#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 07, 2021; 1:27 GMT TreeBASE (cc) 1994-2008 Study reference: Lei B., & Olival K.J. 2014. Contrasting Patterns in Mammal–Bacteria Coevolution: Bartonella and Leptospira in Bats and Rodents. PLOS Neglected Tropical Diseases, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15643] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=52; TAXLABELS Bartonella_sp._B29042_ex._Desmodus_rotundus_HM597187 Bartonella_sp._B29043_ex._Desmodus_rotundus_HM597188 Bartonella_sp._B29044_ex._Desmodus_rotundus_HM597189 Bartonella_sp._B29102_ex._Pteronotus_davyi_HM597193 Bartonella_sp._B29105_ex._Pteronotus_davyi_HM597203 Bartonella_sp._B29107_ex._Desmodus_rotundus_HM597190 Bartonella_sp._B29108_ex._Desmodus_rotundus_HM597191 Bartonella_sp._B29109_ex._Pteronotus_davyi_HM597194 Bartonella_sp._B29110_ex._Glossophaga_soricina_HM597202 Bartonella_sp._B29111_ex._Artibeus_toltecus_HM597197 Bartonella_sp._B29112_ex._Phyllostomus_hastatus_HM597204 Bartonella_sp._B29114_ex._Desmodus_rotundus_HM597192 Bartonella_sp._B29115_ex._Phyllostomus_hastatus_HM597201 Bartonella_sp._B29116_ex._Phyllostomus_hastatus_HM597198 Bartonella_sp._B29119_ex._Desmodus_rotundus_HM597195 Bartonella_sp._B29122_ex._Desmodus_rotundus_HM597196 Bartonella_sp._B29126_ex._Carollia_perspicillata_HM597199 Bartonella_sp._B29134_ex._Pteronotus_davyi_HM597205 Bartonella_sp._B29137_ex._Sturnira_lilium_HM597206 Bartonella_sp._B29172_ex._Micronycteris_microtis_HM597207 Bartonella_sp._B29230_ex._Phyllostomus_hastatus_HM597200 Bartonella_sp._B32851_ex._Artibeus_obscurus_JQ071380 Bartonella_sp._B32854_ex._Phyllostomus_hastatus_JQ071388 Bartonella_sp._B32855_ex._Desmodus_rotundus_JQ071378 Bartonella_sp._B32856_ex._Vampyressa_bidens_JQ071389 Bartonella_sp._B32943_ex._Carollia_perspicillata_JQ071384 Bartonella_sp._B32946_ex._Glossophaga_soricina_JQ071383 Bartonella_sp._B32947_ex._Phyllostomus_hastatus_JQ071387 Bartonella_sp._B32953_ex._Artibeus_planirostris_JQ071381 Bartonella_sp._B32954_ex._Artibeus_planirostris_JQ071382 Bartonella_sp._B32955_ex._Carollia_perspicillata_JQ071385 Bartonella_sp._B32960_ex._Carollia_perspicillata_JQ071386 Bartonella_sp._Bc37076_ex._Brachyphylla_cavernarum 'Bartonella sp. C-583 ex. Coleura afra HM545136' 'Bartonella sp. E1-105 ex. Eidolon helvum HM363765' 'Bartonella sp. E2-114 ex. Eidolon helvum HM363766' 'Bartonella sp. E3-106 ex. Eidolon helvum HM363767' 'Bartonella sp. Ew-111 ex. Eidolon helvum HM363768' 'Bartonella sp. H-556 ex. Hipposideros armiger HM545137' Bartonella_sp._Mr37075_ex._Monophyllus_redmani Bartonella_sp._Mr37077_ex._Monophyllus_redmani Bartonella_sp._Mr37078_ex._Monophyllus_redmani Bartonella_sp._Mr37079_ex._Monophyllus_redmani Bartonella_sp._No.05_ex._Miniopterus_schreibersii_JF500511 Bartonella_sp._No.16_ex._Miniopterus_schreibersii_JF500522 'Bartonella sp. R-191 ex. Rousettus aegyptiacus HM363764' 'Bartonella sp. T-837 ex. Triaenops persicus HM545138' Bartonella_sp._ex._Artibeus_jamaicensis_AJ37081 Bartonella_sp._ex._Myotis_daubentoni_AJ871613 Bartonella_sp._ex._Myotis_mystacinus_AJ871612 Bartonella_sp._ex._Nyctalus_noctula_AJ871615 Brucella_melitensis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M21869] TITLE Bartonella_sp._citrate_synthase; LINK TAXA = Taxa1; DIMENSIONS NCHAR=338; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bartonella_sp._B29042_ex._Desmodus_rotundus_HM597187 AGCCAATGAAGCGTGCTTGAAAATGTTACAAGAAATAGGTTCCGTTAAAAAAATTCCTGAGTTTATTTCACGTGCAAAAGATAAAAGTGATCCTTTCCGTCTGATGGGCTTTGGTCACCGAGTCTATAAAAACTATGATCCACGCGCGAAAATCATGCAAAAAACGTGCTATGAAGTCTTAAAAGAAATGAACATTCAAGATGATCCGCTTTTTGATATCGCCATGGAACTTGAACACATTGCCTTAAACGATGAATACTTTATTGAAAAAAAGCTTTATCCTAATGTCGATTTTTATTCTGGCATTACATTAAAAGCTCTAGGTTTCCCAACCAAAA Bartonella_sp._B29043_ex._Desmodus_rotundus_HM597188 AGCCAATGAAGCGTGCTTGAAAATGTTACAAGAAATAGGTTCTGTTAAAAAAATTCCTGAGTTTATTTCACGTGCAAAAGATAAAAGTGATCCTTTCCGTCTGATGGGCTTTGGTCACCGAGTCTATAAAAACTATGATCCACGCGCGAAAATCATGCAAAAAACGTGCTATGAAGTCTTAAAAGAAATGAACATTCAAGATGATCCGCTTTTTGATATCGCCATGGAACTTGAACACATTGCCTTAAACGATGAATACTTTATTGAAAAAAAGCTTTATCCTAATGTCGATTTTTATTCTGGCATTACATTAAAAGCTCTAGGTTTCCCAACCAAAA Bartonella_sp._B29044_ex._Desmodus_rotundus_HM597189 AGCCAATGAAGCGTGCTTGAAAATGTTACAAGAAATAGGTTCCGTTAAAAAAATTCCTGAGTTTATTTCACGTGCAAAAGATAAAAGTGATCCTTTCCGTCTGATGGGCTTTGGTCACCGAGTCTATAAAAACTATGATCCACGCGCGAAAATCATGCAAAAAACGTGCTATGAAGTCTTAAAAGAAATGAACATTCAAGATGATCCGCTTTTTGATATTGCCATGGAACTTGAACACATTGCCTTAAACGATGAATACTTTATTGAAAAAAAGCTTTATCCTAATGTCGATTTTTATTCTGGTATTACATTAAAAGCTCTAGGTTTCCCAACCAAAA Bartonella_sp._B29102_ex._Pteronotus_davyi_HM597193 TGCTAATGAAGCATGTTTAAAAATGTTACAAGAAATAGGATCTGTAGAAAGAATTCCTGAATTTATTGCACGAGCAAAAGATAAAAATGATCCTTTCCGTCTCATGGGTTTTGGTCATCGTGTTTACAAAAACTATGATCCACGTGCTAAAGTTATGCAAAAAAATTGCTATGAAGTTTTAAAAGAGCTCAATATTAAGAATGATCCTCTTTTTGATATTGCTATGGAACTTGAAAAAATTGCTCTAAATGATGAATATTTTATTGAAAAAAAGCTCTATCCCAACGTTGATTTTTATTCTGGCATTATATTAAAAGCTCTAGGCTTCCCAACTCAAA Bartonella_sp._B29105_ex._Pteronotus_davyi_HM597203 AGCCGATGAAGCATGCTTAGAAATGCTACGAGATATCGGATCTATCGAGAAAATTCCTGAATTTATCACCCGTGCAAAAGACGAGAATGATCCCTTCCGTCTTATGGGATTTGGTCACCGAGTCTATAAAAACTACGATCCACGTGCGAAAATTATGCGGAAAACTTATTATGATGTTTTACAAGAACTAAATATTCAAGATGATCCACTTTTTGATATCGCTATGGAACTTGAAAAAATTGCCTTGAATGATGAATACTTTATTGAAAAAAAGCTCTATCCTAACGTTGACTTTTATTCTGGCATTATATTAAGAGCTTTAGGGTTCCCATCTGAAA Bartonella_sp._B29107_ex._Desmodus_rotundus_HM597190 AGCCAATGAAGCGTGCTTGAAAATGTTACAAGAAATAGGTTCCATTAAAAAAATTCCTGAGTTTATTTCACGTGCAAAAGATAAAAGTGATCCTTTCCGTCTGATGGGCTTTGGTCACCGAGTCTATAAAAACTATGATCCACGCGCGAAAATCATGCAAAAAACGTGCTATGAAGTCTTAAAAGAAATGAACATTCAAGATGATCCACTTTTTGATATCGCCATGGAACTTGAACACATTGCCTTAAACGATGAATACTTTATTGAAAAAAAGCTTTATCCTAATGTCGATTTTTATTCTGGCATTACATTAAAAGCTCTAGGTTTCCCAACCAAAA Bartonella_sp._B29108_ex._Desmodus_rotundus_HM597191 AGCCAATGAAGCGTGCTTGAAAATGTTACAAGAAATAGGTTCCGTTAAAAAAATTCCTGAGTTTATTTCACGTGCAAAAGATAAAAGTGATCCTTTCCGTCTGATGGGCTTTGGTCACCGAGTCTATAAAAACTATGATCCACGCGCGAAAATCATGCAAAAAACGTGCTATGAAGTCTTAAAAGAAATGAACATTCAAGATGATCCGCTTTTTGATATCGCCATGGAACTTGAACACATTGCCTTAAACGATGAATACTTTATTGAAAAAAAGCTTTATCCTAATGTCGATTTTTATTCTGGTATTACATTAAAAGCTCTAGGTTTCCCAACCAAAA Bartonella_sp._B29109_ex._Pteronotus_davyi_HM597194 TGCTAATGAAGCATGTTTAAAAATGTTACAAGAAATAGGATCTGTAGAAAGAATTCCTGAATTTATTGCACGAGCAAAAGATAAAAATGATCCTTTCCGTCTCATGGGTTTTGGTCATCGTGTTTACAAAAACTATGATCCACGTGCTAAAGTTATGCAAAAAAATTGCTATGAAGTTTTAAAAGAGCTCAATATTAAGAATGATCCTCTTTTTGATATTGCTATGGAACTTGAAAAAATTGCTCTAAATGACGAATATTTTATTGAAAAAAAGCTCTATCCCAACGTTGATTTTTATTCTGGCATTATATTAAAAGCTCTGGGCTTCCCAACTCAAA Bartonella_sp._B29110_ex._Glossophaga_soricina_HM597202 AGCGAATGAAGCATGTCTAAAGATGTTACAAGAAATAGGTTCCATTGAAAGAATTCCTGAATTTATCGCACGCGCAAAAGATAAAAATGATCCTTTCCGACTGATGGGATTTGGTCACCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAAACCTGTCACGAAGTCTTAAAAGAGCTGAATATCCAAGATGATCCGCTGCTTGATATAGCTATGGAACTTGAAAGAATCGCCCTGAATGATGAATATTTTGTTGAGAAGAAACTTTATCCAAATGTTGATTTTTATTCTGGCATTACATTAAAAGCTCTGGGTTTTCCAACTGAAA Bartonella_sp._B29111_ex._Artibeus_toltecus_HM597197 TGCAAATGAAGCATGCCTCAAAATGCTACAAGAAATAGGTTCTATTAAAAAAATTCCTGAATTTATTGCACGAGCAAAAGATAAAAATGATCCTTTCCGTCTCATGGGATTTGGCCATCGTGTCTATAAAAATTATGATCCACGTGCGAAAATTATGCAGAAAACCTGTCACGAAGTTCTGAAAGAATTAAACATTCAAGATGATCCACTTCTTGATATTGCCATGGAGCTTGAAAAAATTGCTTTGAATGACGAATATTTTATTGAAAAAAAGTTATATCCTAATGTCGATTTCTATTCTGGCATTACATTAAAAGCTCTAGGATTTCCAACTGAAA Bartonella_sp._B29112_ex._Phyllostomus_hastatus_HM597204 TGCTAATGAAGCATGCCTAAAAATGCTCAAAGAAATAGGATCCGTTCAAAAAATCCCTGAATTTATCGCACGTGCAAAAGATAAAAATGATCCTTTCCGTCTTATGGGTTTTGGCCATCGCGTTTACAAAAGCTATGATCCACGCGCAAAAATTATGCAGAAAACTTGCTATGAGGTTTTAAAAGAACTCAACATTCAAGATGATCCACTTTTTGATATAGCTATGGAACTTGAAAAAATTGCTTTGAATGATGAATATTTTATTGAAAAAAAACTTTATCCTAATGTTGATTTCTATTCTGGCATCACGTTAAAAGCTCTAGGCTTTCCAGCCAAAA Bartonella_sp._B29114_ex._Desmodus_rotundus_HM597192 AGCCAATGAAGCGTGCTTGAAAATGTTACAAGAAATAGGTTCCGTTAAAAAAATTCCTGAGTTTATTTCACGTGCAAAAGATAAAAGTGATCCTTTCCGTCTGATGGGCTTTGGTCACCGAGTCTATAAAAACTATGATCCACGCGCGAAAATCATGCAAAAGACGTGCTATGAAGTCTTAAAAGAAATGAACATTCAAGATGATCCGCTTTTTGATATTGCCATGGAACTTGAACACATTGCCTTAAACGATGAATACTTTATTGAAAAAAAGCTTTATCCTAATGTCGATTTTTATTCTGGCATTACATTAAAAGCTCTAGGTTTCCCAACCAAAA Bartonella_sp._B29115_ex._Phyllostomus_hastatus_HM597201 TGCTAATGAGGCATGCCTAAAAATGCTACAAGAAATAGGTTCCATTGAAAAAATTCCTGAATTTATTGCACGTGCAAAAGATAAAAATGATCCTTTTCGACTTATGGGTTTTGGTCATCGTGTCTATAAAAATTATGATCCACGCGCAAAAATTATGCAACAGACCTGCCATGAAGTTCTGAAAGAACTCAATATTCAAGATGATCCACTTCTTGATATCGCCATGGAGCTTGAGAAAATTGCTCTTCATGATGAATACTTTATTGAGAAGAAACTATATCCTAATGTCGATTTTTATTCGGGTATTACATTAAAAGCTTTAGGCTTCCCAACAGAAA Bartonella_sp._B29116_ex._Phyllostomus_hastatus_HM597198 TGCTAATGAAGCATGCTTAAAGATGCTACAAGAAATAGGTTCAATTAAAAAAATTCCTGAATTTATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGTCTCATGGGATTTGGCCATCGAGTCTATAAAAATTATGATCCACGTGCGAAAATCATGCAGAAAACCTGTCACGAAGTTCTAAAAGAATTAAATATCCAAGATGATCCACTTCTTGATATCGCCATGGAGCTTGAAAAAATTGCTTTGAATGACGAATATTTTATTGAAAAGAAGCTATACCCTAATGTCGATTTCTATTCTGGCATTACATTAAAAGCTCTAGGGTTTCCAACTGAAA Bartonella_sp._B29119_ex._Desmodus_rotundus_HM597195 CGCCAATGAAGCATGTCTAAAAATGTTACAAGAAATAGGTTCCATTGAGAAAATTTCTGAATTTATTGCACGTGCAAAAAACAAAAATGATCCTTTCCGTCTTATGGGTTTTGGACACCGTGTCTATAAAAATTATGATCCACGTGCAAAAATTATGCAACAAACCTGCCATGAAGTTCTAAAAGAACTCAATATTCAAGATGATCCACTTCTTGATATCGCCATGGAGCTTGAAAGAATTGCCCTAAATGATGCATATTTTATTGAAAAAAAGCTCTATCCTAATGTCGATTTCTATTCTGGCATTACATTAAAAGCTTTAGGGTTCCCAACTGAAA Bartonella_sp._B29122_ex._Desmodus_rotundus_HM597196 TGCCAATGAAGCATGTCTAAAGATGTTACAAGAAATAGGTTCCATTGAGAAAATTTCTGAATTTATTGCACGTGCAAAAAACAAAAATGATCCTTTCCGTCTTATGGGTTTTGGACACCGTGTCTATAAAAATTATGATCCACGTGCAAAAATTATGCAACAAACCTGCCATGAAGTTCTGAAAGAACTCAAAATTCAAGATGATCCACTTCTTGATATCGCTATGGAGCTTGAAAGAATTGCCCTGAATGATGCATATTTTATTGAAAAAAAGCTCTATCCTAATGTCGATTTCTATTCTGGTATTACATTAAAAGCTTTAGGATTCCCAACTGAAA Bartonella_sp._B29126_ex._Carollia_perspicillata_HM597199 AGCCAACGAAGCATGTCTAAAAATGCTTCAAGAAATAGGCTCCATTGAAAGAATTCCTGAATTTATTGCACGTGCAAAAGATAAAAATGATCCCTTCCGCCTAATGGGATTTGGTCATCGTGTCTATAAAAATTATGATCCACGTGCAAAGATCATGCAAAAAACTTGCCACGAAGTTTTAAACGAACTGAATATCAAAGATGATCCGCTACTTGATATCGCTGTAGAACTTGAAAAAATAGCCTTAGATGATGCGTATTTTGTTGAGAAAAAGCTTTATCCAAATGTTGATTTCTATTCTGGTATTACACTGAAAGCTTTAGGATTTCCAACCGAAA Bartonella_sp._B29134_ex._Pteronotus_davyi_HM597205 AGCCAATGAGGCATGTCTAAAAATGCTACAAGAAATAAATTCCGTTAAAAGAATTCCCGAATTTATTGCACGTGCAAAAGATAAGAACGACCCCTTCCGCTTAATGGGATTTGGCCATCGTGTCTATAAGAATTATGATCCACGTGCAAAAATCATGCAAAAAACTTGCCATGAAGTTTTAAAAGAGCTGAATATCCAAGATGATCCACTGCTTGATATCGCTATAGAACTTGAAAAAATCGCTTTAAATGATGAATATTTTATTGAAAAAAAGCTTTATCCAAATGTTGACTTCTACTCTGGTATTACATTAAAAGCCTTGGGATTTCCGACAGAAA Bartonella_sp._B29137_ex._Sturnira_lilium_HM597206 AGCCAATGAAGCATGCCTAAAAATGCTGCAAGAAATAGGCTCTGTTGAAAGAATTCCTGAATTTATTGCGCGTGCAAAAGACAAAAGTGATCCCTTCCGCCTGATGGGATTTGGTCATCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAGACCTGTCATGAAGTTTTAAAAGAACTAAATATCAAAAATGATCCACTGCTTGATATCGCTATAGAACTTGAGAAAATAGCCTTAGATGATGCATATTTTATTGAGAAAAAGCTTTATCCAAATGTTGATTTCTATTCTGGTATTACATTGAAAGCTTTAGGATTTCCAACCGAAA Bartonella_sp._B29172_ex._Micronycteris_microtis_HM597207 CGCTAATGAAGCATGTCTAAAAATGCTACAAGAAATAGGATCCGTTCAAAAAATCCCTGAATTTATCGCACGTGCAAAAGATAAAAATGATCCTTTCCGCCTTATGGGTTTTGGCCATCGCATTTATAAAAGTTATGATCCACGTGCAAAAATTATGCAAAAAACTTGCTATGAAGTTTTAAAAGAACTGAACATTCAAGATGATCCACTTTTTGATGTAGCTATGGAACTCGAAAAAATTGCTTTGAATGATGAATATTTTATTGAAAAAAAGCTCTATCCTAATGTTGACTTCTATTCTGGTATCACATTAAAAGCTTTAGGCTTTCCAACCGAAA Bartonella_sp._B29230_ex._Phyllostomus_hastatus_HM597200 AGCCAACGAAGCATGTCTAAAAATGCTGCAAGAAATAGGCTCCGTTGAAAGAATTCCTGAATTTATTGCACGCGCAAAAGATAAAAATGATCCTTTCCGCCTAATGGGATTTGGTCATCGTGTCTATAAAAACTATGATCCACGTGCAAAAATCATGCAAAAAACCTGCCACGAAGTTTTAAAAGAACTGAATATCAAAGATGATCCACTACTTGATATCGCTATAGAACTTGAAAAAATAGCCTTAGATGATGCGTATTTTGTTGAGAAAAAGCTTTATCCAAATGTTGATTTCTATTCTGGTATTACATCGAAAGCTTTAGGATCTCCAACCGAAA Bartonella_sp._B32851_ex._Artibeus_obscurus_JQ071380 TGCTAATGAAGCATGCCTAAAAATGCTACAAGAAATAGGATCCGTTCAAAAAATTCCTGAATTTATTGCGCGCGCAAAAGATAAAAATGATCCTTTCCGTCTTATGGGTTTTGGCCATCGCGTTTACAAAAGTTATGATCCACGCGCAAAAATTATGCAAAAAACTTGCTATGAAGTTTTAAAAGAACTGAACATTCAAGATGATCCACTTTTTGATATAGCTATGGAACTTGAAAAAATTGCTTTGAATGATGAATATTTTATTGAAAAAAAGCTCTATCCTAATGTTGATTTCTATTCTGACATCACGTTAAAAGCTTTAGGTTTCCCAGCCGAAA Bartonella_sp._B32854_ex._Phyllostomus_hastatus_JQ071388 TGCGAATGAAGCATGCCTAAAAATGCTACAAGAAATAGGTTCTATTAAAAAAATTCCTGAATTTATTGCACGAGCAAAAGATAAAAATGATCCTTTCCGTCTCATGGGATTTGGCCATCGAGTCTATAAAAATTATGATCCACGTGCGAAAATTATGCAGAAAACCTGCCACGAAGTTCTGAAAGAATTAAACATTCAAGATGATCCACTTCTTGATATCGCCATGGAGCTTGAAAAAATTGCTTTGAATGACGAATATTTTATTGAAAAAAAATTATATCCTAATGTCGATTTCTATTCTGGCATTACATTAAAAGCCCTAGGATTTCCAACTGAAA Bartonella_sp._B32855_ex._Desmodus_rotundus_JQ071378 TGCCAATGAAGCATGCCTAAAAATGCTACAAGAAATAGGTTCTATTAAAAAAATTCCTGAATTTATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGCCTTATGGGATTTGGCCATCGAGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAGAAAACCTGCCACGAAGTTCTGAAAGAATTAAACATCCAAGATGATCCACTTCTTGATATCGCCATGGAGCTTGAAAAAATTGCTTTGAATGACGAATACTTTATTGAAAAAAAACTATACCCTAATGTCGATTTTTATTCTGGCATTACATTAAAAGCCCTAGGGTTTCCAACCGAAA Bartonella_sp._B32856_ex._Vampyressa_bidens_JQ071389 TGCAAATGAAGCATGTCTAAAAATGTTACAAGAAATAGGCTCTATTAGAAAAATTCCTGAATTTATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGCCTTATGGGTTTTGGCCACCGGGTTTATAAAAACTATGATCCACGTGCGAAAATCATGCAGAAAACCTGTCACGAAGTTTTGAAAGAATTAAATATCCAAGATGATCCACTTCTTGATATCGCTATAGAACTTGAAAACATTGCTCTAAATGATGAATATTTTATTGAAAAAAAGCTATACCCTAATGTTGATTTCTATTCTGGCATTACATTAAAGGCTCTAGGATTCCCAACCGAAA Bartonella_sp._B32943_ex._Carollia_perspicillata_JQ071384 AGCGAATGAAGCATGTCTAAAGATGTTACAAGAAATAGGTTCCGTTGAAAGAATTCCTGAATTTATCGCACGTGCAAAAGATAAAAATGATCCTTTCCGACTGATGGGATTTGGTCATCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAAACTTGTCACGAAGTCTTAAAAGAGCTGAATATCCAAGATGATCCGCTGCTTGATATAGCTATGGAACTTGAAAGAATCGCCCTGAATGATGAATATTTTGTTGAGAAGAAACTTTATCCAAATGTTGATTTTTATTCTGGCATTACATTAAAAGCTCTAGGTTTTCCAACTGAAA Bartonella_sp._B32946_ex._Glossophaga_soricina_JQ071383 AGCGAATGAAGCATGTCTAAAGATGTTACAAGAAATAGGTTCCATTGAAAGAATTCCTGAATTTATCGCACGCGCAAAAGATAAAAATGATCCTTTCCGACTGATGGGATTTGGTCACCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAAACCTGTCACGAAGTCTTAAAAGAGCTTAATATCCAAGATGATCCGCTGCTTGATATAGCCATGGAACTTGAAAGAATCGCCCTGAATGATGAATATTTTGTTGAGAAGAAACTTTATCCAAATGTTGATTTTTATTCTGGCATTACATTAAAAGCTCTAGGTTTTCCAACTGAAA Bartonella_sp._B32947_ex._Phyllostomus_hastatus_JQ071387 TGCTAATGAAGCATGCTTAAAGATGCTACAAGAAATAGGTTCAATTAAAAAAATTCCTGAATTTATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGTCTCATGGGATTTGGCCATCGAGTCTATAAAAATTATGATCCACGTGCTAAAATCATGCAGAAAACCTGTCACGAAGTTCTAAAAGAATTAAATATCCAAGATGATCCACTTCTTGATATCGCCATGGAGCTTGAAAAAATTGCTTTGAATGACGAATATTTTATTGAAAAGAAGCTATACCCTAATGTCGATTTCTATTCTGGCATTACATTAAAAGCTCTAGGGTTTCCAACTGAAA Bartonella_sp._B32953_ex._Artibeus_planirostris_JQ071381 AGCCAACGAAGCATGTTTAAAAATGCTGCAAGAAATAGGCTCTGTTGAAAGAATTCCTGAATTTATTGCGCGTGCAAAAGATAAAAATGATCCCTTCCGCCTAATGGGATTTGGTCATCGTGTCTATAAAAATTACGATCCACGTGCAAAAATCATGCAAAAAACCTGCCACGAAGTTTTAAAAGAACTGAATATCAAAGATGATCCACTACTTGATATCGCTATGGAACTTGAAAAAATAGCCCTAGATGATGCATATTTTGTTGAGAAAAAACTTTATCCAAATGTTGATTTCTATTCTGGTATCACATTGAAAGCTTTAGGATTTCCAACCGAAA Bartonella_sp._B32954_ex._Artibeus_planirostris_JQ071382 AGCGAATGAAGCATGTCTAAAGATGTTACAAGAAATAGGTGCCATTGAAAGAATTCCTGAATTTATCGCACGTGCAAAAGATAAAAATGATCCTTTCCGACTGATGGGATTTGGTCATCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAAACTTGTCACGAAGTCTTAAAAGAGCTGAATATCCAAGATGATCCGCTGCTTGATATAGCTATGGAACTTGAAAGAATCGCCCTGAATGATGAATATTTTGTTGAGAAGAAACTTTATCCAAATGTTGATTTTTATTCTGGCATTACATTAAAAGCTCTAGGTTTTCCAATTGAAA Bartonella_sp._B32955_ex._Carollia_perspicillata_JQ071385 CGCTAATGAAGCATGTCTAAAAATGCTACAAGAAATAGGATCCGTTCAAAAAATCCCTGAATTTATCGCACGTGCAAAAGATAAAAATGATCCTTTCCGCCTTATGGGTTTTGGCCATCGCATTTACAAAAGTTATGATCCACGTGCAAAAATTATGCAAAAAACTTGCTATGAAGTTTTAAAAGAACTGAACATTCAAGATGATCCACTTTTTGATGTAGCTATGGAACTCGAAAAAATTGCTTTGAATGATGAATATTTTATTGAAAAAAAGCTCTATCCTAATGTTGACTTCTATTCTGGTATCACATTAAAAGCTTTAGGCTTTCCAACCGAAA Bartonella_sp._B32960_ex._Carollia_perspicillata_JQ071386 AGCGAATGAAGCATGTTTAAAGATGTTACAAGAAATAGGTTCCGTTGAAAGAATTCCTGAATTTATCGCACGTGCAAAAGATAAAAATGATCCTTTCCGACTGATGGGATTTGGTCATCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAAACTTGTCACGAAGTCTTAAAAGAGCTGAATATCCAAGATGATCCACTGCTTGATATAGCTATGGAACTTGAAAGAATCGCCCTGAATGATGAATATTTTATTGAGAAGAAACTTTATCCAAATGTTGATTTTTATTCTGGCATTACATTAAAAGCTCTAGGTTTTCCAACTGAAA Bartonella_sp._Bc37076_ex._Brachyphylla_cavernarum AGCCAATGAGGCATGTCTAAAAATGCTACAAGAAATAAAGTCCGTTAAAAGAATTCCTGAATTTATTGCACGTGCAAAAGATAAGAATGACCCTTTCCGTTTGATGGGGTTTGGTCATCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAAACCTGCCATGAAGTCTTAAAAGAGCTGAATATACAAGATGATCCGCTGCTTGATGTCGCGATGGAACTTGAAAACATCGCCTTACGTGATGAGTATTTTATTGAGAAAAA{AG}CTTTACCCAAATGTTGATTTCTACTCTGGTATTACATTAAAAGCCCTAGGCTTTCCGACCGAAA 'Bartonella sp. C-583 ex. Coleura afra HM545136' TGCTAATGAGGCATGCCTAAATATGATACAAGAAATTGGTTCTACTGAAAGAATTCCTGAATTTATAGCGCGTGCAAAAGATAAAAA{AT}GACCCTTTCCGCCTTATGGGCTTTGGTCATCGTGTCTACAAAAATTATGATCCACGTGCTAAAATTA{AT}GCAACAAACCTGCCACGAAG{ACT}GCTAAAAGAGCTAAATATTCAAAACGATCCACTTCTTGATATCGCTGTTGCGCTTGAAAAAATTGCTCTGAATGATGAGTATTTTATCGAAAAAAAGCTTTACCCCAACGTCGATTTTTATTCTGGTATTACACTAAAAGCTT------------------ 'Bartonella sp. E1-105 ex. Eidolon helvum HM363765' AGCGAATGAAGCATGTCTAAAGATGCTACAAGAAATAGGTTCTGTTGACAGAATTCCTGAATTTATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGCCTTATGGGATTTGGTCACAGAGTTTATAAAAACTATGATCCACGTGCAAAGATTATGCAGCAGACCTGTCACGAAGTTTTAAAAGAGCTGAACATCCAAGATGATCCGCTTCTTGATATCGCTGTCGCACTTGAAAACATTGCCCTGCATGACGAATACTTTATTGAAAAAAAGCTTTATCCTAATGTCGATTTTTATTCTGGAATTACGTTAAAAGCTTTAGGTTTTCCAACGACAA 'Bartonella sp. E2-114 ex. Eidolon helvum HM363766' AGCAAATGAAGCATGCCTAAAAATGCTACAAGAAATAGGATCTGTTGAAAGAATCCCTGAATTTATCGCGCGTGCAAAAGATAAAAATGACCCTTTCCGTCTTATGGGATTTGGTCATAGAGTTTACAAAAATTATGATCCACGTGCAAAAATTATGCAGCAAACTTGTCACGAAGTTTTAAAAGAATTAAACATTAAAGATGACCCACTTCTTGATATTGCTGTCGAACTTGAAAAAATTGCTCTGCATGATGATTACTTTATTGAAAAAAAGCTTTATCCTAATGTCGACTTTTACTCTGGCATCACATTGAAAGCTTTAGGTTTTCCGACTCAAA 'Bartonella sp. E3-106 ex. Eidolon helvum HM363767' AGCCAATGAAGCATGCCTAAATATGCTAAAGGAAATCGGTTCTGCAGAAAGAATTCCTGAATTCATAGCACGTGCAAAAGACAAAAAAGACCCCTTCCGTCTCATGGGATTCGGTCATCGAGTCTATAAACATTATGATCCACGTGCAAAAATTATGCAGCAAACCTGCCATGAAGTACTAAAAGAATTAAACATCCAAGATGATCCACTTCTTGATGTGGCTGTCGCGCTTGAAAATATTGCTCTTAACGATGAATATTTTATTGAAAAGAAGCTTTATCCTAACGTCGATTTTTATTCTGGAATCACATTAAAAGCTTTAGGCTTTCCGACTAAAA 'Bartonella sp. Ew-111 ex. Eidolon helvum HM363768' AGCCAATGAAGCATGCTTAAAAATGCTACAAGAAATAGGCTCCGTCAAAAAAATTCCTGAATTTATTGCTCGCGCAAAAGATAAAAATGATTCTTTTCGTCTTATGGGTTTTGGTCATCGCGTATATAAAAATTATGATCCACGCGCAAAAATCATGCAACAAACCTGTCATGAAGTCTTAAAAGAACTGAACATTCAAAATGATCCACTTCTTGATATAGCTATCGAACTCGAAAACATTGCGCTAAATGATGACTACTTTGTTGAAAAACGACTTTATCCTAACGTCGATTTCTATTCTGGCATTACACTAAAAGCTC------------------ 'Bartonella sp. H-556 ex. Hipposideros armiger HM545137' AGCTAATGAGGCATGCCTAAAGATGCTACAAGAAATAGGCCTTATTGAAAGAATCCCCGAATTCATTGCACGTGCGAAGGATAAAAATGATCCTTTTCGCCTTATGGGTTTTGGTCACCGAGTCTACAAAAATTATGATCCGCGCGCAAAAATCATGCAAAAAACCTGTCATGAAGTTTTAAAGGAACTAAATATTCAGAACGATCCACTTCTTGATATTGCCGTCGCACTTGAAAATATTGCCCTAAATGATGAATATTTTATCGAAAAAAAGCTCTACCCTAATGTAGATTTTTATTCTGGAATTACGTTAAAAGCTTTAGGCTTTCCAGCTGAAA Bartonella_sp._Mr37075_ex._Monophyllus_redmani TGCCAATGAAGCATGCCTGAAAATGCTACAAGAAATAGGATCCATTGAGAAAATTCCTGAATTTATTGCACGTGCCAAAGATAAAAACGACCCTTTCCGTCTTATGGGTTTTGGCCACCGTGTTTATAAAAACTATGATCCACGCGCGAAAATCATGCAGCAAACCTGCCATGAGGTTTTGAAAGAACTAAATATTCAGGATGATCCACTTCTTGATATCGCTATGGAGCTTGAAAAAATTGCTCTAAGTGATGAATATTTCATTGAGAAAAAACTATACCCTAATGTTGATTTCTATTCTGGTATTACATTAAAAGCTCTAGGTTTCCCAACAGAAA Bartonella_sp._Mr37077_ex._Monophyllus_redmani CGCCAATGAAGCGTGTCTAAAAATGCTACAAGAAATAGGTTCCATTAAGAAAATTCCTGAATTTATTGCACGTGCAAAAGACAAAAATGATTCTTTCCGACTTATGGGTTTTGGGCACCGTGTCTACAAAAATTATGATCCACGCGCAAAAATTATGCAGAAAACCTGCCATGAAGTTCTGAAAGAACTAAATATTCAGGATGATCCTCTTCTTGATATTGCCATGGAGCTTGAAAAAATTGCTCTTAATGATGAATATTTCATTGAGAAGAAGTTATATCCAAATGTAGATTTCTATTCTGGCATTACATTGAAAGCTCTGGGCTTCCCAACAGAAA Bartonella_sp._Mr37078_ex._Monophyllus_redmani AGCTAATGAAGCATGTCTAAAAATGCTACAAGAAATAAATTCTGTTAAAAGAATTCCTGAGTTTATTGCACGTGCAAAAGATAAAAATGACCCTTTCCGCTTAATGGGATTTGGTCATCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAGACCTGCCATGAAGTTTTAAAAGAACTGAATATTCAAGACGACCCGCTGCTTGATATCGCCATGGAACTTGAAGACATCGCATTACGCGACGAATATTTTATTGAGAAAAAGCTTTACCCAAATGTTGATTTCTACTCTGGTATTACATTAAAGGCCTTAGGCTTTCCGACCGAAA Bartonella_sp._Mr37079_ex._Monophyllus_redmani --------------------------TACAAGAAATAGGATCCGCTGAGAAAATTCCTGAATTTATTGCACGCGCAAAAGATAAAAATGACCCTTTCCGGCTTATGGGTTTTGGCCACCGTGTTTATAAAAACTATGATCCACGCGCCAAAATCATGCAGCAAACCTGCCATGAAGTTCTGAAAGAACTAAATATTCAAGATGATCCACTTCTTGATATTGCCATGGAGCTTGAAAAAATTGCTCTAAATGATGAATACTTCATTGAGAAAAAACTATACCCTAATGTTGATTTCTATTCTGGTATTACATTAAAAGCTCTAGGTTTCCCAACAGAAA Bartonella_sp._No.05_ex._Miniopterus_schreibersii_JF500511 ----AATGAAGCGTGCTTAAAAATGTTACAAAAAATAGGCTCAGTTCAAAAAATTCCTGAATTCATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGTCTTATGGGTTTTGGTCACCGAGTTTATAAAAATTATGACCCACGTGCAAAAATTATGCAGCAGACCTGCCATGAAGTTTTAAAAGAACTCAATATTAAAGATGATCCACTTCTTGATATTGCTGTAGAACTTGAAAAAATTGCTCTAAATGACGAATATTTTATTGAAAAAAAGCTTTACCCTAATGTCGATTTTTATTCTGGCATAACATT-------------------------- Bartonella_sp._No.16_ex._Miniopterus_schreibersii_JF500522 ----AATGAAGCATGCTTAAAAATGTTACAAAAAATAGGCTCAGTTCAAAAAATTCCTGAATTCATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGTCTTATGGGTTTTGGTCACCGAGTTTATAAAAATTATGACCCACGTGCAAAAATTATGCAGCAAACCTGCCATGAAGTTTTAAAAGAACTCAATATTAAAGATGATCCACTTCTTGATATTGCTATAGAACTTGAAAAAATTGCTCTAAATGACGAATATTTTATTGAAAAAAAGCTTTACCCTAATGTCGATTTTTATTCTGGCATAACATT-------------------------- 'Bartonella sp. R-191 ex. Rousettus aegyptiacus HM363764' GGCCAATGAAGCGTGCTTAAATATGCTGAAAGAGATCGGTTCTGCTGAAAGAATTCCCGAATTCATAGCACGTGCAAAAGACAAAAAAGATCCTTTTCGCCTTATGGGTTTTGGTCATAGAGTTTATAAACATTATGATCCACGTGCAAAAATTATGCAGCAAACCTGTCATGAAGTCCTAAAAGAATTAAACATTCAAGATGATCCGCTTCTTGATGTCGCTGTCGCGCTTGAAAAGATCGCTCTCAATGACGAATATTTTATTGAAAAGAAACTTTACCCTAACGTCGATTTTTATTCCGGAATCACATTGAAAGCTTTAGGCTTTCCGACTAAAA 'Bartonella sp. T-837 ex. Triaenops persicus HM545138' AGCAAATGAAGCATGCTTAAAGATGTTGCAGGAAATCGGTTCTGTTGAAAATATTCCTGAATTCATTGCACGTGCAAAAGATAAAAATGATCCTTTTCGCCTTATGGGTTTTGGTCATCGCGTCTACAAAAATTATGATCCACGTGCAAAAATTATGCAAAAAACCTGTCATGAAGTTTTAAAAGAACTTAATATCCAAGATGATCCGCTTCTAGACGTTGCTATTGCACTTGAAAAAATTGCCCTCAACGATGAATACTTTATTACAAAAAAGCTTTATCCCAATGTAGATTTCTATTCTGGTATTACATTAAAAGCTTTAGGCTTTCCAACTGAGA Bartonella_sp._ex._Artibeus_jamaicensis_AJ37081 GGCCAACGAAGCATGTCTAAAAATGCTGCAAGAAATAGGCTCTGTTGAAAGAATTCCTGAATTTATTGCGCGTGCAAAAGATAAAAATGATCCCTTCCGCCTAATGGGATTTGGTCATCGTGTCTATAAAAATTATGATCCACGTGCAAAAATCATGCAAAAAACCTGCCACGAAGTTTTAAAAGAACTAAATATCAAAGATGATCCACTACTTGATATCGCTATGGAACTTGAAAAAATAGCCCTAGATGATGCATATTTTGTTGAGAAAAAGCTTTATCCAAATGTTGATTTCTATTCTGGTATCACATTGAAAGCTTTAGGATTTCCAACCGAAA Bartonella_sp._ex._Myotis_daubentoni_AJ871613 AGCCAATGAAGCATGCCTAAAAATGCTACAAGAAATAGGTTCCGTTAAGAGAATTCCTGAATTCATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGCCTGATGGGCTTTGGTCATCGAGTCTATAAAAATTATGACCCACGTGCAAGAATCATGCAAAAAACCTGCCATGATGTTTTAAAAGAACTAAATATTCAAGATGATCCGCTTCTTGATATCGCTATAGAACTTGAGAAAATCGCCTTAAATGATGAATATTTTGTTGAGAAAAGGCTTTATCCGAATGTTGATTTTTATTCTGGCATTACATTAAAGGCCCTAGGCTTTCCAACCGAAA Bartonella_sp._ex._Myotis_mystacinus_AJ871612 AGCCAATGAAGCATGCCTAAAGATGCTACAAGAAATAGGTTCCGTTAAGAGAATTCCTGAATTCATTGCACGTGCAAAAGATAAAAATGATCCTTTCCGCCTGATGGGCTTTGGTCATCGAGTCTATAAAAATTATGACCCACGTGCAAAAATCATGCAAAAAACCTGCCATGATGTTTTAAAAGAACTAAATATTCAAGATGATCCGCTTCTTGATATCGCTATAGAACTTGAGAAAATCGCCCTGAATGATGAATATTTTGTTGAGAAAAAGCTTTATCCGAATGTTGATTTCTATTCTGGCATTACATTAAAAGCTCTAGGCTTTCCAACCGAAA Bartonella_sp._ex._Nyctalus_noctula_AJ871615 AGCCAATGAAGCATGCCTAAAGATGCTGCAAGAAATAGGTTCCGTTAAGAGAATTCCTGAATTCATTGCACGTGCAAAAGATAAAAACGATCCTTTCCGCCTCATGGGATTTGGTCATCGAGTCTATAAAAATTATGACCCACGTGCAAAAATCATGCAAAAAACCTGCCATGAGGTTTTAAAAGAACTAAATATTCAAGATGATCCGCTTCTTGACATCGCTATAGAGCTTGAGAAAATCGCCTTAAATGATGAATATTTTGTTGAGAAAAAGCTGTATCCTAATGTTGATTTCTATTCTGGCATTACATTAAAAGCTCTAGGATTTCCATCCGAAA Brucella_melitensis CGCCAATGAAGCTGCGCTCAACATGCTTTCGGAAATCGGCTCGGTTGACCGTATCCCGGAATATATCGCCAGGGCTAAAGACAAGAACGATCCGTTCCGTTTGATGGGCTTCGGCCATCGCGTTTACAAGAACTACGATCCGCGCGCCAAGATCATGCAGAAGACCTGCCATGAAGTCCTCGGCGAGCTGGGCATCAAGGATGATCCGCTGCTTGACGTTGCAATGGAACTGGAAAGGATTGCCCTGACCGACGAATATTTCATCGAAAAGAAGCTCTACCCGAACATCGACTTCTATTCGGGCATCACGCTGAAGGCGCTGGGCTTCCCGACCGAAA ; END; BEGIN TREES; TITLE Bartonella_sp._citrate_synthase; LINK TAXA = Taxa1; TRANSLATE 1 Bartonella_sp._ex._Artibeus_jamaicensis_AJ37081, 2 Bartonella_sp._ex._Myotis_mystacinus_AJ871612, 3 Bartonella_sp._ex._Myotis_daubentoni_AJ871613, 4 Bartonella_sp._ex._Nyctalus_noctula_AJ871615, 5 Bartonella_sp._Bc37076_ex._Brachyphylla_cavernarum, 6 'Bartonella sp. R-191 ex. Rousettus aegyptiacus HM363764', 7 'Bartonella sp. E1-105 ex. Eidolon helvum HM363765', 8 'Bartonella sp. E2-114 ex. Eidolon helvum HM363766', 9 'Bartonella sp. E3-106 ex. Eidolon helvum HM363767', 10 'Bartonella sp. Ew-111 ex. Eidolon helvum HM363768', 11 'Bartonella sp. C-583 ex. Coleura afra HM545136', 12 'Bartonella sp. H-556 ex. Hipposideros armiger HM545137', 13 'Bartonella sp. T-837 ex. Triaenops persicus HM545138', 14 Bartonella_sp._B29042_ex._Desmodus_rotundus_HM597187, 15 Bartonella_sp._B29043_ex._Desmodus_rotundus_HM597188, 16 Bartonella_sp._B29044_ex._Desmodus_rotundus_HM597189, 17 Bartonella_sp._B29107_ex._Desmodus_rotundus_HM597190, 18 Bartonella_sp._B29108_ex._Desmodus_rotundus_HM597191, 19 Bartonella_sp._B29114_ex._Desmodus_rotundus_HM597192, 20 Bartonella_sp._B29102_ex._Pteronotus_davyi_HM597193, 21 Bartonella_sp._B29109_ex._Pteronotus_davyi_HM597194, 22 Bartonella_sp._B29119_ex._Desmodus_rotundus_HM597195, 23 Bartonella_sp._B29122_ex._Desmodus_rotundus_HM597196, 24 Bartonella_sp._B29111_ex._Artibeus_toltecus_HM597197, 25 Bartonella_sp._B29116_ex._Phyllostomus_hastatus_HM597198, 26 Bartonella_sp._B29126_ex._Carollia_perspicillata_HM597199, 27 Bartonella_sp._B29230_ex._Phyllostomus_hastatus_HM597200, 28 Bartonella_sp._B29115_ex._Phyllostomus_hastatus_HM597201, 29 Bartonella_sp._B29110_ex._Glossophaga_soricina_HM597202, 30 Bartonella_sp._B29105_ex._Pteronotus_davyi_HM597203, 31 Bartonella_sp._B29112_ex._Phyllostomus_hastatus_HM597204, 32 Bartonella_sp._B29134_ex._Pteronotus_davyi_HM597205, 33 Bartonella_sp._B29137_ex._Sturnira_lilium_HM597206, 34 Bartonella_sp._B29172_ex._Micronycteris_microtis_HM597207, 35 Bartonella_sp._No.05_ex._Miniopterus_schreibersii_JF500511, 36 Bartonella_sp._No.16_ex._Miniopterus_schreibersii_JF500522, 37 Bartonella_sp._B32855_ex._Desmodus_rotundus_JQ071378, 38 Bartonella_sp._B32851_ex._Artibeus_obscurus_JQ071380, 39 Bartonella_sp._B32953_ex._Artibeus_planirostris_JQ071381, 40 Bartonella_sp._B32954_ex._Artibeus_planirostris_JQ071382, 41 Bartonella_sp._B32946_ex._Glossophaga_soricina_JQ071383, 42 Bartonella_sp._B32943_ex._Carollia_perspicillata_JQ071384, 43 Bartonella_sp._B32955_ex._Carollia_perspicillata_JQ071385, 44 Bartonella_sp._B32960_ex._Carollia_perspicillata_JQ071386, 45 Bartonella_sp._B32947_ex._Phyllostomus_hastatus_JQ071387, 46 Bartonella_sp._B32854_ex._Phyllostomus_hastatus_JQ071388, 47 Bartonella_sp._B32856_ex._Vampyressa_bidens_JQ071389, 48 Bartonella_sp._Mr37075_ex._Monophyllus_redmani, 49 Bartonella_sp._Mr37077_ex._Monophyllus_redmani, 50 Bartonella_sp._Mr37078_ex._Monophyllus_redmani, 51 Bartonella_sp._Mr37079_ex._Monophyllus_redmani, 52 Brucella_melitensis; TREE 'Imported tree 0+' = [&R] (52:0.3308821857297412,((32:0.05548791096522709,(5:0.02845340816399157,51:0.05579582885440218)84:0.01456172844250038)92:0.03328282000694964,((33:0.0335992724614113,((39:0.009105166183995568,1:0.00566934763084224)82:0.007893235482450653,(26:0.025989971427933137,27:0.015629135440526916)78:0.010077913295376493)70:0.013450336454363917)84:0.050996647407881845,((44:0.008992841074678643,(42:2.73284178798397E-6,(40:0.0062018140157772805,(41:0.006004203755107892,29:0.002794071288767581)92:0.009210283198957768)61:0.0028114918070704068)60:2.73284178798397E-6)94:0.06339145884906368,((4:0.03620646596386237,(3:0.02114201997739435,2:0.0023959496905545732)63:0.0041086161277068475)82:0.027071730567008734,((13:0.11867608064740147,(12:0.1334674779447255,((8:0.0995665537198961,7:0.059379466692418184)73:0.03761540699935513,(11:0.10942762776962502,(9:0.05261060492413964,6:0.06123449615457308)99:0.0628509259969013)74:0.05056814155053007)38:0.017377709129861044)30:0.011353105646475185)49:0.022504364928917536,(((17:0.004222244625714111,(15:0.002794508187434965,(14:2.73284178798397E-6,(19:0.0056115015355604255,(16:0.0028125518599273567,18:2.73284178798397E-6)56:0.0027944860442697815)25:2.73284178798397E-6)16:2.73284178798397E-6)55:0.0014134819735245308)100:0.10454973338965479,(30:0.19908440884127368,((21:0.006050751452686012,20:2.73284178798397E-6)100:0.13874998591378965,(38:0.01413986259743799,(31:0.034072690330942665,(34:0.002903166761356092,43:2.73284178798397E-6)99:0.03629948165392607)63:0.008967584073391413)97:0.0455365046761213)24:0.019816357209536607)59:0.01271602092010129)61:0.015794978136468994,(10:0.12411958613840518,((36:2.73284178798397E-6,35:0.0102888439204212)99:0.08732587271937708,((23:0.02336435795005398,22:0.001626421506768922)100:0.05084683258867047,(((50:0.022685449277660353,48:0.028050555350570577)85:0.037665413568038125,(28:0.059668222698316925,49:0.07076478112284576)44:0.012948882183879169)65:0.01786942932709129,(47:0.06243295410582963,((45:0.0029129070857615426,25:2.73284178798397E-6)99:0.028983707497065234,(37:0.014443825956921693,(46:2.73284178798397E-6,24:0.02218440750218271)89:0.028286612351538752)43:0.00817853356893845)78:0.027575326668543464)83:0.039727597935429626)45:0.01270359278287875)59:0.03348918761345326)10:2.73284178798397E-6)6:0.006371771901857492)19:0.02153926534910934)65:0.028483982111496085)67:0.02412194297619831)29:2.73284178798397E-6)15:0.01667137612632404):0.3308821857297412); END;