTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTAACAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------CTGTAATTTCCCCATTACAAAAAA-TGCTTATATTATCACAAA??????????????????????????????????????????????TGAT-ATGGAAGGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGCGCCTAGTTGTTAGTATTTGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTTATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAGA--CTAACCAAAATAACCAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGG-----------------------------AGGGCTAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCCTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTGATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGGAT????? Cyphokentia_macrostachya ?????????????????????????????????????GGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----GCACAGAGGAG------------CCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAG-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTAAGG-------TCTCTCCTAAATTGTATAATAATAGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTGGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAATTTCCTAGGGGAC???????????????????????????????????????????????ACGTGGGCACAGTCTTGAGAGCATCAAAGCTAGCATCGAAGCCCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCACAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATCGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCCTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATGTGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCGGATGACGATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGGTGAAAGAAGGAGTGAAATACTTCGATCCAGGTTACCTCTTCGATGAAGGGT???????????????????????????????????????????????????????????????? Cyphophoenix_nucele ????????????????????????????????AAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGC-TTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTACTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTT-GAGGGG-CG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATCATCCTGCTATTTGAAGTCTACTTTAG----CTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGATAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCCGGAGTTCCATCCTAAATGATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACATA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAATTTCCTAGGGGCCCAA???????????????????????????TTGTGAT-ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCTTAGCGCATAGTTATTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAT--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATGCTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCATCTGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCATGGGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATTACCCCTGGAAATA Cyphosperma_balansae ???????????????????????????GGGGGAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTTGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACGT--CATACCTGGATTTT-ATTTTAA-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAA--ATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAATT-CCTAGGGGACCAATCA????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCAAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT{AG}GAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAATA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAAAGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTTGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Cyrtostachys_renda ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATATAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACAAGCGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATTAAGTTTCAAGACATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAGT---AGACTATCTCC-TTGTAACTGACTTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTTAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGC??????????????????????????????????????????????????????????????????????????????????????GTCTCGAGCACATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGCGCCTGGTTGTTCGTATTCCAAGAA---TTGGCAGA----GCACAAATTTGTCTGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAGTATCTACGAAATGCTTCATAAAAAAA--CTAACCAAACCAACAAAACATCT----GATCAATAAGTAAAATAATGCACAAAACATACTGGACTGGCAATGTAATATTA-----CT-TCATGTGCAATTTTTTT-----GGTTACCT--TTTTTCAA---AAGAAAGAAAGAGGGTGGGGGGGGGGGCG------------------AGGGCGAGCCACACCTGATTCAT-TGAGGCAA----TAAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCATTCTTGGATTGCTGACAGCTTA-CACA--TTACTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Deckenia_nobilis ??????????????????????????????????????????????????????????????????????????????????????????????????????????GAGGAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTTCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGCAAGGTTGCTTTTG-TTCGGC---TCCAGGAGAAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATCAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATAACTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTTTATAAAGTTTCAAGGCATACTATTTTGACACAGG-------TCTCTCCTAAATTATATATT---AGACTATCACT-TTGCAACTGACATG-------------------------------------------------------------------------------------------------------------------------TGACTTGCGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATATGTA-ATTGTACTT----------------------------------------------------------------------------------TGGTAATTTG????????????????????????????????????????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAACTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTTACTTTGCCACGGCGCCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GAGTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATGAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTGATATTA-----CT-TCATGTGCAATTTTTTT-----GG-TACCT--TTTTCCCA---AAGAAAGAGGGGGGGTGGGGGG-------------------------------------AACTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGATCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TT{AT}CAT-GGATA-CCCTG??????????????????????????????????????? Dictyosperma_album ?????????????????????????????????????????????????????????????????????????????????????????TCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAAGTT-------------------------------------------------------------------------------------GCTAT-AAACGCTGGAGC-TTTTTGCTTATTCAGTTTAAGAATTCCAA--------GACACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGGCTAGCTAAAAGACA-TTGTTGATAGCTTGTACAAAAACATATGGTTATTCAATTTGCATTACCATTAAGGA--TGTAC--------AGTTT-AATAAATATGTTTGAGAA-----ACACAGGGAAG------------TCGTCT---AGAACCCTTC-AACTT--CATTCCTGGATTTT-ATTTAAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTCGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTGAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATATATCAGGAGCTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-AT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTCGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGCACCTAGTTGTTAGTATTTGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGACCGATGCCATTAATCTT---GATTGCTGAATATAGTCA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATATGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTCTTTTT----AG-TACCT--TTTTTCAA---AAGAAAGAG--------------------------------------------AGCCACGCCCGATTCAT-CGAGACAA----TGAGACAATTGGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGAAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGCAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Drymophloeus_litigiosus GCATCATGGGAAAGGTTGCTGCCCATATGGGAAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGG-G------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTAAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTAAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTATCCATTAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG???TGAT-ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATGGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATCATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CATGATTCAT-TGAGACAA----TGAGACAATTAGATG-TGTT--GAGTCTCAT-----GTTCTTTTGATAACAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGACGACAATGAAAGGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? Dypsis_lutescens ????????????????????????????GGGAA-GGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATGGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GTCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGCGGAAGGAATA---TTTGCATATGTCTAGCTAAAATACA-TTGTTGACAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGCA-----ATGCAGGGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTCGGACTT-CATATTTT---CCTCTGAATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTCAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAGCTTGTATGAAGTTTCAAGACATACTATTTTGACTGTGG-------TCTCTCCTAAATTATACAAT---AGACTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCAAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATATTATCACAAATTTCCTAGGTGGACAATAC????????????????????????????????????????????????????GTCTGGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGAGCCTAGTTGTTAGTATTCGAAGAA---TTGGCATA----GCACAAATTTGTCGGTATAATATGGAGGAATGTCATTAGTCTT---GATTGCTGAATATGGTAA----TATACTT--------------------ATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--ATTTTCAA---AAGAAAGAGGGAGGTTGGGGGGG------------------------AGGGCGAGCCACACCTGATTCAT-CGAGACAA----TGAGACAGTTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAACTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Geonoma_deversa ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTTTTTTTTTTTGTTTTTTGAGGGGG-G-------CACTTGCCTTTAGAGTT-CATATTTTTTTCCTTTGGATTAGTTAA-TTATAATCCTGTTATTTGAAGTCTACTTTAAATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACC--GT-------AACGTGGCTTTGAAGAATGACTTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGACATACTTTTTTGACCGATC-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCTATCAGGAGTTCTGTCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATAGGTA-ATGGTACTT----------------------------------------------------------------------------------TTATAATTTCCCCATTACAAAAAA-TGCTTATATTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGCACCTAGTTGTTAGTGCTCGAAGAA---TTGGCAGA----GCTCTAATTTGTCGGTATAATATAGAGCAATGTCATTAGTCTT---GATTGCTGA-TATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCTAACTA--------TCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATATAATATTA-----CT-TCATATGCAATTTTTTT-----GG-TACCT-GTTTTTCAA---TAGAAAG----------------------------------------------------------------------------------AATTAGATA-TGTC--GAGTCTCAT-----GTTCT---AATACCAGAA--TCCACTGT--CTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCTGCAGAAGCAATATGCTGATGTTGTAATCGAAGTGTTACCGACACAATTAATTCCTGATGACAATGAAAGGAAAGTGCCGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCAGTTTTCCTCTTCGACGAAGGCTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAA??????????????????????? Hedyscepe_canterburyana ????????????????????????????????????????????????CTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACCT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTACGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCTTCCAATTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTT-------CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTATGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCC?????????????????????????????????????????????????????????????????????????TTGTGAT-ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATGGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCAAAGTTTTGCCGACGCAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCATGGGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATTACCCCTGGAAATA Heterospathe_cagayanensis ??????????????????????????????????????????ATGCCACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAATCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTAAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTGGTATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTAACAA-----ACAT--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACGGAAATGTGGCTCTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAATTT????????????????????????????????????????????????ATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCAACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCCT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCT??????????????? Heterospathe_delicatula ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTCAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACTGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACCATTTTGACTGAGC-------TCTCTCCTAAACTATATAAT---AAACT--CTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAATT???????????????????????????????????????????TGTGATATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCGAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTACGTCACTTTGCCATGGTGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTGTAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATGCAT-CGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCGGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCCGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGGAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCCT???????????????? Heterospathe_elata_Chapin_55 ???????????????????????GCATGGGGGAA?GAGGGAGATGCTACTCCTTTTACTGATCTCACGGTAAGTAAATCCATAGAATCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTAAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTGGTATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTAAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACGGAAATGTGGCTCTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAATTCCTAGGGGACCAA????????????????????????????TTGTGAT-ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGATCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCTTACCCTGGGAATAA? Heterospathe_elata_Houg_Hubb_1024 ???????????????????????????GGGAAAGG-AGGGAGATGCTACTCCTTTTACTGATGTCACGGTAAGTAAATCCATAGAATCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTAAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTGGTATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTAAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACGGAAATGTGGCTCTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAG-TGCTTATATTATCACAAATTT????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGATCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Heterospathe_elata_Lewis_99034 ????????????????????????????????????????????GCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAATCTCCATGCAACCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTAAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTGGTATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTAAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACGGAAATGTGGCTCTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAATTTGCCTAGGTGG???????????????????????????????TGTGATAATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGATCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCCT???????????????? Heterospathe_humilis ??????????????????????????????????????????????T-CTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGC--ATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTCAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACTGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACCATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACT--CTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAATTCCTAGGGGACCAA????????????????????????????TTGTGATTATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTACGTCACTTTGCCATGGTGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTGTAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-CGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCGGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAACATGCCGATGTTGTAATCGAAGTTTTGCCGACACAATTAATCCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATTACCCCTGGGAATA Heterospathe_macgregorii ??????????????????????????????????????????ATGCTACTCCTTTTACTGATCTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCATAGTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATCATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAGGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGCTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGATCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTCGAAGAATGACCTTGGACGTGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAGTGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTCATATTATCACAAATTTC????????????????????????????????????????TGTGATCATGGAAAGAACGTGGGCACAGTCTCGAGTGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGC?????????????????? Heterospathe_philippinensis ??????????????????????????TGGGGGAAGGAGGGAGATGCTACTCCTTTTACTGATCTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGG{AG}GCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTAAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-{GT}CTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTTGCATTATCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CAT{AT}TGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACTGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATGGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAAATCCTAGGGGACCAATC??????????????????????????TTGTGATAATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTCGACTTTGATGCTTATGTTGGTATGTGACTTTGCCATGGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-CGAGACAA----TGAGACAATTAGATG-TGTC--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTGATTCCTGATGACGATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATTACCCTGGGAATAA Heterospathe_phillipsii ??????????????????????????????GGAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCGTGCAAGCTTTACCTGAGTAGCA-TTTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTTGCATTACCATTAAGGATTTATACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACGC--GGGAG------------TAGTCC---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACTGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTCAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAATTTCCAG????????????????????????????????????????????ATGGAAAG-ACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGGAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-{CT}GAGACAA----TGAGACAATTAGATA-TGTC--GAGTCTCAT-----GCTCTTCTGATATCAGAAA-TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCTA?????????????? Heterospathe_scitula ?????????????????????????????????????????????????????????????????????????????TCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTAAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTTGCATTATCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTTAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACTGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTCTAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATGGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCACCTAAAAAAA???????????????????????????????????????????????????????????????TTGTGATATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-CGAGACAA----TGAGACAATTAGATG-TGTC--GAGTGTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTGATTCCTGATGACAATGAAAGCAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGCTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATTACCCTGGGAATAA Heterospathe_sibuyanensis ????????????????????????????????????????????GCCATTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAATCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTAAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCT-GCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTGGTATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTAACAA-----ACAT--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACGGAAATGTGGCTCTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGC-------TCTCTCCTAAATTATATAAT---AAACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAACAAAATGCTTATATTATCACAAATTT????????????????????????????????????????????????ATGGAAAG-ACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCAACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCCT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCTTACCCTGGGAATAA? Heterospathe_sp_Baker_1115 ????????????????????????????????????????????GCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGCTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAAT{CT}CTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTCGAAGAATGACCTTGGACCTGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTCATATTATCACAAATT??????????????????????????????????????????TGTGATCATGGAAAGAACGTGGGCACAGTCTCGAGAGCATAAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCTATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCCT???????????????? Heterospathe_sp_Baker_1130 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTGTGAT-ATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTCGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACGATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGGTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATTACCCTGGGAATA? Heterospathe_sp_Baker_1142 ??????????????????????GGCATGGGGGAAGGAGGGAGATGCTACTCCTTTTACTGATCTCACAGTAAGTAAATCCATAGAACCTCCCCCCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGCTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTCGAAGAATGACCTTGGACGTGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTCATATTATCACAAATTCCTAGGGGACCAATC???????????????????????????TGTGAT-ATGGAAAGAACGTGGGCACAGTCTCGAGAGCATAAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATTACCCTGGGAATA? Heterospathe_sp_Banka_2008 ??????????????????????????????????????????????TACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGCTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTCGAAGAATGACCTTGGACGTGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTCATATTATCACAAATTCCTAGGGG?????????????????????????????????TTGTGAT-ATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTCGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCAATTTTTTTTT---GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGGTTGGTGATGAAAGAAGGGGTGAAATACTTTGATCCGGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCTTACCCTGGGAATA?? Heterospathe_sp_nov_Fernando_1624 ????????CAGGAGGTTGCTGCCCATATGGGAAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAATCTTTACCTGAGTAGCA-TG---AAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGTTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATTTGTCT-GGTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTCATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TAGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTGCTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACTGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTGAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGGGC-------TCTCTCCTAAATTATATAAT---AAACTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTTGGTTTTCCAGTTCAATGATCTATCAGGGGTTCCATCCTAAATAATGTTCC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAAA-TGCTTATATTATCACAAAT??????????????????????????????????????????TTGTGATATTGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCCAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTCGCCATAGTGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAGATTTGTTGGTATAATAT-----------------------------------------------TACTTC------------------------------------------------------------------------------------------------------------------------ATGTGCATTTTTTTTTTT--GG-TA----------------------------------------------------------------------------CCTGATTCAT-CGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCCT-----GCTCTTCTGATATCAGAA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCTGATGACGATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCGGTTTACCTCTTCGATGAAGGATCCACTG-TTTCAT-GGATA-CCCTGGGGG--AGGAAACTAAGCTGCTCT??????????????? Howea_belmoreana ????????????????????????????????????????????????CTCCTTTT-CTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACGT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTTC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAAATTATAATCCTGCTATTTGAAGTCTACTTTAGATATTTTTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGGCAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAGCTTGTATAAAGTTTCAAGGCATACTATTTTGACTAAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTGGCATACTATTTTGACTAAGGTCTCTCCTAAATTATATAATAGAC--------------------------------------------------------TATCTCCTTGTAACTGACCTGTGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTTTTGTGAGTTCCATCCTAAATAATGTTTCTAACATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTAATTGTACTTTTGTAATTTCTCCATTAAAAAAA--TGCTTATATTATCACAAA????????????????????????????????????????????????????????????????GGGCACAGTCTCGAGAGCATCAAATCTAGCATCGAAGCTCGAAAGCTTGACTTCCATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGCA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCGATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACGTACCGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGAAGCTTGGGGGGGGG----------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGT???????????????????????????????????????????????????????????????? Hydriastele_beguinii ??????????????????????????????????????GGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGATCCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTACTTATTCAGTTTAAGAATTCCAA--------GGCAATGTATCTGATGTTAAAGAA----------------------------CATTCTGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TATGC--ATGTCTAGCTAAAAGACA-TTGTTGATAGCTTACACAAAAGCACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATTTGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CACATTGT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTAGTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGGAATGTGGCTTTGAAGAATAACCCTGGACGACTGTCTTGTAAGTTATTCTGATGATGCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTGACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCCATCAGGAGTTCCATTCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACGGAAAA-TGCTTATATCATCAC??????????????????????????????????????????????????????ATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTTACTTTGCCACAGTGTCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATTTGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATTT----GATCAATAAGTCAAATATTGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TATCT--TTTTTCAA---AAGAAAGAGGGA------------------------------------------------CCTGATTCAT-------------TGAGAGAATTAGATA-AGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTGGCACACTTGGATTGCTGACAGCTTA-TACACATTGCTATCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACCA-TTTCAT-GGTTA-CCC????????????????????????????????????????? Hydriastele_brassii ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGATCCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCCGGAGCTTTTTTACTTATTCAGTTTAAGAGTTCCAA--------GGCAATGTATCTGATGTTAAAGAA----------------------------CATTCTGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTACACAAAAGCACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CACATTGT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTAGTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAAACAGAAATGTGGCTTTGAAGAATAACCCTGGACGACTGTCTTGTAAGTTATTCTGATGATGCTAAACTTATATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTGACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCCATCAGGAGTTCCATTCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACGGAAAA-TGCTTATGTC???????????????????????????????????????????????????????????ATGGAA-GAACGTGGGCACAGTTTCGAGAGCATCAAAACTAGCATCGAAGCT-GAAAGCTTGACTTCGATGCTTATGTTGGTATGTTACTTTGCCACAGTGTCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAACTTGTCGGTATAATTT--------GTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATTT----GATCAATGAGTCAAATATTGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TATCT--TTTTTCAA---AAGAAAGAGGG------------------------------------------------ACCTGATTCAT-------------TGAGACAATTAGATA-AGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTGGCACACTTGGATTGCTGACAGCTTA-TACACATTGCTATCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACCATTTTCTT-GGAT--CCCTGTGGG--AGGAAACTAAAGACTGCTCATACCCTG?????? Hydriastele_costata ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGATCCTTCATGCAAGGTTTACCTGAGTAGCA-TGTTTCAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCGGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCAATGTATCTGATGTTAAAGAA----------------------------CATTCTGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTACACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACGGGAGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-GTTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGTCTTTGGAGTT-CACATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTAGTTTAGATATCTCTTTTGAAGCTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATAACCCTGGACGGCTGTCTTGTAAGTTATTCTGATGATGCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCCATCAGGAGTTCCATTCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTTCTGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACGAAAAA-TGCTTATATCATCACAAATTTTCTAGGGGACAATATCAGC????????????????????????????AAT-GAAAG-ACGTGGGCACAGT-TCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTTACTTTGCCACAGTGCCTAGTTATTAGTATTTGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATGTGGAGCAATGTCATTAGTATT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAATAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATATTGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTT-----GGGTACCT--TTTTTCAA---AAGAAAGAGG-------------------------------------------------ACCTGATTCAT-------------TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTGGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTATCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACCG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAA---CTGCTCATACCCT??????? Hydriastele_microspadix ???????????????????????????????????GAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGATCCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTACTTATTCAGTTTAAGAATTCCAA--------GGCAATGTATCTGATGTTAAAGAA----------------------------CATTCTGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTACACAAAAGCACAAGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATTTGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CACATTGT---CCACTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTAGTTTAGATATCTCTTTTGAAGTTTTTGATATGTAA-GTTTACCCTGTAGACAGGAATGTGGCTTTGAAGAATAACCCTGGACGACTGTCTTGTAAGTTATTCTGATGATGCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTGACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCCATCAGGAGTTCCATTCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCTCCATTACGGAAAA-TGCTTATATCATCACAAACTTCATAGGTGGACGATATCA?????????????????????????????GAAGAAACGGTGGGCACCAGTTCCCCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTCGACTTCGATGCTTATGTTGGTATGTTACTTTGCCACAGTGCCT{AG}GTTGTTAGTTTCTGAAGAA---TTGGCAGA----GCACAAATTTGTC{AG}GTATAATATGGAGCAATGCCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAAAGCTTCATACAATAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATATTGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTT-----GGGTACCT--TTTTTCAA---AAGAAAGAGG-------------------------------------------------ACCTGATTCAT-------------TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACAATTTCTTTGGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTATCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACCG-TTTCAT-GGATA-CCCTGTGGGGAAGAAAACTAAGCTGCTCATACCCCTG??????? Iguanura_wallichiana ???????????????????????????????????GAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAGATCCATAGAACCTTCATGCAGGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGTTGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTAC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAG-----ACGCCGAGGAG------------TCTCCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAATT-CATATTTT---CATCTGGATTAGTTAA-TTATAATCCTGCTATTCGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAAAGTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAATTTGTATAAAGTTTCAAGGCATACT---------GAGG-------TCTCTCCTAAATTATATAAT---AGACT--CTCC-TTGTAACTGACCTA-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTGTCCAGTTCCATGATCTATCAGGAGTTCCATCTTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAGAAAA-TGCTTATATTATCACAAATTTCCTA????????????????????????????????????????????????????????????????GTCTCGAGAGTATCAAAGCTAGCATCAAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACGTTGCCACAGCACCTAGTTGTTAGTATTCGAAGAA---TTGACAGG----GCACAAATTTGTCGGTATAATATGAAGCAATGCTA{GT}TAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAAAACTAACCAAACTAACAAAGCATCT----GATCAACAAGTCAAATAATGCACAAAACATACTGGACTAAAAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TAACT--TTTTTCAA---AAAAAAGAGGAAGTGTGGGGGGG------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAG----TGAGACAATTAGATA-TGTC--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TCGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCTGACACAATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGAGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Kentiopsis_oliviformis ?????????????????????????????????????????????CTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACTTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCACATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGGG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGTTTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCGTGTAGACTGAAATGTGGCTTTGAAGAATGACCTTGGATGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACCATTTTTACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAT-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCTTTAAAAAA---TGCTTATTTTATCACAAATTTACTAGG??????????????????????????????????????????????????????????????GTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTTGAAGAA---TTGGCAGA----GCACAAACTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGGTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCAAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTGTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGCAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Laccospadix_australasicus ?????????????????????????????????????????????????????????CTGACCTCACGGTAAGTAAATCGATAGAACCTTCCTGCAAGCTTTTCCTGAGTAGCA-TGTCACAATTTAACGT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTTC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGTTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ATACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---C{AC}TCTGGATTAGTTAA-TTATAATCCTGCTATTTGAATTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGGCAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCAATGATCCTAAACTTGTATAAAGTTTCAGGGCATACTATTTTGACTAAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTGGCATACTATTTTGACTAAGGTCTCTCCTAAATTATATAATAGACTATTTTGACAAGGCATACTATTTTGACTAAGGTCTCT{AC}CTAAATTATATAATAGACTATCTCCTTGTAACTGACCTGTGACTTGGGTTTTCCAGTTCAATAATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-AGGGTACTT----------------------------------------------------------------------------------TTGTAATTTCTCCATTAAAAAA?????????????????????????????????????????????????????????????????????????????????????????????????GAGAGCATCAAATCTAGCATCAAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGCA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCGATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACGTACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGAAGCGTGGGGGGG------------------------TGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTCAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG?????????????????????????????????????????????????????????? Lavoixia_macrocarpa ????????????????????????????????????????????GCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------CCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTCTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTCTTTTGACTAAGG-------TCTCTCCTAAATTGTATAATAATAGACTATCTCC-CTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTCC-GATATA-TCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTCCCCCATTAAAAAAA?????????????????????????????????????????????????????????????????????????????????ACGGGGCACAGTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACCTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACGAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATCGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACGAAACATACCGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAG----------------------------------------AGGGAGGGCCACACCTGATTCAT-TGAGACAA----CGAGACAATTAGATA-TGTG--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCGGATGACGATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGAGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTC???????????????? Lemurophoenix_halleuxii ????????????????GCTGCC-ATATGGGAA-GG-AGGGAGATGCT-CTCCTTTTACTGATGTCACAGTAAGTGAATCCATAGAACCTTCATGCAAGCTTTACCTGAATAGCA-TGTCGCATTTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GTCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGC?TATACAAAAACACATGGTTATTCAGTTTGCATTACC?TTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACGCAGGGGAG------------TAGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTATTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTGTGAATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTCTGAAGTTCTTGATATGTAA-GTTT?CCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGCCTCTCTCC-TTGTAACCGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTGGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAACCATTGATTTCAA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGCGCCTGGTTGTTAGTTTTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA---ATATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAGACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTGACAATGTAATATTA-----CT-TCATGTGCAATTTTTTT-----GG-TACCT--TTTTTCAA---AAGAAAGAGGG------------------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAACATGCTGATGTTGTAATCGAAGTTTTGCCAACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Leopoldinia_pulchra ????????????????????????????????????????AGATGCTACTCCTTTTACTGATGTCACAGTAAGCAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGAAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTATTAAATGCTGGAGCTTTTTTG----TTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGATGTTAAAAAA---------------------------ACATTATGAAAAGTTTCTTCTG-TTCTGC---TTCAGGAGGAAG---TAATTTTTGTATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACGAAAACACATGGTTATTCAATTTGCATTACCTTTAAGGATTTGTACTATATAT-GGTTT-AATAAATATGTTTGAGAC-----ACACAAGGGGG------------TCGTCT---AGAACACTTC-AACTT--CATACCTGGATTCT--TTTTTTTTTTTTTTTTTCCTTTTTTTTTTTTGAGGGG-AC-------CATTTGCCTTTGGAGTT-TATATTTT---CCCCTGGATTAGTTAA-TCATAATTCTATT-TTTGAAGTCCACTTTAAATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAACGTAGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGGTGATCCTAAACTTGTATAAAGTTTCAAGACGT--TATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGAC-GTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCTCTCAGGACTTCCATCCTAAATAATGTTTC-----TAAC-ATCGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTT-TTTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATATTATCACAAATTTTCTAGGTGGACAATATCA????????????????????????????????????????????????????????????CAC-AAAGCTAGCATCGAAGCTCGAAAGCTCGACTTTGATGCTTATGTTGGTATGTCACCTTGCCACAGCACCTGGTTGATAGTACTCGAAGAA---TTGGCAGA----GCACTAATTTGTCGGTATAATATAGAGCAATATCATTAGTCTT---GATTGCTGAACACAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAATA--CTAACCTAACTAACAAAGCATCT----GATCAGTAAGTCAAATAATGGACAAAACACACTGGACTAACAATATAATATTA-----CT-TCATGTGCAATTTTTTT-----GGGTACCT--TTTTCCAA---AAGAAAGAGAGAGAGTTGGTGGGGGGGGGGGGGGG------------GGGGCAAGGCCCACCTGATTCAT-TGAGATAA----TGAGACAATTAGATA-TGTTAAGAGTCTCAT-----GTTCTTCTGATATCAGAA--TCAACTATTACTATAGCACTCTTGGATTGCTGACAGCTTA-TATATGTTGCCACCCTTGGCAGACCCGCAGAAGCAATATGCTGATGTTGTAATGGAAGTTTTACCGACACAATTAATTCCCGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAGTCCAGTTTACCTCTTTGACGAAGGCTCCACTC-TTTCAT-GGATATCCCTGGGAG--A???????????????????????????????? Lepidorrhachis_mooreana ?????????????????????????????????????????????????????????CTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGCTGCTTCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATAAAA-AACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAATCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCATGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTT-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ACTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAA????????????????????????????????????????????????????????????????????????????????????????????????????????GAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATTGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGAAATATTA-----CT-TCATGTGCAACTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCA????????????????????????????????????????????????????????????? Linospadix_albertisiana ???????????????????????????????????????????????????????TACTGATGTCACAGTAAGTAATATTATAGAACCTTCATGCAACCTTTACCTGAGTAGCA-TGTCACAATTTAACGT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGGATTC-GA--------GGCACTGTTTCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTTC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAAGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTGCCCTGTAGGCAGAAATGTGGCTTTGAAGAATGACCTTGGACAAGTGTCTTGTAAGTTATTCCGATGATCCTAAGCTTGTATAAAGTTTCAAGGCATACTATTTTGACTAAGG-------TCTCTCCTAAATTATGTAAT---AGACTATCTCC-TTGTAACTGACCCGGCATACTATTTTGACTAAGGTCTCTCCTAAATTATATAGTAGACTATTTTGACATGGCATACTATTTTGACTAAGGTCTCTCCTAAATTATATAATAGACCATCTCCTTGTGACTGACCTGTGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCTCCATTAAAAAAA--TGCTTAT?????????????????????????????????????????????????????????????????????????ACGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGTGCATAGTTGTTAGTATTCGAAGCA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGCAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGGATCT----GATCAATAAGTCAAATAATGCACAAAACGTACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAAATTTTTTT----GG-TACCT--TTTTTCAA---AAGAATGAGGAAGCGTGGGGGGG------------------------AGGGCGAGCCACAGCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAA-CTAGCGC???????????????????? Loxococcus_rupicola ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTAAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTCTCTGATGTTAAAGAA----------------------------CATTTTGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATCAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTTA---AGAATCCTTG-AACTT--CATACCTGGATTTT-ATTGTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATGTT---CCTCTGGATTAGTTAA-TTATAATCCTGATATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCAACGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCTGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTTAGATGTATTCTGATGTAGGAGTTTAATACATA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCTATTACAAAAAA-T???????????????????????????????????????????????????????????????????AATGGAA-G-ACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTAGTTAGTATTTGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATGATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAAAGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGCACTAACAATGTAAT-TTA-----CT-TCATGTGAAATTTTTTTT----GG-TACCT---TTTTCAA---AAGAGAGAG-------------------------------------------------------------------------------------------GTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAACACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACGCAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCAT?????????????? Manicaria_saccifera ???????????????????????????????????????GAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTGCATGCAAGCTTTACCTGAGAAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAACTTTTTAGCTTATTCAGTTTAAGAATTCCAA--------GGCACCGTATCTGATGTTAAAGAA----------------------------CATTAAGGAAAGGTTCTTTTG-TTCTGC---TTCAGGAGGAAG---TAATTGTTGCATATGTGTAGCTAAAGGGCA-TTGTTGATAGCTAATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-GATAAATATGTTTGAGAA--------CTGGCGG-------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTT-----------------------TTTTGAGGGG-AG-------CTTTTGCCTTTGGAGTT-CATATTTT---CGCCTGGATTAGTTAA-TTATAATCTTGTTATTTGAAGTCTACTTTGAATATCTCTTTTGGAGTTCTTGATATGTAA-GTTTACCCAGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGCCTCTTGTAAGTTATTCTGATGATCCTGAACTTGTAT-AAGTTTCAAGACATACTATTTTGACTTAGG-------TCTTTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAATTCAATGATCTATCAGGAGTTCTATCCTAAATAATGTTTC-----TAAC-GTTGATTTCAGATATATTCTGATGTAGGAGTTTAATATGTA-ATTGTACTT---------------------------------------------------------------------------------CTTGTAATTTCCCCATTACAAAGAAA-GCTTATATTATCACAAATTTCCTAGGTGGACACATATC??????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAATCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGCGCCTAGTTGTTAGTACTTGAAGAA---TTGGCAGA----GCACTAATTTGTCGGTATAATATAGAGCAATGTCATTTGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCTAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACCAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-CACCT--TTTTTCAA---AAGAAAGAGGGAGAGTGGGGGGGG-----------------------AGGGACAGCCCCACCTGATTCAT-TGAGATAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCAGTATTTCTTTATCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCGTTGGCAGACCCGCAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTACCGACACAATTAATTCCTGATGATAATGAAAAGAAGGTGCCGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCAGTTTACCTGTTCGATGAAGGCTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Marojejya_darianii ??????????????????????????????????GGAGGGAGATGCTACTCCTTTTACTGGTGTCACAGTAAGTAAATCCATGGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GTCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGCGGAAGGAATA---TTTGCATATGTCTAGCTAAAATACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ATGCAGGGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGAATTAGTTAA-TTATAATCCTTCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACAAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATATTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGACGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAG-TGCTTATATTATCACAAATTTCCTAGGTGGACAAATC????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGACACGGAGCCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGACATTAGTCTT---GATTGCTGAATATAGTAA----TATACTT--------------------ATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTATTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGG------------------------------------AGGGCGAGCCACACCTGATTCAT-GGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGAAATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Masoala_madagascariensis ?????????????????????????????????????????????????????????????????????????????TCCGTAGAACCTACATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTACGAATTCCAA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGCTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCATCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCAATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTCTATCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCGCCATTACAAAAA--TGCTTATATTATCACAAAT??????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCCCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGAGCCTAGTTGTTAGTATTGGAAGAA---TTGGCAGA----GCACAAAGTTGTCAGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCGATAAGTTGAACAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CTTTCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGAAGGGTGGGAGGG------------------------AGGGCAAGCCACACCTGATTCAT-CCAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----G---TTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTC-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCCGACGTTGTAGTCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Moratia_cerifera ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTATGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------CCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACAAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTAAGG-------TCTCTCCTAAATTGTATAATAATAGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCATAAATTACCTAGGGGCCCAA???????????????????????????????????????????????????CACAGTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATCGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCCTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCGGATGACGATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGAGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Nenga_pumila_var_pachystachya ?????????????????????????????????AGGAGGGAGATGCTACTCCTTT-ACCGATGTCACAGTAAGTAAATCCAT{AG}GAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGATGGAGCTTTTTTTCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGTTGTTAAAGAA----------------------------CATTATAGGAGGTTGCTTTTG-ATCTGC---TCCAGGAGGAAGGAATA---TTTGCATATATCTAGCTAAAAGATA-TTGTTAATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAGATATGTTTGAGAA-----ACAC-GGAGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGGGAG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTGTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGTTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAATTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCT-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATATGTA-ATTGCACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATCACAAAAA--TGCTTATCTTATCACAAATTTCCTAGG??????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACGGCGCCTAGCTGCTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTTGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAAAACTAACCAAACTAACAAAGCATCC----GATCAATAAGTCAAATAATGCACAAATCATAGTGGACTAGCAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT-----TTCGA---AAGAAAGAGGGAGCGTGTGTGGGGGGG--------------------AGGGCGAGCCACACCTGATTCAT-TGTGACAA----TGAGACAATTAGATA-TGTT--GAGCCTCGT-----GTTCTTCTGATATCAGAA--TCCACTACTTCCTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACCG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Neonicholsonia_watsonii ????????????????????????????????????????????????CTCCTTTTACTGATGCCACAGTAAGTAAATCCATAAAACCTTCATGC?AGCTTTACCTGAGAAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AGATGCTGGATCTTTTTTGCTTATTCAGTTTAAGAATTTCAA--------GGCACTCTATCTGATGTTAAAGAA----------------------------CATTATGGAAAGTTTCTTTTG-TTCTGC---TCCAGGAGGAAG---TAATTTTTGC--ATGTCTAGATAAAAGACA-TTGTTCATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGCA-----ACACAGGAGGG------------CCATCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTA----------------TTTATTTTTTGGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGTTATTTGAAGTCTACTTTAAATATCTCTTTTGAAATTCTTGATATGTAA-GTTTACCCTGTAGACAGAAACGTGACTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCGTAAACTTGTATAAAGTTTCAAGACATACTATTTTGACTGAGG-------TCTCTCCTAAATTATGTGAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCTGTCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-TTTGATTTTAGATATATTCTGATTTAGGAGTTTAGTACGCA-ATCGTGCTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAA??AATGCTTATATTATCACAAA????????????????????????????????????????????????????????????ACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGCGCCTAGTTGTTAGTACTCGAAGAA---TTGGCAGA----GCACTAATTTGTCGGTATAATATAGAGCAATGTGATTAGTCTT---GATTGCTGAATA-AGTAA----TATACTTCAATATCTACCAAATGTTTCATAAAAAAA--CTAACCTAAGTAGCAAAGCATCT----GATTAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATATAATATTA-----CT-TCATGCGCAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAAAGAGGG----------------------------------------------------CATTCAT-TGAGATAA----TGAGACATTTAGATA-CGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCGCAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTACCCACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGCGAAATACTTCAATCCAGTTTACCTCTTCGACGAAGGCTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAGCT????????????????????? Neoveitchia_storckii ?????????????????????CC-ATATGG--AAGGAGG-AGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGCACCTTCATGCAAGCTTTACCGGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTATGC---TTCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGGCA-TTGTCGATAGCTTATACAAAAACACGCGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCTAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTT-GATTGAGG-------TCTCTCCTAAATTATATAAT---AGACTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTACCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATCCGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATA-TATCAC???????????????????????????????????????????????????????????????ACGTGGGCACGGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTCGACTTCGATGCTTATGTTGGTACGTCACTTTGCCATAGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGCCATCAGTCTT---CATTGCTGAATATAGTAA----TACACTTCAATATCTACCGAATGCTTCATAAAAAAA--CTAACCAAACT---------------------------------------AAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTCTTTT----GG-T----------------------------------------------------------------------------ACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTC--GAGTCTCAT-----GTTCTTCTGATATCGGCA--TCCGGGATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TAGA--TTGCTACCCTTGGCAGACCCGCAGAAGCAATATGCTGACGTCGTGATCGAAGTTTTGCCGACGCGATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCC?????????????????????????????????????????????????????????????? Nephrosperma_vanhoutteanum ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAT-AAATGCTGGAGCTTTTTTGCTTATTC?GTT??AAAATTCCAA--------GG?ACTATATCTGATGTTGAAGAA----------------------------CATTATGGAAGGTTGCCTTTG-TTCCAC---TCCAGGAGGGAGGAATA---TTTGCATGTGTCTAGCTAAAAGACA-TTGTTGATATCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACC--GGAG------------TCGTCT---AGAACCCTTC-AACCT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---TCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGTTATCTCTTTTGAAGTTCTTGAGATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGGGTGTCTTGTAAGTTGTTCCGATGATCCTAAACTTGTATAATGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCTTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATAATCTATCAGGAGTTCCATCCTAAATAATGTTAC-----TAAC-ATTAATTTCAGATATATTC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGTGAGCATCCAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGCACCTAGTTGTTAGCATTCGAAGAA---TCGGCAGA----GCACAAATTTGTCGGTATAATATGGATCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTGACAATGTAATATTA-----CT-TCATGTGCAATTTTTTT-----GGGTACCT--TGTTTCAA---AAGAAAGAGGGAGGGTGGGGG--------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCGTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGATCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTTGATCCAGTTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Normanbya_normanbyi ?????????????????????????????????????AGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTG-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCTAGGATGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGG-G------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTAAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGCTCCATCCTAAATAATGTTTC-----CAAC-ATTGATTTCAGATATATTCTGATATAGGAGTTAAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCTCCATTAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGAC?????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATGTCTACCAAATGGTTCATAAAAAAA--CTAACAGAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-T----------------------------------------------------------------------------ACCTGATTCAT-TGAGACGA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATAACAGAA--TCCACTATTTCTTTAGCACTTTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGACGACAATGAAAGGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Oncosperma_tigillarium ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAACTTTCGAAGGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TTCAGGAGGAAGGAATA---TTTGCAGATGTCTAGCTAAAAGACA-TTGTTCATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-GATAAATATGTTTGAGAA-----ACACGGGGTAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTTA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATTTCTTTTCTAAAGTTCCTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGATGAGTGTCTTGTAAGTTATTTCGATGATCCTAAACTTGTCTAA-GTTTCAAGGCATACTATGTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACCATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAATTCAATGATATATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATACATTCTGATGTAGGAGTTTAATGGGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCC?????????????????????????????????????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTCGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGCGCCTAGTTGTTAGTATTCGAAGAAGAATCGGCAGATCGAGCACAAATTTGTCGGTATAATATGGAGCAATGTCATCAGTCTTTTTGATTGCTGAATATAGTAATTAATATACTTCAATATCTACCAAAGGCTTCATGAAAAAA--CTAACCAAACTAACAAAGCATCC----GATCGATAAGTCGAATAATGCACAAAACATACTGGACTAACGATGTAATATTA-CTTACT-TCATGTGCAATTTTTTTT----GGTTACCT--TTTTTCAA---AAGAAAGAG----------------------------------------------CCGCACCTCATTCAT-------------TGAGACAATTAGATAATGTTA-GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACCATTTCTTCAGCACTCTTGGATTGCTGACAGCTTAATACA--TTGCTACCCTTGGCAGACCCGCAGAAGCAATATGCCGATGTTGTAATCGAAGTTTTGCCGGCACAATTAATTCCTGATGACAATGAAAGGAAGGTGCCGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Pelagodoxa_henryana ????????????????????????????????????????????GCTACACCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGAAGCG-TGTCACTATTTAACTTGCTATGAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAAGGCGCTGTATCTGATGTTATGAATGCTGGAGCTTTTTTGCTAT-GAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCGCTGTATCTGATGTTAAGGAA----------------------------CATTATGGAAAGTTTTTTTTG-CTCCGC---TCCAGGAGGAA---ATAATTTTTGC--ATGTCTAGCTAAAAGGCA-TTGTTGATAGCTTATACAAAAACACATGCTTATTCAATTTGCATTACTATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAAGGGGGG------------CGTCT---AGAACCCTTC-AACTT--CATACCTAGATTTT--TTTTTA---------------------------GGGG-AGTATTTAGTATTTACCTTTAGAGTT-TGTATTTA---CCCCTGGATTAGTTAA-TTATAATCCTGTTATTTGAAGTCTACTTTACATATCTCTTTTGATGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAACGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAGCTTGTATAAGTTTTCAAGACATACTATTTTGACTGAGG-------TATCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGCTTGATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAA--TGCTTATATTATCACAAATTT????????????????????????????????????????????????TAGGAA-GAACGTGG-CACAGTCTCGAGAACATCAAAGCTAGCATTGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGCGCCTAGTTATTAGTACTGGAAGAA---TTGGCAAA----GCACTAATTTGTCAGTACAATATAGAACAATGTCATTAGTCTT---GATTGCAGAATATAGTAA----TATACTTCAGTATCTATCAAATGCTTCATAAAAATA--CTAACCTAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTTGACTGTCAATATAATATTA-----CT-TCATGTGCGATTTTTTTTT---GG-TACCTTGTTCTTCAA---AAGAAAGAGGGGGAGTGGGGGGC------------------------AGCGCGAGCCCCACCTGATTCAT-TGAGATAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTAA-ACA--TTTCTACCCTTGGCAGAGCCGCAGAAGCAATATGCTGATGTTGTGATCGAAGTTTTGCCGACACAATTAATTCCCGAAGACAGTGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCAGTTTACCTTTTCGACGAAGGCTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAA-CTAGCTGTC?????????????????? Phoenicophorium_borsigianum ???????????????????????????????????????????????????????????????????????????????????????????????????TTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATACTGGAGCTTTTTTGCTTATTCAGTTTTAGAATTCCAA--------GGCACTATATCTGATGTTGAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCCGC---TCCAGGAGGAAGGAATA---TTTGCATATGCCTAGTTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATCGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCATCT---AGAACCCTTT-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGTTATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGATGAGTGTCTTGTAAGTTATTCCAATGATCCTAAACTTGTATAATGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCT-AATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTACCAGGAGTTTCATCCTAAATAATGTTTC-----TAAC-ATTAATTTTAGATATATTCTGACGTAGGAGTTTAATACGTG-ATTGTGCTT----------------------------------------------------------------------------------GTGTAATTTCGCC?????????????????????????????????????????????????????????????????????????????????????????????????????GTCTCGTGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGCACCTAGTTGTTAGTATTCCAAGAA---TCGGCATA----GCACAAATTTGTCGGTATAATGTGGATCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTT-----GGGTACCT----TGTCAA---AAGAAAGAGGGAGGGTGGGGGGGGGGGGGGGGGT-------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCGTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGAAATATGCTGATGTTGTAATCGAAGTTCTGCCGACACAACTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGAGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTACAT-GGATA-CCCTG??????????????????????????????????????? Pholidostachys_pulchra ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTTC--TTTC--TTCTTTTTTTCTTTTCTATTTTTTTGAGGGG-AG-------CACTTGCCTTGAGAGTT-CATATTTT---CCTTTGCATTAGTTAA-TTATAATCTTGTTATTTGAAGTCTAATTTAAATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACC--GT-------AATGTGGCTTTGAAGAATGACTTTGGACTAGTGTCTTGTAAGTTATTCGGATGATCCTAAACTTGTATAAAGTTTCAAGACATACTATTTTGACCGATC-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCTATCAGGAGTTCTGTCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATAGGTA-ATGGTACTT----------------------------------------------------------------------------------TTGTTATTTCCCCATTACAAAAAA-TGCTTATATTATCACAATTTTCCTAGGTGGACAATATCAGCAAAGCTCTTCACAAGTGT?????????????????????????????????TCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGATTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGCGCCTAGTTGTTAGTGCTCGAAGAA---TTGGCAGA----GCACTAATTTGTCGGTATGATATAGAGCAATGTCATTAGTCTT---GATTGCTGA-TATAGTAA----TATACTTCAATATCTACCAAATTCTTCATAAAAAAA--CTAACCTAACTA--------TCT----GATCAATAAGTCAATTAATGCCCAAAACATACTGGACTGACAATATAATATCA-----CT-TCATGTGCAATTTTTTTT----AG-TACTT--TTTTTCAA---AAGAAAGAGGAAGAGGAAGGGG-------------------------AGGGCAAGCCCCACCTGATTCAT-TGAGATAA----TGAGACAATTAGATA-TGTC--GAGTCTTAT-----GTTCTTCTAATATCAGAA--TCCACTATGTCTTTAGCACTCTCGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGGCCCGCAGAAGCAATATGCTGATGCTGTAATCGAAGTTTTACCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCAGTTTACCTCTTCGACGAAGGCTCCACTG-TTTCAT-GGATA-CCCTGTGGG-?AG??????????????????????????????? Physokentia_rosea ??????????????????????????????????????????????TACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GATAT-AAATGCTGGAGCTTTTT-----ATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTCCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACCAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTTTATTTTAA-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGATTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACCGAGG-------TCTCTCCTAAATTATATAAT---AGACGATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATCCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAA????????????????????????????????????????????????????????????????????????????????????????CACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTGGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAAT-CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCGAATAATGCACAAAACATGCTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-T----------------------------------------------------------------------------ACCTGATTCAT-CGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTCAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGTAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTC?????????????????????????????????????????????????????????????????????????? Pinanga_coronata ????????????????????????????????????AGGGAGATGCTACTCCTTTTACCGATGTCACGGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGATGGAGCTTTTTGGCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTGTGGGAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATATCTAGCTAAAAGACA-TTGTTAATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACA-GGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATTTCTGTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGATGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAGTAATGTTTC-----TAAC-ATTGATTTCAGAACTATTCTGATGTAGGAGTTTAACACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATCTTATCACAAATTTC?????????????????????????????????????????TGTGAAATGGAA-GAACGTGGGCACAGT?TCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTTT-GAGTCTCGT---GTGTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGTCAGACCCACAGAAGCAACATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTGATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGTTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCGTCCG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTG???????? Podococcus_barteri ?????????GGAAGGTGCTGCCCATATGGGAA-GG-AGGGAGATGCTACTCCTTTTACCGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGAAGCA-TGTTACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTGGCTTATTTAGTTTAAGAATTCCAA--------GGCACTGTAT-TGATGTTAAAGAA----------------------------CATTATGGAAAGTTTCTTTTG-TTCTGC---TCTAGTAGGA--------------------TCTGGCTAAAAGACA--TGTTGATAGCTTATAGAAAAACACATGGTTATTCAATTAGCATTACTATCAAGGATTTGTGCTAGATATTGGTTT-AATAAATATGTTTGAGAACTGTT---------------ATCCTCCTCCTCCTTAAAGAACCCTTC-AACTT--CATACCTGGATTTT-ATTTT-----------------------TTTTGAGGGG-AG-------CTTTTGCCGTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGTTATTTGAAGTCTACTTTGAATCTCTCTTTTGAAGTTCTTGATATGCAA-GTTTACCCTGTAGATAGAAATGCGACTTTGAAGAATGACCTTGGA-TA------------CTATTTT---------------------------AAG-TCTACTATTTTGACGAAGG-------TCTCTCCTAAATTATATAAT---AGTCTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCCATCAGGAATTCTATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATATGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTGCCTTGTTACAAAAAAATGCTTATATTATCAGAAATTTCCTAGGTGGACAATATCA??????????????????????????????????????????????????GTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTC--------------------TGTTAGTGCGCCAAGAA---TTGGCAGA----TTACTAATTTTTTGGTATAATATAGAGCAATGTCGTTAGTCTT---GATTGCTGAATATAGCAA----TATACTTCAATGTCTAGCAAATGCTTCATGAAAAAA--CTAGCCTAAGTAACAAAGTATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGAGTAACAATATAATATTA-----CT-TTATGTGCAATTTTTTT-----GG-TACCT--TTTTCTAA---AAGAAAGAGGGAGAGCCGGGGGGGAGGG-------------------AGGGTGAGCCCCACCTGATTCAT-TGAGATAA----TGAGACAATTAGATT-TGCT--GAATCTCAT-----GTTCTTCAGACATCAGAATATCCATTCTTTCTTTAGCACTTTTGGATTATTGACAGCTTA-TAGA--TTGCTACCCT-GGCAGACCCGCAGAAGCAATATGCTGATATCGTAATCGAAGTTTTACCGACACAATTAATTCCTGGTGACAATGAAAGGAAGGTGCTGAGAGCTCGATTGGTGATGAAAGAAGGGGTGAAGTACTTCAATCCAGTTTACCTCATTGATGAAGGCTCCACTG-TTTCAT-GGCTA-CCCTG??????????????????????????????????????? Ponapea_palauensis CATCATGGGAAAGGTTGCTGCCCATATGGGAAAGG-AGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCGTAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATCATGGAAGGTTCCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGC--ATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACCAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGGG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGCTTAGTTAA-TTATACTCCTGCTATTTGAAGTCTACTTTAGATATCTTTTTTGAAGTTCTTGATATGTAA-GTTTACGCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTCTCTCT-----------------------------------------------------------------------------------------------------------------------------------------------------CCAGTTCAATGATCTATCAGTAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGAATTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCTATTAAAAAA---TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG????TGATATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATACCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATTGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATGTCTACCAAATGGTTCATAAAAAAA--CTAGCAGAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCGCAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-T----------------------------------------------------------------------------ACCTGATTCAT-TGAGACAA----TTAGA-----------------------------------------TAACAGAA--TCCACTATTTCTTTAGCACTCTTGGACCGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCAACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAATGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? Ptychococcus_paradoxus CATCATGGGAAAGGTTGCTGCCCATATGGGAAAGG-AGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGA-------------TTGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTAAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----CAAC-AGTGATTTCAGATATATTCTGATGTAGGAGTTAAATACGTA-CTTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG????TGATATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATGGTGCATGGTTGTTAGTATTGGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-T----------------------------------------------------------------------------ACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATAACAGAA--TCGACTATTTCTTTAGCTCTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCGATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATCAATTCCTGACGACAATGAAAGGAAGGTACTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCAGTTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? Ptychosperma_micranthum ???????????????????????GCGTGGGGGAAGGAGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTGAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-ACTAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCCTCCAACTTTTCATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTTTTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACCAAGC-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTTTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCAATAAAAAGAA-TGCTTATATTATCACAAATTTCCTAGGTGGCCCA??????????????????????????????????????????GAACGTGGGCACAGTCTTGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATATCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAAA-CTAACCGAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACCAAACGTACTGGACTAACAATGTAATATTA-----CT-TCAAGTGCATTTTTTTTT----GG-TACCT-TTTTTTCAA---AAGAAAGAGGAAGGGTGGGGGGA------------------------AGGGCGAGCCACACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCCTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCCGATGACAATGAAAGGAAGGTGCTCAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTC???????????????? Ptychosperma_salomonense ????????????????????????TATGGGAA-GG-AGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTCTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TTCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACA--GGGG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATGATCCTGCTATTTGAAGTCTACTTAAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATCATATAAT---AGACTATCTCC-TTGTAACTGACCTT-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCA??????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGGTTCATAAAAAAA--CTAACAAAACTAACAAGGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTT-----GG-T----------------------------------------------------------------------------ACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATAACAGAA--TCCACTATTTCTTTGGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAGTTAATTCCTGATGACAATAAAAGGAAGGTGCTAAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTTGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Rhopaloblaste_augusta ??????????????????????????????????????????????????????????TGATGTCACAGTAAGTAAATCCATAGAACCTTCTTGCAAGCTTTACTTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTTGACCTTTTTAGCTTATTCAGTTTTAGAATTCCAA--------GACACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TTCAGGAGGAAGGAATA---TTTGCATATGGCTAGCTAAAAGACAATTGTTGATAGCTTATACAAAAACATATGGTTATTCAATTTGCATTACCATTAAGGATTTGTAC--------AGTTT-AATAAATATGTTTGAGAA-----ACAT--GGGAG------------TCGTCT---AGAACCCCTC-AACTT--CGTACCTGGATTTT-ATTTTAA-------------------TTGTTTGAGGGG-AG-------CATTTTCCTTTGGAGTT-CATATTTT---CCCCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGCGGCCTTGAAGAATGACCTTGGACGAGTGTCTTGTGAGTTATTCCGATGATCCTAAACTTGTATAGAGTTTCAAGGCATTCTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATGTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTTTCCATTACAAAAAA-TGCTTATATTATCACAAATTTTCTAGGT?????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCAGGGTGCCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTGTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAAAACTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTGACAATGTAATATTA-----CT-TCATGTGCAAATTTTTTT----AG-TACCT--TTTTTCAA---AA{AG}AAAGAGGGAGAGTGGGGGGGGG----------------------AGGGCGAGCCACACCTGACTCAT-TGAAACAA----TGAGACAATTAGATA-TGTT--GAGTCTTAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTCAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTTTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Rhopaloblaste_ceramica ??????????????????????????????????????????ATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTTTTGCAAGCTTTACTTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGACCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GACACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---ACCAGGAGGAAGGAATA---TTTGCATATGGCTAACTAAAAGACAATTGTTGATAGCTTATACAAAAACATATGGTTATTCAATTTGCATTACCATTAAGGATTTGTAC--------AGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCATCT---AGAATGCCTC-AACTT--CGTACCTGGATTTT-ATTTTAA-------------------TTGTTTGAGGGG-AG-------CATTTTCCTTTGGAGTT-CATATTTT---CCCCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGCGGCCTTGAAGAATGACCTTGGACGAGTGTCTTGTGAGTTATTCCGATGATCCTAAACTTGTATAGAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTA--TAAT-ATAGACCATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATATATCAGGAGTTCCATCCTAAATAGTGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTTTCCATTACAAAAAA-TGCTTATATTATCACAAAT?????????????????????????????????????????????????????????????CGGGGCACAGTCTCAAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGTGCCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAAA-CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTGACAATGTAATATTA-----CT-TCATGTGCAAATTTTTTT----AG-TACCT--TTTATCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCGAGCCACACCTGACTCAT-TGAGACAA----CGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCACAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCGTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAACTAATTCCTGATGACAATGAAAGGAAGGTGCTCAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TCTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCCTTACCTG???????? Rhopaloblaste_ledermanniana_Heatubun_191 ???????????????????????GCCTGGGGGAAGGAGGGAGATGCTACTCCTTTTACTGATGTTACAGTAAGTAAATCCATAGAACCTTTTTGCAAGCTTTACTTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGACCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GACACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGGCTAGCTAAAAGACAATTGTTGATAGCTTATACAAAAACATATGGTTATTCAATTTGCATTACCATTAAGGATTTGTAC--------AGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCCTC-AACTT--TGTACCTGGATTTT-ATTTTAA-------------------TTGTTTGAGGGG-AG-------CATTTTCCTTTGGAGTT-CATATTTT---CCGCTGGATTAGTTAA-TTATAACCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGCGGCCTTGAAGAATGACCTTGGACGAGTGTCTTGTGAGTTATTCCGATGATCCTAAACTTGTATAGAGTTTCAAGGCATAGTATTTTGACTGAGG-------TCTCTCCTAAATTA--TAAT-ATAGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATATATCAGGAGTTCCATCCTAAATAGTGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGTGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATATTATCACAAA-TTCCTAGGTGGACCAATCAGCAA???????????????????TTTGTGATATGGAAGAAACGTGGGCACAGTCTCAAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACGGTGCCTGGTTGTTAGTATTCGAAGAA---CTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAAA-CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTGACAATGTAATATTA---TACT-TCATGTGCAAATTTTTTT----AG-TACCT--TTTTTCAA---AAGAAAGAGGG------------------------------------------AGCCACACCTGACTCAT-TGAGACAA----CGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCACAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCGTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTCAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCAATACCCCTGGAATAA Rhopaloblaste_ledermanniana_Maturbongs_650 ??????????????GTGCTGCCCATATGGGAA-GGAGGG-AGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACTTTCTTGCAAGCTTTACTTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGACCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GACACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-GTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGGCTAGCTAAAAGGCAATTGTTGATAGCTTATACAAAAACATATGGTTATTCAATTTGCATTACCATTAAGGATTTGTAC--------AGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCCTC-AACTT--CGTACCTGGATTTT-ATTTTAA-------------------TTGTTTGAGGGG-AG-------CATTTTCCTTTGGAGTT-CATATTTT---CCCCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGCGGCCTTGAAGAATGACCTTGGACGAGTGTCTTGTGAGTTATTCCGATGATCCTAAACTTGTATAGAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTA--TAAT-AGAGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATATATCATGAGTTCCATCCTAAATAGTGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATATTATCACAAATTTCCTAGGTGGACAATATCAGCAAA??????????????????????????????????????????????????????????????????????????????GAAAGCTTGACTTTGATGCTTATGTTGGTATGTTGCTTTGCCATGGTGCCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAC----TATACTTCAATATCTACCAAATGCTTCACAAAAAAAA-CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTGACAATGTAATATTA-----CT-TGATGTGCAAATTTTTTT----AG-TACCT--TTTTTCAA---AAGAAAGAGGGAGGGTGGGGGGG------------------------AGGGCGAGCCACACCTGACTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTCAGAGTTCGCTTGGGGATGAAAGAAGGGGTGAAATA???????????????????????????????????????????????????????????????????????????????????????????????? Rhopaloblaste_singaporensis ??????????????????????????????????????????????TACTCCTTTTACTGATCTTACAGTAAGTAAATCCATAGAACCTTTTTGCAAGCTTTACTTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGACCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GACACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGGCTAGCTAAAAGACAATTGTTGATAGCTTATACAAAAACATATGGTTATTCAATTTGCATTACCATTAAGGATTTGTAC--------AGTTT-AATAAATATGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCCTC-AACTT--TGTACCTGGATTTT-ATTTTAA-------------------TTGTTTGAGGGG-AG-------CATTTTCCTTTGGAGTT-CATATTTT---CCGCTGGATTAGTTAA-TTATAACCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGGTATGTAA-GTTTACCCTGTAGACAGAAATGCGGCCTTGAAGAATGACCTTGGACGAGTGTCTTGTGAGTTATTCCGATGATCCTAAACTTGTATAGAGTTTCAAGGCATAGTATTTTGACTGAGG-------TCTCTCCTAAATTA--TAAT-ATAGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATATATCAGGAGTTCCATCCTAAATAGTGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGTGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATATTATCACAG?????????????????????????????????????????????TTGTGATATGGAAGAAACGTGGGCACAGTCTCAAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACGGTGCCTGGTTGTTAGTATTCGAAGAA---CTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAAA-CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTGACAATGTAATATTA---TACT-TCATGTGCAAATTTTTTT----AG-TACCT--TTTTTCAA---AAGAAAGAGGG------------------------------------------AGCCACACCTGACTCAT-TGAGACAA----CGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCACAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCGTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTCAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCATGGGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCAATACCCCGGGAATAA Rhopalostylis_baueri ????????????????????????TATGG-AA-GG-AGG-AGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTCCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-AGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TTGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTCGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTAGCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAATTTCCTAGGTGGACCAATCCAGCAAA??????????????????TTGTGATATGGAAAGAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATGGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATG-------------------CTGAATACAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCTATCTGATCAATAAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTACTTTACT-TCATGTGCAATTTTTTTT----GG-TA----------------------------------------------------------------------------CCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GTGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACT--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGGAAATAA? Roscheria_melanochaetes ?????????????????????????????????????GGGGGATGCTACTCCTTTTACTGATGTCACGGTAAGTAAATCCACAGAACCTTCATGCAAGCTTTACCCGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATCCAGTTTAAGAATTCCAA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAGAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACA--GGAG------------TCGTCT---AGAACCCTTC-AACTT--CATAACTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CA--TGTCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACATTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTGCCCTGTAGGCAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGGTCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACT--CTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATTAGGAGTTCCATCCTAAATAATGTTTCTATTCTAAC-ATTGATTTCAGATATATTC-GATGTAGGAGTTTAATATGTA-ATTGTATTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATAT-ATCACA?????????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGCACCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATGGTAA----TATACTTCAATATCTACCAAATGCTTCATAAGAAAAA-CTAACCAAACTAACAAAGCATCT----GATCAATTAGTCAAATAATGCACAAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTT------GGGTACCT--TTTTTCAA---AAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------GCACTCTTGGATTGCTGATAGCTTA-TGCA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATCCCTGATGACAAGGAAAGGAAGGTGCTGAGGGTTCGCTTAGTGATGAAAGAAGGGGTGAAATTCTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Satakentia_liukiuensis ???????????????????????ATATGGGAA-GG-AGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGCACCTTCATGCAAGCTTTA-TGGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TTCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATGCAAAAACACGCGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCTAATTT--CATACCTGGTTTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTATAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATGAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATCCGTA-ATCGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAATTT????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTACGTCGCTTTGCCATAGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACC---------------------------------------AAAACATACTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-T----------------------------------------------------------------------------ACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTC--GAGTCTCAT-----GTTCTTCTGATATCAGCA--TCCAGTATTTCTTTAGCACTCTTGGATTGCTGACGGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGACGTCGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATAAAAGGAAGGTGCTGAGAGTTCGCTTGGTAATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Socratea_exorrhiza ????????????????ATTGCA----------------GGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCTTAGAACCTTCATGCAAGCTTTACCTGAGAAGCA-CGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTATAAAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCTGA--------GGCACTGTATCTGAGGTTAAAGAA----------------------------CGTTAAGGAAAGTTTCTTTTG-TTCTGC---TCCAGGAGGAAG---TAATTTTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGATTATTCAATTTGCATTACCATTTAGGATTTGTACTAGATAT-GGTTT-AATAAATGTGTTTGAGAACTGTT---------------ACCCCCCCCTCCGGTCTAGAACCTTCC-AACTT--CATACCTGGATTTG-ATATT-----------------------TTTAGAGGGG-AG-------CTTTTGCCTTTGGGGTT-CATATTTT---CCTCTGGATTAGCTAA-TTATAATCCTGTTATTTGAAGTCTACTTTGAATCTCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCGTGTAGACAGAAACATGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGAAGATCCTGCACGTGTAT-AAGTTTCAAGACATATTATTTCGACTAAGGTCTAAGGTCTCTCCTAAATTATATTGT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAATTCAATGATCTATCAGGAGTCCTATCCTAAATAATGTTTC-----GAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATATGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTGTCCCATTACAAAAAA-TGCTGATATTATCACAAATTTC-TAGGTGGACAAT??????????????????????????????????????????????????????GTCTCGAGAGCGTCAGAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATACTTATGTTGGTATGTCACTTTGCCACAGCACCTCGTTGTTGGTACTCGAAGAA---TTGGCAGA----GCACTAATTTGTTGGTATGATATAGAGCAATGCCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTAGCAAATGCTTCAAAAAAAAAA-CTAACCTAACTAACAAAGCATT-----GATCAATAAGTCAAATAATGCATAAAACATACTGGACTAACAATATAATAT-A-----C--TCATGGGCAATTTCTTT-----GG-TACCAT-TTTTTCAA---ACGAAAG----------------------------------------AGGGAGAGCCCCACCTGATTCAT-TGAGATAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCAGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTAA-----------ACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATTGAAGTTTTACCGACACAACTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAGTCCAGTTTACCTCTTTGATGAAGGCTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Solfia_samoensis CATCATGGGAAAGGTTGCCGCCCATATGGGAAAGG-AGGGAGATGCTACTCCTTTTACTGGTGTCACAGTAAGTAAATCCGTAGTACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCCTATTCAGTTTAAGAATTC-AA--------GGCACTGTACCTGGTGTTAAAGAA----------------------------CATCATGGAAGGTTGCTTTTG-TTCTGC---TCCGGGCGGAAGGAATA---TTTGCATATGTCTAGCTAAAGGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTCGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAG-----ACATTGGGGGGGGGGGGGGG---TCGTCCTCTAGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATACTCCTGCTATTTGAAGTCTACTTTAGATATCTTTTTTGAAGTTCTTGATATGTAA-GTTCACCCTGTAGA-----------CTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATGCTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TCGTAACTGACCTA-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGTAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTGGTACGTA-ATTGTACTT----------------------------------------------------------------------------------TTTTAATTTCCCCATGAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG????TGATATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAACATCGAAGCTCGAAAGCTTGACTGCGATGCTTATGTTGGTATCTCACTTTGCCATGGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAGCATACTGGATTAACAATGTAATATTA-----CT-TCATATGCAATTTTTTTT----GG-T----------------------------------------------------------------------------ACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATAACAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAGTTCCTGACGACAATGAAAGGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGATGGGGTGAAATACTTCGATCCAATTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? Sommieria_leucophylla ????????????????????????????????????????????GCTACACCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCAGAGAAGCA-TGTCACCATTTAACTT-------------------------------------------------------------------------------------GCTAT-GAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGATGTTAAGGAA----------------------------CACTATGGAAAGTTTCTTTTG-CTCCGC---TCCAGGAGG---GAATA-TTTTTGCATATGTCTAGCTAAAAGGCA-TTGTTGAGAGCTTATACAAAAACACGTGCTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAAGGGGG------------GCGTCT---AGAACCCTTC-AAGTT--CATACATAGATTTT--TTTTTA---------------------------GGGG-AG-------TATTTACCTTTAGAGTT-TATATTTT---CCCCTGGATTAGTTAA-TTATAATCCTGTTATTTGAAGTCTACTTTACATATCTCTTTTGATGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAACGTGGCTTTGAAGAATGACCTTCGACAAGTGTCTTGTAAGTTATTCTGATGATCCTAAGCTTGTATAAGTTTTCAAGACATACTATTTTGACCGAGG-------TCTCTTTTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGATTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAAAAATGTTTC-----TAAC-CTTGATTTCAGATATATTCTGATGTAGGAGTTTGATACATAGATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCGTTACAAAAAA-TGCTTATATTATCACAAAT??????????????????????????????????????????????TGATATGGAA-GAACGTGGGCACAGTCTCAAGAACATCAAAGCTAGCATTGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTCACTTTGCCACAGCGCCTGGTTATTAGTACTGGAAGAA---TTGGCAAA----GCACTAATTTGTCAGTACAATATAGAACAATGTCATTAGTCTT---GACTGCCGAATATAGTAA----TATACTTCAGTATCCATCGAATGCTTCATAAAAATA--CTAACCTAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGACTGTCAATATAATATTA-----CT-TCATGTGCAATTTTTTT-----GG-TACCTTGTTCTTCAA---AAGAAAGAGGGAGAGTGGTGGCC------------------------AGGGCGAGCCCCTCCTGATTCAT-TGAGATAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTCATATCAGAA--TCTACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTTCTACCCTTGGTAGAGCCGCAGAAGCAGTATGCTGATGTTGTAATCGAAGTTTTACCAACACAATTAATTCCTGAAGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCGGTTTACCTCTTCGACGAAGGCTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAA-CTAAGCTGCT????????????????? Tectiphiala_ferox ??????????????????????????????????????????ATGCTACTCCTTTTACCGATGTCACAGTACGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTTGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCTAA--------GGCACTGTATCTGATGTTAAAGAACATTATGGAAGGTTGCGATGTTAAAGAACATTATGGAAGGTTGCTTTTG-TTCAGC---TCCAGGAGAAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATCAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATAACTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTTCCCTGTAGACAGAAATGTGGCTTTGAAGCATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACCGAGG-------TCTCCCCTAAATTATATATT---AGACTATCACC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATATGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAAA-TGCTTATATTATCACAAATTTC???????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAACTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTTACTTTGCCACAGCGCCTGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTCGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCGATATCTACCAAATGCTTCATGAAAAAA--CTAATCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATGGTGGACTGACAATATGATATCA-----CT-TCATGTGTAATTTTTTT-----GG-TACCT--TTTTTCAA---AAGAA---------------------------------------------------------TGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTG--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGCTCGCTTGATGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGACGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Veillonia_alba ?????????????????????????????????????????????????????????????????????????????TCCATAGAACCTCCATGCAAGCCTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTACTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAATGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-AATAAATATGTTTGAGAA-----ACACAGGGGAG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTTAA-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTAATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTATCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATATTATCACAAA??????????????????????????????????????????????????????????????????GCACAGTCTCGAGAGCATCAAAGCCAGCATCGAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCTTAGCGCATAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATG-------------------CTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAT--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATGCTGGACTAACAATGTAATATTA-----CT-TCATGTGCAATTTTTTTT----GG-TACCT----------------------------------------------------------------------------GATTCAT-CGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATATCAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGC?????????????????? Veitchia_spiralis CATCATGGGAAAGGTTGCTGCCCATATGGGAAAGG-AGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTACATCCGTAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATCATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTATACAAAAACACATGGTTATTCATTTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACCGGGGGGGGGGTGGGGTTGTCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTAAC-------------------TTTTT-GAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATACTCCTGCTATTTGAAGTCTACCTTAGATATCTTTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TTTCTCCTAAATTATATAAT---AGACTATCTCT-----------------------------------------------------------------------------------------------------------------------------------------------------CCAGTTCAATGATCTATCAGTAGTTCCATCCTAAATAATGTTTC-----TAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTTAATACGTA-ATTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCTATTAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG????TGATATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCAAAGCTCGAAAGCTTGACTTCGATGCTTATGTTGGTATGTCACTTTGCCATGGTGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GC----------------AATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATACTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CT-TCATATGCAATTTTTTTT----GG-T----------------------------------------------------------------------------ACCTGATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCAT-----GTTCTTCTGATAACAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGACGACAATGAAAGGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCAATCCAATTTACCTCTTTGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? Verschaffeltia_splendida ??????????????????????????TGGGAAAGG-AGGGGGATGCTACTCCTTTTACTGA??TCACGGTAAGTAAATCCACAGAACCTTCATGCA??CTTTACC??AGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTATTCAGTTTAAGAATTCCAA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGTTGATAGCTTAT-CAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAC-GGTTT-{AG}ATAAATGTGTTTGAGAA-----ACAC--GGGAG------------TCGTCT---AGAACCCTTC-AACTT--CATAACTGGATTTT-ATTTTAA-------------------TTTTTTGAGGGG-AG-------CATTTGTCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATATGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCCGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTCTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATTCTAAATAATGTTTCTATTCTAAC-ATTAATTTCAGATATATTCTGATGTAGGAGTT-AATATG-A-ATCGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTACAAAAA--TGCTTATATTATCACAAA???????????????????????????????????????????????????????????????????????GTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTTGATGCTTATGTTGGTATGTTACTTTGCCACAGCGCCTAGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTAGTCTT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAGAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACCGGACTGACAATGTAATATTA-----CT-TCATGTACAATTTTTTTT----GG-TACCT--TTTTTCAA---AAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------GCACTCTTGGGTTGCTGACAGCTTA-TGCA--TTGCTACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATCCCTGATGACAATGAAAGGAAGGTGCTGAGAGTTCGCTTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTTACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTG??????????????????????????????????????? Wodyetia_bifurcata CATCATGGGAAAGGTTGCTGCCCATATGGGAAAGG-AGGGAGATGCTACTCCTTTTACTGATGTCACAGTAAGTAAATCCATAGAACCTTCATGCAAGCTTTACCTGAGTAGCA-TGTCACAATTTAACTT-------------------------------------------------------------------------------------GCTAT-AAATGCTGGAGCTTTTTTGCTTGTTCAGTTTAAGAATTC-AA--------GGCACTGTATCTGATGTTAAAGAA----------------------------CATTATGGAAGGTTGCTTTTG-TTCTGC---TCCAGGAGGAAGGAATA---TTTGCATATGTCTAGCTAAAAGACA-TTGGTGATA-------CAAAAACACATGGTTATTCAATTTGCATTACCATTAAGGATTTGTACTAGATAT-GGTTT-AATAAATATGTTTGAGAA-----ACACAC-GGGG------------TCGTCT---AGAACCCTTCCAACTT--CATACCTGGATTTT-ATTTAAA-------------------TTTTTTGAGGGG-AG-------CATTTGCCTTTGGAGTT-CATATTTT---CCTCTGGATTAGTTAA-TTATAATCCTGCTATTTGAAGTCTACTTTAGATATCTCTTTTGAAGTTCTTGATATGTAA-GTTTACCCTGTAGACAGAAATGTGGCTTTGAAGAATGACCTTGGACGAGTGTCTTGTAAGTTATTCTGATGATCCTAAACTTGTATAAAGTTTCAAGGCATACTATTTTGACTGAGG-------TCTCTCCTAAATTATATAAT---AGACTGTCTCC-TTGTAACTGACCTG-------------------------------------------------------------------------------------------------------------------------TGACTTGGGTTTTCCAGTTCAATGATCTATCAGGAGTTCCATCCTAAATAATGTTTC-----CAAC-ATTGATTTCAGATATATTCTGATGTAGGAGTTAAATACGTA-ACTGTACTT----------------------------------------------------------------------------------TTGTAATTTCCCCATTAAAAAAA--TGCTTATTTTATCACAAATTTCCTAGGTGGACAATATCAGCAAAGCTCTTCATAAGTGTGG????TGATATGGAA-GAACGTGGGCACAGTCTCGAGAGCATCAAAGCTAGCATCGAAGCTCGAAAGCTTGACTTCGATGCCTATGTTGGTATGTCACTTTGCCATGGCGCATGGTTGTTAGTATTCGAAGAA---TTGGCAGA----GCACAAATTTGTTGGTATAATATGGAGCAATGTCATTGGTCCT---GATTGCTGAATATAGTAA----TATACTTCAATATCTACCAAATGCTTCATAAAAAAA--CTAACCAAACTAACAAAGCATCT----GATCAATAAGTCAAATAATGCACAAAACATACTGGATTAACAATGTAATATTA-----CC-TCATGTGCAATTTTTTTT----GG-TACCT----------------------------------------------------------------------------GATTCAT-TGAGACAA----TGAGACAATTAGATA-TGTT--GAGTCTCCT-----GTTCTGATGATAACAGAA--TCCACTATTTCTTTAGCACTCTTGGATTGCTGACAGCTTA-TACA--TTGCAACCCTTGGCAGACCCACAGAAGCAATATGCTGATGTTGTAATCGAAGTTTTGCCGACACAATTAATTCCTGACGACAATGAAAGGAAGGTGCTGAGAGTTCGCCTGGTGATGAAAGAAGGGGTGAAATACTTCGATCCAGTTCACCTCTTCGATGAAGGGTCCACTG-TTTCAT-GGATA-CCCTGTGGG--AGGAAACTAAGCTGCTCATACCCTGG??????? ; END; BEGIN SETS; CHARSET Ambiguous (CHARACTERS = PRK_&_RPB2) = 1-44 506-524 574-594 1238-1329 1553-1554 1659-1664 1673-1676 1693-1732 2063-2101; CHARSET PRK (CHARACTERS = PRK_&_RPB2) = 1302-2101; CHARSET RPB2 (CHARACTERS = PRK_&_RPB2) = 1-1301; END; BEGIN TREES; TITLE Tb7800; LINK TAXA = Taxa1; TRANSLATE 1 Basselinia_velutina, 2 Balaka_longirostris, 3 Archontophoenix_purpurea, 4 Alsmithia_longipes_Zona_1039, 5 Alsmithia_longipes_Baker_1180, 6 Alloschmidia_glabrata, 7 Adonidia_merrillii, 8 Actinorhytis_calapparia, 9 Actinokentia_huerlimannii, 10 Verschaffeltia_splendida, 11 Tectiphiala_ferox, 12 Sommieria_leucophylla, 13 Hydriastele_beguinii, 14 Rhopalostylis_baueri, 15 Rhopaloblaste_ledermanniana_Maturbongs_650, 16 Rhopaloblaste_ledermanniana_Heatubun_191, 17 Rhopaloblaste_singaporensis, 18 Rhopaloblaste_ceramica, 19 Rhopaloblaste_augusta, 20 Roscheria_melanochaetes, 21 Pinanga_coronata, 22 Phoenicophorium_borsigianum, 23 Pelagodoxa_henryana, 24 Oncosperma_tigillarium, 25 Nephrosperma_vanhoutteanum, 26 Nenga_pumila_var_pachystachya, 27 Socratea_exorrhiza, 28 Podococcus_barteri, 29 Pholidostachys_pulchra, 30 Manicaria_saccifera, 31 Neonicholsonia_watsonii, 32 Leopoldinia_pulchra, 33 Geonoma_deversa, 34 Chamaerops_humilis, 35 Calyptrogyne_costatifrons, 36 Asterogyne_martiana, 37 Wodyetia_bifurcata, 38 Veitchia_spiralis, 39 Veillonia_alba, 40 Solfia_samoensis, 41 Satakentia_liukiuensis, 42 Ponapea_palauensis, 43 Ptychosperma_salomonense, 44 Ptychosperma_micranthum, 45 Ptychococcus_paradoxus, 46 Physokentia_rosea, 47 Normanbya_normanbyi, 48 Neoveitchia_storckii, 49 Moratia_cerifera, 50 Loxococcus_rupicola, 51 Linospadix_albertisiana, 52 Lepidorrhachis_mooreana, 53 Lavoixia_macrocarpa, 54 Laccospadix_australasicus, 55 Kentiopsis_oliviformis, 56 Howea_belmoreana, 57 Heterospathe_elata_Lewis_99034, 58 Heterospathe_sp_nov_Fernando_1624, 59 Heterospathe_sp_Baker_1130, 60 Heterospathe_sp_Banka_2008, 61 Heterospathe_sp_Baker_1142, 62 Heterospathe_sp_Baker_1115, 63 Heterospathe_sibuyanensis, 64 Heterospathe_scitula, 65 Heterospathe_phillipsii, 66 Heterospathe_philippinensis, 67 Heterospathe_macgregorii, 68 Heterospathe_humilis, 69 Heterospathe_elata_Chapin_55, 70 Heterospathe_elata_Houg_Hubb_1024, 71 Heterospathe_delicatula, 72 Heterospathe_cagayanensis, 73 Hedyscepe_canterburyana, 74 Drymophloeus_litigiosus, 75 Cyphosperma_balansae, 76 Cyphophoenix_nucele, 77 Cyphokentia_macrostachya, 78 Clinosperma_bracteale, 79 Chambeyronia_macrocarpa, 80 Carpoxylon_macrospermum, 81 Carpentaria_acuminata, 82 Campecarpus_fulcitus, 83 Calyptrocalyx_hollrungii, 84 Burretiokentia_vieillardii, 85 Brongniartikentia_lanuginosa, 86 Brassiophoenix_drymophloeoides, 87 Masoala_madagascariensis, 88 Marojejya_darianii, 89 Lemurophoenix_halleuxii, 90 Iguanura_wallichiana, 91 Hydriastele_microspadix, 92 Hydriastele_costata, 93 Hydriastele_brassii, 94 Dypsis_lutescens, 95 Dictyosperma_album, 96 Deckenia_nobilis, 97 Cyrtostachys_renda, 98 Clinostigma_savoryanum, 99 Bentinckia_condapanna, 100 Areca_catechu, 101 Acanthophoenix_rubra; TREE Fig._3.2 = [&R] (((((((((((101,11),96),(20,10)),(100,(26,21)),99,(98,97),(95,(19,((18,(17,16)),15))),(((94,88),89),90),(((93,13),91),92),87,(25,22),24),((14,(9,3,79,55),8,(((7,((2,40),38)),((86,45),(81,37),(74,47))),(43,42)),((6,1),73),(((5,4),((72,63),(70,69),57),(71,68),(66,64),65,58),(67,(62,61),60)),(((85,78),53),(77,49)),(84,(82,39),76,46),83,(80,(48,41)),75,((56,54),51),52,44),50))'Indo-Pacific Pseudomonomerous Areceae',(((23,12),32),31)),(((36,33),35),29)),30),27),28)Arecoideae,34)Arecaceae; TREE Fig._3.1 = [&R] ((((((((((((101,11),96),(20,10)),(((93,13),91),92),(95,(19,((18,(17,16)),15))),(87,(25,22))),(((100,(26,21)),(99,24)),(98,97)),(((94,88),89),90)),((((14,((((5,4),(((((72,63),((70,69),57)),(66,64)),58),(71,68)),65),(67,(62,61),60)),75),52,((84,76),((82,39),46))),(((9,55,79),3),83,8),(((7,((2,40),38)),(((86,45),(74,47)),(81,37))),(43,42)),(((((85,78),53),(77,49)),44),((56,54),51)),(80,(48,41))),((6,1),73)),50))'Indo-Pacific Pseudomonomerous Areceae',(((23,12),32),31)),(((36,33),35),29)),30),27),28)Arecoideae,34)Arecaceae; END; BEGIN TREES; TITLE Tb7798; LINK TAXA = Taxa1; TRANSLATE 1 Basselinia_velutina, 2 Balaka_longirostris, 3 Archontophoenix_purpurea, 4 Alsmithia_longipes_Zona_1039, 5 Alsmithia_longipes_Baker_1180, 6 Alloschmidia_glabrata, 7 Adonidia_merrillii, 8 Actinorhytis_calapparia, 9 Actinokentia_huerlimannii, 10 Verschaffeltia_splendida, 11 Tectiphiala_ferox, 12 Sommieria_leucophylla, 13 Hydriastele_beguinii, 14 Rhopalostylis_baueri, 15 Rhopaloblaste_ledermanniana_Maturbongs_650, 16 Rhopaloblaste_ledermanniana_Heatubun_191, 17 Rhopaloblaste_singaporensis, 18 Rhopaloblaste_ceramica, 19 Rhopaloblaste_augusta, 20 Roscheria_melanochaetes, 21 Pinanga_coronata, 22 Phoenicophorium_borsigianum, 23 Pelagodoxa_henryana, 24 Oncosperma_tigillarium, 25 Nephrosperma_vanhoutteanum, 26 Nenga_pumila_var_pachystachya, 27 Socratea_exorrhiza, 28 Podococcus_barteri, 29 Pholidostachys_pulchra, 30 Manicaria_saccifera, 31 Neonicholsonia_watsonii, 32 Leopoldinia_pulchra, 33 Geonoma_deversa, 34 Chamaerops_humilis, 35 Calyptrogyne_costatifrons, 36 Asterogyne_martiana, 37 Wodyetia_bifurcata, 38 Veitchia_spiralis, 39 Veillonia_alba, 40 Solfia_samoensis, 41 Satakentia_liukiuensis, 42 Ponapea_palauensis, 43 Ptychosperma_salomonense, 44 Ptychosperma_micranthum, 45 Ptychococcus_paradoxus, 46 Physokentia_rosea, 47 Normanbya_normanbyi, 48 Neoveitchia_storckii, 49 Moratia_cerifera, 50 Loxococcus_rupicola, 51 Linospadix_albertisiana, 52 Lepidorrhachis_mooreana, 53 Lavoixia_macrocarpa, 54 Laccospadix_australasicus, 55 Kentiopsis_oliviformis, 56 Howea_belmoreana, 57 Heterospathe_elata_Lewis_99034, 58 Heterospathe_sp_nov_Fernando_1624, 59 Heterospathe_sp_Baker_1130, 60 Heterospathe_sp_Banka_2008, 61 Heterospathe_sp_Baker_1142, 62 Heterospathe_sp_Baker_1115, 63 Heterospathe_sibuyanensis, 64 Heterospathe_scitula, 65 Heterospathe_phillipsii, 66 Heterospathe_philippinensis, 67 Heterospathe_macgregorii, 68 Heterospathe_humilis, 69 Heterospathe_elata_Chapin_55, 70 Heterospathe_elata_Houg_Hubb_1024, 71 Heterospathe_delicatula, 72 Heterospathe_cagayanensis, 73 Hedyscepe_canterburyana, 74 Drymophloeus_litigiosus, 75 Cyphosperma_balansae, 76 Cyphophoenix_nucele, 77 Cyphokentia_macrostachya, 78 Clinosperma_bracteale, 79 Chambeyronia_macrocarpa, 80 Carpoxylon_macrospermum, 81 Carpentaria_acuminata, 82 Campecarpus_fulcitus, 83 Calyptrocalyx_hollrungii, 84 Burretiokentia_vieillardii, 85 Brongniartikentia_lanuginosa, 86 Brassiophoenix_drymophloeoides, 87 Masoala_madagascariensis, 88 Marojejya_darianii, 89 Lemurophoenix_halleuxii, 90 Iguanura_wallichiana, 91 Hydriastele_microspadix, 92 Hydriastele_costata, 93 Hydriastele_brassii, 94 Dypsis_lutescens, 95 Dictyosperma_album, 96 Deckenia_nobilis, 97 Cyrtostachys_renda, 98 Clinostigma_savoryanum, 99 Bentinckia_condapanna, 100 Areca_catechu, 101 Acanthophoenix_rubra; TREE Fig._1 = [&R] (((((((101,11),96),(100,(26,21)),99,98,(97,89),95,94,((93,13),(92,91)),90,88,(87,24),(25,22),(20,10),(19,(18,(17,16)),15),(14,(9,3,79,55),8,(((7,((2,40),38),(86,45),74),(81,37)),((47,42),43)),(6,1),((5,4),((72,63),(70,69,58,57)),((71,68),((66,64),65)),67,(62,61),(60,59)),((85,78,53),(77,49)),84,83,((82,(76,39)),46),(80,(48,41)),75,73,((56,54),51),52,50,44))'Indo-Pacific Pseudomonomerous Areceae',((23,12),32),((36,35,33),29),31,30),27),28)Arecoideae,34)Arecaceae; END; BEGIN TREES; TITLE Tb7799; LINK TAXA = Taxa1; TRANSLATE 1 Basselinia_velutina, 2 Balaka_longirostris, 3 Archontophoenix_purpurea, 4 Alsmithia_longipes_Zona_1039, 5 Alsmithia_longipes_Baker_1180, 6 Alloschmidia_glabrata, 7 Adonidia_merrillii, 8 Actinorhytis_calapparia, 9 Actinokentia_huerlimannii, 10 Verschaffeltia_splendida, 11 Tectiphiala_ferox, 12 Sommieria_leucophylla, 13 Hydriastele_beguinii, 14 Rhopalostylis_baueri, 15 Rhopaloblaste_ledermanniana_Maturbongs_650, 16 Rhopaloblaste_ledermanniana_Heatubun_191, 17 Rhopaloblaste_singaporensis, 18 Rhopaloblaste_ceramica, 19 Rhopaloblaste_augusta, 20 Roscheria_melanochaetes, 21 Pinanga_coronata, 22 Phoenicophorium_borsigianum, 23 Pelagodoxa_henryana, 24 Oncosperma_tigillarium, 25 Nephrosperma_vanhoutteanum, 26 Nenga_pumila_var_pachystachya, 27 Socratea_exorrhiza, 28 Podococcus_barteri, 29 Pholidostachys_pulchra, 30 Manicaria_saccifera, 31 Neonicholsonia_watsonii, 32 Leopoldinia_pulchra, 33 Geonoma_deversa, 34 Chamaerops_humilis, 35 Calyptrogyne_costatifrons, 36 Asterogyne_martiana, 37 Wodyetia_bifurcata, 38 Veitchia_spiralis, 39 Veillonia_alba, 40 Solfia_samoensis, 41 Satakentia_liukiuensis, 42 Ponapea_palauensis, 43 Ptychosperma_salomonense, 44 Ptychosperma_micranthum, 45 Ptychococcus_paradoxus, 46 Physokentia_rosea, 47 Normanbya_normanbyi, 48 Neoveitchia_storckii, 49 Moratia_cerifera, 50 Loxococcus_rupicola, 51 Linospadix_albertisiana, 52 Lepidorrhachis_mooreana, 53 Lavoixia_macrocarpa, 54 Laccospadix_australasicus, 55 Kentiopsis_oliviformis, 56 Howea_belmoreana, 57 Heterospathe_elata_Lewis_99034, 58 Heterospathe_sp_nov_Fernando_1624, 59 Heterospathe_sp_Baker_1130, 60 Heterospathe_sp_Banka_2008, 61 Heterospathe_sp_Baker_1142, 62 Heterospathe_sp_Baker_1115, 63 Heterospathe_sibuyanensis, 64 Heterospathe_scitula, 65 Heterospathe_phillipsii, 66 Heterospathe_philippinensis, 67 Heterospathe_macgregorii, 68 Heterospathe_humilis, 69 Heterospathe_elata_Chapin_55, 70 Heterospathe_elata_Houg_Hubb_1024, 71 Heterospathe_delicatula, 72 Heterospathe_cagayanensis, 73 Hedyscepe_canterburyana, 74 Drymophloeus_litigiosus, 75 Cyphosperma_balansae, 76 Cyphophoenix_nucele, 77 Cyphokentia_macrostachya, 78 Clinosperma_bracteale, 79 Chambeyronia_macrocarpa, 80 Carpoxylon_macrospermum, 81 Carpentaria_acuminata, 82 Campecarpus_fulcitus, 83 Calyptrocalyx_hollrungii, 84 Burretiokentia_vieillardii, 85 Brongniartikentia_lanuginosa, 86 Brassiophoenix_drymophloeoides, 87 Masoala_madagascariensis, 88 Marojejya_darianii, 89 Lemurophoenix_halleuxii, 90 Iguanura_wallichiana, 91 Hydriastele_microspadix, 92 Hydriastele_costata, 93 Hydriastele_brassii, 94 Dypsis_lutescens, 95 Dictyosperma_album, 96 Deckenia_nobilis, 97 Cyrtostachys_renda, 98 Clinostigma_savoryanum, 99 Bentinckia_condapanna, 100 Areca_catechu, 101 Acanthophoenix_rubra; TREE Fig._2 = [&R] (((((((((101,11),96),100,99,(98,97),(95,(19,18,(17,16),15)),(((94,88),89),90),((87,(25,22)),50),(26,21),24,(20,10),14,((9,3,79,55),8,83),(6,1,73),(((5,4),(((72,63),(70,69),57),(66,64)),(71,68),65,58),((67,61),62,60)),((85,78),77,53,49),(84,82,39),(80,(48,41)),76,75,((56,51),54),52,46),((93,(91,13)),92),(7,(2,40),(42,38)),(86,81,(74,47),45,37),44,43)'Indo-Pacific Pseudomonomerous Areceae',(((23,12),32),31)),(((36,33),35),29)),30,28),27)Arecoideae,34)Arecaceae; END;