#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 3:58 GMT TreeBASE (cc) 1994-2008 Study reference: Crous P.W., Liebenberg M., Braun U., & Groenewald J.Z. 2006. Re-evaluating the taxonomic status of Phaeoisariopsis griseola, the causal agent of angular leaf spot of bean. Studies in Mycology, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1562] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=45; TAXLABELS Cladosporium_herbarum Davidiella_tassiana Pseudocercospora_basiramifera Pseudocercospora_eucalyptorum_AF309598 Pseudocercospora_eucalyptorum_AF309599 Pseudocercospora_griseola_f._griseola_AF222834 Pseudocercospora_griseola_f._griseola_CBS_194.47 Pseudocercospora_griseola_f._griseola_CBS_880.72 Pseudocercospora_griseola_f._griseola_CPC_10457 Pseudocercospora_griseola_f._griseola_CPC_10458 Pseudocercospora_griseola_f._griseola_CPC_10459 Pseudocercospora_griseola_f._griseola_CPC_10460 Pseudocercospora_griseola_f._griseola_CPC_10464 Pseudocercospora_griseola_f._griseola_CPC_10465 Pseudocercospora_griseola_f._griseola_CPC_10467 Pseudocercospora_griseola_f._griseola_CPC_10468 Pseudocercospora_griseola_f._griseola_CPC_10469 Pseudocercospora_griseola_f._griseola_CPC_10477 Pseudocercospora_griseola_f._griseola_CPC_10480 Pseudocercospora_griseola_f._griseola_CPC_10481 Pseudocercospora_griseola_f._griseola_CPC_10484 Pseudocercospora_griseola_f._griseola_CPC_10779 Pseudocercospora_griseola_f._griseola_CPC_12238 Pseudocercospora_griseola_f._griseola_CPC_12239 Pseudocercospora_griseola_f._griseola_CPC_12240 Pseudocercospora_griseola_f._griseola_CPC_5592 Pseudocercospora_griseola_f._griseola_CPC_5594 Pseudocercospora_griseola_f._mesoamericana_CPC_10463 Pseudocercospora_griseola_f._mesoamericana_CPC_10474 Pseudocercospora_griseola_f._mesoamericana_CPC_10479 Pseudocercospora_griseola_f._mesoamericana_CPC_12241 Pseudocercospora_griseola_f._mesoamericana_CPC_12242 Pseudocercospora_griseola_f._mesoamericana_CPC_5596 Pseudocercospora_griseola_f._mesoamericana_CPC_5597 Pseudocercospora_musae_AY266148 Pseudocercospora_musae_AY266149 Pseudocercospora_natalensis Pseudocercospora_paraguayensis Pseudocercospora_protearum_var._leucadendri Pseudocercospora_robusta Pseudocercospora_syzygiicola Pseudocercospora_vitis_CPC_11595 Pseudocercospora_vitis_CPC_11660 Stigmina_platani_AF222849 Stigmina_platani_AY260090 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=29; TAXLABELS Batcheloromyces_proteae Cercospora_zebrina Cladosporium_cladosporioides Cladosporium_herbarum Dissoconium_dekkeri Mycosphaerella_latebrosa Mycosphaerella_nubilosa Mycosphaerella_ohnowa Mycosphaerella_populorum Mycosphaerella_punctiformis Mycosphaerella_sp._AY251115 Mycosphaerella_sp._AY251116 Passalora_fulva Passalora_janseana Pseudocercospora_cruenta Pseudocercospora_griseola_CBS_194.47 Pseudocercospora_griseola_CBS_880.72 Pseudocercospora_griseola_CPC_10779 Pseudocercospora_protearum_var._leucadendri Pseudocercospora_vitis Pseudocladosporium_hachijoensis Ramularia_sp. Ramulispora_sorghi_AY251110 Ramulispora_sorghi_AY251111 Septoria_epambrosiae Septoria_rosae Septoria_tritici Stigmina_platani Trimmatostroma_macowanii ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1208] TITLE Combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1117; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cladosporium_herbarum -----------------ATCATTACAAGAACGCCCGGGCTTCGGCCTGGTTATTCATAACCCTTTGTTG-TCCGACTCT-GTTGCCTCCGGGGCGACCCTGCC-------TTCGGGCGG-GGGCT--CCGGGTGGACACTTC-AAACTCTTGCGTAACTTTGCAGTCTGAGTA-AACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGG--TCCGCCGCGTGCCTCAAA-TCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGG-------AAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACC-----------------------?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTCCAA---AAACACCCGCAACCCTGCCTGCCAGCCAGACGGCCAGCTGACAACATCTTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCTTCTCCTCCTCCTTGATCACCACCGGATCCAACGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTCTTCGTAAGTGACTGCCTAG---CCCACATGCCTA--CCACTACAGTGCGAGGCTGACTCTCTGGATCAGGACAAGGATGGCGA----------------------------------------------------CGGACAGATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACCATCGACTTCCCCGAGTTCCTGACCATGATGGCCAGAAAGATG Davidiella_tassiana -------------AGGGATCATTACAAGAACGCCCGGGCTTCGGCCTGGTTATTCATAACCCTTTGTTG-TCCGACTCT-GTTGCCTCCGGGGCGACCCTGCC-------TTCGGGCGG-GGGCT--CCGGGTGGACACTTC-AAACTCTTGCGTAACTTTGCAGTCTGAGTA-AACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGG--TCCGCCGCGTGCCTCAAA-TCGTCCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGG-------AAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTCCATCAGAAACACCCATTTCA---CCC-CCAGCCAGACGGCCAGCTGACAGCATCCTAGCTTCCATTGTCGGCAGACCCCGTCACCATGGGTATGCTCCTCTTTACCTCCCTAACCACCACCGGATTCAATGTCTAACCGCAGCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTCTTCGTAAGTGACTGCCTAGTAGCCCA--TGCATTCGCCAGCACCGCGCGAGGCTGACTCCCTGGCTCAGGACAAGGATGGCGA----------------------------------------------------CGGACAGATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCGCTCGGCCAGAACCCTTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACAATCGACTTCCCCGAGTTCCTGACCATGATGGCCAGAAAGATG Pseudocercospora_basiramifera ------------GAGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCTTTGT-GAACCAAACTT-GTTGCTTCGGGGGCGACCCTGCCGACG-ACTTG-GTCGCCGGGCGCCCCCGGAGGT--CTTCTAAACACT-GCAT--CTTTGC-GTCGGAGTT-TAA-A-CA-AATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGTGTT--CCGCGCGCCTTAAAGTCTTCCGGCTGAGCTGTCCGTC-TCTAAGCGTTGTGG-ATTTTTCAATT---CGCTTCGGAGTGCGGATGGCCGC-GGCCGTTAAA--TCTTTA-TTCAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_eucalyptorum_AF309598 ------------AAGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCTTTGT-GAACCACACTT-GTTGCTTCGGGGGCGACCCTGCCGGC--ACTTC-GTCGCCGGGCGCCCCCGGAGGT--CTCC-AAACACT-GCAT--CTTTGC-GTCGGAGTT-TAA-A-CA-AATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGG--CT--CCGCGCGCCTTAAAGTC-TCCGGGTGAGCCATTCGTC-TCTAAGCGTTGTGG-ATTTTTCAATT---CGCTTCGGAGTGCGGGTGGCCGC-GGCCGTTAAA--TCTTTA-TTCAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_eucalyptorum_AF309599 ------------GAGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCTTTGT-GAACCACACTT-GTTGCTTCGGGGGCGACCCTGCCGGC--ACTTC-GTCGCCGGGCGCCCCCGGAGGT--CTCC-AAACACT-GCAT--CTTTGC-GTCGGAGTT-TAA-A-CA-AATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGG--CT--CCGCGCGCCTTAAAGTC-TCCGGCTGAGCCATTCGTC-TCTAAGCGTTGTGG-ATTTTTCAATT---CGCTTCGGAGTGCGGGTGGCCGC-GGCCGTTAAA--TCTTTA-TTCAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_griseola_f._griseola_AF222834 ------------GAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_griseola_f._griseola_CBS_194.47 GGTGAACCTGCGGAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CBS_880.72 GGTGAACCTGCGGAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGG---------?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10457 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGG--------?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10458 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGG---------?????------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10459 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10460 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10464 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10465 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10467 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGT------?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10468 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10469 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10477 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10480 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGAT------?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10481 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10484 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGG---------?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_10779 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTA-----------?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_12238 GGTGAACCTGCGGAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAGCCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACAAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_12239 GGTGAACCTGCGGAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTAAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAGCCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACAAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_12240 GGTGAACCTGCGGAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_5592 ------------GAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGT------?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._griseola_CPC_5594 ------------GAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTTGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCGGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACTTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACCACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCCTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._mesoamericana_CPC_10463 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTCGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCCGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACCTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCTTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._mesoamericana_CPC_10474 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTCGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCCGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACCTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCTTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._mesoamericana_CPC_10479 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTCGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCCGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGAT------?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACCTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCTTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._mesoamericana_CPC_12241 GGTGAACCTGCGGAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AACGTCGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCCGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACCTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCTTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._mesoamericana_CPC_12242 GGTGAACCTGCGGAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTCGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCCGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACCTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCTTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._mesoamericana_CPC_5596 ------------GAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTCGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCCGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACCTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCTTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_griseola_f._mesoamericana_CPC_5597 ------------GAGGGATCATTACC-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCACTGT-GAACC-AATGTCGTTGCTTCGGGGGCGACCCTGCCGGC--ACTCT-GTCGCCGGGCGCCCCCGGAGGT--CTCCTGAACACT-GCAT--CTCTGC-GTCGGAGTT-CAA-T-TA-AATCGAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTCTTGGGCGTCGCGG-GCTCCCCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGAC-TCTAAGCGCTGTGGCAC---TTAACTATTCGCTTCCGAGTACGGGCGGCCGC-GGCCGTTAAA--TCTTCA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-----TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCGCGAGCTGTCTTCCGTAAGTACCTCTGCTATCAATGGCGACCAGCGGCGGAGAGCTGACACCATTATACAGCAT--------CCATCGTCGGCCGGCCACGTCACCATGGGTATGCGATTCTTTT-----CTCCGAGTCGACGGAGCAAAT-TCTGACAAGAGCATAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA-----?????-----GAGTTCAAGGAGGCCTTCTCCCTTTTCGTAAGTGATTTAACCCGTACCTTCTGGATTTCGGAAGCTCA-----AGGCTGACTACGTCACACAGGACAAGGACGGCGATGGTACGACTACCTCCTTCTCGATGCGCGACGAATATCTGACATGTGCGCGCAGGACAGATCACCACTAAAGAGCTGGGCACTGTAATGCGCTCCCTTGGACAGAACCCTTCCGAGTCTGAGTTGCAAGACATGATCAACGAAGTCGACGCCGACAACAATGGCACAATCGACTTTCCCGAGTTCCTCACCATGATGGCCAGAAAGATG Pseudocercospora_musae_AY266148 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-CCCCG-ACCTCCAACCCTTTGT-GAACCACACCT-GTTGCTTCGGGGGCGGCCCTGCCGGCGAACTC--GTCGCCGGGCGCCCCCGGAGGT--CTCCTTAACACT-GCAT--CTCTAC-GTCGGAGTTCCAA-A-CA-AATCGGACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGCT--CCGCGCGCCCCAAAGTCTCCCGGCTGAGCCGTCCGTC-TCTAAGCGTTGTGG-ATTTTTC-AGT--TCGCTCCGGAGTGCGGGTGGCCGC-GGCCGTTAAA--TC-----TTCAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_musae_AY266149 -------------AGGGATCATTACC-GAG-TGA-GGGCT-CAC-CCCCG-ACCTCCAACCCTTTGT-GAACCACACCT-GTTGCTTCGGGGGCGACCCTGCCGGCGAACTT--GTCGCCGGGCGCCCCCGGAGGT--CTCCTTAACACT-GCAT--CTCTGC-GTCGGAGTTCCAA-A-CA-AATCGGACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGCATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGCT--CCGCGCGCCCCAAAGTCTCCCGGCTAAGCCGTCCGTC-TCTAAGCGTTGTGG-ATTTTTC-AGT--TCGCTCCGGAGCGCGGGTGGCCGC-GGCCGTTAAA--TC-----TTCAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_natalensis ------------GAGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCTTTGT-GAACCACACTT-GTTGCTTCGGGGGCGACCCTGCCGGC--ACTTC-GTCGCCGGGCGCCCCCGAAGGT--CTCC-AAACACT-GCAT--CTTTGC-GTCGGAGTT-TAA-A-CA-AATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGG--TG--CCGCGCGCCTTAAAGTC-TCCGGCTGAGCCATTCGTC-TCTAAGCGTTGTGG-ATT-TTCAATT---CGCTTCGGAGTGCGGGTGGCCGC-GGCCGTTAAA--TCTTTA-TTCAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_paraguayensis ------------GAGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-CCCTCCAACCCTTTGT-GAACCAAACTT-GTTGCTTCGGGGGCGACCCTGCCGACG-ACTCC-GTCGCCGGGCGCCCCCGGAGGT--CTTCTAAACACT-GCAT--CTTTGC-GTCGGAGTT-TAA-A-CA-AATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGTGTT--CCGCGCGCCTTAAAGTCTTCCGGCTGAGCTGTCCGTC-TCTAAGCGTTGTGG-ATTTTTCAATT---CGCTTCGGAGTGCGGATGGCCGC-GGCCGTTAAA--TCTTTA-TTCAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_protearum_var._leucadendri -------------AGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCGACCCTTTGT-GAACACAATCTTGTTGCTTCGGGGGCGACCCTGCCGGC--CCTTG-GTCGCCGGGCGCCCCCGAATTG--TCTCCAAACACT-GCAT--CTCTGC-GTCGGAGTT-TAA-A-CA-AATCAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGAAGAGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGG--CT--CCGCGCGCCTCAAAGTC-TCCGGCTGAGCCATTCGTC-TCTAAGCGTTGTGG-ATTTTCGAATT---CGCTTCGGAGTGCGGGTGGCCGC-GGCCGTTAAA--TCTTCA-TTCAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_robusta ------------GAGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-CCCTCCAACCCTTTGT-GAACCACACTT-GTTGCTTCGGGGGCGACCCTGCCGGC--ACTTC-GTCGCCGGGCGCCCCCGAAGGT--CTCC-AAACACT-GCAT--CTCTGC-GTCGGAGTT-TAA-A-CA-AATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGG--CT--CCCCGCGCCTTAAAGTC-TCCGGCTGAGCCATTCGTC-TCTAAGCGTTGTGG-ATTTTTCAATT---CGCTTTGGAGCGCGGGTGGCCGC-GGCCGTTAAA--TCTTTA-TTGAAAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_syzygiicola ------------GAGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCTTTGT-GAACCACACTT-GTTGCTTCGGGGGCGACCCTGCCGGC--ACTTC-GTCGCCGGGCGCCCCCGAAGGT--CTCC-AAACACT-GCAT--CTTTGC-GTCGGAGTT-TAA-A-CA-AATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGCGAATCATCCAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGGTTGGTATTGGGCGTCGCGG--CT--CCGCGCGCCTTAAAGTC-TCCGGCTGAGCCATTCGTC-TCTAAGCGTTGTGG-ATTTTTCAATT---CGCTTCGGAGTGCGGGTGGCCGC-GGCCGTTAAA--TCTTTA-TTCAAAGGTTGACCTCGGATCAAGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_vitis_CPC_11595 -------------AGGGATCATTACT-GAG-TGA-GGGCT-CGC-GCCCG-ACCTCCAACCCTTTGT-GAACCAAATCCTGTTGCTTCGGGGGCGACCCTGCCGGC--ACACC-GTCGCCGGGCGCCCCCGGAGGT--CTTC-AAACACT-GCAT--CTTTGC-GTCGGAGTT-TAA-ATCA-AATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGTCGCGG--CT--CCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGTC-TCTAAGCGTTGTGGAAA--TTCAACTATTCGCTTCGGAGTGCGGGCGGCCGC-GGCCGTTAAA--TCTTTA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudocercospora_vitis_CPC_11660 -------------AGGGATCATTACT-GAG-TGA-GGGCT-CGC-GCCCG-ACCTCCAACCCTTTGT-GAACCAAATCCTGTTGCTTCGGGGGCGACCCTGCCGGC--ACACC-GTCGCCGGGCGCCCCCGGAGGT--CTTC-AAACACT-GCAT--CTTTGC-GTCGGAGTT-TAA-ATCA-AATAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGG--CT--CCGCGCGCCTTAAAGTC-TCCGGCTGAGCTGTCCGTC-TCTAAGCGTTGTGGCAA--TTCAACTATTCGCTTCGGGGTGCGGGCGGCCGC-GGCCGTTAAA--TCTTTA-TTC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Stigmina_platani_AF222849 -------------AGGGATCATTAGT-GAG-TGA-GGGCT-CAC-GCCCGAACCTCCAACCCTTTGG-AAACAC-ATCT-GGTGCTTCGGGGGCGACCCGGCCG----------GT-GCCGGGCGCCCCCGGAGGT--CTTCTCAACACT-GCAT--TTTTGC-GTCCGAGTC-TGA-TACA-AATCAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGG--CTCCCCGCGCGCCTTAAAGTC-CCCGGCTGAGCTGTCCGTC-TCCAAGCGTTGTGGCA---TTCAACTATTCGCTTTGGAGCACGGGCGGCCGC-GGCCGTTAAA--TCCTCG-CAC-AAGCTTATCAAGAGCGAAGGAGCATATC-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Stigmina_platani_AY260090 -------------AGGGATCATTACT-GAG-TGA-GGGCT-CAC-GCCCG-ACCTCCAACCCTTTGT-GAACAC-ATCTCGTTGCTTCAGAGGCGACCCGGCCG----------GT-GCCGGGCGCCCCCGGAGGT--CTTCTCAACACT-GCAT--TTTTGC-GTCCGAGTC-TGA-TACA-AATCAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGG--CTCCCCGCGCGCCTTAAAGTC-CCCGGCTGAGCTGTCCGTC-TCCAAGCGTTGTGGCA--TTTCAACTATTCGCTTTGGAGCGCGGGCGGCCGC-GGCCGTTAAA--TCCTCA-CAC-AAGGTTGACCTCGGATCAGGTAGGGATA-----?????-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------?????--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN SETS; CHARSET act (CHARACTERS = Combined) = 551-785; CHARSET its (CHARACTERS = Combined) = 18-516; CHARSET cal (CHARACTERS = Combined) = 802-1117; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Combined) = N: 1-1117; CODONPOSSET CodonPositions (CHARACTERS = Combined) = N: 1-1117; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1206] TITLE 18S_rRNA; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1407; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Batcheloromyces_proteae ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTCAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACGCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTCAACCATAAACTATGCCGACTAGGGATCGGTGGATGTT-CTCTTTTGAACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Cercospora_zebrina ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Cladosporium_cladosporioides ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAGAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAGCGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAACCTCATGCCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATTGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACGGTGTTAGTATTTTGA-CCCGTTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Cladosporium_herbarum ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAACCTCATGCCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATTGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACGGTGTTAGTATTTTGA-CCCGTTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Dissoconium_dekkeri ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTCACTACATGGACAACTGTGGCAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTACGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTCTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCGTCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTCGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGGTGTTATTATTTTGA-CCCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Mycosphaerella_latebrosa ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTTACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTAGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCTAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Mycosphaerella_nubilosa ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTACATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTTCTATATTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Mycosphaerella_ohnowa ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGGACGTCCAGTCCCAATGCTGGCGCCAGAAGCAGTGAGGCCCCAACTCACTAGTCGATGCACCCACCAACAGAGAGGGCGGGTGCCGGCAAGACGACCTGGTACGAGGGACCCCTTAACGGCCGCCTATAGGTGGGGCCGAAGGCAATCTCGTGGCGACCTCCCTCACACGGAGGCGTCGTAACGCGCGGAAAGGCGTCGGTCGCGATAAGCGGCTTAAGGAACGTGCTAGACCCGAGGGAAACCTCGCTCCTTCTGATCAGCCCCCTCTCGGCGAAGCAGTGGAGGCGCCCGGCGAACGGGTGTGGACGAGTCAATGAAAATCGGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGATCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGACGTTTCTATTTTGA-CGCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Mycosphaerella_populorum ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCTATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGGTATT-TTTTGC-CTCCATCGGCACCTTACGAGAAATCAAAGTTTT-GGGTTC-GGGGGGAGTATGGTC????? Mycosphaerella_punctiformis ---ATGCATGTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TC----- Mycosphaerella_sp._AY251115 ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTGCTTGGTGAATCATAATAACTTTACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGCTCGGCCGGGCCTTTCCTTCTGGGGGAGCCGCATGCCCTTCACTGGGCGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Mycosphaerella_sp._AY251116 ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Passalora_fulva ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCCTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGC--- Passalora_janseana ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTCATGGGTTCTGGGGGGAGTATG-TCGCAAG Pseudocercospora_cruenta ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCTCATGCCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Pseudocercospora_griseola_CBS_194.47 --------------AGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTCACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCTCATGTCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGA------------- Pseudocercospora_griseola_CBS_880.72 -------------------------CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTCACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCCTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCTCATGTCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTG-------------------------- Pseudocercospora_griseola_CPC_10779 -------------------------CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTCACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCTCATGTCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTT---------------------------- Pseudocercospora_protearum_var._leucadendri ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTCCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCTCATGCCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Pseudocercospora_vitis -----------------------AACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCTGGGCCTTTCCTTCTGGG-GAGCCTCATGCCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTT----------------------------- Pseudocladosporium_hachijoensis ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAGCCTCGACTTCGGAAGAGGTGTACTTATTAGATAAAAAACCAATGCCCTTCGGGGCTGCTTGGTGAATCATAATAATTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATGCCGACACGGCGAGGTAGTGACAATAAATACTGATCCAGGGCTCTTTCGGGTCTTGGAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAACTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAGTAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCCGGTCCGCCTCACCGCGTGTTACTGGTCCGGCCGGACCTTTCCTTCTGGG-GAACCGCATGGCCTTCACTGGCCGTGTCGGGGATCCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATTGAATAGGACGT-GCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTACTATTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Ramularia_sp. ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTCCAGCCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCGTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCGGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTGTAGA-CTCCATCGGCACCTTACGAGAAATCAAAGATCGTGGGTTCTGGGGGGAGTATG-TCGCA?? Ramulispora_sorghi_AY251110 ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCACAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Ramulispora_sorghi_AY251111 ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCACAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Septoria_epambrosiae GCCATGCATGTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Septoria_rosae ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGATCGTGGCTTCTGGGGGGAGTATG-TCGCAAG Septoria_tritici ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGTCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Stigmina_platani ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTCCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCTCATGCCCTTCACTGGGCGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTGTTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGA-CTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGA------------- Trimmatostroma_macowanii ---------GTCTAAGTATAAGCAACTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGT-ACTGGTCCGGCCGGGCCTTTCCTTCTGGG-GAGCCGCATGCCCTTCACTGGGCGTGCCGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGCGGGTGTTTCTATTTTGA-CCCCGTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG ; END; BEGIN SETS; CHARSET ssu (CHARACTERS = 18S_rRNA) = 26-515 840-1378; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 18S_rRNA) = N: 1-1407; CODONPOSSET CodonPositions (CHARACTERS = 18S_rRNA) = N: 1-1407; END; BEGIN TREES; TITLE Tb7812; LINK TAXA = Taxa2; TRANSLATE 1 Batcheloromyces_proteae, 2 Mycosphaerella_ohnowa, 3 Mycosphaerella_nubilosa, 4 Trimmatostroma_macowanii, 5 Dissoconium_dekkeri, 6 Mycosphaerella_sp._AY251115, 7 Septoria_tritici, 8 Mycosphaerella_punctiformis, 9 Mycosphaerella_sp._AY251116, 10 Mycosphaerella_populorum, 11 Pseudocladosporium_hachijoensis, 12 Septoria_rosae, 13 Passalora_fulva, 14 Ramularia_sp., 15 Passalora_janseana, 16 Ramulispora_sorghi_AY251111, 17 Ramulispora_sorghi_AY251110, 18 Mycosphaerella_latebrosa, 19 Stigmina_platani, 20 Pseudocercospora_protearum_var._leucadendri, 21 Pseudocercospora_cruenta, 22 Septoria_epambrosiae, 23 Cercospora_zebrina, 24 Pseudocercospora_vitis, 25 Pseudocercospora_griseola_CPC_10779, 26 Pseudocercospora_griseola_CBS_880.72, 27 Pseudocercospora_griseola_CBS_194.47, 28 Cladosporium_herbarum, 29 Cladosporium_cladosporioides; TREE Fig._1 = [&R] ((29,28)Cladosporium,(((((((((((27,26,25)Pseudocercospora_griseola,(20,19)),24),21)Pseudocercospora,(23,22)),(18,6),(17,16)Ramulispora_sorghi,(15,(14,12)),13),9,8,7),10),11),(((4,3),2),1)),5)Mycosphaerella); END; BEGIN TREES; TITLE Tb7814; LINK TAXA = Taxa1; TRANSLATE 1 Stigmina_platani_AY260090, 2 Stigmina_platani_AF222849, 3 Pseudocercospora_vitis_CPC_11660, 4 Pseudocercospora_vitis_CPC_11595, 5 Pseudocercospora_syzygiicola, 6 Pseudocercospora_robusta, 7 Pseudocercospora_natalensis, 8 Pseudocercospora_protearum_var._leucadendri, 9 Pseudocercospora_eucalyptorum_AF309599, 10 Pseudocercospora_eucalyptorum_AF309598, 11 Pseudocercospora_musae_AY266149, 12 Pseudocercospora_musae_AY266148, 13 Pseudocercospora_paraguayensis, 14 Pseudocercospora_basiramifera, 15 Pseudocercospora_griseola_f._griseola_AF222834, 16 Pseudocercospora_griseola_f._mesoamericana_CPC_12241, 17 Pseudocercospora_griseola_f._mesoamericana_CPC_10479, 18 Pseudocercospora_griseola_f._mesoamericana_CPC_10463, 19 Pseudocercospora_griseola_f._mesoamericana_CPC_12242, 20 Pseudocercospora_griseola_f._mesoamericana_CPC_5597, 21 Pseudocercospora_griseola_f._mesoamericana_CPC_5596, 22 Pseudocercospora_griseola_f._mesoamericana_CPC_10474, 23 Pseudocercospora_griseola_f._griseola_CPC_12240, 24 Pseudocercospora_griseola_f._griseola_CPC_12239, 25 Pseudocercospora_griseola_f._griseola_CPC_12238, 26 Pseudocercospora_griseola_f._griseola_CPC_10779, 27 Pseudocercospora_griseola_f._griseola_CPC_10484, 28 Pseudocercospora_griseola_f._griseola_CBS_194.47, 29 Pseudocercospora_griseola_f._griseola_CBS_880.72, 30 Pseudocercospora_griseola_f._griseola_CPC_10481, 31 Pseudocercospora_griseola_f._griseola_CPC_10480, 32 Pseudocercospora_griseola_f._griseola_CPC_10477, 33 Pseudocercospora_griseola_f._griseola_CPC_10469, 34 Pseudocercospora_griseola_f._griseola_CPC_10468, 35 Pseudocercospora_griseola_f._griseola_CPC_10467, 36 Pseudocercospora_griseola_f._griseola_CPC_10465, 37 Pseudocercospora_griseola_f._griseola_CPC_10464, 38 Pseudocercospora_griseola_f._griseola_CPC_10460, 39 Pseudocercospora_griseola_f._griseola_CPC_10459, 40 Pseudocercospora_griseola_f._griseola_CPC_10458, 41 Pseudocercospora_griseola_f._griseola_CPC_10457, 42 Pseudocercospora_griseola_f._griseola_CPC_5594, 43 Pseudocercospora_griseola_f._griseola_CPC_5592, 44 Davidiella_tassiana, 45 Cladosporium_herbarum; TREE Fig._3 = [&R] ((45,44)Davidiella,(((43,42,41,40,39,38,37,36,35,34,33,32,31,30,29,28,27,26,23),(25,24))Pseudocercospora_griseola_f._griseola,(22,21,20,19,18,17,16)Pseudocercospora_griseola_f._mesoamericana)Pseudocercospora_griseola); END; BEGIN TREES; TITLE Tb7813; LINK TAXA = Taxa1; TRANSLATE 1 Stigmina_platani_AY260090, 2 Stigmina_platani_AF222849, 3 Pseudocercospora_vitis_CPC_11660, 4 Pseudocercospora_vitis_CPC_11595, 5 Pseudocercospora_syzygiicola, 6 Pseudocercospora_robusta, 7 Pseudocercospora_natalensis, 8 Pseudocercospora_protearum_var._leucadendri, 9 Pseudocercospora_eucalyptorum_AF309599, 10 Pseudocercospora_eucalyptorum_AF309598, 11 Pseudocercospora_musae_AY266149, 12 Pseudocercospora_musae_AY266148, 13 Pseudocercospora_paraguayensis, 14 Pseudocercospora_basiramifera, 15 Pseudocercospora_griseola_f._griseola_AF222834, 16 Pseudocercospora_griseola_f._mesoamericana_CPC_12241, 17 Pseudocercospora_griseola_f._mesoamericana_CPC_10479, 18 Pseudocercospora_griseola_f._mesoamericana_CPC_10463, 19 Pseudocercospora_griseola_f._mesoamericana_CPC_12242, 20 Pseudocercospora_griseola_f._mesoamericana_CPC_5597, 21 Pseudocercospora_griseola_f._mesoamericana_CPC_5596, 22 Pseudocercospora_griseola_f._mesoamericana_CPC_10474, 23 Pseudocercospora_griseola_f._griseola_CPC_12240, 24 Pseudocercospora_griseola_f._griseola_CPC_12239, 25 Pseudocercospora_griseola_f._griseola_CPC_12238, 26 Pseudocercospora_griseola_f._griseola_CPC_10779, 27 Pseudocercospora_griseola_f._griseola_CPC_10484, 28 Pseudocercospora_griseola_f._griseola_CBS_194.47, 29 Pseudocercospora_griseola_f._griseola_CBS_880.72, 30 Pseudocercospora_griseola_f._griseola_CPC_10481, 31 Pseudocercospora_griseola_f._griseola_CPC_10480, 32 Pseudocercospora_griseola_f._griseola_CPC_10477, 33 Pseudocercospora_griseola_f._griseola_CPC_10469, 34 Pseudocercospora_griseola_f._griseola_CPC_10468, 35 Pseudocercospora_griseola_f._griseola_CPC_10467, 36 Pseudocercospora_griseola_f._griseola_CPC_10465, 37 Pseudocercospora_griseola_f._griseola_CPC_10464, 38 Pseudocercospora_griseola_f._griseola_CPC_10460, 39 Pseudocercospora_griseola_f._griseola_CPC_10459, 40 Pseudocercospora_griseola_f._griseola_CPC_10458, 41 Pseudocercospora_griseola_f._griseola_CPC_10457, 42 Pseudocercospora_griseola_f._griseola_CPC_5594, 43 Pseudocercospora_griseola_f._griseola_CPC_5592, 44 Davidiella_tassiana, 45 Cladosporium_herbarum; TREE Fig._2 = [&R] ((45,44)Davidiella,((((43,42,41,40,39,38,37,36,35,34,33,32,31,30,29,28,27,26,25,23,(22,21,20,19,18,17,16)Pseudocercospora_griseola_f._mesoamericana,15),24)Pseudocercospora_griseola,(((((14,13),(12,11)Pseudocercospora_musae),(10,9)Pseudocercospora_eucalyptorum,(7,6,5)),8),(4,3)Pseudocercospora_vitis)),(2,1)Stigmina_platani)Pseudocercospora); END;