#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on September 18, 2021; 6:45 GMT TreeBASE (cc) 1994-2008 Study reference: Crous P.W., Slippers B., Wingfield M.J., Rheeder J., Marasas W., Phillips A., Alves A., Burgess T., Barber P., & Groenewald J.Z. 2006. Phylogenetic lineages in the Botryosphaeriaceae. Studies in Mycology, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1560] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=115; TAXLABELS Botryosphaeria_corticola_AY928051 Botryosphaeria_corticola_CBS_112545 Botryosphaeria_corticola_CBS_678.88 Botryosphaeria_dothidea_CBS_110300 Botryosphaeria_dothidea_CBS_115476 Botryosphaeria_dothidea_CBS_331.33 Botryosphaeria_dothidea_CBS_769.71 Botryosphaeria_iberica_CBS_115041 Botryosphaeria_mamane_CBS_117444 Botryosphaeria_melanops_CBS_118.39 Botryosphaeria_obtusa_AY928050 Botryosphaeria_rhodina_AY928054 Botryosphaeria_rhodina_CBS_174.26 Botryosphaeria_rhodina_CBS_287.47 Botryosphaeria_sarmentorum_AY928052 Botryosphaeria_sarmentorum_CBS_115038 Botryosphaeria_sarmentorum_CBS_120.41 Botryosphaeria_stevensii_AY928049 Botryosphaeria_stevensii_CBS_123.30 Botryosphaeria_stevensii_CBS_134.50 Botryosphaeria_stevensii_CBS_431.82 Botryosphaeria_stevensii_CPC_12461 Botryosphaeria_subglobosa_CBS_448.91 Botryosphaeria_sumachi_CBS_217.25 Botryosphaeria_tsugae_CBS_418.64 Botryosphaeria_visci_CBS_100163 Botryosphaeria_visci_CBS_186.97 Botryosphaeria_visci_CBS_218.25 Botryosphaeria_viticola_CBS_112869 Botryosphaeria_viticola_CBS_112870 Botrysphaeria_viticola_CBS_117009 Byssothecium_circinans_AY016357 Camarosporium_quaternatum_CBS_134.97 Camarosporium_quaternatum_CBS_483.95 Camarosporium_sp._CPC_12441 Diaporthe_angelicae_AY196781 Diaporthe_decedens_AF408348 Diaporthe_eres_AF362565 Diaporthe_pustulata_AF408358 Diaporthe_sp._CBS_134.42 Dichomera_eucalypti_CBS_118099 Dichomera_eucalypti_CBS_118100 Dichomera_saubinetii_CBS_990.70 Dichomera_versiformis_CBS_118101 Diplodia_cajani_CBS_214.50 Diplodia_juglandis_CBS_188.87 Diplodia_laeliocattleyae_CBS_167.28 Diplodia_pinea_CBS_393.84 Diplodia_porosum_CBS_110496 Diplodia_porosum_CBS_110574 Diplodia_rosulata_CBS_116470 Diplodia_rosulata_CBS_116472 Diplodia_sp._CPC_12264 Diplodia_sp._CPC_12442 Diplodia_sp._CPC_12444 Gaeumannomyces_graminis_var._avenae_AF362556 Guignardia_bidwellii_CBS_111645 Guignardia_bidwellii_CBS_237.48 Guignardia_citricarpa_CBS_102374 Guignardia_philoprina_CBS_447.68 Guignardia_sp._CPC_10978 Guignardia_sp._CPC_11867 Karstenula_rhodostoma_AY787933 Lasiodiplodia_crassispora_prov._nom._CBS_118741 Lasiodiplodia_gonubiensis_CBS_115812 Lasiodiplodia_rubropurpurea_prov._nov._CBS_118740 Lasiodiplodia_venezuelensis_prov._nom._CBS_118739 Letendraea_helminthicola_AY016362 Macrophomina_phaseolina_CBS_162.25 Macrophomina_phaseolina_CBS_227.33 Macrophomina_phaseolina_CPC_11052 Macrophomina_phaseolina_CPC_11070 Macrophomina_phaseolina_CPC_11079 Macrophomina_phaseolina_CPC_11085 Macrophomina_phaseolina_CPC_11106 Macrophomina_phaseolina_CPC_11108 Magnaporthe_grisea_AF362554 Microdiplodia_sp._CPC_12268 Neofusicoccum_andinum_CBS_117453 Neofusicoccum_arbuti_CBS_116131 Neofusicoccum_arbuti_CBS_116573 Neofusicoccum_arbuti_CBS_116574 Neofusicoccum_arbuti_CBS_117089 Neofusicoccum_arbuti_CBS_117090 Neofusicoccum_luteum_AY928043 Neofusicoccum_luteum_CPC_10899 Neofusicoccum_mangiferum_CBS_118531 Neofusicoccum_mangiferum_CBS_118532 Neofusicoccum_parvum_AY928045 Neofusicoccum_parvum_AY928046 Neofusicoccum_ribis_AY004336 Neofusicoccum_ribis_AY928044 Neoscytalidium_dimidiatum_CBS_251.49 Neoscytalidium_dimidiatum_CBS_312.90 Neoscytalidium_dimidiatum_CBS_499.66 Neoscytalidium_hyalinum_CBS_145.78 Phomopsis_sclerotioides_AF439628 Phomopsis_sp._CPC_12258 Phyllosticta_flevolandica_CBS_998.72 Phyllosticta_sp._CPC_11336 Phyllosticta_sp._CPC_12073 Physalospora_zeicola_CBS_269.31 Pseudofusicoccum_sp._CBS_117451 Pseudofusicoccum_stromaticum_CBS_117448 Pseudofusicoccum_stromaticum_CBS_117449 Saccharata_proteae_CBS_115206 Sphaeropsis_conspersa_CBS_209.25 Stenocarpella_macrospora_CBS_117560 Stenocarpella_maydis_CBS_117557 Stenocarpella_maydis_CBS_117558 Stenocarpella_maydis_CBS_117559 Taeniolella_alta_CBS_488.80 Tiarosporella_graminis_var._karoo_CBS_118718 Tiarosporella_madreeya_CBS_532.76 Tiarosporella_tritici_CBS_118719 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1204] TITLE 28S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1677; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botryosphaeria_corticola_AY928051 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_corticola_CBS_112545 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTAACGAGTGGGCCACGGGGCGAGGACTCCCACGGGGTCTTCGCCCTCCGCTACTAGGTGGTTAAGAGGTAACTGAAAGTGTTTACCTAGTCCCTCTATCGGGGCGACATTGTCAAATTGTTCGGGGACTCCCTTAGAGCTTAGACTACCGCGGCCGGCCGAAAGGTCCGGTGCAGCACCAGGGTAACGACCTCGGGGATGGTAACAACGTCTAAGATTGGGTGATCCGCAGCCAAGCTCCTAAGTCCGGCGAGAGCGGGATACGGAGAAGGTTCACAGACTAGATGGCAATGGGTTCGGCCAGCGATGGCCGGGTCTAAGATATAGTCGATCCCCACGGAAACGTGGGCGGTAGGGCAAAGCTCGCGGGCGGATAGGTGCCTTTCATGGCACGCCCGAGAGCCCGAACCCTGCCGGGGAGGCCGCCGTGCCTCTCGAGCTACATGCTA-------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_corticola_CBS_678.88 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTAACGAGTGGGCCACGGGGCGAGGACTCCCACGGGGTCTTCGCCCTCCGCTACTAGGTGGTTAAGAGGTAACTGAAAGTGTTTACCTAGTCCCTCTATCGGGGCGACATTGTCAAATTGTTCGGGGACTCCCTTAGAGCTTAGACTACCGCGGCCGGCCGAAAGGTCCGGTGCAGCACCAGGGTAATGACCTCGGGGATGGTAACAACGTCTAAGATTGGGTGATCCGCAGCCAAGCTCCTAAGTCCGGCGAGAGCGGGATACGGAGAAGGTTCACAGACTAGATGGCAATGGGTCCGGTCAGCGATGGCCGGGTCTAAGATATAGTCGATCCCCGCGGAAACGTGGGCGGTAGGGCAAAGCTCGCGGGCGGATAGGTGCCTTTCACGGCACGCCCGAGAGCCCGAACCCTGCCGGGGAGGCCGCCGTGCCTCTCGAGCTACATGCTA-------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_dothidea_CBS_110300 --------------------------------------------------------------------CAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTT--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCAAGGGCTCCCGCCTAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTAAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGTTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_dothidea_CBS_115476 ----------------------------------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTT--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCAAGGGCTCCCGCCTAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTAAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_dothidea_CBS_331.33 --------------------------------------------------------------AGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTT--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCAAGGGCTCCCGCCTAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTAAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_dothidea_CBS_769.71 -----------------------------------CTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTT--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCAAGGGCTCCCGCCTAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTAAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_iberica_CBS_115041 -----------------GTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTT--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_mamane_CBS_117444 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTTGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTAACTACTAGGTGGTTAAGAGGCGGCCTGGAAAGAGGCCGCCTAGTCCCTCCGTACGGGGCGACACTGTCAAATTGCCGGGGACATCCTTAGAGCCTCTAATACCGCGGCCGCGTCGAAAGGCGCCGGTGCAGCACCGGGTTAACGACCCCGGGGACGGTAACAACTTAGAGGATTGGACGATCCGCAGCCAAGCTCCTAAACCGCCGGTCGGGCGGCACGGAGAAGGTCCACAGACTAGATGGCAGTGGGTTCGGCCTCGCGGAGGCCGGGCCTAAGATATAGTCGACCCCCCGCGGAAACGCGGGCGGGCGGGCGAAGCCTTCCCAGGCGGATGGGCGACCTCTCCCCGGCGGAGAGGCCGCGCCTGGGGGCCCGAACCCGTCCCGGGGCGGCCTGCTGGCCGCTCTGGAGCTACGTGCTA--------------------------------------------------GTAGCTGGTTCCTGCCGAAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Botryosphaeria_melanops_CBS_118.39 --------------------------------GAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCTC--GGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGCGAGGGTTCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGATGGGTTGCCCGAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTCGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCGGGCCAGCATCGGTTCGGGCGGTCGGATAAAGGCCCCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGCGGAATGCGGCCAGCCCGGACCGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTGTTTGGGTGTCAAACCCAAGCGCGTAATTAAAGTGAACGGAGGTGGGAACCCCTCGCGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-GTA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_obtusa_AY928050 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_rhodina_AY928054 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCTGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTAGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGCAATGCGGCCAGCCTGGACTGAGGAACTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_rhodina_CBS_174.26 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTCGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCAGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCTTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGCTGTGAGCCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_rhodina_CBS_287.47 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCTGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTAGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGCAATGCGGCCAGCCTGGACTGAGGAACTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCGTACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_sarmentorum_AY928052 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTT--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_sarmentorum_CBS_115038 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTT--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_sarmentorum_CBS_120.41 -------------TCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTT--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_stevensii_AY928049 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_stevensii_CBS_123.30 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTCCTGCGGCCAGGCCAGCATCAGTTCAGGCGGTCGGATAAAGACCCGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGGAATGCGGCCAGCTTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTAAGATAAGTAGTTTGTGCGAAAGCTTACACCTGTGGTAGTAACGTTGAACGAGGGTAATTGTCTATTAGGAGGTACTCTCCTCCCAGTGTTGATAGTTAGTGAGGTACGTTGGTTTTAACGTTAAAATTTAAACAGATAAAACGCACTATGCGAATTATCGCCTTACTATGAGCTGGGTAGAGTAGTAGGTGTGGAGTTCCAAAGTGACTCCCGTAAGCATCCTTTAAAAACCTATTCATCCTATCTAGACACCGTTACTACGAGATCATTTGTTCTATTTTGTCAGGAGTTGTGGAGTTTTTGCTTTTCGCTACTAGGTGGTTAAGAGGTGGCTAAAAGTGCCCACCTAGTCCTTCTATCAGGGCGACACTGTTAAATTGTTCGGGGACGCCCTTAGAGCTTAGACTACCGCGGCCCGCCGAAAGGCAGGGTGCAGCACCGGGGTAACGACCTAGGGTATGGTAATAACGTCTAAGATTGGGCAACCCGCAGCCAAGCCCCTAAGTCCAGTAAAATGGATACGGGGAAGGTTCACAGACTAAATAGCAGTGGGTTCGGCTGTAACAGGCCGGGTCTAAGATATAGTCGATCCCCACGGAAACGTGGGCGGTGGGGCGAAGCTCAAAGGCAGATAGGTGCGTCAAGCACGCCTTCAGGGCCCGAACCCCGCCGGGGAGCTGTTATGGGCTTGCCTAGCAAGTCGTTGTGCATGCTCAGGCCTGCAGCAGACTCTCGAGC Botryosphaeria_stevensii_CBS_134.50 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_stevensii_CBS_431.82 ----------GGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_stevensii_CPC_12461 -------------------------------TGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_subglobosa_CBS_448.91 -------------------------------------------------------------AAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATCTGTAGAGGATGGTTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCTTTAGCC-ATGTGAACCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGCGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTAACATTGGCGGCCCTTTGTTACGCGCTTAGGCTGCTAGGTGGTTAAGAGGTGGCTAAAAGTGCCTACCTAGTCCCTCTGTCGGGGCAACATCGTCAAACTGTTCGGGGACGTCCTTAGAGCTTAGACTACCGCGGCCGGGCCGAAAGGCTCGGTGCAGCACCAGGGTAACGACCTCGGGGGTGGTAACAACGTCTAAGATTGGGCTATCCGCAGCCAAGCTCCTACGGCCCGGTCGAACGGGCACGGAGAAGGTTCACAGACTAGATGGCGGTGGGTTCGGCTCGTTTGCGCGGGCCGGGCCTAAGATATAGTCGATCCCCCGCGGAAACGCGGGCGGCGGGGCGAAGCCTGCTGGGCAGACGGGCGCGTCGAGAGGCGCGCGTCTGGCAGGCCCGAACCCCTCCGGGGAGCCGCAGCGCTCCTGGGCTAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_sumachi_CBS_217.25 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_tsugae_CBS_418.64 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTATGCGGTGGGCCGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGACGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_visci_CBS_100163 -----------------------------------------------------------AAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-GTGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_visci_CBS_186.97 -----------------------------------------------------------------AACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-GTGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_visci_CBS_218.25 -----------------------------------CTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGG-CGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_viticola_CBS_112869 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTT--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCCAGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCTGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botryosphaeria_viticola_CBS_112870 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTT--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCTAGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCTGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Botrysphaeria_viticola_CBS_117009 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTT--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCTAGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCTGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Byssothecium_circinans_AY016357 ----------------------------------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCTATGGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTGTTGGTGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTCGCATGCCTTCGCC-GTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCGGGCGTATGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGCCTCTGTCACGTATCTTCCTTCGGGATGACCTTATAGGG-GAGGCGACATGCGACCAGCCCGGACTGAGGTCCGCGCTTCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTT---GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Camarosporium_quaternatum_CBS_134.97 ----------------------------------------------------------GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTC--AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCGTCGCC-GTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCATGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACTTCCTCTCGGGGAAGCCTTATAGGG-GAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTT-GCTAGGATGCTGGCGTAAAGGCTGTATGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTTT--GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGC-ATG-GCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Camarosporium_quaternatum_CBS_483.95 ------------------------------------------------------------GAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTT--AGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCC-GTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGG-GAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTT-GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAC-CCCATTA-GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGC-ATG-GCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Camarosporium_sp._CPC_12441 ---------------------------------------AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTC--AGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCC-GTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGG-GAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAC-CCCATTA-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATG-GCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diaporthe_angelicae_AY196781 ----------------------------------------------------------GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGGCGGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCCGCCGGACGATACCCTC-GCGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTCCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diaporthe_decedens_AF408348 ----------------------------------------------------------GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGCAGGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCCGGCGGACGATACCCCC-GTGGGGACCGAGGTTCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diaporthe_eres_AF362565 ----------------------------------------------------------GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCTGGCGGACGATACCCCC-GTGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diaporthe_pustulata_AF408358 ----------------------------------------------------------GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAGACCGCCGGGAACGTAGCACCCCCCGGGGTGTG-TTATAGCCCGGCGGACGATACCCTC-GCGGGGACCGAGGTTCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diaporthe_sp._CBS_134.42 ------------------------------------ACTAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCTGGCGGACGATACCCCC-GTGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACTG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dichomera_eucalypti_CBS_118099 ------------------------------------------------------------------ACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGGTTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAACCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCTGTCTCCTGACAGGCGCACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATGCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dichomera_eucalypti_CBS_118100 --------------------------------------------------------------------CAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGGTTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAACCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCTGTCTCCTGACAGGCGCACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Dichomera_saubinetii_CBS_990.70 ---------------------------------------AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTT--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCAAGGGCTCCCGCCTAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTAAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAATCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dichomera_versiformis_CBS_118101 --------------------------------------------------------------------CAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGCCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCCGTCTCCTGACGGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTAGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_cajani_CBS_214.50 --------TCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCTGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTAGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGCAATGCGGCCAGCCTGGACTGAGGAACTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCGTACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_juglandis_CBS_188.87 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTT--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_laeliocattleyae_CBS_167.28 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCTGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTAGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGCAATGCGGCCAGCCTGGACTGAGGAACTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCGTACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_pinea_CBS_393.84 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_porosum_CBS_110496 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_porosum_CBS_110574 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_rosulata_CBS_116470 ---------------------------------------------------------------------AACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_rosulata_CBS_116472 -------------------------------------------------------------AAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_sp._CPC_12264 ---------------------------------------------------------GGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCACTGGAACGTGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_sp._CPC_12442 ----------------------------------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCACTGGAACGTGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Diplodia_sp._CPC_12444 ----------------------------------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCACTGGAACGTGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAATGTAACTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Gaeumannomyces_graminis_var._avenae_AF362556 ----------------------------------------------------------GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC------AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACC-GAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATG--GTAGGACGCCG-AGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTTGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTG-TTATAGCCCGTTGCTTAATACCCCG-GCGGGGACCGAGGACCGCGCTTCG--GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGC-TTGG-ACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Guignardia_bidwellii_CBS_111645 ----------------------------------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCGTCTTC--GACGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAGGACTCCTGCCTAAGTCCCCTGGAACGGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCGGGCGGTCCGAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCAGTCGCTCAGCCGGCCTCTTGGCCGGTGTACTCTTCTGCGAGCGGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGTGTCGGGAATGTAGCACCCTCCGGGGTGTG-TTATAGCCCGGCGCGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTCGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTCACGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Guignardia_bidwellii_CBS_237.48 -------------------------------TGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCGTCTTC--GACGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAGGACTCCTGCCTAAGTCCCCTGGAACGGGGCGTCACAGAGGGTGAGAATCCCGTACGTGGCGGGCGGTCCGAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCAGTTGCTCAGCCGGCCTCTTGGCCGGTGCACTCTTCTGCGATCGGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGCGTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGCGCGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGCAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTCGCGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Guignardia_citricarpa_CBS_102374 ------------------------------------------------------------------ACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCGTCTTC--GACGTCCGCGTTGTAATTTGTAGAGGATGTTTCGGCGAGGGCTCCTGCCTAAGTTCCCTGGAATGGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCGGGCGGCCTTAGCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTTCGCAGTTGCTCAGCCCGCCTCTTGGTGGGTGTACTCTTCTGCGGTCGGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGTGTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGCGCGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Guignardia_philoprina_CBS_447.68 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCGTCTTC--GACGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAGGACTCCTGCCTAAGTCCCCTGGAACGGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGCGGGCGGTCCGAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCAGTTGCTCAGCCGGCCTCTTGGCCGGTGTACTCTTCTGCGATCGGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGTGTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGCGCGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTCACGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Guignardia_sp._CPC_10978 ------------------------TACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCGTCTTC--GACGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAAGACTCCTGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGCGGGCAGTCTAAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGTAGTTGCTCAGCCGGCCTCTTGGCCGGTGTACTCTTCTACGATCGGGCCAGCATCAGTTCGGGCGGCAGGATAAAGGTGTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGCGCGGAATGCTGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTCACGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Guignardia_sp._CPC_11867 -----------------------ATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCGTCTTC--GACGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAAGACTCCTGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGCGGGCAGTCTAAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGTAGTTGCTCAGCCGGCCTCTTGGCCGGTGTACTCTTCTACGATCGGGCCAGCATCAGTTCGGGCGGCAGGATAAAGGTGTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGCGCGGAATGCTGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTCACGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Karstenula_rhodostoma_AY787933 ------------------------------------------------------------------------------------AGT-ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGCCTGCCTTTGCC-GTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCAGGCTTTGGCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAGGG-GAGGCGCAATGCAACCAGCCCGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAA-CCCTTTT-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lasiodiplodia_crassispora_prov._nom._CBS_118741 ----------------------------------ACCTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCTCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGCGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTAAGAAAGTAGTTTTCGTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lasiodiplodia_gonubiensis_CBS_115812 --------TCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATTGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCATGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Lasiodiplodia_rubropurpurea_prov._nov._CBS_118740 ---------------------------------------AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACACCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGTCAGAGGAAACTCTGATGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Lasiodiplodia_venezuelensis_prov._nom._CBS_118739 ----------------------------------ACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGTCCTTTC--AGGGCCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCCTGGAACGGGGCGTCGTAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCATGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGCGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Letendraea_helminthicola_AY016362 -------------------------------TGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCCTTTGGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCC-GTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTCGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAGGG-GAGGCGCAATGCAACCAGCCCGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAA-CCGCAA---GGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Macrophomina_phaseolina_CBS_162.25 ----------------------------------------------------------------------ACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Macrophomina_phaseolina_CBS_227.33 ---------------------------------------------------------TGGAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Macrophomina_phaseolina_CPC_11052 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Macrophomina_phaseolina_CPC_11070 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Macrophomina_phaseolina_CPC_11079 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Macrophomina_phaseolina_CPC_11085 ---------------------------------------------------------TGGAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Macrophomina_phaseolina_CPC_11106 ---------------------------------------------------------TGGAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Macrophomina_phaseolina_CPC_11108 ---------------------------------------------------------TGGGAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCTCCTTC--GGAGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGTGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCAGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Magnaporthe_grisea_AF362554 ----------------------------------------------------------GAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC-----CGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCACCTACC-GAGTCCCCTGGAATGGGGCGCCATAGAGGGTGAGAGCCCCGTATG--GTAGGACGCCG-AACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCCGGTTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCTTTCGGGGAGTG-TTATAGCCCGTTGCGTAATACCCCG-GCGGGGACCGACGACCGCGCTTCG--GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTTTCGGAAGGATTTGAGTAGGAGCATTAACGC-TTGG-ACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTTCAGCCGAAGTTTCCCTCAGGATAGCAGTGTCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Microdiplodia_sp._CPC_12268 ---------------------------------------AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCC-GTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTGGCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTTCCTTCGGGATGACCTTATAGGG-GAGGCGTAATGCAACCAGCCCGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAA-CCCTTT--GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_andinum_CBS_117453 ---------------------------------------------------------------GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCCGTCTCCTGACGGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_arbuti_CBS_116131 ---------------------------------------AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCCGTCTCCTGACGGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_arbuti_CBS_116573 -------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCCGTCTCCTGACGGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_arbuti_CBS_116574 -------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCCGTCTCCTGACGGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_arbuti_CBS_117089 -------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCCGTCTCCTGACGGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_arbuti_CBS_117090 -------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCCGTCTCCTGACGGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCCGGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_luteum_AY928043 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGACGGCTCCCGCCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_luteum_CPC_10899 ---------------------------------------------------------------GAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGACGGCTCCTGCCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Neofusicoccum_mangiferum_CBS_118531 -------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGATGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_mangiferum_CBS_118532 -------------------------------------TAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCCGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Neofusicoccum_parvum_AY928045 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_parvum_AY928046 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neofusicoccum_ribis_AY004336 -----------------------------------CTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTAGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Neofusicoccum_ribis_AY928044 ----------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCCCCTTC--GGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGTCTAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGATGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCTTGTCTCCTGACAGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTGGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCTGGGTGCAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neoscytalidium_dimidiatum_CBS_251.49 -------------------------------------------------------------AAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCCC-GGGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGCACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCCGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCGC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCGACTACTAGGTGGTTAAGAGGTGGCTGAAAGTGCCCACCTAGTCCCCCCGTCCGAGGACGGGGGGGCGACATCGCCAAATTGCGGGGACTCCCTTAGAGCCTCTACTACCGCGGCCGGCCGAAAGGCGCGGTGCAGCACCGGGTTAATTGCCTAGGGTACGGTAAAAAGGTAGAGGATTGGGAAATCCGCAGCCAAGCGCCTAAGTCCCGCGGGATACGGCGAAGGTTCAGAGACTAGATGGCGGTGGGTCCGGCCCGAGGGCCGGGCCTAAGGTATAGTCCACCCCCCGCGGAGACGCGGGCGGATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neoscytalidium_dimidiatum_CBS_312.90 -------------------------------------------TATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCCC-GGGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGCACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCCGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCGC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neoscytalidium_dimidiatum_CBS_499.66 -------------------------------------------------------------AAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCCC-GGGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGCACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCCGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCGC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCGACTACTAGGTGGTTAAGAGGTGGCTGAAAGTGCCCACCTAGTCCCCCCGTCCTCGGACGGGGGGGCGACATCGCCAAATTGCGGGGACTCCCTTAGAGCCTCTACTACCGCGGCCGGCCGAAAGGCGCGGTGCAGCACCGGGTTAATTGCCTAGGGTACGGTAAAAAGGTAGAGGATTGGGAAATCCGCAGCCAAGCGCCTAAGTCCCGCGGGATACGGCGAAGGTTCAGAGACTAGATGGCGGTGGGTCCGGCCCGAGGGCCGGGCCTAAGGTATAGTCCACCCCCCGCGGAGACGCGGGCGGATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Neoscytalidium_hyalinum_CBS_145.78 -------------------------------------------------------------AAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCCCCC-GGGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGCACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCCGGGAACGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCGC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCGACTACTAGGTGGTTAAGAGGTGGCTGAAAGTGCCCACCTAGTCCCCCCGTCCTCGGACGGGGGGGCGACATCGCCAAATTGCGGGGACTCCCTTAGAGCCTCTACTACCGCGGCCGGCCGAAAGGCGCGGTGCAGCACCGGGTTAATTGCCTAGGGTACGGTAAAAAGGTAGAGGATTGGGAAATCCGCAGCCAAGCGCCTAAGTCCCGCGGGATACGGCGAAGGTTCAGAGACTAGATGGCGGTGGGTCCGGCCCGAGGGCCGGGCCTAAGGTATAGTCCACCCCCCGCGGAGACGCGGGCGGATCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phomopsis_sclerotioides_AF439628 ----------------------------------------------------------GAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGTTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTTGGACACC-AAGCCTGTGTGAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGCCAGGAACGTGGCACCCTCCGGGGTGTG-TTATAGCCTGGCGGACGATACCCCC-GCGGGGACCGAGGTTCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGCAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTCCCTCAGGATAGCAGTGTTGATC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phomopsis_sp._CPC_12258 ------------------------------------ACTAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGGCGGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCCACCGGACGATACCCTC-GCGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phyllosticta_flevolandica_CBS_998.72 ---------------------------------AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTC-CGGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTCGGCCATGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCTGGCCTTCGCC-ATGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCTTCGGCCTGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCAGGCGGTCGGATAAAGGTCCCGGGAATGTGGCTCTCTTCGGGGAGTG-TTATAGCCCGGGGCGCAATGCGGCCAGCTTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAA-CCCGAAA-GGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phyllosticta_sp._CPC_11336 ----------------------------------GAACTAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCGTCTTC--GACGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAGGACTCCTGCCTAAGTCCCCTGGAACGGGGCGTCACAGAGGGTGAGAATCCCGTATGTGGCGGGCGGTCCAAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCAGTTGCTCAGCCGGCCTCTTGGCCGGTGTACTCTTCTGCGATCGGGCCAGCATCAGTTCGGGCGGCTGGATAAAGGTGTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGCGCGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTCACGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phyllosticta_sp._CPC_12073 -------------------------------------------------------------AAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAGCTGGCGCCTTC--GGCGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAGGACTCCTGCCTAAGTTCCCTGGAATGGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCGGGCGGTCCAAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCAGTTGCTCAGCCTGCCTCTTGGCGGGTGTACTCTTCTGTGATCGGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGTGTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGCGCGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Physalospora_zeicola_CBS_269.31 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTT--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCTGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTAGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTCGGGAATGTGGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGCAATGCGGCCAGCCTGGACTGAGGAACTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCGTACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudofusicoccum_sp._CBS_117451 -----------------------------------CTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCGTCTTC--GGCGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAGGGCTCCGGTTTAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGTGATCGGTTGCCTAAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCGGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGCCTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudofusicoccum_stromaticum_CBS_117448 -------------------------------------------------------------------CCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCGTCTTC--GGCGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAGGGCTCCGGTTTAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGTGATCGGTTGCCTAAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCGGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGCCTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGGTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudofusicoccum_stromaticum_CBS_117449 -------------------------------------------------------------------CCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCGTCTTC--GGCGTCCGCGTTGTAATTTGTAGAGGATGCTTCGGCGAGGGCTCCGGTTTAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGTGATCGGTTGCCTAAGCC-ATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCGGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGCCTCGGGAATGTAGCACCCTTCGGGGTGTG-TTATAGCCCGGGGTGGCATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGGTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Saccharata_proteae_CBS_115206 -----------------------------------------------------------------AACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTC--AGGGTCCGAGTTGTAATTTGTAGAGGATGTTTCGGCGAGTGCTCCCGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGATGGGTTGCGCGAGCC-ATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGCAGTTGCTCAACCCGCCTCCTGGCGGGTGTACTCTTCTGCGGTCAGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGCGTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGCGCGACATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGTAATGAAAGTGAACGGAGGTGGGAA-CGCGCAA-GCGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGTCAGAGGAAACTCTGATGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sphaeropsis_conspersa_CBS_209.25 GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTC--AGGGTCCGCATTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCAAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTCCTGCCGAAGTTTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Stenocarpella_macrospora_CBS_117560 -------------------------------------------------------------AAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCCTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTCTTCGCGGGGGGACAAGACCGCCGGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCCGGCGGACGATACCCCC-GCGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTCAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Stenocarpella_maydis_CBS_117557 -----------------------------------------------------------------AACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGACAAGACCGCCGGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCCGGCGGACGATACCCCC-GCGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTCCCTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Stenocarpella_maydis_CBS_117558 --------------------------------------------------------------AGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGACAAGACCGCCGGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCCGGCGGACGATACCCCC-GCGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTCCCTC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Stenocarpella_maydis_CBS_117559 ------------------------------------------------------------------ACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGACAAGACCGCCGGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCCGGCGGACGATACCCCC-GCGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCACCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Taeniolella_alta_CBS_488.80 ------------------------------------ACTAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCT-------CGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCC-GAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATG--GTCGGACACC-AAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACAGGCCAGCATCGGTTTTCGCGGGGGGATAAGACCGGCGGGAACGTAGCACCCTCCGGGGTGTG-TTATAGCCCACCGGACGATACCCTC-GCGGGGACCGAGGTCCGCGCTCC---GCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCATTAGAGCGAGCGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGCAGGTGAGAG-CTTCGGC-----GCATCATCGACCGATCCTGATGTTCTCGGAAGGATTTGAGTAAGAGTTTTA-ACGGACGG-ACCCGAAAGACAGTGAACTATGCTTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGAGCATGGGGGCGAAAGACTAATCGAACTGTCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTACCGCCGAAGTTTC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Tiarosporella_graminis_var._karoo_CBS_118718 ----------------------------------------------------GCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGTCCTTTC--AGGGCCCGCGTTGTAATTTGTAGAGGATGATTCGGCAAGGGCTCCCGCCTAAGTTCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAACCGGTCTCCTGACCGGCTTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCCCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGACCAGCCTGGACTGAGGAACTCGCTTCG--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGAAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Tiarosporella_madreeya_CBS_532.76 ------------------------------------------------------------------ACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGTCCTTTC--AGGGCCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGTTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGCCGGATAAAGGCCCCGGGAATGTAGCTCCTCTCGGGGAGTG-TTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCG--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCGCAA-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAAC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Tiarosporella_tritici_CBS_118719 ------------------------------------ACTAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGTCCTTTC--AGGGCCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCC-ATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGGCCTCGGGAATGTGGCTCCCTTCGGGGAGTG-TTATAGCCCGGGGCGTAATGCGGCCAGCCTGGACTGAGGAACTCGCTTCG--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCCTCAC-GGGTGCACCATCGGCCGATCCTGATGTCTTCGGATGGATTTGAGCAAGAGC-ATA-GCTGTTGGGACCCGAAAGATGGTGAACTATACCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAGCTGGTTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN SETS; CHARSET lsu (CHARACTERS = 28S_rDNA) = 85-660; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-1677; CODONPOSSET CodonPositions (CHARACTERS = 28S_rDNA) = N: 1-1677; END; BEGIN TREES; TITLE Tb7807; LINK TAXA = Taxa1; TRANSLATE 1 Diaporthe_eres_AF362565, 2 Diaporthe_sp._CBS_134.42, 3 Taeniolella_alta_CBS_488.80, 4 Phomopsis_sp._CPC_12258, 5 Diaporthe_angelicae_AY196781, 6 Stenocarpella_maydis_CBS_117559, 7 Stenocarpella_maydis_CBS_117558, 8 Stenocarpella_maydis_CBS_117557, 9 Stenocarpella_macrospora_CBS_117560, 10 Diaporthe_decedens_AF408348, 11 Phomopsis_sclerotioides_AF439628, 12 Diaporthe_pustulata_AF408358, 13 Microdiplodia_sp._CPC_12268, 14 Letendraea_helminthicola_AY016362, 15 Karstenula_rhodostoma_AY787933, 16 Byssothecium_circinans_AY016357, 17 Camarosporium_quaternatum_CBS_483.95, 18 Camarosporium_sp._CPC_12441, 19 Camarosporium_quaternatum_CBS_134.97, 20 Phyllosticta_flevolandica_CBS_998.72, 21 Guignardia_sp._CPC_11867, 22 Guignardia_sp._CPC_10978, 23 Guignardia_philoprina_CBS_447.68, 24 Guignardia_bidwellii_CBS_111645, 25 Phyllosticta_sp._CPC_11336, 26 Guignardia_bidwellii_CBS_237.48, 27 Phyllosticta_sp._CPC_12073, 28 Guignardia_citricarpa_CBS_102374, 29 Saccharata_proteae_CBS_115206, 30 Botryosphaeria_melanops_CBS_118.39, 31 Pseudofusicoccum_stromaticum_CBS_117449, 32 Pseudofusicoccum_stromaticum_CBS_117448, 33 Pseudofusicoccum_sp._CBS_117451, 34 Neofusicoccum_luteum_AY928043, 35 Neofusicoccum_luteum_CPC_10899, 36 Neofusicoccum_arbuti_CBS_117090, 37 Neofusicoccum_arbuti_CBS_117089, 38 Neofusicoccum_arbuti_CBS_116573, 39 Neofusicoccum_andinum_CBS_117453, 40 Neofusicoccum_arbuti_CBS_116574, 41 Neofusicoccum_arbuti_CBS_116131, 42 Dichomera_versiformis_CBS_118101, 43 Dichomera_eucalypti_CBS_118100, 44 Dichomera_eucalypti_CBS_118099, 45 Neofusicoccum_mangiferum_CBS_118532, 46 Neofusicoccum_mangiferum_CBS_118531, 47 Neofusicoccum_parvum_AY928046, 48 Neofusicoccum_ribis_AY928044, 49 Neofusicoccum_parvum_AY928045, 50 Neofusicoccum_ribis_AY004336, 51 Botrysphaeria_viticola_CBS_117009, 52 Botryosphaeria_viticola_CBS_112870, 53 Botryosphaeria_viticola_CBS_112869, 54 Botryosphaeria_sarmentorum_AY928052, 55 Botryosphaeria_iberica_CBS_115041, 56 Diplodia_juglandis_CBS_188.87, 57 Botryosphaeria_sarmentorum_CBS_115038, 58 Botryosphaeria_sarmentorum_CBS_120.41, 59 Neoscytalidium_dimidiatum_CBS_499.66, 60 Neoscytalidium_dimidiatum_CBS_312.90, 61 Neoscytalidium_hyalinum_CBS_145.78, 62 Neoscytalidium_dimidiatum_CBS_251.49, 63 Macrophomina_phaseolina_CPC_11070, 64 Macrophomina_phaseolina_CPC_11106, 65 Macrophomina_phaseolina_CPC_11085, 66 Macrophomina_phaseolina_CBS_162.25, 67 Macrophomina_phaseolina_CPC_11108, 68 Macrophomina_phaseolina_CPC_11079, 69 Macrophomina_phaseolina_CBS_227.33, 70 Macrophomina_phaseolina_CPC_11052, 71 Botryosphaeria_mamane_CBS_117444, 72 Botryosphaeria_dothidea_CBS_331.33, 73 Dichomera_saubinetii_CBS_990.70, 74 Botryosphaeria_dothidea_CBS_110300, 75 Botryosphaeria_dothidea_CBS_115476, 76 Botryosphaeria_dothidea_CBS_769.71, 77 Tiarosporella_madreeya_CBS_532.76, 78 Tiarosporella_graminis_var._karoo_CBS_118718, 79 Tiarosporella_tritici_CBS_118719, 80 Lasiodiplodia_venezuelensis_prov._nom._CBS_118739, 81 Lasiodiplodia_crassispora_prov._nom._CBS_118741, 82 Botryosphaeria_subglobosa_CBS_448.91, 83 Diplodia_laeliocattleyae_CBS_167.28, 84 Botryosphaeria_rhodina_CBS_287.47, 85 Botryosphaeria_rhodina_AY928054, 86 Diplodia_cajani_CBS_214.50, 87 Physalospora_zeicola_CBS_269.31, 88 Botryosphaeria_sumachi_CBS_217.25, 89 Botryosphaeria_tsugae_CBS_418.64, 90 Botryosphaeria_visci_CBS_218.25, 91 Botryosphaeria_visci_CBS_186.97, 92 Botryosphaeria_visci_CBS_100163, 93 Diplodia_pinea_CBS_393.84, 94 Botryosphaeria_stevensii_CBS_431.82, 95 Diplodia_porosum_CBS_110496, 96 Diplodia_rosulata_CBS_116470, 97 Diplodia_porosum_CBS_110574, 98 Diplodia_rosulata_CBS_116472, 99 Botryosphaeria_stevensii_CPC_12461, 100 Botryosphaeria_stevensii_AY928049, 101 Botryosphaeria_corticola_AY928051, 102 Botryosphaeria_corticola_CBS_678.88, 103 Botryosphaeria_corticola_CBS_112545, 104 Lasiodiplodia_rubropurpurea_prov._nov._CBS_118740, 105 Sphaeropsis_conspersa_CBS_209.25, 106 Botryosphaeria_stevensii_CBS_134.50, 107 Botryosphaeria_obtusa_AY928050, 108 Lasiodiplodia_gonubiensis_CBS_115812, 109 Diplodia_sp._CPC_12264, 110 Diplodia_sp._CPC_12444, 111 Diplodia_sp._CPC_12442, 112 Botryosphaeria_stevensii_CBS_123.30, 113 Botryosphaeria_rhodina_CBS_174.26, 114 Magnaporthe_grisea_AF362554, 115 Gaeumannomyces_graminis_var._avenae_AF362556; TREE Fig._1 = [&R] ((115,114),(((((((((((112,(111,(110,109))Diplodia_sp.),113),(((((106,105),107),((((103,(102,101))Botryosphaeria_corticola,104),((((((95,94),96),97),98),99),100)),((93,(92,91)),(90,(89,88))))),108),((((((84,83),85),86),87),(82,81)),(((78,77),79)Tiarosporella,80)))),((((75,74),76),(73,72)),((71,(((70,69),(((68,67),66),(65,64))),63)Macrophomina_phaseolina),((61,(60,59)),62)Neoscytalidium))),((((((55,54),56),57),58),(53,(52,51))Botryosphaeria_viticola),(((((50,((48,47),49)),(46,45)Neofusicoccum_mangiferum),(44,43)Dichomera_eucalypti),(((41,(40,39)),(38,(37,36))),42)),(35,34)Neofusicoccum_luteum)Neofusicoccum)),(33,(32,31)Pseudofusicoccum_stromaticum)Pseudofusicoccum),30),29),((27,((((24,23),25),26),(22,21))),28)Guignardia),(((19,(18,17))Camarosporium,((15,(14,13)),16)),20)),(((((9,(8,(7,6))Stenocarpella_maydis)Stenocarpella,((5,(4,3)),(2,1))),10),11),12))); END; BEGIN TREES; TITLE Tb7809; LINK TAXA = Taxa1; TRANSLATE 1 Diaporthe_eres_AF362565, 2 Diaporthe_sp._CBS_134.42, 3 Taeniolella_alta_CBS_488.80, 4 Phomopsis_sp._CPC_12258, 5 Diaporthe_angelicae_AY196781, 6 Stenocarpella_maydis_CBS_117559, 7 Stenocarpella_maydis_CBS_117558, 8 Stenocarpella_maydis_CBS_117557, 9 Stenocarpella_macrospora_CBS_117560, 10 Diaporthe_decedens_AF408348, 11 Phomopsis_sclerotioides_AF439628, 12 Diaporthe_pustulata_AF408358, 13 Microdiplodia_sp._CPC_12268, 14 Letendraea_helminthicola_AY016362, 15 Karstenula_rhodostoma_AY787933, 16 Byssothecium_circinans_AY016357, 17 Camarosporium_quaternatum_CBS_483.95, 18 Camarosporium_sp._CPC_12441, 19 Camarosporium_quaternatum_CBS_134.97, 20 Phyllosticta_flevolandica_CBS_998.72, 21 Guignardia_sp._CPC_11867, 22 Guignardia_sp._CPC_10978, 23 Guignardia_philoprina_CBS_447.68, 24 Guignardia_bidwellii_CBS_111645, 25 Phyllosticta_sp._CPC_11336, 26 Guignardia_bidwellii_CBS_237.48, 27 Phyllosticta_sp._CPC_12073, 28 Guignardia_citricarpa_CBS_102374, 29 Saccharata_proteae_CBS_115206, 30 Botryosphaeria_melanops_CBS_118.39, 31 Pseudofusicoccum_stromaticum_CBS_117449, 32 Pseudofusicoccum_stromaticum_CBS_117448, 33 Pseudofusicoccum_sp._CBS_117451, 34 Neofusicoccum_luteum_AY928043, 35 Neofusicoccum_luteum_CPC_10899, 36 Neofusicoccum_arbuti_CBS_117090, 37 Neofusicoccum_arbuti_CBS_117089, 38 Neofusicoccum_arbuti_CBS_116573, 39 Neofusicoccum_andinum_CBS_117453, 40 Neofusicoccum_arbuti_CBS_116574, 41 Neofusicoccum_arbuti_CBS_116131, 42 Dichomera_versiformis_CBS_118101, 43 Dichomera_eucalypti_CBS_118100, 44 Dichomera_eucalypti_CBS_118099, 45 Neofusicoccum_mangiferum_CBS_118532, 46 Neofusicoccum_mangiferum_CBS_118531, 47 Neofusicoccum_parvum_AY928046, 48 Neofusicoccum_ribis_AY928044, 49 Neofusicoccum_parvum_AY928045, 50 Neofusicoccum_ribis_AY004336, 51 Botrysphaeria_viticola_CBS_117009, 52 Botryosphaeria_viticola_CBS_112870, 53 Botryosphaeria_viticola_CBS_112869, 54 Botryosphaeria_sarmentorum_AY928052, 55 Botryosphaeria_iberica_CBS_115041, 56 Diplodia_juglandis_CBS_188.87, 57 Botryosphaeria_sarmentorum_CBS_115038, 58 Botryosphaeria_sarmentorum_CBS_120.41, 59 Neoscytalidium_dimidiatum_CBS_499.66, 60 Neoscytalidium_dimidiatum_CBS_312.90, 61 Neoscytalidium_hyalinum_CBS_145.78, 62 Neoscytalidium_dimidiatum_CBS_251.49, 63 Macrophomina_phaseolina_CPC_11070, 64 Macrophomina_phaseolina_CPC_11106, 65 Macrophomina_phaseolina_CPC_11085, 66 Macrophomina_phaseolina_CBS_162.25, 67 Macrophomina_phaseolina_CPC_11108, 68 Macrophomina_phaseolina_CPC_11079, 69 Macrophomina_phaseolina_CBS_227.33, 70 Macrophomina_phaseolina_CPC_11052, 71 Botryosphaeria_mamane_CBS_117444, 72 Botryosphaeria_dothidea_CBS_331.33, 73 Dichomera_saubinetii_CBS_990.70, 74 Botryosphaeria_dothidea_CBS_110300, 75 Botryosphaeria_dothidea_CBS_115476, 76 Botryosphaeria_dothidea_CBS_769.71, 77 Tiarosporella_madreeya_CBS_532.76, 78 Tiarosporella_graminis_var._karoo_CBS_118718, 79 Tiarosporella_tritici_CBS_118719, 80 Lasiodiplodia_venezuelensis_prov._nom._CBS_118739, 81 Lasiodiplodia_crassispora_prov._nom._CBS_118741, 82 Botryosphaeria_subglobosa_CBS_448.91, 83 Diplodia_laeliocattleyae_CBS_167.28, 84 Botryosphaeria_rhodina_CBS_287.47, 85 Botryosphaeria_rhodina_AY928054, 86 Diplodia_cajani_CBS_214.50, 87 Physalospora_zeicola_CBS_269.31, 88 Botryosphaeria_sumachi_CBS_217.25, 89 Botryosphaeria_tsugae_CBS_418.64, 90 Botryosphaeria_visci_CBS_218.25, 91 Botryosphaeria_visci_CBS_186.97, 92 Botryosphaeria_visci_CBS_100163, 93 Diplodia_pinea_CBS_393.84, 94 Botryosphaeria_stevensii_CBS_431.82, 95 Diplodia_porosum_CBS_110496, 96 Diplodia_rosulata_CBS_116470, 97 Diplodia_porosum_CBS_110574, 98 Diplodia_rosulata_CBS_116472, 99 Botryosphaeria_stevensii_CPC_12461, 100 Botryosphaeria_stevensii_AY928049, 101 Botryosphaeria_corticola_AY928051, 102 Botryosphaeria_corticola_CBS_678.88, 103 Botryosphaeria_corticola_CBS_112545, 104 Lasiodiplodia_rubropurpurea_prov._nov._CBS_118740, 105 Sphaeropsis_conspersa_CBS_209.25, 106 Botryosphaeria_stevensii_CBS_134.50, 107 Botryosphaeria_obtusa_AY928050, 108 Lasiodiplodia_gonubiensis_CBS_115812, 109 Diplodia_sp._CPC_12264, 110 Diplodia_sp._CPC_12444, 111 Diplodia_sp._CPC_12442, 112 Botryosphaeria_stevensii_CBS_123.30, 113 Botryosphaeria_rhodina_CBS_174.26, 114 Magnaporthe_grisea_AF362554, 115 Gaeumannomyces_graminis_var._avenae_AF362556; TREE StrictMissing = [&R] ((115,114),((((((((112,(111,110,109)Diplodia_sp.),113),(106,105,107),(108,80),103,102,101,104,95,96,97,98,94,100,99,93,(92,91),90,89,((84,85,86,83,87),((78,77),79)Tiarosporella),82,81,88),(75,76,73,74,72),71,(70,63,68,65,64,67,66,69)Macrophomina_phaseolina,(61,60,62,59)Neoscytalidium,(55,54,56,58,57,(53,(52,51))Botryosphaeria_viticola),(50,48,47,49,(44,43)Dichomera_eucalypti,41,42,(35,34)Neofusicoccum_luteum,38,40,37,36,39,(46,45)Neofusicoccum_mangiferum)Neofusicoccum),30,29),((33,(32,31)Pseudofusicoccum_stromaticum)Pseudofusicoccum,((27,(((24,26)Guignardia_bidwellii,23),(22,21),25)),28)Guignardia)),(((19,(18,17))Camarosporium,((15,(14,13)),16)),20)),((9,8,7,6,(5,(4,3)),(2,1),10,11),12))); END; BEGIN TREES; TITLE Tb7808; LINK TAXA = Taxa1; TRANSLATE 1 Diaporthe_eres_AF362565, 2 Diaporthe_sp._CBS_134.42, 3 Taeniolella_alta_CBS_488.80, 4 Phomopsis_sp._CPC_12258, 5 Diaporthe_angelicae_AY196781, 6 Stenocarpella_maydis_CBS_117559, 7 Stenocarpella_maydis_CBS_117558, 8 Stenocarpella_maydis_CBS_117557, 9 Stenocarpella_macrospora_CBS_117560, 10 Diaporthe_decedens_AF408348, 11 Phomopsis_sclerotioides_AF439628, 12 Diaporthe_pustulata_AF408358, 13 Microdiplodia_sp._CPC_12268, 14 Letendraea_helminthicola_AY016362, 15 Karstenula_rhodostoma_AY787933, 16 Byssothecium_circinans_AY016357, 17 Camarosporium_quaternatum_CBS_483.95, 18 Camarosporium_sp._CPC_12441, 19 Camarosporium_quaternatum_CBS_134.97, 20 Phyllosticta_flevolandica_CBS_998.72, 21 Guignardia_sp._CPC_11867, 22 Guignardia_sp._CPC_10978, 23 Guignardia_philoprina_CBS_447.68, 24 Guignardia_bidwellii_CBS_111645, 25 Phyllosticta_sp._CPC_11336, 26 Guignardia_bidwellii_CBS_237.48, 27 Phyllosticta_sp._CPC_12073, 28 Guignardia_citricarpa_CBS_102374, 29 Saccharata_proteae_CBS_115206, 30 Botryosphaeria_melanops_CBS_118.39, 31 Pseudofusicoccum_stromaticum_CBS_117449, 32 Pseudofusicoccum_stromaticum_CBS_117448, 33 Pseudofusicoccum_sp._CBS_117451, 34 Neofusicoccum_luteum_AY928043, 35 Neofusicoccum_luteum_CPC_10899, 36 Neofusicoccum_arbuti_CBS_117090, 37 Neofusicoccum_arbuti_CBS_117089, 38 Neofusicoccum_arbuti_CBS_116573, 39 Neofusicoccum_andinum_CBS_117453, 40 Neofusicoccum_arbuti_CBS_116574, 41 Neofusicoccum_arbuti_CBS_116131, 42 Dichomera_versiformis_CBS_118101, 43 Dichomera_eucalypti_CBS_118100, 44 Dichomera_eucalypti_CBS_118099, 45 Neofusicoccum_mangiferum_CBS_118532, 46 Neofusicoccum_mangiferum_CBS_118531, 47 Neofusicoccum_parvum_AY928046, 48 Neofusicoccum_ribis_AY928044, 49 Neofusicoccum_parvum_AY928045, 50 Neofusicoccum_ribis_AY004336, 51 Botrysphaeria_viticola_CBS_117009, 52 Botryosphaeria_viticola_CBS_112870, 53 Botryosphaeria_viticola_CBS_112869, 54 Botryosphaeria_sarmentorum_AY928052, 55 Botryosphaeria_iberica_CBS_115041, 56 Diplodia_juglandis_CBS_188.87, 57 Botryosphaeria_sarmentorum_CBS_115038, 58 Botryosphaeria_sarmentorum_CBS_120.41, 59 Neoscytalidium_dimidiatum_CBS_499.66, 60 Neoscytalidium_dimidiatum_CBS_312.90, 61 Neoscytalidium_hyalinum_CBS_145.78, 62 Neoscytalidium_dimidiatum_CBS_251.49, 63 Macrophomina_phaseolina_CPC_11070, 64 Macrophomina_phaseolina_CPC_11106, 65 Macrophomina_phaseolina_CPC_11085, 66 Macrophomina_phaseolina_CBS_162.25, 67 Macrophomina_phaseolina_CPC_11108, 68 Macrophomina_phaseolina_CPC_11079, 69 Macrophomina_phaseolina_CBS_227.33, 70 Macrophomina_phaseolina_CPC_11052, 71 Botryosphaeria_mamane_CBS_117444, 72 Botryosphaeria_dothidea_CBS_331.33, 73 Dichomera_saubinetii_CBS_990.70, 74 Botryosphaeria_dothidea_CBS_110300, 75 Botryosphaeria_dothidea_CBS_115476, 76 Botryosphaeria_dothidea_CBS_769.71, 77 Tiarosporella_madreeya_CBS_532.76, 78 Tiarosporella_graminis_var._karoo_CBS_118718, 79 Tiarosporella_tritici_CBS_118719, 80 Lasiodiplodia_venezuelensis_prov._nom._CBS_118739, 81 Lasiodiplodia_crassispora_prov._nom._CBS_118741, 82 Botryosphaeria_subglobosa_CBS_448.91, 83 Diplodia_laeliocattleyae_CBS_167.28, 84 Botryosphaeria_rhodina_CBS_287.47, 85 Botryosphaeria_rhodina_AY928054, 86 Diplodia_cajani_CBS_214.50, 87 Physalospora_zeicola_CBS_269.31, 88 Botryosphaeria_sumachi_CBS_217.25, 89 Botryosphaeria_tsugae_CBS_418.64, 90 Botryosphaeria_visci_CBS_218.25, 91 Botryosphaeria_visci_CBS_186.97, 92 Botryosphaeria_visci_CBS_100163, 93 Diplodia_pinea_CBS_393.84, 94 Botryosphaeria_stevensii_CBS_431.82, 95 Diplodia_porosum_CBS_110496, 96 Diplodia_rosulata_CBS_116470, 97 Diplodia_porosum_CBS_110574, 98 Diplodia_rosulata_CBS_116472, 99 Botryosphaeria_stevensii_CPC_12461, 100 Botryosphaeria_stevensii_AY928049, 101 Botryosphaeria_corticola_AY928051, 102 Botryosphaeria_corticola_CBS_678.88, 103 Botryosphaeria_corticola_CBS_112545, 104 Lasiodiplodia_rubropurpurea_prov._nov._CBS_118740, 105 Sphaeropsis_conspersa_CBS_209.25, 106 Botryosphaeria_stevensii_CBS_134.50, 107 Botryosphaeria_obtusa_AY928050, 108 Lasiodiplodia_gonubiensis_CBS_115812, 109 Diplodia_sp._CPC_12264, 110 Diplodia_sp._CPC_12444, 111 Diplodia_sp._CPC_12442, 112 Botryosphaeria_stevensii_CBS_123.30, 113 Botryosphaeria_rhodina_CBS_174.26, 114 Magnaporthe_grisea_AF362554, 115 Gaeumannomyces_graminis_var._avenae_AF362556; TREE StrictNew = [&R] ((115,114),((((((((112,(111,110,109)Diplodia_sp.),113),(106,105,107),(108,80),103,102,101,104,95,96,97,98,94,100,99,93,(92,91),90,89,((84,85,86,83,87),((78,77),79)Tiarosporella),82,81,88),(75,76,73,74,72),71,(70,63,68,65,64,67,66,69)Macrophomina_phaseolina,(61,60,62,59)Neoscytalidium,(55,54,56,58,57,(53,(52,51))),(50,48,47,49,(44,43)Dichomera_eucalypti,41,42,(35,34)Neofusicoccum_luteum,38,40,37,36,39,(46,45)Neofusicoccum_mangiferum)Neofusicoccum),30,29),((33,(32,31)Pseudofusicoccum_stromaticum)Pseudofusicoccum,((27,(((24,26)Guignardia_bidwellii,23),(22,21),25)),28)Guignardia)),(((19,(18,17))Camarosporium,((15,(14,13)),16)),20)),((9,8,7,6,(5,(4,3)),(2,1),10,11),12))); END; BEGIN TREES; TITLE Tb7806; LINK TAXA = Taxa1; TRANSLATE 1 Diaporthe_eres_AF362565, 2 Diaporthe_sp._CBS_134.42, 3 Taeniolella_alta_CBS_488.80, 4 Phomopsis_sp._CPC_12258, 5 Diaporthe_angelicae_AY196781, 6 Stenocarpella_maydis_CBS_117559, 7 Stenocarpella_maydis_CBS_117558, 8 Stenocarpella_maydis_CBS_117557, 9 Stenocarpella_macrospora_CBS_117560, 10 Diaporthe_decedens_AF408348, 11 Phomopsis_sclerotioides_AF439628, 12 Diaporthe_pustulata_AF408358, 13 Microdiplodia_sp._CPC_12268, 14 Letendraea_helminthicola_AY016362, 15 Karstenula_rhodostoma_AY787933, 16 Byssothecium_circinans_AY016357, 17 Camarosporium_quaternatum_CBS_483.95, 18 Camarosporium_sp._CPC_12441, 19 Camarosporium_quaternatum_CBS_134.97, 20 Phyllosticta_flevolandica_CBS_998.72, 21 Guignardia_sp._CPC_11867, 22 Guignardia_sp._CPC_10978, 23 Guignardia_philoprina_CBS_447.68, 24 Guignardia_bidwellii_CBS_111645, 25 Phyllosticta_sp._CPC_11336, 26 Guignardia_bidwellii_CBS_237.48, 27 Phyllosticta_sp._CPC_12073, 28 Guignardia_citricarpa_CBS_102374, 29 Saccharata_proteae_CBS_115206, 30 Botryosphaeria_melanops_CBS_118.39, 31 Pseudofusicoccum_stromaticum_CBS_117449, 32 Pseudofusicoccum_stromaticum_CBS_117448, 33 Pseudofusicoccum_sp._CBS_117451, 34 Neofusicoccum_luteum_AY928043, 35 Neofusicoccum_luteum_CPC_10899, 36 Neofusicoccum_arbuti_CBS_117090, 37 Neofusicoccum_arbuti_CBS_117089, 38 Neofusicoccum_arbuti_CBS_116573, 39 Neofusicoccum_andinum_CBS_117453, 40 Neofusicoccum_arbuti_CBS_116574, 41 Neofusicoccum_arbuti_CBS_116131, 42 Dichomera_versiformis_CBS_118101, 43 Dichomera_eucalypti_CBS_118100, 44 Dichomera_eucalypti_CBS_118099, 45 Neofusicoccum_mangiferum_CBS_118532, 46 Neofusicoccum_mangiferum_CBS_118531, 47 Neofusicoccum_parvum_AY928046, 48 Neofusicoccum_ribis_AY928044, 49 Neofusicoccum_parvum_AY928045, 50 Neofusicoccum_ribis_AY004336, 51 Botrysphaeria_viticola_CBS_117009, 52 Botryosphaeria_viticola_CBS_112870, 53 Botryosphaeria_viticola_CBS_112869, 54 Botryosphaeria_sarmentorum_AY928052, 55 Botryosphaeria_iberica_CBS_115041, 56 Diplodia_juglandis_CBS_188.87, 57 Botryosphaeria_sarmentorum_CBS_115038, 58 Botryosphaeria_sarmentorum_CBS_120.41, 59 Neoscytalidium_dimidiatum_CBS_499.66, 60 Neoscytalidium_dimidiatum_CBS_312.90, 61 Neoscytalidium_hyalinum_CBS_145.78, 62 Neoscytalidium_dimidiatum_CBS_251.49, 63 Macrophomina_phaseolina_CPC_11070, 64 Macrophomina_phaseolina_CPC_11106, 65 Macrophomina_phaseolina_CPC_11085, 66 Macrophomina_phaseolina_CBS_162.25, 67 Macrophomina_phaseolina_CPC_11108, 68 Macrophomina_phaseolina_CPC_11079, 69 Macrophomina_phaseolina_CBS_227.33, 70 Macrophomina_phaseolina_CPC_11052, 71 Botryosphaeria_mamane_CBS_117444, 72 Botryosphaeria_dothidea_CBS_331.33, 73 Dichomera_saubinetii_CBS_990.70, 74 Botryosphaeria_dothidea_CBS_110300, 75 Botryosphaeria_dothidea_CBS_115476, 76 Botryosphaeria_dothidea_CBS_769.71, 77 Tiarosporella_madreeya_CBS_532.76, 78 Tiarosporella_graminis_var._karoo_CBS_118718, 79 Tiarosporella_tritici_CBS_118719, 80 Lasiodiplodia_venezuelensis_prov._nom._CBS_118739, 81 Lasiodiplodia_crassispora_prov._nom._CBS_118741, 82 Botryosphaeria_subglobosa_CBS_448.91, 83 Diplodia_laeliocattleyae_CBS_167.28, 84 Botryosphaeria_rhodina_CBS_287.47, 85 Botryosphaeria_rhodina_AY928054, 86 Diplodia_cajani_CBS_214.50, 87 Physalospora_zeicola_CBS_269.31, 88 Botryosphaeria_sumachi_CBS_217.25, 89 Botryosphaeria_tsugae_CBS_418.64, 90 Botryosphaeria_visci_CBS_218.25, 91 Botryosphaeria_visci_CBS_186.97, 92 Botryosphaeria_visci_CBS_100163, 93 Diplodia_pinea_CBS_393.84, 94 Botryosphaeria_stevensii_CBS_431.82, 95 Diplodia_porosum_CBS_110496, 96 Diplodia_rosulata_CBS_116470, 97 Diplodia_porosum_CBS_110574, 98 Diplodia_rosulata_CBS_116472, 99 Botryosphaeria_stevensii_CPC_12461, 100 Botryosphaeria_stevensii_AY928049, 101 Botryosphaeria_corticola_AY928051, 102 Botryosphaeria_corticola_CBS_678.88, 103 Botryosphaeria_corticola_CBS_112545, 104 Lasiodiplodia_rubropurpurea_prov._nov._CBS_118740, 105 Sphaeropsis_conspersa_CBS_209.25, 106 Botryosphaeria_stevensii_CBS_134.50, 107 Botryosphaeria_obtusa_AY928050, 108 Lasiodiplodia_gonubiensis_CBS_115812, 109 Diplodia_sp._CPC_12264, 110 Diplodia_sp._CPC_12444, 111 Diplodia_sp._CPC_12442, 112 Botryosphaeria_stevensii_CBS_123.30, 113 Botryosphaeria_rhodina_CBS_174.26, 114 Magnaporthe_grisea_AF362554, 115 Gaeumannomyces_graminis_var._avenae_AF362556; TREE Fig._2 = [&R] (115,114,(((((((((112,(111,110,109)Diplodia_sp.),113),(106,105,107),(108,80),(103,102,101)Botryosphaeria_corticola,104,95,96,97,98,94,100,99,93,(92,91),90,89,(84,85,86,83,87),82,81,((78,79),77)Tiarosporella,88),((75,76,73,74,72),(70,63,68,65,64,67,66,69)Macrophomina_phaseolina),(71,((61,62,59),60)Neoscytalidium)),((55,54,56,58,57,(53,(52,51))Botryosphaeria_viticola),((50,48,47,49,(44,43)Dichomera_eucalypti,(35,34)Neofusicoccum_luteum,(46,45)Neofusicoccum_mangiferum),(41,38,40,37,36,39),42)Neofusicoccum)),((33,(32,31)Pseudofusicoccum_stromaticum)Pseudofusicoccum,((27,(((24,26)Guignardia_bidwellii,23),((22,21),25))),28)Guignardia)),30,29),(((19,(18,17))Camarosporium,((15,(14,13)),16)),20)),((9,8,7,6,((5,(4,3)),((2,1),10),11)),12))); END;