#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:25 GMT TreeBASE (cc) 1994-2008 Study reference: Crous P.W., Groenewald J.Z., Groenewald M., Caldwell P., Braun U., & Harrington T. 2006. Species of Cercospora associated with grey leaf spot of maize. Studies in Mycology, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1564] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=36; TAXLABELS Cercospora_apii_CBS_114418 Cercospora_apii_CBS_116455 Cercospora_apii_CBS_116504 Cercospora_apii_CBS_119.25 Cercospora_apii_CBS_121.31 Cercospora_apii_CBS_127.31 Cercospora_beticola_CBS_116.47 Cercospora_beticola_CBS_116456 Cercospora_beticola_CBS_116501 Cercospora_beticola_CBS_116502 Cercospora_beticola_CBS_124.31 Cercospora_beticola_CBS_126.31 Cercospora_beticola_CPC_10168 Cercospora_beticola_CPC_5125 Cercospora_beticola_CPC_5128 Cercospora_canescens Cercospora_sorghi Cercospora_sorghi_var._maydis_AF297232 Cercospora_sorghi_var._maydis_AF297233 Cercospora_sp. 'Cercospora zeae-maydis AF291709' 'Cercospora zeae-maydis CBS 117755' 'Cercospora zeae-maydis CBS 117756' 'Cercospora zeae-maydis CBS 117757' 'Cercospora zeae-maydis CBS 117758' 'Cercospora zeae-maydis CBS 117759' 'Cercospora zeae-maydis CBS 117760' 'Cercospora zeae-maydis CBS 117761' 'Cercospora zeae-maydis CBS 117762' 'Cercospora zeae-maydis CBS 117763' Cercospora_zeina_AF291710 Cercospora_zeina_CPC_11995 Cercospora_zeina_CPC_11998 Mycosphaerella_thailandica_CBS_116367 Mycosphaerella_thailandica_CPC_10548 Mycosphaerella_thailandica_CPC_10549 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1210] TITLE Combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1820; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Cercospora_apii_CBS_114418 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????----------GAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCGTTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGGGTTCC------------------????---------------GGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGAGAGCACCACAGGACAAGGACGGCGATGGTATGAAGTGCGACCACCCTCTGCAACTGCGC------TGAACTAA--TCTCAACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAATGAGGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAA----------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATTCAGTCC Cercospora_apii_CBS_116455 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------CATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCGTTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????-------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGAGAGCACCACAGGACAAGGACGGCGATGGTATGAAGTGCGACCACCCTCTGCAACTGCGC------TGAACTAA--TCTCAACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAATGAGGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGAT------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACGTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATTCAGTCC Cercospora_apii_CBS_116504 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------CATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCGTTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????-------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGAGAGCACCACAGGACAAGGACGGCGATGGTATGAAGTGCGACCACCCTCTGCAACTGCGC------TGAACTAA--TCTCAACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAATGAGGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGAT------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACGTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATTCAGTCC Cercospora_apii_CBS_119.25 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCGTTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????----------------------TTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGAGAGCACCACAGGACAAGGACGGCGATGGTATGAAGTGCGACCACCCTGTGCAACTGCGC------TGAACTAA--TCTCAACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAATGAGGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGG----------------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACGTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCAC---------- Cercospora_apii_CBS_121.31 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????----------------------TTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGAGAGCACCACAGGACAAGGACGGCGATGGTATGAAGTGCGACCACCCTCTGCAACTGCGC------TGAACTAA--TCTCAACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAATGAGGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATG-----------------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCAC---------- Cercospora_apii_CBS_127.31 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????----------------------TTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGAGAGCACCACAGGACAAGGACGGCGATGGTATGAAGTGCGACCACCCTCTGCAACTGCGC------TGAACTAA--TCTCAACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAATGAGGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCAC---------- Cercospora_beticola_CBS_116.47 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????----------------------TTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCAACACAGGACAAGGACGGCGATGGTATGATGTGCGCCCACCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????-----GGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATTCAGTCC Cercospora_beticola_CBS_116456 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????--------TCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????--------------------------CCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????--------TTCAAGGAGGCCTTCTCTCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCAACACAGGACAAGGACGGCGATGGTATGATGTGCGCCCACCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGG----------------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCAC---------- Cercospora_beticola_CBS_116501 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????--------TCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????--------------------------CCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????--------TTCAAGGAGGCCTTCTCTCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCAACACAGGACAAGGACGGCGATGGTATGATGTGCGCCCACCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGG----------------????-----GGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCAC---------- Cercospora_beticola_CBS_116502 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????--------TCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????--------------------------CCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????--------TTCAAGGAGGCCTTCTCTCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCAACACAGGACAAGGACGGCGATGGTATGATGTGCGCCCACCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGG----------------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCTATCCACGCCAAGCGTGTCAC---------- Cercospora_beticola_CBS_124.31 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????----------------------TTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????-------------------CTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCAACACAGGACAAGGACGGCGATGGTATGATGTGCGCCCACCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACC-----------------------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCAC---------- Cercospora_beticola_CBS_126.31 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAA?TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????----------------------TTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????-------------------CTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCAACACAGGACAAGGACGGCGATGGTATGATGTGCGCCCACCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATG-----------------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCAC---------- Cercospora_beticola_CPC_10168 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????--------TCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????--------------------------CCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????--------TTCAAGGAGGCCTTCTCTCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCAACACAGGACAAGGACGGCGATGGTATGATGTGCGCCCACCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGG----------------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCTATCCACGCCAAGCGTGTCAC---------- Cercospora_beticola_CPC_5125 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????----------------------TTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCACCACAGGACAAGGACGGCGATGGTATGATGTGCGCCCGCCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGG----------------????-----GGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATTCAGTCC Cercospora_beticola_CPC_5128 ----GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACAAAT--GCATTTTGTCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAA-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTTGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATCTGCACGACCACACTTCGCATCAAGAATA----GACTGCTGACAATGGCTCCTCACAGGAAGCAGCTGAACTCGGTAAGG-----------------------????----------------------TTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGACGCAAAAGC-TGGCAGGAAGGAG-GAGCTGACATTGGGACAGCATCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAAATTC-CTCCTAACAAGAGCACAGTATCATGATTGGTATG--------------------------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACAGTTTTCTGAAACAATCAGGCAGCCGCGAGGCAGAGCTAACGACAGCACCACAGGACAAGGACGGCGATGGTATGATGTGCGCCCACCCTCTGCGAATGTAC------TGAACTAA--CCTCGACCGAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAAGTCGACGCCGACAACAACGGCACAATCGATTTCCCCGAATTCCTCACCATGATGG----------------????-----GGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCG-CCTCGACTTCACATCCACAACACCATCTAACATTCATTCCCAGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATTCAGTCC Cercospora_canescens GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cercospora_sorghi GGAGGGATCATTACCGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGACCGGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTC-CAAGGTTGACCTCCGGATCAGGTAGGGATA-----????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cercospora_sorghi_var._maydis_AF297232 GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cercospora_sorghi_var._maydis_AF297233 GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGTTCGCGGCCGTTAAATCTTTCATAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cercospora_sp. GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-CTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------CATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACACGAAT--GCACTTTGTCGCACAAATCTT-CGCCGCTTGTCGCCTCTGCGCTGGTGCCCCTCCAAAT-----CTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTCTGCCGCTCGCGATGACTTCATCCGCTATGACTCCTCGCCCACCGCTCAACGCA-TTGGGC-ATACCGCCA--GCACACCACACATTTGCACAACCACACTTCACACCAAGAATA----GACTGCTGACGATGGCTTCTCACAGGAAGCAGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGCTGCCACAATCAGATGCAAACGC-TGGCAGGAAGGAG-GAGCTGACATTGAGACAGCATCCATTGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCA-TCTCCGCCGCTGCAGAATC-ATCCTAACAAGAGCACAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACTTTTCTGAAACAATCAGGCAGCCGCGAGACAGAGCTAACGACAGCATCACAGGACAAGGACGGCGATGGTATAATGTGCGCCCACCTTCTGCGACGGCAC------TGAACTGA--CCTCAACCAAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACGATCGATTTTCCCGAATTTCTCACCATGATGGCCAGAAAGAT------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTCA-CTTCGACTTC-CATCCCCAACACGATCTAACATTCCCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATCCGCAAGCTGCCATTCCAGCGTCTTGTTCGTGAGATCGCTCAAGACTTCAAGTCCGATCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAATCTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis AF291709' GGAGGGATCATTACCGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTC-CAAGGTTGACCTCCGGATCAGGTAGGGATA-----????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Cercospora zeae-maydis CBS 117755' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis CBS 117756' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-------ATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????-------ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGT----------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis CBS 117757' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis CBS 117758' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis CBS 117759' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-------ATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis CBS 117760' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-------ATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis CBS 117761' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis CBS 117762' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-----TCATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC 'Cercospora zeae-maydis CBS 117763' GGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTCCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTTAAAGTCT-CCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-------ATCGAGAAGTTCGAGAAGGTGAGCAACTGCCAGCACGCGAAC--GCACTTCGTCGCGCAAATTTT-CGCCGCTTGTCGCTTTTGCGCTGCTGCCCCTCCAAAAACTGGCTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTTGCGGCTCGCGATGACTTCATCCGCTATGACTCCGCGCCCACGGCCCAACGTA-TTGGGC-ATACCGCCA--GCACACAACACAT--GCACCCACACGCCCTTCAT--GTCGAGGACGGACTGCTGACCATGCACTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATGCCACAATCGGGTGCACA-GC-GGGCGGGAAGGAA-GAGCTGACACGGGGACAGCGTCCATCGTCGGACGACCGCGCCACCATGGGTATGCGATCCGCCAATCTCCGCCGCTGCAGAATG-AATCTAACACGAGCGCAGTATCATGATTGGAATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTGCGGAACAACCAGGCAGCCGCAGCCCCGAGCTAACCGCGGCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTCAAC------TGAGCTAA--CCTCATACCAAGGACAAATCACCACCAAGGAGCTCGGCACCGTCATGCGCTCCCTCGGTCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCACCATCTACCGGTGGTGTGAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGACTCGTCTTTCACTTGACATTCACAACACAACCTAACATACTCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTTATCCGCAAGCTGCCTTTCCAGCGTCTGGTCCGTGAAATCGCCCAAGACTTCAAGTCCGACCTGCGCTTCCAGAGCTCTGCCATTGGCGCCCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCGCTTTTCGAAGACACAAACTTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC Cercospora_zeina_AF291710 GGAGGGATCATTACCGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTCGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCGAAGTCT-CCGGCTGAGCTGTCCGTCTCCAAGCGCTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTC-CAAGGTTGACCTCCGGATCAGGTAGGGATA-----????------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cercospora_zeina_CPC_11995 GGAGGGATCATTACCGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTCGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCGAAGTCT-CCGGCTGAGCTGTCCGTCTCCAAGCGCTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------CATCGAGAAGTTCGAGAAGGTGAGCAACTCCC-GCACGCGAAC--GCACTTCGGCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGCTGCCCCTCCAAAA-----GTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTCGCGGCTCGCGATGACTTCATCCGCCATGACTCCTCGCCCACCGCCCAACGTGTTTGGGC-ATTCCGCCG--GCGCACAACACAC--GCACCATCACACCCTTCATACGTCGATGACGGACTGCTGACCATGCCTTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATACCACAATCCAGTGCAAA-GC-TGGTGGGAAGGAAAGAGCTGACGCCGGGACAGCGTCCATTGTCGGACGACCGCGCCACCATGGGTATGCGACCCGCCA-TCTCCAGCGCTGCAGAAGC-ATCCTGACAAACGCACAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????----TGAGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTCTGAAACGGCCAGGCAGCCGCAAGGCCGAGCTAATTGCACCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTTCAC------TGAGCTAA--TCTCAAGCCAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAG--------????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTACAAGCCAGGTAAGCATCGAGTGG-CCCTCACCGTACATCGACAACACAACCTAACATACCCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAAATCGCCCAAGATTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAAGACACCAACTTGTGCGCAATCCACGCCAAGCGTGTCACCATCCAGTCC Cercospora_zeina_CPC_11998 GGAGGGATCATTACCGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTCGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC-GGCG-AGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-TTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCGAAGTCT-CCGGCTGAGCTGTCCGTCTCCAAGCGCTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGT-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????-------ATCGAGAAGTTCGAGAAGGTGAGCAACTCCC-GCACGCGAAC--GCACTTCGGCGCACAAATTTT-CGCCGCTTGTCGCCTCTGCGCTGCTGCCCCTCCAAAA-----GTGGTGGGGTGCGAGAATTTCGGCGCTTTGGGCTTCGCGGCTCGCGATGACTTCATCCGCCATGACTCCTCGCCCACCGCCCAACGTGTTTGGGC-ATTCCGCCG--GCGCACAACACAC--GCACCATCACACCCTTCATACGTCGATGACGGACTGCTGACCATGCCTTCTCACAGGAAGCTGCTGAACTCGGTAAGGGTTCCTTCAAGTA----------????------TATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCACGAGCTGTCTTCCGTAAGTGATACCACAATCCAGTGCAAA-GC-TGGTGGGAAGGAAAGAGCTGACGCCGGGACAGCGTCCATTGTCGGACGACCGCGCCACCATGGGTATGCGACCCGCCA-TCTCCAGCGCTGCAGAAGC-ATCCTGACAAACGCACAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????------AGTTCAAGGAGGCCTTCTCCCTCTTCGTACGTACACCTTTCTGAAACGGCCAGGCAGCCGCAAGGCCGAGCTAATTGCACCACCACAGGACAAGGACGGCGATGGTACGATGCGGGCGCGGTCTTTGCGACTTCAC------TGAGCTAA--TCTCAAGCCAAGGACAAATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCCCTCGGCCAGAACCCCAGCGAGTCCGAGCTGCAGGACATGATCAACGAGGTCGACGCCGACAACAACGGCACGATCGATTTCCCCGAATTCCTCACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCCGCTCGCAAGTCCGCACCATCTACCGGTGGTGTCAAGAAGCCTCACCGCTCCAAGCCAGGTAAGCATCGAGTGG-CCCTCACCGTACATCGACAACACAACCTAACATACCCTCTCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCCTCATTCGCAAGCTTCCGTTCCAGCGTCTGGTTCGTGAAATCGCCCAAGATTTCAAGTCCGACCTCCGCTTCCAGAGCTCTGCCATCGGCGCTCTTCAAGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAAGACACCAACTTGTGCGCAATCCACGCCAAGCGTGTCACCATCCAGTCC Mycosphaerella_thailandica_CBS_116367 ----GGATCATTACTGAGTGAGGGCCTCCGGGTCCGACCTCCAACCCTTTGTGAACCAATCTTGTTGCTTCGGGGGCGACCCTGCCGCTTCGGC-GGTGCGGCGCCCCCGGAGGCCATCAAACACTGCATCATTGCGTCGGAGTAAAAGTAAATGAAACAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-TCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGTG--CCGCGCGCCTTAAAGTCTTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGGCAACT--ATTCGCTTCGGAGGCCGGGCGGC-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------CATCGAGAAGTTCGAGAAGGAGAAACAGCGTGAAGAGGAGGCAAAGCAAAAGGCATTGGAAGTGCAAGAGACTGAACCAGAGGAGCGAATGAAGGTCATACAA------GGTGTGGAGTACGAGA-TCGCAGAACGAGTTGATCCTCAAT-CGCGGAAAGAGTATGTGCCGTCA-------------TCCACTTGGG-ATGGGCTACAGCGCGTCGGCAGTGAGCGATGGGTGA--AGCAAAGATTGGATCAAGGAGA-----ACAATACACCA-GGGTGAG---ACAAAGTAG-TACA---------------------------------????-------ATGTGCAAGGCCGGTTTCGCCGGTGATGATGCGCCACGAGCTGTCTTCCGTAAGTCATCCCTCCATCACC-------GCCAGGCGGCGGCAGC-GAGCTGACTCCATCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGTATGCGATCCATCA-TCCTCGAGTATGCCGGAGCATTTCTGACAAGAGCGCAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????-----GAGTTCAAGGAGGCCTTCTCCCTCTTCGTAAGT--------CGCACTCAGCCAGGCATCCACTTATCAG-GCTGACCACGTTAC-ACAGGACAAGGACGGCGATGGTAT-AGTCCAATCCGCACCCCCACACCGATCGCGACATCCTCTGACACATGATGCACAGGACAAATCACCACCAAAGAGCTGGGTACCGTCATGCGCAGTCTGGGCCAGAACCCCTCCGAATCTGAGCTCCAGGACATGATCAACGAGGTCGACGCTGACAACAACGGCACCATCGACTTCCCCGAATTCCTGACCATGATGGCCAGAAAGATG-----????-----GGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCCCCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCAGGTAGGCATCACTCAA-CATCCTC-TCACATCTTCCACAGTCACTGACATCTCCACCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCTTGATCCGAAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAAGACTTCAAGTCCGACCTGCGCTTCCAGTCCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC Mycosphaerella_thailandica_CPC_10548 ----GGATCATTACTGAGTGAGGGCCTCCGGGTCCGACCTCCAACCCTTTGTGAACCAATCTTGTTGCTTCGGGGGCGACCCTGCCGCTTCGGC-GGTGCGGCGCCCCCGGAGGCCATCAAACACTGCATCATTGCGTCGGAGTAAAAGTAAATGAAACAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-TCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGTG--CCGCGCGCCTTAAAGTCTTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGGCAACT--ATTCGCTTCGGAGGCCGGGCGGC-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------CATCGAGAAGTTCGAGAAGGAGAAACAGCGTGAAGAGGAGGCAAAGCAAAAGGCATTGGAAGTGCAAGAGACTGAACCAGAGGAGCGAATGAAGGTCATACAA------GGTGTGGAGTACGAGA-TCGCAGAACGAGTTGATCCTCAAT-CGCGGAAAGAGTATGTGCCGTCA-------------TCCACTTGGG-ATGGGCTACAGCGCGTCGGCAGTGAGCGATGGGTGA--AGCAAAGATTGGATCAAGGAGA-----ACAATACACCA-GGGTGAG---ACAAAGTAG-TACATCCGGTAAGGGTTCCTTCAAGTA----------????-------ATGTGCAAGGCCGGTTTCGCCGGTGATGATGCGCCACGAGCTGTCTTCCGTAAGTCATCCCTCCATCACC-------GCCAGGCGGCGGCAGC-GAGCTGACTCCATCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGTATGCGATCCATCA-TCCTCGAGTATGCCGGAGCATTTCTGACAAGAGCGCAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????-----GAGTTCAAGGAGGCCTTCTCCCTCTTCGTAAGT--------CGCACTCAGCCAGGCATCCACTTATCAG-GCTGACCACGTTAC-ACAGGACAAGGACGGCGATGGTAT-AGTCCAATCCGCACCCCCACACCGATCGCGACATCCTCTGACACATGATGCACAGGACAAATCACCACCAAAGAGCTGGGTACCGTCATGCGCAGTCTGGGCCAGAACCCCTCCGAATCTGAGCTCCAGGACATGATCAACGAGGTCGACGCTGACAACAACGGCACCATCGACTTCCCCGAATTCCTGACCATGATGGCCAGAAAGATG-----????----TGGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCCCCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCAGGTAGGCATCACTCAA-CATCCTC-TCACATCTTCCACAGTCACTGACATCTCCACCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCTTGATCCGAAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAAGACTTCAAGTCCGACCTGCGCTTCCAGTCCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC Mycosphaerella_thailandica_CPC_10549 ----GGATCATTACTGAGTGAGGGCCTCCGGGTCCGACCTCCAACCCTTTGTGAACCAATCTTGTTGCTTCGGGGGCGACCCTGCCGCTTCGGC-GGTGCGGCGCCCCCGGAGGCCATCAAACACTGCATCATTGCGTCGGAGTAAAAGTAAATGAAACAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC-TCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGTG--CCGCGCGCCTTAAAGTCTTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGGCAACT--ATTCGCTTCGGAGGCCGGGCGGC-CGCGGCCGTTAAATCTTTCACAAGGTTGACCTC-GGATCAGGTAGGGATA-----????------CATCGAGAAGTTCGAGAAGGAGAAACAGCGTGAAGAGGAGGCAAAGCAAAAGGCATTGGAAGTGCAAGAGACTGAACCAGAGGAGCGAATGAAGGTCATACAA------GGTGTGGAGTACGAGA-TCGCAGAACGAGTTGATCCTCAAT-CGCGGAAAGAGTATGTGCCGTCA-------------TCCACTTGGG-ATGGGCTACAGCGCGTCGGCAGTGAGCGATGGGTGA--AGCAAAGATTGGATCAAGGAGA-----ACAATACACCA-GGGTGAG---ACAAAGTAG-TACA---------------------------------????-------ATGTGCAAGGCCGGTTTCGCCGGTGATGATGCGCCACGAGCTGTCTTCCGTAAGTCATCCCTCCATCACC-------GCCAGGCGGCGGCAGC-GAGCTGACTCCATCACAGCATCCATTGTCGGCCGACCGCGTCACCATGGGTATGCGATCCATCA-TCCTCGAGTATGCCGGAGCATTTCTGACAAGAGCGCAGTATCATGATTGGTATGGGCCAGAAGGACTCGTA---------????-----GAGTTCAAGGAGGCCTTCTCCCTCTTCGTAAGT--------CGCACTCAGCCAGGCATCCACTTATCAG-GCTGACCACGTTAC-ACAGGACAAGGACGGCGATGGTAT-AGTCCAATCCGCACCCCCACACCGATCGCGACATCCTCTGACACATGATGCACAGGACAAATCACCACCAAAGAGCTGGGTACCGTCATGCGCAGTCTGGGCCAGAACCCCTCCGAATCTGAGCTCCAGGACATGATCAACGAGGTCGACGCTGACAACAACGGCACCATCGACTTCCCCGAATTCCTGACCATGATGGCCAGAAAGATG-----????-----GGTGGCAAGGCCCCACGTAAGCAGCTCGCCTCCAAGGCAGCTCGCAAGTCCGCCCCATCTACCGGTGGTGTCAAGAAGCCTCACCGTTACAAGCCAGGTAGGCATCACTCAA-CATCCTC-TCACATCTTCCACAGTCACTGACATCTCCACCCAGGTACCGTCGCTCTCCGTGAGATCCGTCGCTACCAGAAGTCGACCGAGCTCTTGATCCGAAAGCTCCCCTTCCAGCGTCTGGTCCGTGAGATCGCACAAGACTTCAAGTCCGACCTGCGCTTCCAGTCCTCCGCCATCGGTGCTCTTCAGGAGTCCGTCGAGGCCTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCC ; END; BEGIN SETS; CHARSET act (CHARACTERS = Combined) = 869-1062; CHARSET cal (CHARACTERS = Combined) = 1112-1399; CHARSET ef (CHARACTERS = Combined) = 511-805; CHARSET COMB (CHARACTERS = Combined) = 5-491 511-805 869-1062 1112-1399 1432-1810; CHARSET his (CHARACTERS = Combined) = 1432-1810; CHARSET its (CHARACTERS = Combined) = 5-491; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Combined) = N: 1-1820; CODONPOSSET CodonPositions (CHARACTERS = Combined) = N: 1-1820; END; BEGIN TREES; TITLE Tb7817; LINK TAXA = Taxa1; TRANSLATE 1 Cercospora_canescens, 2 Cercospora_sorghi_var._maydis_AF297232, 3 Cercospora_sorghi_var._maydis_AF297233, 4 'Cercospora zeae-maydis AF291709', 5 Cercospora_sorghi, 6 Cercospora_zeina_AF291710, 7 'Cercospora zeae-maydis CBS 117763', 8 'Cercospora zeae-maydis CBS 117762', 9 'Cercospora zeae-maydis CBS 117761', 10 'Cercospora zeae-maydis CBS 117760', 11 'Cercospora zeae-maydis CBS 117755', 12 'Cercospora zeae-maydis CBS 117759', 13 'Cercospora zeae-maydis CBS 117758', 14 'Cercospora zeae-maydis CBS 117757', 15 'Cercospora zeae-maydis CBS 117756', 16 Cercospora_zeina_CPC_11998, 17 Cercospora_zeina_CPC_11995, 18 Cercospora_sp., 19 Cercospora_apii_CBS_114418, 20 Cercospora_apii_CBS_116455, 21 Cercospora_apii_CBS_121.31, 22 Cercospora_apii_CBS_127.31, 23 Cercospora_apii_CBS_119.25, 24 Cercospora_apii_CBS_116504, 25 Cercospora_beticola_CBS_116502, 26 Cercospora_beticola_CPC_10168, 27 Cercospora_beticola_CBS_116456, 28 Cercospora_beticola_CBS_116501, 29 Cercospora_beticola_CPC_5128, 30 Cercospora_beticola_CPC_5125, 31 Cercospora_beticola_CBS_124.31, 32 Cercospora_beticola_CBS_116.47, 33 Cercospora_beticola_CBS_126.31, 34 Mycosphaerella_thailandica_CPC_10549, 35 Mycosphaerella_thailandica_CPC_10548, 36 Mycosphaerella_thailandica_CBS_116367; TREE Fig._1 = [&R] ((36,35,34)Mycosphaerella_thailandica,((33,32,31,30,29,28,27,26,25,24,23,22,21,20,19,18,3,2),(((17,16,6)Cercospora_zeina,5),(15,14,13,12,11,10,9,8,7,4)'Cercospora zeae-maydis',1))Cercospora); END; BEGIN TREES; TITLE Tb7818; LINK TAXA = Taxa1; TRANSLATE 1 Cercospora_canescens, 2 Cercospora_sorghi_var._maydis_AF297232, 3 Cercospora_sorghi_var._maydis_AF297233, 4 'Cercospora zeae-maydis AF291709', 5 Cercospora_sorghi, 6 Cercospora_zeina_AF291710, 7 'Cercospora zeae-maydis CBS 117763', 8 'Cercospora zeae-maydis CBS 117762', 9 'Cercospora zeae-maydis CBS 117761', 10 'Cercospora zeae-maydis CBS 117760', 11 'Cercospora zeae-maydis CBS 117755', 12 'Cercospora zeae-maydis CBS 117759', 13 'Cercospora zeae-maydis CBS 117758', 14 'Cercospora zeae-maydis CBS 117757', 15 'Cercospora zeae-maydis CBS 117756', 16 Cercospora_zeina_CPC_11998, 17 Cercospora_zeina_CPC_11995, 18 Cercospora_sp., 19 Cercospora_apii_CBS_114418, 20 Cercospora_apii_CBS_116455, 21 Cercospora_apii_CBS_121.31, 22 Cercospora_apii_CBS_127.31, 23 Cercospora_apii_CBS_119.25, 24 Cercospora_apii_CBS_116504, 25 Cercospora_beticola_CBS_116502, 26 Cercospora_beticola_CPC_10168, 27 Cercospora_beticola_CBS_116456, 28 Cercospora_beticola_CBS_116501, 29 Cercospora_beticola_CPC_5128, 30 Cercospora_beticola_CPC_5125, 31 Cercospora_beticola_CBS_124.31, 32 Cercospora_beticola_CBS_116.47, 33 Cercospora_beticola_CBS_126.31, 34 Mycosphaerella_thailandica_CPC_10549, 35 Mycosphaerella_thailandica_CPC_10548, 36 Mycosphaerella_thailandica_CBS_116367; TREE Fig._2 = [&R] ((36,35,34)Mycosphaerella_thailandica,(((((33,32,31,(28,27,(26,25))),30,29)Cercospora_beticola,(((24,23,20),19),22,21)Cercospora_apii),18),((17,16)Cercospora_zeina,(15,14,13,12,11,10,9,8,7)'Cercospora zeae-maydis'))Cercospora); END;