#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:45 GMT TreeBASE (cc) 1994-2008 Study reference: Rahman M.Z., Uematsu S., Suga H., & Kageyama K. 2014. Two plant pathogenic species of Phytophthora associated with stem blight and crown rot of Easter lily and lettuce, respectively in Japan. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15691] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=32; TAXLABELS Phytophthora_austrocedri Phytophthora_brassicae_ Phytophthora_cichorii_ Phytophthora_cryptogea Phytophthora_dauci_ Phytophthora_drechsleri Phytophthora_erythroseptica Phytophthora_foliorum Phytophthora_hibernalis_ Phytophthora_kelmania Phytophthora_lactucae_ Phytophthora_lateralis_ Phytophthora_medicaginis Phytophthora_megasperma Phytophthora_obscura_ Phytophthora_porri_ Phytophthora_primulae_ Phytophthora_ramorum Phytophthora_sansomeana Phytophthora_sp._CBS_137103 Phytophthora_sp._KPh2010_1_1_ Phytophthora_sp._KPh2010_4_1_ Phytophthora_sp._KPh2011_1_1_ Phytophthora_sp._KPh2013_1_1_ Phytophthora_sp._KPh2013_4_1_ Phytophthora_sp._MAFF239556 Phytophthora_sp._NBRC110061 Phytophthora_sp._NBRC110062_ Phytophthora_syringae Phytophthora_taxon_castitis_ Phytophthora_taxon_parsley_ Phytophthora_trifolii_ ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=32; TAXLABELS Phytophthora_austrocedri Phytophthora_brassicae_ Phytophthora_cichorii_ Phytophthora_cryptogea_ Phytophthora_dauci_ Phytophthora_drechsleri_ Phytophthora_erythroseptica_ Phytophthora_foliorum_ Phytophthora_hibernalis_ Phytophthora_lactucae_ Phytophthora_lateralis_ Phytophthora_medicaginis_ Phytophthora_megasperma_ Phytophthora_obscura_ Phytophthora_porri_ Phytophthora_primulae_ Phytophthora_ramorum_ Phytophthora_sansomea Phytophthora_sp._CBS137103 'Phytophthora sp. KPh2010-1-1 ' 'Phytophthora sp. KPh2010-4-1' 'Phytophthora sp. KPh2011-1-1 ' 'Phytophthora sp. KPh2013-1-1 ' 'Phytophthora sp. KPh2013-4-1 ' Phytophthora_sp._MAFF239556 Phytophthora_sp._NBRC110061 Phytophthora_sp._NBRC110062 Phytophthora_sp._kelmania_ Phytophthora_syringae_ Phytophthora_taxon_castitis_ Phytophthora_taxon_parsley_ Phytophthora_trifolii ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=65; TAXLABELS Phytiophthora_phaseoli Phytophhtora_ramorum Phytophthora_bisheria Phytophthora_boehmeriae Phytophthora_botryosa Phytophthora_brassicae Phytophthora_cactorum Phytophthora_cajani Phytophthora_cambivora Phytophthora_capsici Phytophthora_cinnamomi Phytophthora_cinnamomi_var._parvispora Phytophthora_clandestina Phytophthora_colocasiae Phytophthora_cryptogea Phytophthora_cuyabensis Phytophthora_drechsleri Phytophthora_erythroseptica Phytophthora_europaea Phytophthora_fallax Phytophthora_foliorum Phytophthora_fragariae Phytophthora_glovera Phytophthora_gonapodyides Phytophthora_heveae Phytophthora_hibernalis Phytophthora_humicola Phytophthora_idaei Phytophthora_ilicis Phytophthora_infestans Phytophthora_insolita Phytophthora_inundata Phytophthora_ipomoeae Phytophthora_iranica Phytophthora_katsurae Phytophthora_kernoviae Phytophthora_macrochlamydospora Phytophthora_meadii Phytophthora_megakarya Phytophthora_megasperma Phytophthora_melonis Phytophthora_mexicana Phytophthora_multivesiculata Phytophthora_multivora Phytophthora_nemorosa Phytophthora_nicotianae Phytophthora_niederhauserii Phytophthora_palmivora Phytophthora_porri Phytophthora_primulae Phytophthora_pseudosyringae Phytophthora_pseudotsugae Phytophthora_psychrophila Phytophthora_sansomea Phytophthora_sinensis Phytophthora_sojae Phytophthora_sp._EL8701 Phytophthora_sp._EL8703 Phytophthora_sp._kelmania Phytophthora_syringae Phytophthora_tentaculata Phytophthora_trifolii Phytophthora_uliginosa Phytophthora_vignae Phytopythium_vexans ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M21822] TITLE Phytophthora_spp._from_Lettuce_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=722; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phytophthora_austrocedri CCACGTGAACCGTATCAAAACTTTTATTGGGGGCTTCTGCTGGCTTCGGCTGGTCTGGGTGGCGGCTCTATCATGGCCGCTCTGGGCTTCTTGGGAGTTAGGCCCCATTAACCATTCTTAATACTGAACATACTGTGGGGCAAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGACGTGAAGTGTCTTGCGACTGGGCTTCGGCTCGGCTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGCGTTATATTACGGTTGTGGGGCGTGCTTACTGGCAAGTCGGCGACCGGTTTGTTAGCTGCGGCGTATGGGGGAGTGTCGATTCGCGGTATGATCGGCTTCGGCTGGACAGCGCTTATTGGTGCTTTTCCTGCTGTGGCGGTACGAACTGGTGAACCGTAGCTGTATTGCTTGGCATTTGAACCGACGATGTGGTGCGAAGTAGAGTGGCGGTTGTTCCGGCGCAAGGCTGTCGGGAATTGTGTCAGTGCGACTTCGGTTGT Phytophthora_brassicae_ TCCACGTGACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTAGACTGGGCGGCGGCTCTAGCGCGACCGTTCTGGGCTTCTTGGGGCTAGTAGCTTATTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATAGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGTAGCTTGGCTTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_cichorii_ CCACGTGAACCGTATCAACCTTAATATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGTGGCAGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGTAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGCCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGACGTGAAGTGTCTTGCGACTGGGCTTCGGTCTAGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGAATGTTTTTCTTACTGCGGCGGATAGACTGGTGAACCGTAGCTGTGTGGCTTGGCTTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_cryptogea_ CCACGTGAACCGTATCAACCTTTAATTTGGGGGCTTCCGCGGCCGTTCGGCTGGCTGGGTGGCGGCTCTATCATGGCCGCTTGGGCCTCGCCTGGGCTAGTAGCGTATTAACCATTCCTAATACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGTCCGGCTGCGAGTCCTTTGAAATGTACTACACTGTACTTCTCTTTGCTCGAAAAGCGTGACGTTGCTGGTTGTGGGCTGCCTGTGTGGCATGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGACGCTTATGGTGCTTTTCCTGCTGTGGCTGGATGGACTGGTGAACCGTAGCTGTGCTGCTTGGCGTTTGAACCGGCGGTGTGGTGCGAAGTAGGGTGTCTGTTCTGGCGTAAGCTGCTGGACGGGAACTGTGTGCGCTTCGGCGCGCATCA Phytophthora_dauci_ CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGACCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGAATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCAGCTTGGCTTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGTGACCTCGGTTGT Phytophthora_drechsleri_ CCACGTGAACCGTATCAACCTTTAAATTGGGGGCTTCCGCGGCCGCTCGGCTGGCTGGGTGGCGGCTCTATCATGGCCGCCTGGGCCTCGCCTGGGTTAGTAGCGTATTAACCATTCCTAATACTGAAAAAACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGTCCGGCTGCGAGTCCTTTTAAATGTACTACACTGTACTTCTCTTTGCTCGAAAAGCGTGACGTTGCTGGTTGTGGGCTGCCTGTGTGGCATGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGACGCTTATGGTGCTTTTTCTGCTGCGGCGGGATGGACTGGTGAACCGTAGCTGTGCTGCTTGGCGTTTGAACCGGCGGTATTGTGCGAAGTAGGGTGTCTGTCTCGGCGCAAGCTGGTGGGCGGGAACTGTGTGCGCTTCGGCGTGCATCA Phytophthora_erythroseptica_ CCACGTGAACCGTATCAACCTTTAAATTGGGGGCTTCCGCGGCCGTTCGGCTGGCTGGGTGGCGGCTCTATCATGGCCGCTTGGGCCTCGCCTGGGCTAGTAGCGTATTAACCATTCCTAATACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGTCCGGCTGCGAGTCCTTTGAAATGTACTACACTGTACTTCTCTTTGCTCGAAAAGCGTGACGTTGCTGGTTGTGGGCTGCCTGTGTGGCATGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGACGCTTATGGTGCTTTTCCTGCTGTGGCTGGATGGACTGGTGAACCGTAGCTGTGCTGCTTGGCGTTTGAACCGGCGGTGTGGTGCGAAGTAGGGTGTCTGTTCCGGCGTAAGCTGGTGGACGGGAACTGTGTGCGCTTCGGCGCGCATCA Phytophthora_foliorum_ CCACGTGAACCGTATCAACACTTAGTTGGGGGCTGCTGTTCGGCTTTCGGCTGGCTGGGCGGCGGCTCTATCATGGGCGCCTGGGCCTTCTCTGAGCTAGTAGCCCATTAACCATTCCTAATACTGAACATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGACGTGAAGTGTCTTGCGGCTGGTCTTCGGTCCGGCTGCGAGTCCTTTGAAATGTACTGAACTGTACTTCTCTTTGCTCGAAAAGCGTGACGTTTGTGGTTGTGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCGCTTATGGTGCTTTTCCTGCTGTGGCGGTACGGACTGGTGAACCGTAGCTGTGCGGCTTGGCTTTTGAATCGGCGATGTGGTGCGAAGTAGAGTGGCTGTTCGGCGCAAGCTGGGCGGTCGGGAAATGTGTTGGCGGCTTCGGCTTGCC Phytophthora_hibernalis_ CCACGTGAACCGTATCAACCTTTAGTTGGGGGCTTCTGTTCGGCTTTTTGCTGGCTGGGCGGCGGCTCTATCATGGGCGCCTGGGCCTTCTCTGAGCTAGTAGTCTTTTAACCTTTCTTAATACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGACGTGAAGTGTCTTGCGATTGGTCTTCGGGCCGGCTGCGAGTCCTTTTAAATGTACAGAACGGTACTTCTCTTTGCTCGAAAAGCATAATGGAATGGTTGTGGAAGCTTCCCGGTGGCAAGTCGGCGACTGGTTTGTCTGCTACGGCGTATGGAGGAATGTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAAGCGCTTATGGTGTTTTTCCTGCTGTGGTGGTAATGACTGGTGAACCGTAGCTATGCAGATTGGCCTTTGAACTGAGGATGTTGTGTGAAGTAGAGTGGCGGTTTGGCGCAAGCTGGGCTGTCGGGGAATGTGTTGGCGGCTTCGGCTGTTA Phytophthora_lactucae_ CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_lateralis_ CCACGTGAACCGTATCAAAACTTAGTTGGGGGCTTCTGTTCGGCTTTCGGCTGGCTGGGCGGCGGCTCTATCATGGGCGCATGGGCCTTCTCTGAGCTAGTAGCCCTTTAACCATTCCTAATACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGACGTGAAGTGTCTTGCGATTGGTCTTCGGGCCGGCTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGCATGACGTT-GTGGTTGTGGGCTGTCCGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAAGCGCTTATGGTGTTTTTTCTGCTGTGGCGGTAATGACTGGTGAACCGTAGCTATGCAGCTTGGCTTTTGAACCGACGGTGTTGTGCGAAGTAGAGTGGCGGTTTGGCGCAAGCTGGGCTGTCGGGAAATGTGTTGGCAGCTTCGGCTGTTA Phytophthora_medicaginis_ CCACGTGAACCGTATCAACCTTTAAATTGGGGGCTTCCGCGGCCGTTCGGCTGACTGGGTGGCGGCTCTATCATGGCCGCTTGGGCCTCGCTTGGGCTAGTAGCTTCTTAACCATTCCTAATACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGTCCGGCTGCGAGTCCTTTGAAATGTACTAAACTGTACTTCTCTTTGCTCGAAAAGCGTGACGTTGCTGGTTGTGGGCTGCCTGTGTGGCATGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGACGCTTATGGTGCTTTTCCTGCTGTGGTGGGACGGACTGGTGAACCGTAGCTGTACTGCTTGGCGTTTGAACTGGCGGTGTGGTGCGAAGTAGGGTGTCTGTTCCGGCGCAAGCTGGTGGGCGGGAAGTGTGTGCGCTTCGGCGCGCATCA Phytophthora_megasperma_ CCACGTGAACCGTATCAACCCTAAATTTGGGGGCTTGCTCGTGTGTGGCCTGTAATGGGGGCGGGCTCTATCATGGAGCGTTTGGGCTTCCTCGAGCTAGTGCTATCTTAACCTTTCTTAATACTGAACATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCAGATGTGAAGTGTCTTGCTAGCGGTCTTTCGAGTCTGCCGGTGAGTCCTTTTAAATGTACTGAACTGTACTCTTCTTTGCGCGAAAAGCGTGGCGTTGCGGTTGTGGGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTTAGCTGTGGCGTTTGGAGGAGTGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAACTGCTTATGGTGCTTTTCCTGTCATGGCGGTATGAACTGGTGAACCGTAGCTGTGTGGCTTGGCTTTTGAACCGGCTTTGCTTTGCGAAGTAGTGTGACGGCTTCGGCTGTCGAGCCATTTTGGGAACTGTGTGTGCGGCTTCGTGCTGCG Phytophthora_obscura_ CCACGTGAACCGTATCAAAACCTTTATTGGGGGCTTCTGCTGGCTTCGGCTGGGCTGGGTGGCGGCTCTATCATGGCCGCTCTGGGCTTCCTGGAGTTAGTAGCTCATTAACCATTCTTAATACTGAACATACTGTGGGGCGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGAT-ACAGACGTGAAGTGTCTTGCGACTGGGCTTCGGCTCGGCTGCGAGTCCTTTGAAATGTACTGAACTGTACTTCTCTTTGCTCGAAAAGCGTAATATTACGGTTGTGGGGCTGCTTGTGTGGCATGTCGGCGACCGGTTTGTTAGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGATCGGCTTCGGCTGGGCAGCGCTTATTGGTGCTTTTCTTGCTGTGGCGGTACGAACTGGTGAACCGTAGCTATGTTGCTTGGCTTTTGAACCGGCGATGTGGTGCGAAGTAGAGTGGCGGTTGTTCCAGCGCAAGGCTGTCGGGAATTGTGTCTGTGCGACTTCGGTTGT Phytophthora_porri_ CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGACCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGAATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGC{AC}GCTTGGCTTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGTGACCTCGGTTGT Phytophthora_primulae_ CCCCGTGAACCGTATCAACCTTTTTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGTGGCGGCTCTAGCGCGACCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGCCAGATGTGAAGTGTCTTGCGACTGGACTTTGATCTAGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTATGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTAATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATAAATGTTTTTCTTACTGTGGCGGATAGACTGGTGAACCGTAGCTGTGTAGCTTGGCCTTTGAACCGGTGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_ramorum_ CCACGTGAACCGTATCAAAACTTAGTTGGGGGCTTCTGTTCGGCTTTCGGCTGGCTGGGCGGCGGCTCTATCATGGGCGCTTGAGCCTTCTCTGAGCTAGTAGCCCATTAACCATTCCTAATACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGACGTGAAGTGTCTTGCGATTGGTCTTCGGGCCGGCTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGCATGACGTT-GTGGTTGTGGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAAGCGCTTATGGTGCTTTTTCTGCTGTGGCGGTAATGACTGGTGAACCGTAGCTGTGCAGCTTGGCTTTTGAATCGACGGTGTTGTGCGAAGTAGAGTGGCGGTTCGGCGCAAGCTGGGCTGTCGGGAAATGTGTTGGCGGCTTCGGCTGCTA Phytophthora_sansomea CCACGTGAACCGTATCAACCTTTAAATTGGGGGCTTCCGCGGCCGTTCGGCTGGCTGGGTGGCGGCTCTATCATGGCCGCTTGGGTCTCGCCTGGGCTAGTAGCTTCTTAACCATTCCTAAGACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTGACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGTCCGGCTGCGAGTCCTTTGAAATGTACTAAACTGTACTTCTCTTTGCTCGAAAAGCGTGACGTTGCTGGTTGTGGGCTGCCTGTGTGGCATGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGACGCTTATGGTGCTTTTCCTGCTGTGGCGGGACGGACTGGTGAACCGTAGCTGTGCTGCTTGGCGTTTGAACCGGCGGTGTGGTGCGAAGTAGGGTGTCTGTTCCGGCGCAAGCTGGGGGACGGGAACTGTGTGCGCTTCGGCGCGCATCA Phytophthora_sp._CBS137103 CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT 'Phytophthora sp. KPh2010-1-1 ' CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCCAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT 'Phytophthora sp. KPh2010-4-1' CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT 'Phytophthora sp. KPh2011-1-1 ' CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT 'Phytophthora sp. KPh2013-1-1 ' CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT 'Phytophthora sp. KPh2013-4-1 ' CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_sp._MAFF239556 CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_sp._NBRC110061 CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_sp._NBRC110062 CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCCAGCGCGAGCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGATGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCGTTTGAACCGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_sp._kelmania_ CCACGTGAACCGTATCAACCTTTAAATTGGGGGCTTCCGCGGCCGCTCGGCTGGCTGGGTGGCGGCTCTATCATGGCCGCTTGGGCCTCGCCTGGGCTAGTAGCGTATTAACCATTCCTAATACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGTCCGGCTGCGAGTCCTTTGAAATGTACTACACTGTACTTCTCTTTGCTCGAAAAGCGTGACGTTGCTGGTTGTGGGCTGCCTGTGTGGCATGTCGGCGACCGGTTTGTCTGCTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGATCGGCTTCGGCTGAACAGACGCTTATGGTGCTTTTCCTGCTGTGGCTGGATGGACTGGTGAACCGTAGCTGTGCTGCTTGGCTTTTGAACCGGCGGTGTGGTGCGAAGTAGGGTGTCTGTTCCGGCGCAAGCTGGTGGACGGGAACTGTGTGCGCTTCGGCGCGCATCA Phytophthora_syringae_ CCACGTGAACCGTATCAAAACTTTTATTGGGGGCTTCTGCTGGCTTCGGCTGGATTGGGTGGCGGCTCTATCATGGCCGCTCTGAGCTTCCTGGAGCTAGTAGCCCATTAACCATTCTTAATACTGAACAAACTGTGGGGCGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGACAGACGTGAAGTGTCTTGCGACTGGGCTTCGGCTCGGCTGCGAGTCCTTTTAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGCGTTATATTACGGTTGTGGGGCTGCCTGTGCGGCAAGTCGGCGACCGGTTTGTTAACTGCGGCGTATGGAGGAGTGTCGATTCGCGGTATGGATGGCTTCGGCTGAACTGCGCTTATTGATACTTTTCCTGCTGTGGTGGTACGAACTGGTGAACCGTAGCTGTGTTGCTTGGCTTTTGAACTGGCGATGTGGTGCGAAGTAGAGTGACGGTTGTTCCGGCGCAAGACTGTCGGGAATTGTGTCTGTGCGACTTCGGTTGG Phytophthora_taxon_castitis_ CCACGTGAACCGTATCAACCTGATTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGCGGCGGCTCTAGCGCGACCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGGCAGACGTGAAGTGTCTTGCGACTGGGCTTCGGTCTGGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATGGATGTTTTTCTTACTGCGGCGGATGGACTGGTGAACCGTAGCTGTGCGGCTTGGCTTTTGAACAGGCGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_taxon_parsley_ CCCCGTGAACCGTATCAACCTTTTTATTGGGGGCTGCTGCTGGCTTCGGCTGGACTGGGTGGCGGCTCTAGCGCGACCGTTCTGGGCTTCTTGGGGCTAGTAGCTTTTTAACCATTCTTAATTACTGAAATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGATGCCAGATGTGAAGTGTCTTGCGACTGGACTTTGATCTAGATGCGAGTCCTTTTAAATGTACTAAAACTGTATTCTCTTTGCTCGAAAAGCGTGACGTTGCGGTTGTGGGGCTGCCTGTATGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGTGTTGGAGAAGTGTTTAATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATAAATGTTTTTCTTACTGTGGCGGATAGACTGGTGAACCGTAGCTGTGTAGCTTGGCCTTTGAACCGGTGATATTGTGCGAAGTAGAGTGACGGCTGTTCCGGCGCAAGGCTGTCGGGAATTGTGCCGTTGCGACCTCGGTTGT Phytophthora_trifolii CCACGTGAACCGTATCAACCTTTAAATTGGGAGCTTTCGCGGCCGTTTGGCTGGTTGGGCGGCGGCTCTATCATGGCCGCTTGGGCCTCGCTTGGGCTAGTAGCTTCTTAACCATTCCTAATACTGAATATACTGTGGGGAGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGGCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGTCCGGCTGCGAGTCCTTTGAAATGTACTAAACTGTACTTCTCTTTGCTCGAAAAGCGTGACGTTGCTGGTTGTGGGCTGCCTGTGTGGCATGTCGGCGACTGGTTTGTCTGCTGCAGCGTATGGAGGAGTGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGACGCTTATGGTGCTTTTCCTGCTGTGGTAGTATGGACTGGTGAACCGTAGCTGTGCTGCTTGGCGTTTGAACTGGCGGTGTGGTGCGAAGTAGGGTGTCTGTTCCGGCGCAAGCTGGTGGGCGGGAAATGTGTGCGCTTCGGCGCGCATCA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M22628] TITLE Phytophthora_spp.; LINK TAXA = Taxa1; DIMENSIONS NCHAR=666; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phytophthora_austrocedri AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATTCGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCATTTATAATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTACCTTTAATGATTGGTGCACCAGATATGGCTTTCCCCCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTGCTTTATTATTATTAGTTTCATCTGCAATTGTTGAATCGGGTGCGGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGAATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCCGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCTGTATTATATCAA Phytophthora_brassicae_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCCCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGGGCACCTGATATGGCATTTCCGCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTGGCAATCTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCCCCGGGTTTAAGTTTCCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACGGCTTTCCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACGTCTTTTTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_cichorii_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGAATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCCGGTACTGGTTGGACGGTCTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCAATCTTTAGTTTACATTTAACTGGGATTTCTTCTTTATTAGGTGCAATTAATTTTATCTCAACTATATATAATATGAGAGCTCCAGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATTTTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGAGGGGGTGATCCTGTATTATATCAA Phytophthora_cryptogea AAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_dauci_ AAAGATATTGGAACTTTATATTTAATTTTTAGCGCTTTTGCGGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTAGTAGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCCTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCGTTTCCCCGTATGAATAACATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCAATTGTTGAATCTGGTGCTGGTACTGGTTGGACGGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTTGATTTAGCAATTTTTAGTTTACATTTAACAGGAATTTCTTCATTGTTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGCTTACCTTTATTTGTATGGTCAATATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCGGGTGGAGGTGATCCGGTATTATATCAA Phytophthora_drechsleri AAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCGGGTGCCGGTACCGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_erythroseptica AAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_foliorum AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATAATGGTTTTTTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCCTTTCCACGAATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCGGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCCTTTCTTTTATTATTAACATTACCCGTTTTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCATCTGGGGGGGGTGATCCAGTATTATATCAA Phytophthora_hibernalis_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCCCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTCGTTCCTTTAATGATAGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCCGCTTTATTATTATTAGTATCATCAGCTATTGTGGAATCTGGAGCAGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCGGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTTTTAGCAGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCCTCTGGAGGTGGTGATCCCGTATTATATCAA Phytophthora_kelmania AAAGATATTGGCACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_lactucae_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTATTGGTACAACATTATCCCTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATACAATGTTGTTGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTGGTTTCATCAGCTATTGTGGAATCAGGTGCAGGTACTGGTTGGACGGTTTACCCACCATTATCGAGTGTGCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATCTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCTATATTAATTACTGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCGGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCATTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_lateralis_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTATTGTTACTGCACATGCTTTTATCATGGTTTTTTTTTTAGTTATGCCCGCTTTAATTGGGGGTTTTGGTAATTGGTTTGTACCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCGGCTATTGTAGAATCTGGTGCAGGTACAGGTTGGACTGTTTATCCACCGTTATCTAGTGTACAAGCCCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCACCCGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACGGCTTTTCTTTTATTATTAACGTTACCTGTTTTAGCTGGAGCAATTACCATGTTGTTAACCGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGG?G?AGGT?ATCCTGTATTATATCAA Phytophthora_medicaginis AAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTGTAGGTACAACATTATCCCTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCACGCTTTTATCATGGTTTTCTTCTTAGTTATGCCCGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCGGCATTATTATTATTAGTTTCTTCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCACAGATTACCCTTATTCGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCGGTATTAGCTGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCGTTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_megasperma AAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACCTTATCACTTTTAATCCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTCCCACGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCGTTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCCGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCCTTTCTTTTATTATTAACATTACCCGTATTAGCTGGTGCCATTACCATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCTGGGGGGGGGGATCCAGTATTATATCAA Phytophthora_obscura_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATTCGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCGTTTATAATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCCTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCAATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCGGGTCCTTCAGTAGATTTAGCAATCTTTAGTTTACATTTAACGGGAATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACAGATAGAAACTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_porri_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAACTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCTATTGTTGAATCGGGTGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCGGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCGATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATTTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_primulae_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTAGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCCGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCAATTGTTGAATCCGGCGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATCTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGCTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_ramorum AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACCTTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATCATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCAGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCGGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGAGCTGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGCGGAGGTGATCCTGTGTTATATCAA Phytophthora_sansomeana AAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sp._CBS_137103 AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_sp._KPh2010_1_1_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_sp._KPh2010_4_1_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_sp._KPh2011_1_1_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_sp._KPh2013_1_1_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_sp._KPh2013_4_1_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_sp._MAFF239556 AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_sp._NBRC110061 AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_sp._NBRC110062_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_syringae AAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACGGCACACGCATTTATAATGGTTTTCTTCTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATTGGTGCTCCAGATATGGCCTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCTGCAATTGTAGAATCTGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_taxon_castitis_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACGGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGCGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCCGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCTATATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_taxon_parsley_ AAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTAGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCCGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCTATTGTTGAATCCGGCGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATCTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACAATGCTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_trifolii_ AAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTGTTGGTACAACATTATCCCTTTTAATCCGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACTGTTTACCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCACAGATTACCCTTATTCGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTACTAACATTACCGGTATTAGCTGGAGCAATTACTATGCTGCTAACTGATAGAAATTTAAATACTTCGTTTTATGACCCATCAGGTGGAGGTGATCCAGTATTATATCAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M21962] TITLE Phytophthora_spp._from_Lily; LINK TAXA = Taxa3; DIMENSIONS NCHAR=7743; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430 5440 5450 5460 5470 5480 5490 5500 5510 5520 5530 5540 5550 5560 5570 5580 5590 5600 5610 5620 5630 5640 5650 5660 5670 5680 5690 5700 5710 5720 5730 5740 5750 5760 5770 5780 5790 5800 5810 5820 5830 5840 5850 5860 5870 5880 5890 5900 5910 5920 5930 5940 5950 5960 5970 5980 5990 6000 6010 6020 6030 6040 6050 6060 6070 6080 6090 6100 6110 6120 6130 6140 6150 6160 6170 6180 6190 6200 6210 6220 6230 6240 6250 6260 6270 6280 6290 6300 6310 6320 6330 6340 6350 6360 6370 6380 6390 6400 6410 6420 6430 6440 6450 6460 6470 6480 6490 6500 6510 6520 6530 6540 6550 6560 6570 6580 6590 6600 6610 6620 6630 6640 6650 6660 6670 6680 6690 6700 6710 6720 6730 6740 6750 6760 6770 6780 6790 6800 6810 6820 6830 6840 6850 6860 6870 6880 6890 6900 6910 6920 6930 6940 6950 6960 6970 6980 6990 7000 7010 7020 7030 7040 7050 7060 7070 7080 7090 7100 7110 7120 7130 7140 7150 7160 7170 7180 7190 7200 7210 7220 7230 7240 7250 7260 7270 7280 7290 7300 7310 7320 7330 7340 7350 7360 7370 7380 7390 7400 7410 7420 7430 7440 7450 7460 7470 7480 7490 7500 7510 7520 7530 7540 7550 7560 7570 7580 7590 7600 7610 7620 7630 7640 7650 7660 7670 7680 7690 7700 7710 7720 7730 7740 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phytiophthora_phaseoli TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCCTTCCCCTTCGTGTGCCACTTGTGTCTGACGAGAAGGAGCAGCTTTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTTCACATGCGCATCCGCTGCCACCCGTTCCAGGTCCTGCGTATTAACAAAATGCTTTCGTGCGCCGGTGCCGATAGGCTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTCGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGATTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGACGTGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGACAATGAGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCACTTATGGTGACCTGAACCACTTGGTTTGTGCCGCCATGTCCGGTATTACACGTGCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTCGCAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACAGCCGCGTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATAGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCGGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTGCCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACCGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACTTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCGAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATTACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCGAGCGGAGCCTCCACGGGCGAATTTGAGGCCCTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCTGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTATCGGCAGGACGTGACGAGCAGGCCGAGATCGACCGTCATGGTGGAGGAGCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAGCTGGGGCCAACGCGATCTGGGTGTGTCCTTGCTCTGTGCCGTGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCACACATGCCGACCTGGCCGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGTGCTAAAACTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGTCGCTACGGCCTGGAGCCACTGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCATCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCGGATCGGAAAGATCCGCAACTGCTGGAGGTGTACGAGGCTTTATCGCTAAGGCGTATCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGATGACTGGGAGTCGTGGTGAAATACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAATGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGGCATTATGCCAGCCATCGTAGGGCGAGACAGAGGACACGTTCATCGCTGATGGCTGTGGGTCTGAGTGCCGGCCAGATCAAGACGGCGGACTCTGGTATTGGTATGACGAAGGCTGACTGATTAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCTGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTATTCGGCCTACTGGTCGCGAAAGGTTGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCCGGTGGCTCGTTCACTGTCACGCCGACACGTCGGAGCCATCAGCGTGGTACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAAGAGGAGAGAAGGAGGTGACGACAAGCCCAAGGTCGAAGAGTCGAAGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAAGTGACGCACGAGTGGGACCACTCAATAGCCAGAAGCCCATCTGGATGCGCAAGCCTGAAGACGTGACCCACGAGGAGTATGCTCTTCTACAAGTCGCTGACGAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTTTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTATGTGCGCGCGTGTTCATCATGGACAATTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACTTGCCGCTAACATCTCGCGTGAGACGCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTCGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGTCGTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGATGCGTTACCACTCGACCAAGTCTGGGAGGAAGTGACGTCCTGGAGACTACATCTCGCGTATGCCTGAGAGCCAGCCCGGTATCTACTACGTGACTGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCATTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGATGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATTTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAAGGACTGTGCAAGCTCATGAAGGAGGTGCTGGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCCTGTGTGCTGTTACTGGGAGTACGGTGGTCGGCCAATATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTTTCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCCAAAAGTGTTGTGGACGCTGCGGCGACTGCTGCGGCGTGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCATGGCTCCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCTGTGTCTCTGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTGCCGTTCGTGGAGGTCGTTGTGGCCCCTTCGCAGGTGCACGCCGCTACCGTCAAGGCTTCGCTGCGCTCCGACGTGCGTGTCAGGGCCAGGACGTCTGGAAGCAAGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAAATGCTCAAGGACTGGGCGCTGAGTAACTCTTGTTGGCCACAGCGAGCGCCGCGAAAGGGCGAGATAACGAGGTCGTAGCAAGAAGGCGCTACGCCTCGAAAAGGGCCTGGGCGTTATGCTTGCATCGGTGAGACAAGGACCACCGCGAAGCAACCAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATTAATGACTGGACCAAGTGTATTGCCTACGAACCCATCTGGGCCATCGGTACGGCTTACGCCTCGCCTGACAGGCTCAGGAGGGCACGCTAGCATTCGTGCCTGGCTCAAGGAGAAGGTGTCTCCTGAGGCGCGGAGCAGACCGGTATTACGGTGGATCGTCGGCGCGAAGAACGCCCCGAGCTCTCGCAGAAGGAAGACATGACGGCTTCCTGGTGGTAGCCCGACTTCCTCAGATTATAACGCTCAAACCCACGGCCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGTCGTATTGGCCGCTTGTGTCGTGCGCGCTAACCCGTCATCAACATCGTTGCCATAACGACCGTTCGTTTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCTCACTATCGCATGAGAGACGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCCGAGAATATTCAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACCTGAGAAGCATCGACCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCACCGTCCAGTGACGCCCCCATGTTCGTGATGGGGTGAATCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACAAACTGCCTGGCCCCCTGGCTAAGGTGGTGAACGACAAGTTTGGCATAGGAAGGCCTCATGACGACGTCCACGCTGTACGCCACGCAGAAGACGTTGACGGTCCTTCCAAGAAGGACTGGCGGGTGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTAAACGGTAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGATGTGTCTGTGGTGGACTGACGGCTCGTCTGTGAACCCTGCTTCTACGAGAGATTACGGCGCCATCAATCGCAGTGAGAACGAGATGAAGGGCATTCTCGGCTACACGAGAGGCGTGTTCGAGGACTTTATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophhtora_ramorum TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATTTACGATGTGGGTAACAGAAGGCTTCGTGGACTCCTTCCCCTTCGTGGCTCACCTGTGTCCGACGAGAAGGAGCAGCTGTCGTCGAGGCTCTGGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATTCGTTGCCACCCTTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTTGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTCGACGTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGGTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCTGGTATGGGCACGCTTCTGATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCTGGATAACGAGCGCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCTATGTCCGGCATCACACGTGCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTCGGAAGCTGGCGGTAACTTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCAAAGAACATGATGTGCGCCGCCGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGCCTGAAGATGAGCACTACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACCTTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATCATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCAGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCGGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGAGCTGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGCGGAGGTGATCCTGTGTTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACAGTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGCGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCGTCCACGGGCGAGTTCGAGGCCCTCGAGATGCGGAGGGGTCGTACATGGGCAAGGGCGTCCTCAAGCCGTCAAAACGTGAACGAGATCTCGCCCCCGCTCTTGTCGGCAGGACGTGACCCGCAGGTCGAGCTCGACCGTCATGGTGGAGACCCTGGACGGCACGCAAATGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCCCTGTGCCGTGGGGTGCCGCGGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGGTACACGGACAAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAACAACGCTCCCGATCGGAAAGATCCGCAACTGCAGGAGATGTACGAGGCTTCATCTCGAAGGCGTCTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAAATACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATTGCCGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGTGGACTCGGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACGGTCACGCCGACACGACGGAGCCATCTGCGCGGCACGCGATGTCCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTTACCGAGACGAGGAGGATGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACAAAGAAGATCAAGGAGGTCACCCACGACTGGGACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGGCGTGAAGCACTTCTCTGTGGAGGGCAGCTCGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCTCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACTTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGCTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGTATGCCCGAGAGCCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGGACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGAAAAGGTGAGAAGGTCGAGATCTCGAACCGTATGTGGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCTGCCAACATGGAGCGTATCATGAAGGCCCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGTCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTTTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGTTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTTGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTACTGTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTCGGCGCCGAATAACACTCGTGGGCCATAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGCTGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACAAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCCTCACCTGACAGGCCCAGGACGGCACGCCAGCATCCGTGCCTGGCTTAAGGAGAAGGTCTCCCCCGAGGCGCTGAGAAGACCGGTATTACGGCGGCTCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGATTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACCGAGAAGTCGGGGCCCGTGAAGTGCCATTAACGGATTCGGCCGTATCGGCCGCTTGTGTCGCGCGCGCCAACCCGTCATCAACATCGTGGCCATAACGACCGTTCATCTCGACGACTACATGGATACATGCTTGAGTACGACACGGTGCACGGCAGTTGACGGCTCGCTGTCGCACGAGAGCAACACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGACCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACCTGAGAAGCCTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCCAGCGACGCCCCCATGTTCGTCATGGGGTCAACCACGAGCTGTACGAGAAGAATATGCACGTGGTGTCAACGCTCGTGCACGACCAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTTGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGCCTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCCACGCGATGTGTCTGTGGTGGACTGACTGCTCGCTTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCTAGGACTTCATGGGACTCGCCTCATCATTTGAGCAGCGCGGAT Phytophthora_bisheria TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTATGATGTGGGTAACAGAAGGCTTCGTCGACGCCTTCCCCTTCGTGGCCCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAAGCTCTTGAGGCGCCGTGTGGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCTGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGATGTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGGGTACCGGCTCCGGTATGGGTACGCTTCTTATCTCGAAGATCCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCATCAGCTGGTTGAGAACGCCGATGAGGTTATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACCACCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTAAACTCTGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGCGCCCTCACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGTGCTGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCCAAGGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAAGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGCGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCATTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTGATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCAGGTGGAGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAAATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCCGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCTCTGTCCCGAGCGGAGCGTCCACGGGTGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTCAAGCCGTGAAAACGTGAACGAGATCTCGCTCCTGCTCTTGTGGGCAGGATGTGACCAGCAGGTGGAGCTTGACCGTCATGGTGGAGGAACTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCCCTGTGCCGTGGGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCTGACCTGGCTGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCTATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGTCCATGAAGATCGGTCGGAGGTGTACACAATTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCTATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGGACAAGGTGCGATTGGATGGATTGCCGCCTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTTGACTTCAAGAAAAATGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGCATCAGCAAGATGTGTCCATCGAAGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTGCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGGCATCATGCTAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGTGCTGGCCAGATTAAGACGGCGGACTCGGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGCTTTACTCCGCCTATTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGTTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTTCGCGGTACGCGATGTCCTTAAGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAAGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCATGCGCCGTGAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGATATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACTCTGCAGCAAACAAGATCCTCGCGTCATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACGAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAACTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTTGAGTCCCCCTGCGTGCTGTGACTGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCAAATTTTTAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCGTGTAGTCGGTGGAGGATATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGTGTTGTGGAGGCTGCGGCGACTGCTGCGGTGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTACTTGGCTTTGAACCGAGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTCCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGGCCGTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGATGTTTGCCGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGGGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTCGTGGTGGCTCCTTCGCAGGTGCACGCGGCCACCGTCAAAGCCTCTTTGCGGTCGGACGTGCGCGTCAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCAGCCGAGATGCTTAAAGACTGGGCGCCGAGTAACTTTGGTGGGCCACAGTGAGCGCCGCGAAAGGGCGAAAGAATGAAATTGTAGCAAGAAGGCGCTACGCCTGGAGAAGGGTCTGGGCGTCATGCGTGCATTGGCGAGAGAAAGAGACCCGCGAGGCAACCAGACTGCTTACATCACGGAACAGCTCACGCCTACGCGGCTGATCAAGGACTGGAGCCAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCTTCGCCCGACAGGCGCAGGAGGGCACGCCAGCATCCGCGCGTGGCTCATGGAGAAGGTCTCCTCCGAGGCGCTGACAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCGCCGAACTGTCGCAGAAGGAGGACATGACGGCTTCCTGGTGGCAGCCTGACTTCCTCAGATCATAACGCGCAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGTATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTCATCAACATCGTTGCTATAACGACCGTTCATCTCGACCACTACATGGATACATGCTGGAGTACGACACCGTGCACGGCAGTTGCCGGCTCGCTGTCGCATGAGAGAAGCACATCTTCGTAGGAAAGCCATCCGGTGTTAAGAGATGAACCTGAGAACATCAAGTGGGAGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGCGACGCGCCGATGTTCGTCATGGGGTGAACCACGAGCTGTACGAGAAGGAGATGCACGTGGTGTCAACGCTCGTGCACGACCAACTGTCTGGCGCCTTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGTCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGACGTGTCTGTGGTGGATTGACTGCTCGCCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCGATCAAGAGCAGCGAGAGCGAGATGAAGGGCATCCTCGGTTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_boehmeriae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCTTCGTCGACACCTTCCCCTTCGTTGCCCACTTGTCTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTGGAAGCGCCGTGTTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCCTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATTGACTCGTGCTGGATGTGTCCGGAAGGAGGCCGAGTCCTGCGATTGCCTGCAGGGTTTCCAGATTACCCACTCGCTGGGTGGGGTACCGGTTCCGGTATGGGAACGCTGCTGATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCCCCAAGGTGTCGGACACTGTGGTGGAGCCTTACAACGCGACGCTATCTGTGCACCAGCTTGTGGAGAACGCCGATGAAGTTATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCACCTACGGTGATCTGAACCACCTGGTGTGTGCCGCCATGTCCGGTATCACACGTGCTTCGATTCCCAGGCCAGCTGAACTCCGACCTCGTAAGCTGGCTGTAACTTGATCCCATTCCCGCGTCTTCACTTCTTTATGATCGGTTTCGCCCGCTGACATCACGTGGCTCGCAGCAGTACCGCGCCCTGACGGTCCGGAGCTGACCCAGCAGCAGTTCGACGCGAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGTGGACGGATGAGCACGAAGGAGGTGGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCATACTTTGTGGAATGGATCCCGAACAACATCAAGGCTAGTGTGTGTGATATCCCGCCTAAGGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACGCTATCCAGGAGATGTTCAAGCGCGTGTCTGAGCAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACAGGGAGGGTATGGATGAAATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCTGGTATTGTTGGTACAACATTCTCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATAATGGTATTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCGGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCATTATTATTATTAGTTTCATCTGCTTTAGTTGAATCAGGTGCAGGTACCGGTTGGACAGTTTATCCACCTTTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATATCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCCAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGACACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACTGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAAATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTGCCCAGCGGAGCGTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGTCGTACATGGGCAAGGGCGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTCGTGGGCAGGACGTGACCCGCAGGCCGAGCTGGACAATCATGGTGGAGACTCTGGACGGCACACAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCGATCTGGGCGTGTCCTCGCTCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGCGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGCAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGTCTGGAGCCACGGCCGTGGGTGACGAGGGCGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATTGAGGAGGCCATCAAGGCTGCGGCTACACGGACAAGGTGAACTTGGATGGATTGCCGCCTCGGAGTTCTACACTGGGCGAGCTCGTTACAACCTGGACTTCAAGAAAAACGCGCCGGATCGGAAAGATCCGCAACTGACGGAGGTGTACGAGGCTTCATCGCCAAGGCAGAACAGCGCCATGTGTCCATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGATCAATTACGCGAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGCAGAAGGCATGAAAGGCTGCAACGCTCCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGGTATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCTGGTATCGGTATGACGAAGGCCGACTCATTAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTGGCGAAAGGTGGTGTCCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCTGCCGGCGGTTCGTTCACCGTCACGCCGACACGTCGGAGCCATCAGCGTGGTACCCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAGGAGACAAGGAGGAGACGACAAGCCCAAGGTGGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCTGTCGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATTAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATTTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACTCGGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGTTGGGATCACGAGGACTCGACCAACCGACGAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCGGGGAGGAGCTGACGTCCTCGAGACTACATTTCGCGCATGCCGGAGAACCAGCCTGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTGAAGAAGAAGGGTAGAGTGCTGTTCATGGTCGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGTCTGCCATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTGATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTCCAGATCTCGAACCGTATGTGGAGTCGCCGTGTGTGCTGTGACGGGGAGTACGGTGGTCAGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTTCAACTGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCGTGTAGTCGGTGGAGGGAATGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTTACTGTTCTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGAGTGCTGAGGCGTGGAGAGGGGTTCGATTCGCGGTAGTGTTGGTTTCGGCCGAGCTTATTGTGTACCGTAGCTGCTTGGCTTTGAACGCAGTGGCGAACGAAAATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGCGAGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACTGAGGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGCGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTTTTGCAGTGGCTTGGCTGCGGTGCGTGCTTGCGTTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGAACTCTCTGTGTGGCGCTGTGCGGATAGCTTGCTATGTGTGCGGTGCTGTGCGTGGATTGAGGTCTGCTGTAACTTGTTGCCGTTCGTGGAAGTCGTGGTGGCCCCCTCGCAGGTGCACGCGGCCACCGTCAAGGCCTCGCTGCGCTCCGACGTGCGCGTCAGGGCCAGGACGTCTGGAGCCAGGGCAACGGCGCCTTCACCGGCGAGACGTCTGCTGAGATGCTCAAGGACTCGGCGCCGAGTAACGCTGGTGGGCCACAGTGAGCGTCGCGAAAGGGCGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGCCTTGCTGTCATGCCTGTATTGGCGAGTCAAGGAAACTCGCGAGGCAACGAGACTGCCTGGATCACCAAGCAGCTGATGCCTACGCCGCGGATCGACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCTTCTCCTGACAGGCTCAAGATGGCACGCCAGCATCCGTGCTTGGCTCAAGGAGAAGGTCTCCCCGGAGGCTCGGAGAAGACCGATATTACGGTGGATCGTGGGTGCAAAGAACGCCCCGAGCTGTCGCAGAAGGCGGACATGACGGCTTCCTTGTGGCAGCCTGACTTCTTCAGATCATAACGCCCAAACCCACGGGCAAGTTGGGGTGCGTGAAGTGCTATCAATGGCTTCGGTCGTATTGGACGCTTGTGTCGTGCGCGCCAACCCGTGATCAACATCGTGGCTATAACGACCGTTCATTTCGACGACTACATGGATACATGTTGGAGTACGATACGGTGCACGGTAGTTGATGGATCGCTGTCGCACGAGAGAAGCACATTTTTGTAGGAAAGCCATCCGGTTTTAAGAGATGAACCTGAAAACATCAAGTGGGAGAGGACAGTGCATAGTGGTTGAGTCACGGGGCCTTCACAACTGACAAGCGTCGGCTCACTGAAGAACAGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCGAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGCGGTCGTGGCGCTTGTTAACATCATTCCTCGTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGTCTGAACGGCAAACTGACTGGCATGTCTTCCGTGTGCCTACGCGACGTGTCTGTTGTCGACTGACTGCTCGTTTGCGAATCCTGCTTCTATGAGAGATCAAGGCGCGATTAATCGCAGTGAGAACGAGATGAAGGGTATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_botryosa TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCTTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTATCCGTTGCCACCCGTTCCAGGTCCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCTGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGATGTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACTGTGGTGGAGCCCTACAACGCCACGTTGTCGGTACACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCACCTACGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTCGTAAGTTGGCTGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTCCTGAGCTGACCCAGCAACAGTTCGATGCCAAGAACATGATGTGTGCCGCTGATCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGTGGACGGATGAGCACGAAGGAGGTCGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCCAAGGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCGATTACTATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCTAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCGTCCACGGGCGAATTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTTCTGAAGCTGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACGAGCAGGCGGAGCTTGACCGTCATGGTGGAGCAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGTGTGTCCTGGCTCTGTGCCGCGGGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATTCTCCTGTGGGTGCCACAGCTTCACGGAGTCGATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATGGCTGCTTCGGAGTTCTACACCGGGCGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAAGTGTACGAGGCTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACGCGTGTGCAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCTGGTATTGGTATGACCAAGGCCGACTTATCAACAACTGGGACGATCGCTAAGTCTGGCACCAAGGCTTCATGGAGGCTTGGCTGCTGGTGCTGACATCAGATGATGGTCAGTTTGGTGTGGGTTTTACTCTGCCTATTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGCGGCTCGTTCACTGTGACGCCGACACTTCGGAGCCATTTGCGTGGTACGCGATGTCCTGACGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATTGGTTTCCCCATAAGCTCTATGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAAGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGATGGTGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACTCACGAGTGGGACCACTGAACTCTCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTTACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTCATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCGGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTTTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATTTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCTAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTTGAGTCCCCGTGCGTGCTGTGACTGGGAGTACGGTGGTCCGCCAACATGGAGCGTATTATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGATGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTTGTGGTTGCTCCTTCCCAGGTGCACGCGGCTACTGTCAAGGCTTCGCTGCGTTCCGACGTGCGTGTGAGGGCCAGGACGTCTGGAAGCAGGGAAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACTCTGGTGGGTCACAGTGAACGTCGTGAAAGGGTGAGACAATGAGGTCGTGGCAAGAAGGCGCTATGCCTTGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGGAGCTCCGTGAGGCAACAAGACTGCGTACATCACGGAACAGCTTACGCCTACGCAGCTGATCAAGGACTGGACCAAGTGTATTGCGTACGAGCCTATTTGGGCCATTGGCACGGCTCACGCTTCGCCTGACAGGCCCAGGAGGGCATGCCAGCATCCGTGCGTGGTTGAAGGAGAAGGTCTCCCCTGAGGCGCTGAGAAGACCGGTATTACGGTGGCTCGTCGGTGCTAAGAACGCTCCGAATTGTCGCAGAAGGAAGACATGACGGCTTCCTGGTGGTAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGTGCGTGAAGTGCCATCAACGGCTTTGGCCGTATTGGCCGCTGGTGTCGCGCGCGCCAACCCGTCATCAACATTGTGGCCATAACGACCGTTCATCTCTACTACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCTGGCTCGCTTTCCCACGAGAGAAGCACATCTTCGTAGGCAAGCCATTCGGTGTTAAGAGATGAACCGGCCAACATCAAGTGGGTGAAGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCTGCTCACTGCAGAATGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGTGACGCTCCCATGTTTGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTTTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGTATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCTACGCAGAAGACGTGGATGGTCCGTCGAAGAAGGACTGGCGGGCGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGTTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTTGTGGATTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCGATCAATCGCAGTGAGAACGAGATGAAGGGCATTCTTGGATACACGAGAGGCGTGTTCCAGGACTTCATGGGACTCGCCTCATCATTTGAGCAGTGCGGAT Phytophthora_brassicae TACCGTTTCCAGAACAAGAAGCCCTTCATTAAGTCCGCTTCTGCCGTGGTGTCCCTGACCCCAAGATCCGCATTTACGATGTCGGTAACAGAAGGCGTCGTGGACCTTTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCGTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTATCCGTTGTCACCCGTTCCAGGTGCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCTGATAGACTTCAGACCGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAAGACAACTTCGGCCCTTCGGTGTCGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCAGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGGGTACTGGTTCCGGTATGGGAACGCTTTTGATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCTCCAAGGTGTCAGACACGGTTGTGGAGCCCTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCTGATGAAGTCATGTGCTGGATAACGAGCCTTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGCATCACACCTGCTGCGTTTCCCGGGTCAGTTGAACTCAGACTTCGAAAGCTGGCCGTAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGTGTGTGTGACATCCCGCCCAAGGGACTGAAGATGAGCACTACATTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACAGGGAAGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCCCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGGGCACCTGATATGGCATTTCCGCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTGGCAATCTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCCCCGGGTTTAAGTTTCCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACGGCTTTCCTTTTATTATTAACTTTACCTGTTTTTGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACGTCTTTTTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCAAACATGCCGTGGTACAAGGGCCTACCTTCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGATTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCCGGAAGGTCTGGCGCTGTCCCCAGTGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCTTGAAGCTGTCCGAACGTGAACGAGATCTCGCCCCCGCTCTTGTCGGCAGGACGTGACCAGCAGGCCGAGCTCGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTCGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAACAGCCCTGTGCATACATGCTGACCTGGCCGGCAACCCGAGCCCGTGCCTGCCGTGCCGTCGTTTAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGAGACGAGGGTGGTTCGCCCCTAACATCCAGGCCAACGCCGAAGCCATCGACTTAATCCAGGAAGCCATTAAGGATGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCTTCAGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTTAAGAACGACGGCGCTGATCGGAAAGATCCGCAACTGTTGGAGATGTACGAGGCTTCATCTCGAAGGCATATCAGCAAGATGTGTCGATTGAGGACCCGTTTGACCAGGACGACTGGGAGTCGTGGTGAAATACGGCAGAATGGCAAGGACGTGCAAATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAATGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACTATGGCCAAGAAGGCTGGCTGGGCTATCATGCCAGCCACCGTAGGGTGAGACGGAGGACACGTTCATTGCCGATGGCTGTGGGCCTGAGCGCCGGCCAGATTAAGACGGTGGACTCTGGTATCGGTATGACCAAGGCTGACTCATTAACAACTGGGACGATTGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCTGGCGCTGACATCAGATGATGGCCAGTTCGGTGTCGGTTTTACTCGGCTTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCTGGCGGCTCGTTCACGGTCACGCCGACACGACCGAGCCATCTTCGCGGAACGCGATGTCCTTACGCTTAAGGAGGACATGCTGAGTATCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGTTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGATGACAAGCCCAAGGTCGAGGAGTGGACGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACTCACGAATGGGACCACTTAACAGCCAGAAGCCTATCTGGATGCGTAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACGAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTTGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATTAACAACATTAAGTTGTATGTCCGCGTGTGTTCATTATGGACAACTGTGAGGACCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAAACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACTTGTCAAGAAGTGTTGGAGATGTTTGCCGACTGCGAAGACAACGAGAAGTACAGCAAGTTTAGAGGCTTTCAGCAAGAACCTAAGCTGGGATCACGAAGACTCGACGAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGACGACGTCCTTGAGACTACATCTCGCGCATGCCCGAGACCCAGCCTGGTATTTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAGCTCGCCGTTATTGAGAAGCTTAAGAAGAAGGGTAGAGTCATTTTCATGATTGACGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTATGAGGGCAAGAAGCTATCTGGCACAAGGAAGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGATTGTGCAAGCTCATGAAGGAGGTCCTGGACGACAAGGTGAGAAGGTTGAGATCTCGAACCGTATGTGGAGTCCCCGTGTGTGCTGTGACTGGGAGTACGGTGGTCGGCCAACATGGAGCGTATTATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGAGCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAAACTGTATTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGTGTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGAGTGACGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCATGCAAGTTTTGTATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCTGAGGCTTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGTGTGGCTGTGGCAGTGGCTTAGCTGCGGTGTGCGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTTGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTTGTCGCCGTTCGTGGAGGTGGTCGTGGCTCCATCGCAGGTGCACGCCGCCACCGTTAAGGCTGCTCTGCGCGCCGACGTGCGCGTCAGGGCCAAGATGTCTGGCAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTCGGCGCCGAGTAACGCTTGTGGGTCACAGCGAGCGCCGTGAAACGGCGAGACAACGAGGTGGTGGCAAGAAAGCGCTACGCCTCGAGAAGGGCCTCGCCGTAATGCCTGCATTGGTGAGAGAAGGAAACCCGTGAGGCAACAAGACTGCTTACATTACGGAGCAGCTTACGCTTACGCTGCGGATCAAGGACTGGACCAAGTGTATCGCCTACGAACCTATCTGGGCCATCGGCACGGCTCACGCTTCGCCCGACAGGCGCAGGACGGCACGCCAGCATCCGTGCTTGGCTTAAGGAGAAGGTCTCCTCTGACGCGCCGAGAAGACCGGTATTACGGCGGCTCGTGGGTGCCAAAAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTTGTGGCAGCCCGACTTCCTCACATCATAACGCCCAAACCCACCGAAAAGTCGGGGCCCGTGAAGTGCCATCAACGGCTTCGGTCGCATCGGTCGCTTGTGTCGCGCGCGCCAACCCATCATCAACATTGTGGCGATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGGAGTTGACGGTTCGCTCTCGCACGAGAGAAGCACATCTTTGTAGGTAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATTAAGTGGGAGAGGACAGTGCATAGTGGTCGAGTCACGGGGCCTTCACACCTGAGAAGCCTCAACTCACTGCAGAATGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGTGACGCTCCTATGTTCGTCATGGGGTCAACCATGAACTGTATGAGAAGAACATGCACGTGGTGTCAATGCTCGTGCACGACGAACTGTCTGGCCCCCTGGCCAAGGTGGTGAACGACAAGTTTGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACACAGAAGACGTGGATGGTCCGTCCAACAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCGAGCCTTAACGGCAAGCTTACGGGCATGTCTTCCGTGTTCCTACGCGACGTCTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATTAAGGCGCTATTAAGAGCAGCGAGAACGAGATGAAGGGCATCCTTGGCTACACGAGAGGCGTGTTCTAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_cactorum TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTTCTACGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTTGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTTGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCACCTACGGGGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTCCAGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCTAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAAGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATATACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGGGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCCTCCACGGGCGAATTCGAGGCTCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAGAACGTGAACGAGATCTCGCTCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCCGAGATCGACCGTCATGGTGGAGGAGCTTGATGGCACCCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCACACATGCCGACCTGGCCGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCTGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCCGTTGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGATACACGGACAAGGTGCGCTTGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATTGCCAAGGCGTGTCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGATGACTGGGAGTCGTGGTGAAATACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGGAATCATGCCAGCCACCGTAGGGAGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCGGGTCAGATCAAGACGGCGGACTCTGGTATTGGTATGACGAAGGCTGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCCGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTATGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACTGTGACGCCGACACGTCGGAGCCATCAGCGTGGTACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAAGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTTGAGGAGTCGAAGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTCAACAGTCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGGTGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACTCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCTGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGTCGTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCGACCAAGTCTGGGAGGAAGTGACGTCCTGGAGACTACATCTCGCGTATGCCCGAGAACCAGCCTGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGTCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCCTGTGTGCTGTGACCGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCACTGCGTGACCACACCTAAAACTTCCACGTGACCGTTTCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCCTTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAAGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAGCTTATTGTGAACCATAGCTCCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGCTAGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAGGTCGTCGTGGCTCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCGCGCTGCGCTCCGACGTGCGCGTCAGGGCCAGGATGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAGATGCTCAAGGACTGGGTGCTGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGTGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGTCTCGCCGTCATGCCTGCATTGGTGAGACAAGGAGCTCCGCGAAGCAACCAGACTGCCTACATCACGGAGCAGCTCATGCTTACGCCGCCGATTAACGACTGGACTAAGTGTATTGCCTACGAGCCTATCTGGGCCATCGGTACGGCTCACGCCTCGCCTGACAGGCTCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAAGAGAAGGTGTCCCCCGAGGCGGTGACAAGACCGGTATTACGGTGGATCGTTGGTGCCAAGAACGCCCCGAGCTCTCTCAGAAGGAAGACATGACGGTTTCCTGGTGGTAGCCCGACTTCCTCATATCATAATGCACAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATTGGTCGCTTGTGTCGCGCGCGCCAACCCGTCATCAACATCGTTGCCATAACGACCGTTCATCACGACGACTACATGGATACATGCTCGAGTACGACACGGTACACGGCAGTTGATGGCTCGCTCTCGCACGAGAGAAGCACATCTTTGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGGCCAACATTACGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCTTTCACACCTGAGAAGCCTCGGCTCACTGAAGAATGGTGGAAAGGTGTGATCTCGGCTCCGTCGAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTATGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTAGCTCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCACGCCGTACGCCACCCAGAAGACGTTGACGGTCCGTCTAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATTATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCAAGCCTGAACGGCAAGCTCACGGGCATGTCTTCCGTGTGCCCACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCCTCTACGAGAGATCAAGGCGCCATTAATCGCAGCGAGAACGAGATGAAGGGTATCCTTGGTTACACGAAAGGCGTGTTCTAGGACTTTATGGGACTCGCCTCGTCATTTGAGCAGTGCGGAT Phytophthora_cajani TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCCTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTTGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTCGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCCGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGAAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTCGTTGAGAACGCCGATGAGGTCATGTGCTGGATAATGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACGGCACATGCTTTTATCATGGTTTTCTTTCTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTTCCCAGCGGAGCCTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTGCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCGTCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTCGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGCGACGAGGGTGGTTCGCGCCCAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACGCCAAGGTGGCGAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGCGGACTCGGGTATCGGTATGACTAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCCGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGCGGTACCCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCTCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTCTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACCAGAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCGGGGAGGAAATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCTGTCGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTTGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCAATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGTTGCTTGGCTTTGAACCGGGTGGGGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTCGAGGTGGTCGTTGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTTGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTTCATCACGGAGCAGCTCACGCCTACGCGGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTTAAGGAGAAGGTCTCCCCTGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTGGTGGCAGCCCGATTTCCTCAGATCATAACGCTCAAACCCACGGACAAGTGGGGGCGCGTGAAGTGCCATCAACGGATTCGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTCATCAACATTGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGTGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCGCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTTGCGCCCTGGCCAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATTAAGGCGCGATCAATCGCAGCGAGAAAGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_cambivora TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCGTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTTGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACACGTGCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCTAAGGGACTGAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGAGCAATTACAATGTTATTGACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGGGGAGATCCTGTACTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTTTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTCTGGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTTCTGAAGCCGTGAAAACGTGAACGACATCTCGCCCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCGGAGCTTGACCGTCATGGTCGAGGAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGGGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGAACCGCTACGGCCTGGAGCCACGGCTGTGGGCGACGAGGGCGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCAACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATCGCTGCTTCGGAGTTCTACACGGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGGATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGGTGAAATACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCGGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCGGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGCATGACCAAGGCTGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTGGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACCGTCACGCCGACACGACGGAGCCATCTGCGCGGCACGCGATGTGCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGAGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTGAAGAAGTGCTTGAGATGTTCGCCGACTGTGAGGACAACGAGAAGTACAGCAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGCAGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCCGTGGAGAACTCGCCCTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTCATCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTCGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATCAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCTCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGCGGCTGGGCTGCGGTGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTGCGCGAGGCAACCAGACTGCCTACATCACGGAGCAGCTGACGCCTACGCGGCCGATCAGCGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTGTCCGTCGAGGCGCTGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTGGGGGCGCGTGAAGTGCCATCAACGGATTCGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTGATCAACGTCGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGCCGAGGACAGTGCGTAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCCTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCCTCTACGAGAGATCAAGGCGCTATCAATCGCAGTGAGAACGAGATGAAGGGCATCCTCGGTTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_capsici TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTGGACGCCTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGATGTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCATCGCCAAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCCACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTCCCGAGCTGACCCAACAACAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCCAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAATAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCGTCCACGGGTGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACGAGCAGGCGGAGCTTGACCGTCATGGTGGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTCGGGCCAACGCCATCTGGGTGTGTCCTGGCTCTGTGCCGTGGGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATTCTCCTGTGGGCGCCACAGCTTCACGGAGTCGATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGTTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGGTACACGAACCAGGTGCGCTTGGATGGATGGCCGCTTCGGAGTTCTACACCGGGCGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCTCCGGATCAGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTTATCGCCAAGGCGTATCAGCAAGATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCTAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCGGGTATTGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTTGCTGCTGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCTGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGTGGCTCGTTCACTGTGACGCCGACACTTCGGAGCCATTTGCGTGGTACGCGATGTCCTGACCCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGATGGTGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGATGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTCGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATTAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTTTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCTACGAGGGTCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTTGAGTCCCCGTGCGTGCTGTGACTGGGAGTACGGTGGTCCGCCAACATGGAGCGTATTATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAATTTTAAACCTTACTGGGGGGACAAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGGGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGAGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGCCAATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGATGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCGTGGAGGTTGTGGTGGCCCCCTCGCAAGTGCACGCAGCTACTGTCAAGGCTTCGCTGCGTTCTGACGTGCGTGTGAGGGTCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCTGAGTAACGCTGGTGGGCCACAGTGAGCGTCGCGAAAGGGCGAAACAATGAGGTCGTGGCAAGAAGGCGCTATGCCTTGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGGAGCTTCGTGAGGCAACCAGACTGCGTACATCACGGAACAGCTCACGCCTATGCGGCTGATCAAGGACTGGACCAAGTGTATTGCATACGAACCCATCTGGGCCATTGGAACGGCTCACGCCTCACCTGACAGGCTCAAGAGGGCACGCCAGCATCCGTGCGTGGCTCAAGGAGAAGGTCTCCTCTGACGCGCTCAGAAGACCGGTATTACGGCGGATCGTCGGTGCTAAGAACGCCCCGAACTCTCGCAGAAGGAGGACATGATGGCTTCCTGGTGGTAGCCTGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGTGCGTGAAGTGCCATCAACGGCTTCGGCCGTATTGGCCGCTGGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAATGACCGTTCATCTCCACCACTACATGGATACATGCTCGAGTACGACACGGTCCACGGTAGTTGCTGGCTCGCTTTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGGCTAATATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACTGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGATAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGAGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAATGGCAAGTTGACTGGCATGTCTTCCGCGTTCCTACGCGATGTGTCTGTTGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGAATTCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCACCTCTTCATTTGAGCGAAGCGGAT Phytophthora_cinnamomi TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCCTCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCGTCGAGGCCCTCGAGGCGCCGTATCGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCCTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCGGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTCGATGTGTCCGCAAGGAGGCGGAGAGCTGCGACTGCCTGCAGGGATTCCAGATCACGCACTCGCTCGGTGGGGTACCGGTTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCGACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGCCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGCTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGAGAGCAGATGCTTAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCTAAGGGTCTCAAGATGAGCACCACGTTCATCGGCAACTCCACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCATTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCAATCGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGCGTTCAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCCATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGGGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCATCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTCGAGCAGCTCGATGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAATTGGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGCGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGCGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATTAAGGCGGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCTGCTTCGGAGTTCTACACCGGGAGAGCTCGTTACAACCTTGACTTCAAGAAAAATGCCCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATTGCCAAGGTGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACCGCAAGGTGGCGAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCTATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCGGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGCATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGCGGCACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACGAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTCTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCCGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCGGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCCGTCGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGATGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGAGGTGCCAGACGTGAGGTGTCTTGCGTGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTCGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGGTGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTGGTGGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCCAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCGGCCAGACTGCCTTCATCACGGAGCAGCTGACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCGCAGGAGGGCACGCCAGCATCCGCGCCTGGCTGAAGGAGAAGGTCTCGCCCGAGGCGCCGACAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCGCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCGCAAACCCACGGCCAAGTGGGGGCGCGTCAAGTGCCATCAACGGCTTCGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTCATCAACGTCGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTTGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCATATCTTTGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGAGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCGCCGATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGGACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCGATCAATCGCAGTGAGAACGAGATGAAGGGTATCCTTGGCTACACGAGAGGCGTGTTCAAGGACTTCGTGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_cinnamomi_var._parvispora TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCCTCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCGTCGAGGCCCTCGAGGCGCCGTATCGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCCTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCCTACGGTAAGCCCGGTGTCGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCGGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTCGACGTGTGCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCTAAGATCCGCGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGACAACGAGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCTGGCCAGCTGAACTCAGACCTCGTAAGCTCGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCCCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCTAAGGGCCTCAAGATGAGCACCACGTTCATCGGTAACTCCACGCCATCCAGGAGATGTTCAAGCGCGTGTCTGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCATTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCAATCGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGCGTTCAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCCATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCGTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCATCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTTGAGCAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCCACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGCGGCTCCACGCTGGAACAACTGGCGATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCTGTGGGCGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCTGCTTCGGAGTTCTACACCGGGAGAGCTCGCTACAACCTGGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATTGCCAAGGCGCGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGATGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCCAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAATGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCGGATGGCTGTGGGTCTGAGCGCGGGCCAGATCAAGACGGCGGACTCGGGCATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGCTTTACTCGGCCTACTCGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGCGGCACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACCGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACTCCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTCTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCCGTCGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAATCTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGAGGCGCCAGACGTGAGGTGTCTTGCGTGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTCGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGGTGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTGGTGGTGGCCCCGTCGCAGGTGCACGCGGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCACCGCGAGGCGGCCAGACTGCCTTCATCACGGAGCAGCTGACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCTATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGACGGCACGCCAGCATCCGCGCCTGGCTCAAGGAGAAGGTCTCGCCCGAGGCGCCGACAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCGCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCGCAAACCCACGGCCAAGTGGGGGCGCGTCAAGTGCCATCAACGGCTTCGGCCGTATCGGCCGCTGGTCTCGTGCGCGCCAACCCGTCATCAACATCGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGGACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCGAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCTGTGGTGGACTGACCGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCGTGGGACTCGCCTCTTCATTTGAGCAGCGCGGAT Phytophthora_clandestina TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCCTTCCCGTTCGTGGCCCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTCGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGTCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGACGTGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGCTTCCAGATCACGCACTCTCTTGGCGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCGTCGCCAAGGTGTCAGACACGGTTGTGGAGCCCTACAATGCTACGCTGTCGGTGCATCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTAAAGCTCACCACCCCACCTACGGCGACCTTAACCACCTGGTTTGCGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCTGGTCAGTTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGTTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAGGTGGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCCAAGGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAGGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGGACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCTCGTATGAATAATATAAGCTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCGGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTTTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGATTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGTGCCTCCACGGGCGAATTCGAGGCCCTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTATCGGTAGGACGTGACGAGCAGGCCGAGATCGACCGTCATGGTGGAGCAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTTGCTTTGTGCCGCGCGGTGCCGCTGCCAAGAAACAGCCCTGTGCACACATGCTGACCTGGCCGGAAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGATCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCTTCCTGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACATAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAAGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAATGCTGAGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGTTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGCAGAAGGCATGAAAGGCTGCAACGCTTTTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGGCATTATGCCAGCCACCGTAGGGTGAGACGGAGGACACGTTCATTGCCGATGGCTGTTGGTCTGAGCGCCGGCCAGATCAAGACGGTGGACTCTGGTATTGGTATGACGAAGGCAGACTCATCAACAACTGGGACGATCGCCAAATCAGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGATTTACTCCGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCATAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGTGGCTCGTTCACAGTGACCCCGACACGTCGGAGCCATCAGCGTGGCACGCGATGTGCTAAAGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGATCAAGGATTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGATGAGGAAGAGGAGAGAAGGAAGGGACGACAAGCCCAAGGTGGAGGAGTCGAAGGCGAGAAGAAGAAGAAAACGAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACGAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTTTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAAAAATGAACAACATCAAGCTGTACGTGCGCGCGTCTTCATCATGGACAACTGCGAGGATCTATGCCGAGTATTTGTCGTTCGTCAAGGGCGTGGTCGACTCGGAGGACCTGCCGCTAACATTTCGCGTGAGACGCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAATGCTCGAGATGTTCGCTGACTGTGAGGACAACGAGAAGTATAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTACGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCTGAGAACCAGCCCGGTATCTACTACGTGACGGGGAGAGCAAGAAGGCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCTATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGTACAAGGAGGGCCTAAGATGGAGGAGACGGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAAGGACTGTGCAAGCTCATGAAGGAGGTGCTGGACGACAAGGTGAGAGGGTGGAGATCTCGAACCGCATGTCGAGTCGCCGTGTGTGCTGTGACGGGGAGTACGGTGGTCAGCCAACATGGAGCGCATCATGAAGGCGCAGGCTTTGCGTGACCACACCTAAAAATTCCACGTGACCGTTTCAATGGGGAACCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGTCAGATATGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCCAAAAGTGTTGTGGAGGCTGTGGCGACTGCTGTGGCGTGGAAGAATGCTTGATTCGCGGTATGATTAGCTTCGGCTGAGCTTATTGTGAACCATAGCTCCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGTGGGCACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTTATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTATCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTATGGCAGCGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTAGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAGGTCGTCGTGGCCCCATCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTACGCTCCGACGTGCGTGTCAGGGTCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGTGAGACCTCGGCCGAGATGCTCAAAGACTGGGTGCTGAGTAACACTTGTGGGCCACAGCGAGCGCCGTGAAAGGGCGAAACAACGAGATTGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGGATCTCCGTGAAGCAACCAGACTGCGTACATCACGGAGCAGCTCATGCCTACGCTGCCGATTAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCTTCGCCTGACAGGCTCAGGAGGGCACGCCAGCATCCGTGCTTGGCTCAAGGAGAAGGTGTCCCCCGATGCGCTGAGAAGACCGGTATTACGGTGGCTCGTCGGAGCTAAGAACGCTCCGAGCTCTCGCAGAAGGAAGACATGACGGCTTCCTGGTGGTAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATTAACGGCTTCGGTCGTATCGGTCGCTTGTGTCGTGCGCGCCAACCCGTCATCAACATCGTTGCTATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTACACGGCAGTTGATGGCTCGCTCTCGCACGAGAGAAGCACATTTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCTGAGAATATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAATCACGGGGCCTTCACACCTGAGAAGCATCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCCAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGTTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCTTGGCCAAGGTGGTGAACGACAAATTCGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTTGACGGTCCGTCCAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCGAGTCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTTCCGACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCGGCTTCTACGAGAGATCAAGGCGCTATTAATCGCAGTGAGAACGAGATGAAGGGCATCCTTGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_colocasiae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCTTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAAGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTATCCGTTGCCACCCGTTCCAGGTCCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCTGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGATGTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACTGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCACCTATGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTCGTAAGTTGGCTGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGTTGACCTCTCGTGGATCTCAGCAGTACCGTGCCCTCACGGTCCTGAGCTGACCCAGCAACAGTTCGATGCCAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTTGAGAGCAGATGTTGAACGTGCAAAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCCAAGGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACTGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCTCACTCAGGTCCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTCTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCGAGCGGAGCGTCCACGGGCGAATTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACGAGCAGGCGGAGCTTGACCGTCATGGTGGAGCAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGTGTGTCCTGGCTCTGTGCCGTGGGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATTCTCCTGTGGGTGCCACAGCTTCACGGAGTCGATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATGGCTGCTTCGGAGTTCTACACCGGGCGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTACAGGAAGTGTACGAGGCTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACGCGAGTGCAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCTGGTATTGGTATGACCAAGGCCGACTTATCAACAACTGGGACGATCGCCAAGTCTGGCACCAAGGCTTCATGGAGGCTTGGCTGCTGGTGCTGACATCAGATGATGGTCAGTTTGGTGTGGGTTTTACTCTGCCTATTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGCGGCTCGTTCACTGTGACGCCGACACTTCGGAGCCATTTGCGTGGTACGCGATGTCCTGACGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATTGGTTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAAGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGATGGTGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCCTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCTTGCAGCAAACAAGATCCTCGTGTCATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACGAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCCGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAACCCGGCATTTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATTTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCTAAGGCGCCACGAGGGCTTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTGCTGTGACTGGGAGTACGGTGGTCCGCCAACATGGAGCGTATTATGAAGGCCCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAAGTTTTAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGATGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCGTGGAGGTTGTGGTTGCTCCTTCCCAGGTGCACGCAGCTACTGTCAAGGCTTCGCTGCGTTCCGACGTGCGTGTGAGGGCCAGGACGTCTGGAAGCAGGGAAACGGCGCCTTCACGGGTGAGACGTCGGCCGAGATGCTTAAGGACTGGGCGCCGAGTAACTCTGGTGGGTCACAGTGAACGTCGTGAAAGGGTGAGACAATGAGGTCGTGGCAAGAAGGCGCTATGCCTTGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGGAGCTCCGTGAGGCAACAAGACTGCGTATATCACGGAACAGCTTACGCTTACGCAACTGATCAAGGACTGGACAAAGTGTATTGCGTACGAGCCTATTTGGGCCATTGGCACGGCTCACGCTTCGCCTGACAGGCACAGGAGGGCATGCCAGCATCCGTGCGTGGTTGAAGGAGAAGGTCTCCCCTGAGGCGCTGAGAAGACCGGTATTACGGTGGCTCGTCGGTGCTAAGAACGCTCCGAATTGTCGCAGAAGGAAGACATGACGGCTTCCTGGTGGTAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGCGCGTGAAGTGCCATCAACGGATTCGGCCGTATCGGCCGCTCGTGTCGTGCGCGCCAACCCGTCATCAACATTGTGGCCATAACGACCGTTCATCTCTACTACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCTGGCTCGCTTTCCCACGAGAAAAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAAATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCTGCTCACTGCAGAATGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGTGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGCGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGTTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTTGTGGATTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCGATCAATCGCAGTGAGAACGAGATGAAGGGCATTCTTGGATACACGAGAGGCGTGTTCCAGGACTTCATGGGACTCACCTCATCATTTGAGCAGTGCGGAT Phytophthora_cryptogea TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCCAAGATCCGCATCTACGATGTGGGCAACAGAAGGCTTCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCGGACGAGAAGGAGCAGCTGTCGTCGAGGCTCTCGAGGCGCCGTATCGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCAAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGTTTCCGTACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCGGTAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGTACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAAATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAATATGACGCTCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTGCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGTGGAGCGTCGACGGGTGAGTTCGAGGCCCTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTCAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCAGCAGGTCGAGCTGGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGCGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAACAACGCGCCGGATCGGAAAGATCCGCAATTGCAGGAGATGTACGAGGCTTCATCTCGAAGGCGTATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGTCAGATCAAGACGGCGGACTCGGGTATCGGTATGACGAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTCCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGTAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTCACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTGGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTTAACAGCCAGAAGCCCATTTGGATGCGCAAACCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTTACCAAGACTGGGAGGAGCACGCGCTGTCAAGCACTTCTCCGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGACCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAAATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCTTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCTTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTCGAGACTACATCTCGCGCATGCCTGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTTCTCTTCATGATTGAGGCCATGATGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTCCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTCACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGTCTGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGGGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGTGAGTGTGTGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGCGCTGTAACTTGTCGCCGTTCGTCGAGGTGGTCGTGGCCCCGTCGCAGGTGCATGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGTGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGTGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGACTCGCCGTCATGCCTGCATCGGAGAGAGAAGGAGACCCGCGAGGCAACGAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATTGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCCCCCGACAGGCGCAGGACGGCACGCCAGCATCCGTGCTTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGATCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACCGAGAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGCATCGGCCGCTTGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAACGACCATTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCGCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGTCCAACATTAAGTGGGCGAGGACAGTGCATAGTGGTCGAGTCACGGGGCTTTCACACCTGAGAAGCTTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCCGCCCCGTCCAGCGATGCCCCCATGTTCGTCATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACCAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCTATTAATCGCAGCGAGAACGAGATGAAGGGAATCCTTGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_cuyabensis TACCGTTTCCAGAACAAGAAGCCGTTCATCAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTGGGTAACAGAAGGCTTCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCTGACGAGAAGGAGCAGCTGTCTTCGAGGCTCTTGAGGCGCCGTGTGGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGATGTGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTACAGGGATTCCAGATCACCCACTCGCTCGGTGGGGTACCGGCTCTGGTATGGGCACGCTTTTGATCTCCAAGATCCGCGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCTACGCTGTCGGTCCACCAGCTGGTCGAGAACGCTGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACTACCCCACCTACGGTGACCTGAATCACCTAGTGTGCGCCGCCATGTCGGGTATCACACGTGCTGCGTTTCCCGGGCCAGCTGAACTCGGACCTCGTAAGCTGGCTGTAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGTTTCGCCCGTTGACGTCGCGTGGATCGCAGCAGTACCGTGCTCTGACCGTCCGGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGAGAGCAGATGCTGAACGTTCAGAACAAGAATTCCTCGTACTTCGTGGAGTGGATTCCTAACAACATCAAGGCTAGCGTGTGTGACATTCCGCCTAAGGGCTTGAAGATGTCCACGACGTTCATTGGTAACTCAACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAATTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGATGAAATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCTGGAATTGTGGGTACAACTTTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCCTTTATCATGGTATTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATAGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTCTTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCACAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCGTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGCGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGCGTCCTCAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCCGAGCTCGACCGTCATGGTGGAGACCCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTGGCTCTGTGCCGCGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCGGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACCGACAAGGTGAACTGGGATGGATTGCCGCCTCGGAGTTCTACACGGGGAGAGCTCGCTACAACCTGGACTTCAAGAACAACGCTCCGGATCGGAAAGATCCGCAACTGACGGAGGTGTACGAGGCTTCATCGCCAAGGCAGATCAGCAACATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGCCAAGGTGGCAAGGACACGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGTCCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCTATCATGCCAGCCACCGCAGGGTGAGACTGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCTGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACGAAGGCTTCATGGAGGCCTGGCTGCCGGCGCCGATATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTGGCGAAAGGTCGTGTCCACTCCAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCTGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATTCCCGCGGTACCCGATGTCCTGAAGCTTAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTTTACGTGAGAAGACCGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCGGAGGACGTTACCCATGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCTGTGAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTATGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTCTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTGAAGAAGTGCTCGAGATGTTCGCCGACTGCGAGGACTCGGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCTAAGCTGCTGCGCTACCACTCGACCAAGTCGGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCGGAGAACCAGCCTGGCATCTACTATGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTTCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGACGAGAGTGAGGACGAGAAGAAGCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTTATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGCAGATCTCGAACCGCATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATTATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACTGTCTGTGTGGGGATCCGAGTTGTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCGTGTAGTCGGTGGCGGGAATGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTTACTGTTCTTCTCTTTGCTGGAAAAGCGTTGTGGAGGCTGCGGCGAGTGCTGAGGCGTGGAGAGGAGCTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATGGTGAACCGTAGTCACTTGGCTTTGAACCGGGTGGTTGTCGACCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATGGAGGCGTGGTCAGCGCGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGACGCTTGCGCGTACGACCCGTGTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATCGTCGAGTGTGTGCGTGCGTGGTGTTCGCAGCGGCTTGGCTGCCGCGTGTGCTTGCGTTGCTTGGAGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTTGTCTCTCTGTGTGCCGGTGTGCGGATAGCTTGCTATGCGTGTGTCGTCGTGCGCGGATGGGGGCGTGCTGTAACTTGTTGCCGTTCGTCGAGGTGGTCGTGGCGCCCTCGCAGGTGCACGCCGCCACGGTCAAGGCGCAGCTGCGCCCTGACGTGCGTGTCAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAGATGCTCAAGGACTGGGTGCCGAGTAACGCTCGTAGGCCACTCGGAGCGCCGCGGAAGGGCGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGCCTCGGCGTCATGCCTGCATCGGTGAGTCAAGGAGACCCGCGAGGCAACGACACTGCCTTCATCACCAAGCAGCTGACGCCTACGCCGCCGATCAACGACTGGACCAAGTGTATCGCGTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCGCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGAACAAGGTGTCCGCCGAGGCGCCGAGAAGACCGGTATTACGGTGGCTCGTCGGTGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTTGGGGCGCGTCAAGTGCCATTAACGGCTTTGGCCGCATTGGCCGCTGGTGTCGTGCGCGCCAACCCGTGATCAACATTGTCGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTTGAGTACGACACGGTCCACGGCAGTTGCCGGATCGGTCAGCCACGAGACAAGCACATTATCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCTGAGAACATCAAGTGGGCGAGGACAGTGCATAGTGGTCGAGTCACGGGGCCTTCAAACATGAGACGCCTCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACCAGAAGGACATGCACGTCGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGCGGCCGTGGCGCTTGTTAACATCATCCCTCGTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGTCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTCTCGGTGGTGGACTGACTGCTCGCCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCCATTAAGAGCAGCGAGAACGAGATGAAGGGCATCCTTGGTTACACGAGAGAGGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_drechsleri TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCCAAGATCCGCATCTACGATGTGGGCAACAGAAGGCTTCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCGGACGAGAAGGAGCAGCTGTCGTCGAGGCGCTCGAGGCGCCGTATCGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCCCCAAGGTATCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGATTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCGGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCGGGTGCCGGTACCGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGTGGGGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGTGGAGCGTCGACGGGCGAGTTCGAGGCCCTCGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTCAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCAGCAGGAGGAGTTGGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGG{CT}TGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGGGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAACAACGCGCCGGATCGGAAAGATCCGCAACTGCAGGAGATGTACGAGGTTTCATCTCGAAGGCGTATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGTGGACTCTGGTATCGGCATGACGAAGGCTGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTCCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTCACTGAGACGAGGAGGAGGAGAGAAGGAGGGGATGACAAGCCCAAGGTCGAGGAGTGGAGGGCGAGAAGAAGAAAAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCTGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCT{GT}TACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCTAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTCGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCCGTGGAGAACTCTCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGTCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTCCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTCACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGTCTGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTGCCCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGGGTCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGCTGTGTGTGGATTGATGCGCGCTGTAACTTGTCGCCGTTCGTCGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGACTCGCCGTCATGCCTGCATCGGAGAGAGAAGGAGACCCGCGAGGCAACGAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATTGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCCCCCGACAGGCGCAGGACGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGATCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCTGACTTCCTCAGATCATAACGCCCAAACCCACCGAGAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGCATCGGCCGCTGGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCGCGCTGTCGCACGAGAGCAGCACATCTTCGTAGGCAAACCATCCGGTCTTAAGAGATGAACCGTCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTCGAGTCACGGGGCTTTCACACCTGAGAAGCTTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCCGCCCCGTCCAGCGACGCCCCCATGTTCGTCATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACCAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGACCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCGAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCCACGCGACGTGTCTGTGGTGGACTGACTGCCCGTCTGTGAACCCTGCTTCTACGAGAGATTAAGGCGCGATCAAGAGCAGCGAGAACGAGATGAAGGGAATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_erythroseptica TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCTGACCCCAAGATCCGCATCTACGATGTGGGCAACAGAAGGCTTCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCGGACGAGAAGGAGCAGCTGTCGTCGAGGCTCTCGAGGCGCCGTATCGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCAAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCGGTAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGTACCACTTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAAATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAATATGACGCTCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTGCGAGGCCTCCGGGACAACGTGGTTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGTGGAGCGTCGACGGGTGAGTTCGAGGCCCTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTCAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCAGCAGGTCGAGCTGGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGCGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTTCCGTGCCATCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAACAACGCGCCGGATCGGAAAGATCCGCAATTGCAGGAGATGTACGAGGCTTCATCTCGAAGGCGTATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGTCAGATCAAGACGGCGGACTCGGGTATCGGTATGACGAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGACAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTCCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTCACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTGGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTTAACAGCCAGAAGCCCATCTGGATGCGCAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCTGTCAAGCACTTCTCCGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGACCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAAATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCTTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCTTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTCGAGACTACATCTCGCGCATGCCTGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCGGTGGAAAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGATTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTCCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTCACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGTCTGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGGGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGTGAGTGTGTGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGCGCTGTACCTTGTCGCCGTTCGTCGAGGTGGTCGTGGCCCCGTCGCAGGTGCATGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGTGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAATGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGACTCGCCGTCATGCCTGCATCGGAGAGAGAAGGAGACCCGCGAGGCAACGAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATTGCCTACGAGCCCATTTGGGCCATCGGCACGGCTCACGCCTCCCCCGACAGGCGCAGGACGGCACGCCAACATCCGTGCTTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGATCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACCGAGAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTTGGCCGCATCGGCCGCTTGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCGCGCTGTCGCACGAGAGCAGCACATCTTCGTAGACAAGCCATCCGGTCTTAAGAGATGAACCGTCCAACATTAAGTGGGCGAGGACAGTGCATAGTGGTCGAGTCACGGGGCTTTCACACCTGAGAAGCTTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCCGCCCCGTCCAGCGACGCCCCCATGTTCGTCATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACCAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCCGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCTATTAATCGCAGCGAGAACGAGATGAAGGGAATCCTTGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_europaea TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCTTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCTGCCAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCTAAGTTCAAATTCCCGGGCCGTCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGCACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAATGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACACGTGCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGCTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCTAAGGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTGTTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACGGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACAATGTTATTGACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGGGGAGGAGATCCTGTACTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAGGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTTTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTCTGGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTTCTGAAGCCGTGAAAACGTGAACGACATCTCGCCCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCTGAGCTTGACCGTCATGGTCGAGGAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGTAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGTTCCACGCCGGAACAACTGGCGATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGAACCGCTACGGCCTGGAGCCACGGCTGTGGGCGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCAACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTACGCTGGGATGGATCGCTGCTTCGGAGTTCTACACGGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGCATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCGTCCTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCGGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCGGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCCGCCGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGCTTTACTCGGCTTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACCGTCACGCCGACACGTCGGAGCCATCTGCGCGGCACCCGATGTGCTCACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACGAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACTCGCAGAAGCCCATCTGGATGCGCAAGCCTGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTATGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTGAAGAAGTGCTCGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAGCAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGCAGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATTTACTACGTGACGGGGAGAGCAAGAAGGCCGTGGAGAACTCGCCCTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGATCTTCATGGTGGAGGCCATGATGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCAAACCGTATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCCCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGCTTGGTTGCGGTGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGTGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGGCGTCATGCCTGCATCGGCGAGACAAGGAGCTGCGCGAGGCAACCAGACTGCCTACATCACGGAGCAGCTGACGCCTACGCCGCCGATCAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTGTCCCCCGAGGCGCTGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAAAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTTGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACTAAGTGGGGGCGCGTGAAGTGCCATCAACGGGTTCGGCCGCATCGGCCGCTGGTGTCGCGCGCGCCAACCCGTGATCAATGTTGTTGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCGTAGTGGTGGAATCACGGGGCCTTCACACACGAGAAGCCTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGCGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTAAACCCCGCCTCTACGAGAGATCAAGGCGCTATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCTCCTCTTCATTTGAGCAGCGCGGAT Phytophthora_fallax TACCGTTTCCAGAACAAGAAGCCGTTCATCAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGACGTCGGCAACCTCGCGCCTCGTGGACACCTTCCCCTTCGTGGCCCACTTGTGTCTGACGAGAAGGAGCAGCTGTCGTCGAGGCCCTCGAGGCGCCGCGTTGCTGCCAACCGGTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGCAAGCCCGGCGTGGCGCCCGCGTGGCATCGGCCAGCCATCATCTCGGTGCGTCAAAGACAACTTCGGCCCGTCGGTGTCGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCGGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCGCTCGGTGGGGTACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGTGAGAGTACCCGGACCGCATCATGTGCACCTACTCGGTGTGCCGTCCCCAAGGTGTCGGACACGGTCGTGGAGCCGTACAACGCGACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGCTGGATAACGAGCCTTGTACGACATTTGCTTCCGCACGCTGAAGCTCACCACCCCACCTATGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGGTTCGCCCGCTCACGTCGCGTGGCTCACAGCAGTACCGTGCCCTAACGGTCCGGAGTTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGAGAGCAGATGCTGAACGTCCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCGAACAACATCAAGGCGAGCGTGTGTGACATCCCGCCTAAGGGCCTGAAGATGTCGACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCCTTTTCTGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAACTTGCACAACCGGGTAATCAAATTTTAATGGGGAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTCTTTTTAGTTATGCCTGCCTTAATAGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATTGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCCTTAGTTGAATCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCTAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGGATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCGGGTGCAATTACAATGTTATTAACTGATAGAAATTTTAATACATCTTTTTATGACCCTTCAGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTAGACTACCTGAAGAAGGTGGTACAACCGTAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACCCTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGCGGCTTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGCGTCCTGAAGCCGTCAAAACGTGAACGAGATCTCGCTCCCGCTCTCATCGGCAGGACGTGACCAGCAGACCGAGCTCGACCGTCATGGTCGAGACCCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTTGCGCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCTGACCTGGCCGGCAACCCGTCGCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAAGGCCGCTACGGTCTGGAGCCACAGCTGTGGGTGACGAGGGTGGTTCGCCCCCAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGGACAAGGTGAACTTGGATGGATGGCCGCTTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTGGACTTCAAGAACAACGCCCCTGATCGGAAAGATCCGCAACTGACTGAGGTGTACCAGGCTTCATTGCCAAGGCAGGTCAGCAGCATGTGTCCATTGAGGACCCGTTTGACCAGGACGACTGGGAGTCGTGGTGAATTACCCGCAGGTGGCGAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACGCGTGTCCAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCTGGCTGGGCTATCATGCCAGCCACCGCAGGGTGAGACCGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCGGGCATCGGCATGACGAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTGGTGTCCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCTGCGGGCGGCTCGTTCACGGTCACGCCGACACGACGGAGCCATTCCCGCGGCACCCGATGTCCTGAAGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGAGACGACAAGCCTAAGGTCGAGGAGTAGACGGGGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGTTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGACCTATGCCGAGTACCTGTCGTTCGTCAAGGGAGTCGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACTCGGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCGGGGAGGAGCTGACGTCCTGGAGACTACATCTCGCGCATGCCGGAGAGCCAGCCTGGCATCTACTATGTGACTGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTTAAGAAGAAGGGTAGAGTGCTTTTCATGATTGACGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGCAGATCTCGAACCGCATGTCGAGTCCCCGTGCGTCCTGTGACGGGGAGTACGGTGGTCCGCTAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGCGACCACACCTAAAAATTCCACGTGACTGTATTGTCGGGGATCCGAATTGTAAACCTTACTGTGGGGACGAAAGTCCTTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGCTGTATCAGTGTCCGTATATCAAACTTGCCTTCCTTCCTTCGTGTAGTCGGTGGAGGGAACGTCAGATGTGAAGTGTCTTGGGCGAGTCCTTTTAAATACTACTGTTCTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGAGTGCTGAGACGTGGGGAGGGGCTTGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGTACCGTAGCTGCTTGGCTTTGAACCGAGTGGGCATCGAGATTTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGTGGGCTCTCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATACTGAGGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTTCCAGTGTCTATAATCCGTGGCATATTCCATTGCCGAGTGTGTGCGTGTGTGGTTTCGGCAGCGGCTCGGCTGCTGCCTGTGCTTGCGTTGCTTGGTGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTGTGCCGCGGGAAATATCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTAGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTTGCTTCTCTGTGTGGCGCCGTGCGAATAGCTTGCTATGCGTGTGGTGTTGTGTGTGGATTGAGGCGTGCTGTAACTTGTTGCCGTTCGTGGAGGTCGTGGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCGCAGCTGCGCGCCGACGTGCGCGTCAGGGCCAGGACGTCTGGACGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTTACGCTCGTGGGCCACTCGGAGCGTCGCGGAAGGGCGAGACAACGAGGACGTGGCAAGAAGGCGCTACGCCTCGACAAGGGCCTCGGCGTCATGCCTGCATCGGCGAGTCAAGGAGACCCGCGAGGCAACGAGACTGCCTACATCACCAAGCAGCTGACGCCTACGCTGCTGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCGCAGGACGGCACGCCAGCATCCGCACCTGGTTGAAGACCAAGGTGTCCGCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAATGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTAAGATCATAACGCCCAAACCCACGGACAAGTGGGGGCGCGTGAAGTGCCATTAACGGATTTGGCCGCATCGGCCGCTGGTGTCGTGCGCGCCAACCCGTGATCAACATTGTTGCCGTAACGACCCTTCATCTCGACGACTACATGGATACATGCTCGAGTTCGACACGGTCCACGGCAGTTGCCGGCTCGGTCTCGCACGAGAGAAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCCGAGAACATCAAGTGGGTGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACAAATGAGACGCCTCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAACGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACCAGAAGGACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCTACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGTCGCGGCGCGTGTTAACATCATTCCTCGTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCCTCTACGAGAGATCAAGGCGCTATTAATCGCAGCGAGAACGAGATGAAGGGCATTCTCGGCTACACGACAGAGGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_foliorum TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTGGGCAACAGAAGGCATCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCGGACGAGAAGGAGCAGCTGTCGTCGAGGCTCTGGAGGCGCCGTATCGCCGCTAACCGGTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCCTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCGGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTCGACGTGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGGTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGTTCCGGAATGGGTACGCTTCTGATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCTGGATAACGAGCTCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCACCTACGGCGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCGGGTCAGCTGAACTCGGATTTCGGAAGCTGGCGGTAACTTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCGGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATAATGGTTTTTTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCCTTTCCACGAATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCGGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCCTTTCTTTTATTATTAACATTACCCGTTTTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCATCTGGGGGGGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGGCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCGTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGCGTCCTCAAGCCGTCAAAACGTGAACGAGATCTCGCCCCCGCTCTTATCGGCAGGACGTGACGAGCAGGCCGAGCTGGACCGTCATGGTCGAGACCCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTCGGGCCAACGCCATCTGGGCGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCGGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCGATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGTTACGGCCTGGAGCGACCGCCGTGGGTGACGAGGGTGGTTCGCGCCGAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGATACACGAACCAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAACAACGCTCCCGATCGGAAAGATCCGCAACTGCAGGAGATGTACGAAGCTTCATCTCGAAGGCGTATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAAATACTGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTTTGAGCGCCGGGCAGATCAAGACGGTGGACTCGGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACGAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTTGTGTCCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACAGTCACGCCGACACGTCGGAGCCATCTGCGCGGTACGCGATGTCCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGATCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGACGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTGGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCTCCGTGAAGCACTTCTCGGTGGAGGGCAACTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTGTATGTGCGCGTGTGTTCATCATGGACAACTGCGAGGATCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACTCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAATCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGTACAAGGAGGGACTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTCGAGATCTCGAACCGTATGTGGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCTGCTAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCTGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGGTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATGGATGCGTGCTTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTCGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGTACGGCTCACGCCTCGCCCGACAGGCCCAGGACGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCGGAGAAGACCGGTATTACGGCGGCTCGTGGGTGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGATATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCTCAAACCCACCGAGAAGTCGGGGCCCGTGAAGTGCCATCAATGGCTTCGGCCGTATCGGCCGCTTGTGTCGCGCGCGCCAACCCGTCATCAATATCGTGGCCATAACGACCGTTCATTTCGACGACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGACGGCTCGCTGTCGCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGACCAACATTAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACCTGAGAAGCGTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGCGACGCCCCCATGTTCGTCATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTTTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCGACGCAGAAGACGTGGATGGCCCGTCGAATAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCTACGCGACGTGTCTGTGGTGGACTGACTGCTCGCCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTTGGCTACACGAGAGGCGTGTTCTAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_fragariae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCGTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCTGCCAACCGTTACCTGACTAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTACAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCGGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACACGTGCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGACTGAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAAGGTATGGACGAGATGGAGTAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTATTTGGTCTGTATTAATTACAGCATTTCTTTTATTACTAACTTTACCGGTATTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGGGGAGATCCAGTACTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCTTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTTTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTCTGGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTCCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTTCTGAAGCCGTGAAAACGTGAACGACATCTCGCCCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTCGAGGAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGGGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCGATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACACCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGAACCGCTACGGCCTGGAGCCACGGCTGTGGGCGACGAGGGCGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCAACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGGACCAGGTGCGCTGGGATGGATCGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGGATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGGTGAAATACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCGGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCGGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTGGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACCGTCACGCCGACACGTCGGAGCCATCTGCGCGGCACGCGATGTGCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGAGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACTCGCAGAAGCCCATCTGGATGCGCAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTGAAGAAGTGCTTGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAGCAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGCAGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCCGTGGAGAACTCGCCCTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTCATCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTTGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGCGGCTTGGCTGCGGTGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCTGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTGTGGGAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTAGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTGCGCGAGGCAACCAGACTGCCTACATCACGGAGCAGCTGACGCCTACGCGGCCGATCAGCGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTGTCCGTCGAGGCGCTGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTGGGGGCGCGTGAAGTGCCATCAACGGATTCGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTGATCAACGTCGTGGCCATAACGACCTTTCATCTCCACTACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCTCGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGTCCAACATCAAGTGGGCGAGGACAGTGCGTAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCCTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCAACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCCTCTACGAGAGATCAAGGCGCTATCAATCGCAGTGAGAACGAAATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_glovera TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTGGACGCCTTCCCGTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGATGTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCATCGCCAAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCCACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTTTTTATGATTGGTTTCGCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTCCCGAGCTGACCCAACAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCCAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAATAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATCTTTATGGGAAATCATCAATTATATAATGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACGGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGGCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCGTCCACGGGTGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACAAGCAGGCGGAGCTGGACCGTCATGGTGGAGCAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTCGGGCCAACGCCATCTGGGTGTGTCCTGGCTCTGTGCCGTGGGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCTATGCAGGAGTTCATGATTCTCCTGTGGGCGCCACAGCTTCACGGAGTCGATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGTTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGGTACACGAACCAGGTGCGCTTGGATGGATGGCCGCTTCGGAGTTCTACACCGGGCGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCTCCGGATCAGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTTATCGCCAAGGCGTATCAGCAAGATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCTAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGCCTGAGTGCTGGCCAGATCAAGACGGTGGACTCGGGTATTGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTTGCTGCTGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCTGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGTGGCTCGTTCACTGTAACGCCGACACTTCGGAGCCATTTGCGTGGTACGCGATGTCCTGACCCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGATGGTGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGATGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTCGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATTAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTTTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCTACGAGGGTCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTCGAGATCTCGAACCGTATGTTGAGTCCCCGTGCGTGCTGTGACTGGGAGTACGGTGGTCCGCCAACATGGAGCGTATTATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCAAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGAGGAGGAGTGTCCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGCGATGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCGTGGAGGTTGTGGTGGCCCCCTCGCAAGTGCACGCAGCTACTGTCAAGGCTTCGCTGCGTTCCGACGTGCGTGTGAGGGTCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCTGAGTAACGCTGGTGGGCCACAGTGAGCGTCGTGAAAGGGCGAAACAATGAGGTTGTGGCAAGAAGGCGCTATGCCTTGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGGAGCTTCGTGAGGCAACCAGACTGCGTACATCACGGAACAGCTCACGCCTACGCGGCTGATCAAGGACTGGACCAAGTGTATTGCATACGAACCCATCTGGGCCATTGGAACGGCTCACGCCTCACCTGACAGGCTCAGGAGGGCACGCCAGCATCCGTGCGTGGCTCAAGGAGAAGGTCTCCTCTGACGCGCTCAGAAGACCGGTATTACGGCGGATCGTCGGTACTAAGAACGCCCCGAACTCTCGCAGAAGGAGGACATGATGGCTTCCTGGTGGTAGCCTGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGTGCGTGAAGTGCCATCAACGGCTTCGGCCGTATTGGCCGCTGGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAATGACCGTTCGTCTCCACCACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCTGGCTCGCTTTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGGCTAATATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACTGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCCGCCCCGTCCAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGAGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAATGGCAAGTTGACTGGCATGTCTTCCGCGTTCCTACGCGATGTGTCTGTCGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGAATTCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCACCTCTTCATTTGAGCGAGGCGGAT Phytophthora_gonapodyides TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGTGTGCCCGACCCCAAGATCCGCATCTACGATGTCGGTAACCTAAGGCGTCGTGGACACGTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCGTCGAGGCCCTCGAGGCGCCGTATCGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCGTGCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGCGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATCATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGACGTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGGGTACCGGCTCCGGCATGGGCACGCTTCTTATTTCCAAGATCCGTGAGAGTACCCGGATCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACACGTGCTGCGTTTCCCGGGCCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCGGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGACGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTGGAGAACAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCAAGCGTGTGCGACATCCCGCCCAAGGGCCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACTTTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATCTAACAGGTATTTCGTCAATATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCATTTCTTCTATTATTAACATTACCTGTATTAGCGGGTGCTATAACTATGTTATTAACAGATAGAAATTTAAATACCTCTTTTTATGATCCATCAGGTGGAGGAGATCCGGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCGAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCATGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTTCCCAGCGGAGCGTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGCGTCCTTAAGCCGTGAAAACGTGAACGACATCTCGCCCCCGCTCTTATCGGCAGGACGTGACCAGCAGGAGGAGCTGGACCGTCATGGTTGAGACCCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTTGCTCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGTGACGAGGGTGGTTCGCCCCTAACATCCAGTCGAACGGTGAGGCCATCGACCTCATTGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTGGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGTCGGTGTACGAGGCTTCATCGCGAAGGCGTCTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCTATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACCGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGTCTGCTGGTCAGATCAAGACGGTGGACTCGGGCATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCTGCCGGCGCCGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTCGTGGCGAAAGGTGGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCGGCCGGAGGCTCGTTCACCGTCACGCCGACACGACGGAGCCATCTGCGCGGCACGCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAGGAGACGAGAAGGAGAGGACGACAAGCCCAAGGTCGAGACGACGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAAGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCTTTCGTCAAGGGTGTGGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACGCTTCAGCAAACAAGATCCTCGCGTCATAAGAAAACCTGTGAAGAAGTGCTCGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACCAGAAGTTTAGAGGCCTTCTCGAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGCTACCACTCGACCAAGTCGGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCTGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCGGTCGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGATGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACGGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTGCTGGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATCGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGTGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGATAGCTGTGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGAGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGCGTGTGTGTGCTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACTGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGACGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGTGAGCGTCGCGGAAGGGCGAGACAACGCCGACGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGGCGTTATGCCTGCATCGGCGAGTCAAGGAGACCCGCGAGGCAACGAGACTGCCTACATCACCAAGCAGCTGACGCCTACGCCGCTGATCAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCTTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTGGGTGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTGGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGCATTGGTCGCTCGTGTCGTGCGCGCCAACCCGTCATCAACATCGTGGCCATAACGACCGTTCATCTCGACCACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGGCGGCTCGCTCTCGCACGAGAGAAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCTGAGAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCAAACATGAGACGCTTCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGCCTGGCGCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTTGTGGACTGACGGCTCGTCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCCATTAATCGCAGCGAGAATGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_heveae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCCAAGATCCGCATCTACGATGTCGGCAACAGAAGGCGTCGTGGACGCCTTCCCCTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTGTTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTCGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCCGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGTAAGGAGGCTGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGCACGCTTCTTATTTCCAAGATCCGAGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCGACGTTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAATCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTTACGGTCCCGAGCTGACCCAGCAGCAATTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCCCCCAAGGGTCTCAAGATGAGCACCACGTTCATTGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCACCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTACGATCCTTCTGGTGGAGGAGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTGCCGAGCGGAGCGTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCGTGGGCAGGACGTGACCCGCAGGCCGAGCTGGACCGTCATGGTGGAGACGCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCCCTGTGCCGTGGGGTGCTGCTGCCAAGAAGCAGCCTTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGCGCCAGAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTCGGCGACGAGGGTGGTTCGCCCCCAACATCCAGTCGAACGGTGAGGCCATTGATCTTATTGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCTGCTTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGAGAAGGCGCGACAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGATTAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCCATCGAGGCGTGACGATGGCGAAGAAGGCTGGATGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCGGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCGGGTATCGGTATGACGAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTATGGGAGTCGCTGCCGGCGGCTCGTTCACCGTGACGCCGACACGTCGGAGCCATCAGCGTGGTACCCGATGTGCTCAAGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACGAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCTCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCTGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATTTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAAAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAATCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTAACAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAAGAGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCAGCGTGGAGGCGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGTACCGTAGCTACTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTTCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGACGTGGTTGTGGCTCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTCAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTTACGCTCGTGGGCCACAGCGAGCGTCGCGAAAGGGTGAGACAATGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGCCTCGGCGTCATGCCTGCATTGGTGAGACAAAGAGACCCGCGAGGCAACCAGACTGCTTACATCACGGAGCAGCTCACGCCTACGCTGCTAATCAAGGACTGGACCAAGTGTATTGCCTACGAGCCCATCTGGGCTATCGGCACGGCTCACGCCTCGCCCGACAGGCGCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAACGAGAAGGTGTCCCCGGAGGCGCTGACAAAACCGGTATTACGGCGGCTCGTCGGTGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGTAGCCCGACTTCCTCAAATCATAACGCTCAAACCCACGGCGAAGTGGGGGCGCGTGAAGTGCCATTAACGGTTTTGGTCGTATCGGTCGCTCGTGTCGTGCGCGCTAACCCGTCATCAACATTGTGGCAATAATGACCGTTCATCTCGACGACTACATGGATACATGCTCGAATACGACACGGTGCACGGCAGTTGCTGGCTCGCTCTCTCACGAGACAAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGTGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCCTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCCCCCATGTTCGTGATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGCCTGGCTCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGACGGACCGTCTAAGAAGGACTGGCGGGAGGCCGCGGCGCCTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCTAGCTTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTTCCGACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCTATCAATCGCAGCGAGAATGAGATGAAGGGCATCCTTGGTTACACGAGAGGCGTGTTCCAGGACTTCATGGGACTCGCTTCGTCATTTGAGCGAAGCGGAT Phytophthora_hibernalis TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCGTCGTGGATATCTTCCCCTTCGTGTGCCACTTGTGTCCGACGAGAAGGAACAGCTGTCGTCGAGGCTCTCGAGGCGCCGTATTGCTGCTAACCGTTACTTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCTGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATCATCTCGGTGCGTCAAGGACAACTTCGGACCGTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTGCAAGGGTTCCAGATCACGCACTCGCTCGGTGGGGTACCGGCTCCGGAATGGGCACGCTCCTGATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACATACTCCGTGTGCCGTCGCCAAGGTGTCGGACACCGTCGTGGAGCCCTACAACGCCACACTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCTGGATAACGAGCGCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGGTTCCCCGGTCAGCTGAACTCGGACCTCGGAAACTGGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGCTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGACTCAAGATGAGTACCACGTTCATCGGTAACTCGACGCTATCCAGGAAATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCCCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTCGTTCCTTTAATGATAGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCCGCTTTATTATTATTAGTATCATCAGCTATTGTGGAATCTGGAGCAGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCGGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTTTTAGCAGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCCTCTGGAGGTGGTGATCCCGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGGCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCAAACATGCCGTGGTACAAGGGCCTACCTTCTGAGGCTGACTCTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGCGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCGTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTTCCCAGCGGAGCGTCCACGGGCGAGTTCGAGGCCCTCGAGATGCGGAGGGGGCGTACATGGGCAAGGGCGTCCTGAAGCTGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACACGCAGGTGGAGCTCGACCGTCATGGTGGAGACCCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATTTGGGCGTGTCCTCGCTCTGTGCCGTGGGGTGCCGCGGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCTGGAACAATTGGCTATGCAGGAGTTCATGATTCTCCCGTTGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAAAGTGTGATTAAGGGTAGGTATGGTTTGGAGCGACGGCGGTCGGTGACGAGGGTGGTTCGCCCCGAACATCCAGGCAAACGCTGAGGCCATCGACCTGATCGAGGAGGCTATCAAGAAGGCGGATACACGGACAAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTTCACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCTGGAGGTGTACGAGGCTTCATCTCGAAGGCGTCTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAAATACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGTAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATTGCGGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGCATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCTGCTGGCGCTGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTCGTGTGCACTCCAAGCACAACGACGACGAGCAGTACGTATGGGAGTCGCCGCCGGTGGCTCGTTCACGGTCACGCCGACACGACGGAGCCATCTGCGTGGCACGCGATGTGCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTGGACGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTTACCCATGACTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCTGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACGAAGATTGGGAGGAGCACGCGGAGTCAAGCACTTCTCCGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTGTACGTGCGCGTGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATTCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACACTAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGCTGACGTCCTGGAGACTACATCTCGCGTATGCCCGAGACCCAGCCTGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTTTACATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGACTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCGAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGATGACAAGGTGAGAAGGTCGAGATCTCGAACCGTATGTGGAGTCGCCGTGTGTGCTGTGACGGGGAGTACGGTGGTCCGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGTCAGACGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACGGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAAGCTTCGGCGACTGCTACGGCGTGGAGGAATGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAGCTTATTGTGAACCGTAGCTAATTGGCTTTGAACTGAGTGGCGGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCACACAAGTTTTGTGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGTCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTATGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGATGCGGTGGGACGTCAAGGTCAATTCGTATGCCGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGATTGAGGTGCCTACAACGTGCTTTTGAGTGAGACGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTACTTTAACTTGTTGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGATGTGTGGAAGCAGGGCAACGGTGCCTTCACGGGCGAGACGTCAGCTGAGATGCTCAAGGACTCGGTGCCGAGTAACGCTCGTGGGTCACAGTGAGCGCCGCCAAAGGGCGAGACAACGAGGTCGTAGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTTGCCGTCATGCCTGCATTGGCGAGACAAGGAGCTCCGCGAGGCAACCGGACTTCTTACATCACGGAGCAGCTTACGCTTACGCCGCCGATCAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCCTCGCCCGACAAGCTCAGGACGGCACGCCAGCATCCGTGCTTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCTGACAAGACCGGTATTACGGCGGATCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACCGAGAAGTCGGGGCCCGTGAAGTGCTATCAACGGTTTCGGCCGTATCGGACGCTTGTGTCGCGCGCGCCAACCCGTCATCAACATCGTGGCTATAACGACCATTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACCGTGCACGGCAGTTGACGGCTCGCTGTCGCATGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGACCAACATCAAATGGGAGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACCTGAGAAGCTTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGCGACGCCCCCATGTTCGTCATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGTACGACGAACTGTCTGGCGCCTTGGCCAAGGTGGTGAACGACAAGTTTGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGCTGACAGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACCGCTCGTTTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCTATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCTAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGGTGCGGAT Phytophthora_humicola TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACCTAGGGCGTCGTGGACACGTTCCCGTTCGTGGCTCACCTGTGTCCGACGAGAAGGAGCAGCTGTCTTCGAAGCTCTTGAGGCGCCGCATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTGTGCGTTGCCACCCTTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGCGCTGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTCGAATCGGCCAGCCATTATCTCGGTGCGTCAAAGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGACGTGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCTGACACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGTTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACACGTGCTGCGATTCCCCGGTCAGCTGAACTCGGATCTCGTAAGCTAGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCCCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGTCACGGCCGTTATTTAACTGCAGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGAGAGCAAATGCTGAATGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCCAGCGTGTGTGACATTCCGCCCAAGGGACTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTCGAATGGAATTAGCACAACCGGGTAATCAAATTTTTATGGGGAATCATCAATTATATAATGTTATTGTTACAGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCGAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCGTGCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGATTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCATGAGAAGATGGACCGTCGTCGGGAAGATCTGGCGCTGTCCCCAGCGGAGCGTCTACGGGCGAGTTCGAGGCCCTTGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCCTTAAGCCGTGAAAACGTGAACGACATCTCGCCCCTGCTCTTATTGGCAGGACGTGACCAGCAGGCGGAGCTGGACCGTCATGGTGGAGCAGCTCGACGGCACTCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGTGTGTCCTTGCTCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTTGCGGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGCAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCCGTTGGCGACGAGGGTGGTTCGCCCCTAACATCCAGTCGAACGGTGAGGCCATCGACCTTATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCTTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGTCGGTGTACGAGGCTTCATCTCGAAGGCGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCTATTGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACTGAGGACACGTTCATCGCCAGTGGCCGTGGGTCTGTCTGCTGGCCAGATCAAGACGGTGGACTCCGGTATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCTGGCGCTGACATCAGATGATGGTCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTGGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCGGCCGGTGGCTCGTTCACCGTGACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAAGAGACGAGAAGGAGAGGACGACAAGCCCAAGGTCGAGACGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTATGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCTGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCTAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTCTCGTTCGTCAAGGGCGTTGTCGACTCGGAGGACTTGCCACTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTGAAGAAGTGCTCGAGATGTTTGCTGACTGCGAGGACAACGAGAAATACCAGAAGTTTAGAGGCCTTCTCCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCCACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCGGTGGAGAACTCGCCGTTATCGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTCGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAAGATGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTGCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCTAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATTGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGATAGCTGTAGTATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGTGTGCGTGGCTGTGGCAGCGGCTTGGCTGCGGTGCGTGTGTGTGCTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCTAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGCGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAACTTGTCGCCGTTCGTTGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCTCTGCGCGCCGATGTGCGCGTCAGGGCCAGGACGTGTGGACGCAGGGCAACGGCGCCTTCACGGGCGAGACTTCGGCTGAGATGCTCAAGGACTGGGCGCAGAGTAACGCTGGTTGGCCACAGTGAGCGCCGTGGAAGGGCGAGACAACGTCGACGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGGCGTTATGCCTGCATCGGCGAGTCAAGGAGACCCGCGAGGCAACGAGACTGCTTTCATCACCAAGCAGCTGACGCTTACGCTGCTGATTAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCTATTGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAAGGCACGCCAGCATCCGTGCATGGCTCAAGGAGAAGATTTCTCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTGGGCGCCAAGAACGCTCCGAGCTCTCGCAGAAGGAAGACATGACGGCTTCCTCGTGGCAGCCTGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTGGGGGCGCGTCAAGTGCCATCAACGGCTTCGGCCGCATTGGACGCTTGTGTCGTGCGCGCCAACCCGTGATCAACATCGTGGCGATAACGACCCTTCATTTCGACCACTACATGGATACATGCTTGAGTACGACACGGTGCACGGCAGTTGGCGGCTCGCTCTCGCACGAGAGAAGCACATCATCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCTGAGAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCAAACATGAGACGCCTCGGCTCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGGCCGACGCCCCTATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGCCTGGCGCCCTGGCGAAGGTTGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACTCCGTACGCGTCGCAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCTAGCCTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCGGTCGTGGACTGACGGCTCGTCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCCATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGATTTCATGGGACTCGCCTCGTCATTTGAGCAACGCGGAT Phytophthora_idaei TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTTCAGGTTCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTTGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCACCTACGGTGACTTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCTAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAAGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTGATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATCACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCCTCCACGGGCGAATTCGAGGCTCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAGAACGTGAACGAGATCTCGCTCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCCGAGATCGACCGTCATGGTGGAGGAGCTTGATGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCACACATGCCGACCTGGCCGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCTGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCTGTTGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGATACACGGACAAGGTGCGCTTGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATTGCCAAGGCGTATCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGATGACTGGGAGTCGTGGTGAAATACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAAGCTGGCTGGGGAATCATGCCAGCCACCGTAGGGAGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCGGGCCAGATCAAGACGGCGGACTCTGGTATTGGTATGACGAAGGCTGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCCGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCGGGTGGATCGTTCACTGTGACGCCGACACGTCGGAGCCATCAGCGTGGTACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAAGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTTGAGGAGTCGAAGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACTCTGCAGCAAACAAGATCCTCGTGTAATAAAAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCTGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGTCGTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCGACTAAGTCCGGGAGGAAGTGACATCCTGGAGACTACATCTCGCGTATGCCCGAGAATCAGCCTGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGTCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCCTGTGTGCTGTGACCGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTTTCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCCTTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGTGACTGCTGCGGCGTGGAAGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCATAGCTCCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGCTAGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAGGTCGTCGTGGCTCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCGCGCTGCGCTCCGACGTGCGCGTCAGGGCCAGGATGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAGATGCTCAAGGACTGGGTGCTGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGTGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGTCTCGCCGTCATGCCTGCATTGGTGAGACAAGGAGCTCCGCGAAGCAACCAGACTGCCTACATCACGGAGCAGCTCATGCTTACGCCGCCGATTAACGACTGGACCAAGTGTATTGCCTACGAGCCTATCTGGGCCATCGGCACGGCTCACGCCTCGCCTGACAGGCTCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAAGAGAAGGTGTCCCCCGAGGCGGTGACAAGACCGGTATTACGGTGGATCGTTGGTGCCAAGAACGCCCCGAGCTCTCTCAGAAGGAAGACATGACGGTTTCCTGGTGGTAGCCCGACTTCCTCATATCATAACGCACAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATTGGTCGCTTGTGTCGCGCGCGCCAACCCGTCATCAACATCGTTGCCATAACGACCGTTCATCACGACGACTACATGGATACATGCTCGAGTACGACACGGTACACGGCAGTTGATGGCTCGCTCTCGCACGAGAGAAGCACATCTTTGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCTGAGAACATCACGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCTTTCACACCTGAGAAGCCTCGGCTCACTGAAGAATGGTGGAAAGGTGTGATCTCGGCTCCGTCGAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCACGCCGTACGCCACCCAGAAGACGTTGACGGTCCGTCTAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATTATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCAAGCCTGAACGGCAAGCTCACGGGCATGTCTTCCGTGTGCCCACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCCATTAATCGCAGCGAGAACGAGATGAAGGGCATTCTCGGCTACACGAGAGGCGTGTTCTAGGACTTTATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_ilicis TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGCGTGCCCGACCCGAAGATCCGCATCTACGATGTGGGTAACCCAAGGCGTCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGCATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGCGCCGATAGACTGCAGACCGGTATGCGTCACGCCTACGGCAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATCATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGTCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGTTCCGGTATGGGAACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCTTGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCGGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCATTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTGGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCGCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCATTAATGATTGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCCGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACAATGTTGTTAACCGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGTAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGACGTCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGCGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCGAGTGGAGCGTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTTGTCGGCAGGACGTGACCAGCAGACCGAGCTTGACCGTCATGATCGAGCAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGCAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTAATCAAGGGCCGCTACGGCCTGGAGCCACCGCCGTCGGTGACGAGGGCGGTTCGCTCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGACCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCCTCGGAGTTCTTCACCGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTATCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGACGACTGGGAATCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCGAGCCACCGCAGGGCGAGACCGAGGACACGTTCATCGCCGATGGCTGTGGGCCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCGTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTTACCGTGACGCCGACACGACGGAGCCATCTGCGCGGCACGCGATGTCCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGAGGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGACGGCGACAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCTGACTATGAGGACAACGAGAAGTACATTAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAGCCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAGCTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTTCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCACCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACTGTATCGATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCGTGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGTGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAGCTTATTGTGAACCGTAGCTACTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGTTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCGTGGAGGTCGTGGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCGCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTCTGGCAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTCGGCGCCGAGTTACGCTGGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTGGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGGCGTCATGCCTGCATCGGAGAGACAAGGAGCACCGCGAGGCAACCAGACTGCCTACATCACCGAGCAGCTGACGCCTACGCCGCCGATCAAGGACTGGACCGAGTGTATTGCCTACGAGCCCATTTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGCGAAGGTCTCCCCGGAGGAGCGGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATCGGCCGCTGGTGTCGCGCGCGCCAACCCGTCATTAACGTCGTGGCCATAACGACCGTTCATCTCGACCACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCGGGATCGCTCTCGCACGAGAACAGAACATTTACGTAGGCAAGCCATCCGGTGCAAAGAGATGAACCCGCGAACATCAAGTGGGCGAGCACAGTGCATAGTGGTCGAGTCACGGGGCCTTCACGCATGAGACGCCTCCGCTCACTGAAGAACGGTGGAAAGGTGTGATTTCGGCGCCGTCGAACGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCCATTAATCGCAGTGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGGGGCGGAT Phytophthora_infestans TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCCTTCCCCTTTGTGTGCCACTTGTGTCTGACGAGAAGGAGCAGCTTTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATTAACAAAATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTCGCGCCCGTGTGGCATTGGTCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGACGTGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCGTCGCCAAGGTATCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGACAATGAGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCACTTATGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATTACACGTGCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCATGGCCGCTATTTAACTGCAGCTTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTATTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATTACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCGAGCGGAGCCTCCACGGGCGAATTTGAGGCCCTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCTGTGAAAACGTGAACGAGATCTCGCTCCTGCTCTTATCGGCAGGACGTGACGAGCAGGCCGAGATCGACCGTCATGGTGGAGAAGCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAGCTGGGGCCAACGCGATCTGGGTGTGTCCTTGCTCTGTGCCGTGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCACACATGCCGACCTGGCCGGCAACCCGACCCCATGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGTGCGAAAACTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGTCGCTACGGCCTGGAGCCACTGCTGTGGGTGACGAGGGTGGTTTGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCTTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCGGATCGGAAAGATCCGCAACTGCTGGAGGTGTACGAGGCTTCATCGCCAAGGCGTATCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGATGACTGGGAGTCGTGGTGAAATACTGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTAAAGAAGGCATGAAAGGCTGCAATGCTTCTGTTGAAGGTGAACCAGATTGGAGCATTACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGGCATTATGCCAGCCACCGTAGGGTGAGACAGAGGACACGTTCATCGCTGATGGCTGTGGGTCTGAGTGCCGGCCAGATCAAGACGGCGGACTCTGGTATTGGTATGACGAAGGCTGACTGATTAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCTGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCCGGTGGCTCGTTCACTGTCACGCCGACACGTCGGAGCCATCAGCGCGGTACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAAGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAAGGCGAGAAGAAGAAGAAGACTAAGAAGATTAAGGAAGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCTGAAGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACGAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTTTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCGCCGTTGACATGTTTGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTCTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACTTGCCGCTAACATCTCGCGTGAGACGCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTCGAGATGTTCGCCGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGTCGTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCCACCAAGTCTGGGAGGAAGTGACGTCCTGGAGACTACATCTCGCGTATGCCTGAGAGCCAGCCCGGTATCTACTACGTGACTGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCATTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACGGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAAGGACTGTGCAAGCTCATGAAGGAGGTGCTGGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCCTGTGTGCTGTTACCGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTTTCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCCAAAAGTGTTGTGGACGCTGCGGCGACTGCTGCGGCGTGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCATGGCTCCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCTGTGTCTCTGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTGCCGTTCGTGGAGGTCGTTGTGGCCCCTTCGCAGGTGCACGCCGCTACCGTCAAGGCTTCGCTGCGCTCCGACGTGCGTGTCAGGGCCAGGACGTCTGGAAGCAAGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAAATGCTCAAGGACTGGGCGCTGAGTAACTCTTGTAGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTAGCAAGAAGGCGCTACGCCTCGAAAAGGGCCTGGGCGTTATGCTTGCATCGGTGAGACAAGGACCACCGCGAAGCAACCAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATTAATGACTGGACCAAGTGTATTGCCTACGAACCCATCTGGGCCATCGGTACGGCTTACGCCTCGCCTGACAGGCTCAGGAGGGCACGCCAGCATTCGTGCCTGGCTCAAGGAGAAGGTGTCTCCTGAGGCGCAGAGCAGACCGGTATTACGGTGGATCGTCGGCGCGAAGAACGCCCCGAGCTCTCGCAGAAGGAAGACATGACGGCTTCCTGGTGGTAGCCCGACTTCCTCAGATTATAACGCTCAAACCCACGGCCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGTCGTATTGGCCGCTTGTGTCGTGCGCGCTAACCCGTCATCAACATCGTTGCCATAACGACCGTTCGTTTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCTCACTATCGCATGAGAGACGCACATCTTTGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCCGAGAATATTAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACCTGAGAAGCATCGACCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGTGACGCCCCCATGTTCGTGATGGGGTGAATCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACAAACTGCCTGGCCCCCTGGCTAAGGTGGTGAACGACAAGTTTGGCATAGGAAGGCCTCATGACAACGTCCACGCTGTACGCCACGCAGAAGACGTTGACGGTCCTTCCAAGAAGGACTGGCGGGTGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGTAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGATGTGTCTGTGGTGGACTGACGGCTCGTCTGTGAACCCTGCTTCTACGAGAGATTAAGGCGCCATTAATCGCAGTGAGAACGAGATGAAGGGCATTCTCGGCTACACGAGAGGCGTGTTCGAGGACTTTATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_insolita TACCGTTTCCAGAACAAGAAGCCGTTCATCAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGTATCTACGATATCGGTAACAGCGCGCTTCGTCGACGCCTTCCCGTTCGTGGCCCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTGTGGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGAATTGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTTGAGGCCCTGCGTCGTGCCAAGTTCAAATTCCCGGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTGGGTGGGGTACCGGTTCCGGTATGGGCACGCTTCTGATCTCCAAGATCCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCCCCAAGGTCTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCTGGATAA{CT}GAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACCACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGATCTCGTAAGCTGGCTGTAACCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTCCGGAGCTGACGCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGTGGACGCATGAGCACGAAGGAGGTGGAGAGCAGATGCTGAATGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGACATCCCGCCTAAGGGTCTGAAGATGTCCACGACGTTCATCGGTAACTCTACGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGATGAAATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTTCAGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACACGCTTTTATTATGGTATTCTTTTTAGTTATGCCTGCATTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCAGGAGCTGGTACTGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACTTTTATCAGGTATTTCTTCTTTATTAGGTGCTATCAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCATTATTTGTTTGGTATGTTTTAATTACAGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTCTATGATCCTTCTGGAGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCAGCAGGCCGAGATCGACCGTCATGGTTGAGACCCTTGACGGCACCCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACCGACAAGGTGAACTTGGATGGATTGCCGCTTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTGGACTTCAAGAACAACGCTCCCGATCGGAAAGATCCGCAACTGACGGAGGTGTACGAGGCTTCATTGCCAAGGCAGATCAGCAACATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACCCGAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACGCGTGTCAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGTCGATCACGGAGTCGATCGAGGCGTGACCATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACCGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGTGGACTCTGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCCGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGCGGCACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTTTACGTGAGAAGACCGAGGAGAAGGAGTGACTGAGACGAGGAAGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACTCGGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCGGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCGGAGAACCAGCCTGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCCTTATTGAGAAGCTTAAGAAGAAGGGTAGAGTGCTCTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCTAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTCCAGATCTCCAACCGTATGTGGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCCGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGCGACCACACCTAAAACGTCCACGTGACTGTGTCGATTGGGATCCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCTGTATCAGTGTCCGTACATGAAACTTGGCTTCCTTCCTTCGTGTAGTCGGTGGCGGGAACGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTGACGTGTGTTCTCTTTGCTGGAAAAGCGTTGTGGAGGCTGCGGCGAGTGCTGATGCGCGGAGAGCGGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTCTGAACTGGGTGGCTGCTGTCAATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCGAGTTTCGCGTGGCGAATTGTAGTCTATAGATGCGTGGTCAGCGTTGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTGGCGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATCGGCGAGTGTGTGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGCGTGTGCTTGCGTTGCTTGGTGGTGCCCTGTGTTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGCGAGTTGTGTCTCTGGATGGTGCTGTGCGGATAGCTTGCTATGCGTGTGGCGTTGTGTTTGGATTGGCGTGCGCTTTTGCTTGTTGCCGTTCGTGGAGGTCGTCGTCGCCCCCTCGCAGGTGCACGCCGCCACGGTCAAGTCCCAGCTGCGCGCCGACGTGCGCGTCAGGGCCAGGACGTCTGGCAGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAGATGCTCAAGGACTCGGCGCCGAGTAACCCTGGTGGGCCACTCGGAGCGTCGCGGAAGGGCGAGACAACGAGATCGTCGCAAGAAGGCGCTACGCCTGGAGAAGGGCCTCGGCGTCATGCCTGCATCGGCGAGTCAAGGAGACTCGCGAGGCAACGAAACTGCCTTCATCACGAAGCAGCTGACGCCTACGCCGCTGATCAACGACTGGACCAAGTGTATTGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCGCAGGAGGGCACGCCAGCATCCGTGCCTGGCTGAAGAACAAGGTGTCCCCGGAGGCTCGGAGAAGACCGGTATTACGGTGGCTCGTCGGCGCCAAGAACGCCCCGAGCTTTCGCAGAAGGAGGACATGATGGTTTCCTTGTGGCAGCCCGACTTCCTAAGATCATAACGCCCAAACCCACGGACAAGTTGGGGTGCGTGAAGTGCTATCAACGGATTTGGCCGTATTGGACGCTGGTGTCGTGCGCGCCAACCCGTGATCAACATTGTTGCCATAACGACCCTTCATTTCCACTACTACATGGATACATGCTTGAGTTCGACACGGTGCACGGCAGTTCCTGCCCCTGTATCCCACGAGAGAAGCACATTATTGTAGGAAAGCCATCCGGTGTTAAGAGATGAACCCGAGAACATCAAGTGGGAGAGGACAGTGCATAGTGGTCGAGTCACGGGGCCTTCAAACATGAGACGCCTCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGAACGACGCCCCGATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGTCGCAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCTCGTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCTATCAATCGCAGCGAGAACGAGATGAAGGGCATTCTCGGCTACACGAGAGAGGTGTTCTAGGACTTCATGGGACTCTCCTCGTCATTTGAGCAATGCGGAT Phytophthora_inundata TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACCTAGGGCGTCGTGGACACGTTCCCGTTCGTGGCTCACCTGTGTCCGACGAGAAGGAGCAGCTGTCTTCGAGGCTCTTGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTGTGCGTTGCCACCCTTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGCGCTGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTCGAATCGGCCAGCCATTATCTCGGTGCGTCAAAGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGACGTGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCTGACACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGTTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACACGTGCTGCGATTCCCCGGTCAGCTGAACTCGGATCTCGTAAGCTAGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACGTCCCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGTCACGGCCGTTATTTAACTGCAGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGAGAGCAAATGCTGAATGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCCAGCGTGTGTGACATTCCGCCCAAGGGACTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTATTGTTACAGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCAAGTGTACAGGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGGGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCGAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCGTGCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGATTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCTTGAAGTTAAAGAGATCATGAGAAGATGGACCGTCGTCGGGAAGATCTGGCGCTGTCCCCAGCGGAGCGTCTACGGGCGAGTTCGAGGCCCTCGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCCTTAAGCCGTGAAAACGTGAACGACATCTCGCCCCTGCTCTTATTGGCAGGACGTGACCAGCAGGCGGAGCTGGACCGTCATGGTGGAGCAGCTCGACGGCACTCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGTGTGTCCTTGCTCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTTGCGGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGCAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCCGTTGGCGACGAGGGTGGTTCGCCCCTAACATCCAGTCGAACGGTGAGGCCATCGACCTTATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCTTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGTCGGTGTACGAGGCTTTATCTCGAAGGCGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCTATTGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACTGAGGACACGTTCATCGCCGATGGCCGTGGGTCTGTCTGCTGGCCAGATCAAGACGGTGGACTCGGGTATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCTGGCGCTGACATCAGATGATGGTCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTGGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCGGCCGGTGGCTCGTTCACCGTGACGCCGACACGACGGAGCCATCTGCGTGGTACGCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAAGAGACGAGAAGGAGAGGACGACAAGCCCAAGGTCGAGACGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCTGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAATTAAGGCTGCTGTTCACCCTAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTCTCGTTCGTCAAGGGCGTTGTCGACTCGGAGGACTTGCCACTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTGAAGAAGTGCTCGAGATGTTTGCTGACTGCGAGGACAACGAGAAGTACCAGAAGTTTAGAGGCCTTCTCCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCCACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCTGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCGGTGGAGAACTCGCCGTTATCGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTCGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAAGATGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTGCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATTGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGATAGCTGTAGTATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGTGTGCGTGGCTGTGGCAGCGGCTTGGCTGCGGTGCGTGTGTGTGCTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCTAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGCGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAACTTGTCGCCGTTCGTTGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGC{CT}TCTCTGCGCGCCGATGTGCGCGTCAGGGCCAGGACGTGTGGACGCAGGGCAACGGCGCCTTCACGGGCGAGACTTCGGCTGAGATGCTCAAGGACTGGGCGCAGAGTAACGCTGGTTGGCCACAGTGAGCGCCGCGGAAGGGCGAGACAACGTCGACGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGGCGTTATGCCTGCATCGGCGAGTCAAGGAGACCCGCGAGGCAACGAGACTGCTTTCATCACCAAGCAGCTGACGCTTACGCTGCTGATTAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCTATTGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAAGGCACGCCAGCATCCGTGCATGGCTCAAGGAGAAGATTTCTCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTGGGCGCCAAGAACGCTCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCTGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTGGGGGCGCGTCAAGTGCCATCAACGGCTTCGGCCGCATTGGACGCTTGTGTCGTGCGCGCCAACCCGTGATCAACATCGTGGCCATAACGACCCTTCATTTCGACCACTACATGGATACATGCTTGAGTACGACACGGTGCACGGCAGTTGGCGGCTCGCTCTCGCACGAGAGAAGCACATCATCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCTGAGAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCAAACATGAGACGCCTCGGCTCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGGCCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGCCTGGCGCCCTGGCGAAGGTTGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACTCCGTACGCGTCGCAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCTAGCCTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCGGTCGTGGACTGACGGCTCGTTTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCCATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACAGGAGAGGCGTGTTCGAGGATTTCATGGGACTCGCCTCGTCATTTGAGCAACGCGGAT Phytophthora_ipomoeae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCTGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCTTCGTCGACGCCTTCCCCTTCGTGTGCCACTTGTGTCTGACGAGAAGGAGCAGCTTTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCGTTCCAGGTCCTGCGTATTAACAAAATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTCGCGCCCGTGTGGCATTGGTCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGACGTGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTTATGTGCTGGACAATGAGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCACTTATGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATTACACGTGCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCAGCTTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCCAAGGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAGTTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACGGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCGGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTATGATCCATCAGGTGGAGGTGATCCCGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGTAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATTACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCGAGCGGAGCCTCCACGGGCGAATTTGAGGCCCTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCTGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTATCGGCAGGACGTGACGAGCAGGCCGAGATCGACCGTCATGGTGGAGAAGCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAGCTGGGGCCAACGCGATCTGGGTGTGTCCTTGCTCTGTGCCGTGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCACACATGCCGACCTGGCCGGCAACCCGACCCCATGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGTGCTAAAACTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGTCGCTACGGCCTGGAGCCACTGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCGGATCGGAAAGATCCGCAACTGCTGGAGGTGTACGAGGCTTCATCGCCAAGGTGTATCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGATGACTGGGAGTCGTGGTGAAATACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAATGCTTCTGCTGAAGGTGAACCAGATTGGAGCATTACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGGCATTATGCCAGCCACCGTAGGGTGAGACAGAGGACACGTTCATCGCTGATGGCTGTGGGTCTGAGTGCCGGCCAGATCAAGACGGCGGACTCTGGTATTGGTATGACGAAGGCTGACTGATTAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCTGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCTGGCGGCTCGTTCACTGTCACGCCGACACGTCGGAGCCATCAGCGTGGTACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAAGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAAGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCTGAAGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACGAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTTTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTCTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACTTGCCGCTAACATCTCGCGTGAGACGCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTCGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGTCGTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAAGTGACGTCCTGGAGACTACATCTCGCGTATGCCTGAGAGCCAGCCTGGTATCTACTACGTGACTGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCATTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACGGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAAGGACTGTGCAAGCTCATGAAGGAGGTGCTGGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCCTGTGTGCTGTTACCGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTTTCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACAATAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCCAAAAGTGTTGTGGACGCTGCGGCGACTGCTGCGGCGTGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCATGGCTCCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCTGTGTCTCTGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTGCCGTTCGTGGAGGTCGTTGTGGCCCCTTCGCAGGTGCACGCCGCTACCGTCAAGGCTTCGCTGCGCTCCGACGTGCGTGTCAGGGCCAGGACGTCTGGAAGCAAGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAAATGCTCAAGGACTGGGCGCTGAGTAACTCTTGTAGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTAGCAAGAAGGCGCTACGCCTCGAAAAGGGCCTGGGCGTTATGCTTGCATCGGTGAGACAAGGACCACCGCGAAGCAACCAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATTAATGACTGGACCAAGTGTATTGCATACGAACCCATCTGGGCCATCGGTACGGCTTACGCCTCGCCTGACAGGCTCAGGAGGGCACGCCAGCATTCGTGCCTGGCTCAAGGAGAAGGTGTCTCCTGAGGCGCAGAGCAGACCGGTATTACGGTGGATCGTCGGCGCGAAGAACGCCCCGAGCTCTCGCAGAAGGAAGACATGACGGCTTCCTGGTGGTAGCCCGACTTCCTCAGATTATAACGCTCAAACCCACGGCCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGTCGTATTGGCCGCTTGTGTCGTGCGCGCTAACCCGTCATCAACATCGTTGCCATAACGACCGTTCGTTTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCTCACTATCGCATGAGAGACGCACATCTTTGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCCGAGAATATTAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACTTGAGAAGCGTCGACCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCACCGTCCAGTGACGCCCCCATGTTCGTGATGGGGTGAATCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAATGCTCGTGCACGACAAACTGCCTGGCCCCCTGGCTAAGGTGGTGAACGACAAGTTTGGCATAGGAAGGCCTCATGACGACGTCCACGCTGTACGCCACGCAGAAGACGTTGACGGTCCTTCCAAGAAGGACTGGCGGGTGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGTAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGATGTGTCTGTGGTGGACTGACGGCTCGTCTGTGAACCCTGCTTCTACGAGAGATTAAGGCGCCATTAATCGCAGTGAGAACGAGATGAAGGGCATTCTCGGCTACACGAGAGGCGTGTTCGAGGACTTTATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_iranica TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATTCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCTTTCCCGTTCGTGGCCCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCATTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTTGCGCCCGTGTGGCATTGGCCAGCCATCATTTCTGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCTGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAATGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTAAAGCTCACCACCCCACGTACGGCGACCTAAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCTGGTCAGTTAAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCCAAGGGTCTGAAGATGAGCACCACGTTCATTGGTAACTCTACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAAGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGGACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACCCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTTTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGTGCCTCCACGGGCGAATTCGAGGCCCTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTATCGGTAGGACGTGACGAGCAGGCCGAGATCGACCGTCATGGTGGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGCGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCACACATGCTGACCTGGCCGGAAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGTTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCTTCCTGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAAGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCGTCGGAATTCTACACTGGAAGAGCTCGCTACAACCTTGACTTCAAGAAAAATGCTGCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGTTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACAGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGCAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCGGGCTGGGGCATTATGCCAGCCACCGTAGGGTGAGACGGAGGACACGTTCATTGCCGATGGCTGTTGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCTGGTATTGGTATGACGAAGGCGGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGCGCCGACATCAGATGATGGTCAATTCGGTGTGGGTTTTACTCTGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCTGGTGGCTCGTTCACAGTGACCCCGACACGTCGGAGCCATCAGCGTGGTACGCGATGTGCTGAAGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGTTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGATGAGGAAGAGGAGAGAAGGAAGGGACGATAAGCCCAAGGTGGAGGAGTCGAAGGCGAGAAGAAGAAGAAGACGAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAAGAGTACGCTCTTCTACAAGTCGCTGACGAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTTTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTCTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTATCTGTCGTTCGTCAAGGGCGTGGTCGACTCGGAGGACCTGCCGCTAACATTTCGCGTGAGACGCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTCGAGATGTTCGCTGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTACGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCTGAGAACCAGCCCGGTATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAACTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACGGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAAGGACTGTGCAAGCTCATGAAGGAGGTGCTGGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCGCCCTGTGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCGCTGCGTGACCACACCTAAATATTCCACGTGACCGTTTCAATGGGGAACCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGTCAGATATGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCCAAAAGTGTTGTGGAGGCTGTGGCGACTGCTGCGGCGTGGAAGAATGCTTGATTCGCGGTATGATTGGCTTCGGCTGAGCTTATTGTGAACCATAGCTCCTTGGCTTTGAATTGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGTGGGCACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTATCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTATGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAGGTCGTCGTGGCCCCATCGCAAGTGCACGTCGCCACCGTCAAGGCCTCGCTACGCTCCGACGTGCGTGTCAGGGTCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGTGAGACCTCGGCCGAGATGCTCAAAGACTGGGTGCTGAGTAACACTTGTGGGCCACAGCGAGCGCCGTGAAAGGGCGAAACAACGAGATTGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGAATCTCCGTGAAGCAACCAGACTGCGTACATCACGGAGCAGCTCATGCCTACGCTGCCGATTAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCTTCGCCTGACAGGCTCAGGAGGGCACGCCAGCATCCGTGCTTGGCTCAAGGAGAAGGTGTCCCCTGACGCGCTGAGAAGACCGGTATTACGGTGGCTCGTCGGCGCTAAGAACGCTCCGAGCTCTCGCAGAAAGAAGACATGACGGCTTTCTGGTGGTAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGTCGTATCGGTCGCTTGTGTCGTGCGCGCCAACCCGTCATCAACATCGTTGCTATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTACACGGCAGTTGATGGCTCGCTCTCGCACGAGAGAAGCACATTCTCGTAGGCAAGCCATTCGGTGTTAAGAGATGAACCTGAGAATATCAAGTGGGCGAGGACAGTGCATAGTTGTGGAATCACGGGGCCTTCACACCTGAGAAGCATCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCCAGCGACGCCCCTATGTTCGTGATGGGGTGAACCACGAGTTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCTTGGCCAAGGTGGTGAACGACAAATTCGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTTGACGGTCCGTCCAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCGAGTCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTTCCGACGCGATGTGTCTGTGGTGGACTGACTGCTCGTTTGTGAACCCGGCTTCTACGAGAGATCAAGGCGCTATTAATCGCAGTGAGAACGAGATGAAGGGCATCCTTGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_katsurae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCCAAGATCCGCATCTACGATGTCGGTAACAGAAGGCCTCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTGTTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCCGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGTAAGGAGGCTGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGCACGCTTCTTATTTCCAAGATCCGCGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCGACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAATCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTTACGGTCCCGAGCTGACCCAGCAGCAATTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATTGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCATCATTATTAGGTGCTATTAACTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTGCCGAGCGGAGCGTCCACGGGCGAGTTCGAGGCCCTGGAAATGCGGAGGGGGCGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCGTGGGCAGGACGTGACCCGCAGGCCGAGCTGGACCGTCATGGTGGAGACGCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCCCTGTGCCGTGGGGTGCCGCTGCCAAGAAGCAGCCTTGTGCATACATGCCGACCTGGCCGGTAACCCGACGCCATGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTTATGATCCTCCTGTGGGCGCCAGAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTTATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTCGGCGATGAGGGTGGTTCGCCCCCAACATCCAGTCGAACGGTGAGGCTATTGATCTCATTGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCTGCTTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGAGAAGGCGCGACAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGATTAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGTTGAAGGTGAACCAGATCGGAGCATCACGGAGTCCATCGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCGGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCGGGTATCGGTATGACGAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCCGGCGGCTCGTTCACCGTGACGCCGACACGTCGGAGCCATCAGCGTGGTACCCGATGTGCTCAAGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAAGAGAGAAGGAGGGGATGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAAAAGAAGAAGAAGACGAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCCCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCTGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATTTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAAAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTAACAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTCCTCTTTGCTCAAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGCGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGTACCGTAGCTACTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGACGCTCATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGACGTGGTTGTGGCTCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTCAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTTACGCTCGTGGGCCACAGCGAGCGTCGCGAAAGGGTGAGACAATGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGCCTCGGCGTCATGCCTGCATTGGTGAGACAAAGAGACCCGCGAGGCAACCAGACTGCTTACATCACGGAGCAGCTCACGCCTACGCTGCTAATCAAGGACTGGACCAAGTGTATTGCCTACGAGCCCATCTGGGCTATCGGAACGGCTCACGCCTCGCCCGACAGGCGCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAACGAGAAGGTGTCCCCGGAGGCGCTGACAAAACCGGTATTACGGCGGCTCGTCGGTGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGTAGCCCGACTTCCTCAAATCATAACGCTCAAACCCACGGCGAAGTGGGGGCGCGTGAAGTGCCATTAACGGTTTTGGTCGTATCGGTCGCTGGTGTCGTGCGCGCTAACCCGTCATCAACATTGTCGCAATAATGACCGTTCATCTCGACGACTACATGGATACATGCTCGAATACGACACGGTGCACGGCAGTTGCTGGCTCGCTCTCTCACGAGACAAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGTGAGCACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCCTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCCCCCATGTTCGTGATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTAGCTCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGAGGCCGCGGCGCCTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCTAGCTTGAACGGCAAGCTGACAGGCATGTCTTCCGTGTTCCGACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCTATCAATCGCAGCGAGAATGAGATGAAGGGCATCCTTGGTTACACGAGAGGCGTGTTCCAGGACTTCATGGGACTCGCTTCGTCATTTGAGCGAAGCGGAT Phytophthora_kernoviae TACCGTTTCCAGAACAAGAAGCCCTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACTCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACACGTTCCCGTTCGTTTGTCACTTGTGTCTGACGAGAAGGAGCAGCTCTCCTCGAAGCTCTTGAAGCGCCGTGTTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTATCCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAAATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTGGACGTGTCCGTAAGGAGGCCGAGTCCTGCGATTGCCTGCAGGGTTTCCAGATTACCCACTCCCTTGGTGGGGTACCGGTTCCGGTATGGGAACGCTTCTAATCTCCAAGATTCGTGAGAGTACCCAGACCGTATCATGTGCACGTACTCGGTGTGCCGTCCCCAAGGTGTCGGACACTGTGGTGGAGCCTTACAACGCGACACTTTCCGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACACTCAAGCTCACGACCCCACCTATGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCTGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTCAACTCTGACCTCGTAAGCTGGCTGTAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGATCGCAGCAGTATCGCGCCCTGACGGTCCGGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCTCGTCATGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGGATGAGCACGAAGGAGGTGGAGAGCAGATGTTGAACGTGCAGAACAAGAACTCTTCATACTTCGTGGAGTGGATCCCGAACAACATCAAGGCTAGTGTGTGTGATATCCCGCCTAAGGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTTCTGGTATTGTTGGTACAACATTTTCACTTTTAATTCGTATGGAATTATCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTCTTAGTTATGCCTGCTTTAATTGGTGGCTTTGGTAATTGGTTTATTCCTTTAATGATAGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCATCAGCTTTAGTTGAATCAGGTGCGGGTACAGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCGGTAGATTTAGCTATTTTTAGTTTACATTTATCCGGAATGTCTTCACTGTTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATTTTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCATTTTATGATCCTTCAGGCGGAGGTGATCCGGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTTTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCGTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTGCCTAGTGGAGCGTCAACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGTCGTACATGGGCAAGGGTGTTCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCCGCAGGCCGAGCTGGACAGTCATGGTGGAGATCCTGGACGGTACCCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCTAACGCGATTTGGGTGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAATTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGCAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCTACGGCTGTGGGTGACGAGGGCGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGGACAAGGTGAACTTGGATGGATTGCCGCTTCGGAGTTCTACACTGGGCGAGCCCGTTACAACCTGGACTTCAAGAAAAACGCCCCAGATCGGAAAGATCCGCAACTGACGGAGGTGTACGAAGCTTCATCGCCAAGGCAGATCAGCGACATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGATCAATTACGCGAAGGTGGCAATGATGTGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGCAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCCAAGAAGGCCGGTTGGGCCATCATGCTAGTCACCGTAGGGTGAGACAGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGTGCTGGTCAGATCAAGACGGTGGACTCTGGTATTGGTATGACGAAGGCGGACTCATTAACAACTAGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCTGCCTACTGGTTGCGAAAGGTGGTGTCCACTCGAAGCACAACGACGATGAGCAGTACGTGTGGGAGTCGCTGCTGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTGATGAAACTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGATGAAGAGGAGGAGACAAGGAGGAGAAGACGACAAGCCTAAGGTGGAGACGAAGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACAGCCAGAAACCTATCTGGATGCGCAAGCCTGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGTTGACCAAGACTGGGAGGAGCACGCGGCGTTAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCCCCGTTGATATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATTAAGCTGTATGTGCGCGCGTGTTCATCATGGACAACTGCGAGGATCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGTTAACATCTCGCGTGAGACTCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACGCGGAGAAGTACAACAAGTTTAGAGTCGTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCAACCAAGTCGGGGAGGAGGTGACGTCCTGGAGACTACATCTCGCGCATGCCGGAGAGCCAGCCGGGCATTTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCCCCGTTATTGAGAAGCTTAAGAAGAAGGGTAGAGTTCTGTTTATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTATGAGGGCAAGAAGCTATCTGGCACAAGGAGGGTCTGCCATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTGATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTCCAGATCTCGAACCGTATGTGGAGTCGCCGTGTGTGTTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTTAAAATGGGGATCCGATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCGTGTAGTCGGTGGAGGGAATGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTTACTGTTCTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGAGTGCTGAGGCGTGGAGAGGGGTTCGATTCGCGGTAGTGTTGGTTTCGGCCGAGCTTATTGTGTACCGTAGTAGCTTGGCTTTGAACGAAGTGGCTAACGAAATTTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGCGAGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACTGAGGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTATGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGTGCGTGTTTGCGTTGTTTGCTGGTGCCCTGTGCTATGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCTAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTCTGTGAACTCTCTGTGTGGTGCTGTGTGGATAGCTTGCTATGTGCGTGGTGCTGTGCGTGGATTGAGGTCTGCTGTAACTTGTTGCCGTTCGTGGAGGTCGTGGTGGCCCCCTCGCAGGTGCACGCTGCTACCGTCAAGGCCTCGCTGCGTTCTGACGTGCGCGTCAGGGCCAGGACGTCTGGAGCCAGGGCAATGGTGCCTTCACGGGCGAGACGTCCGCCGAGATGCTCAAGGACTGGGTGCCGAGTAACACTGGTGGGACACAGCGAGCGTCGCGAAAGGGAGAGACAACGAGGTTGTGGCAAGAAGGCGCTATGCCTGGAGAAGGGTCTTGCTGTCATGCCTGCATTGGCGAGTCAAGGAGACCCGCGAGTCAACCAGACTGCCTGGATCACCAAGCAGCTGACGCCTACGCCGCTAATCGACGACTGGACTAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCTTCGCCCGACAGGCTCAGGACGGCACGCTAGCATCCGTGCGTGGTTGAAGGAGAAGGTCTCTGCGGAGGCTCGGAGAAGACCGATATTACGGTGGATCGTTGGTGCAAATAACGCCCCGAGCTATCTCAGAAGACGGACATGACGGCTTCCTTGTGGCAGCCCGATTTCTTCATATCATAACGCCCAAACCCACGGACAAGTCGGGGAGCGTGAAGTGCTATCAACGGCTTTGGGCGTATCGGCCGCTTGTGTCGTGCGCGCCAACCCGTGATTAACATTGTGGCTATAACGACCGTTCATCTCGACAACTACATGGATACATGTTGGAGTACGACACGGTGCACGGCAGTTGATGGCTCGCTGTCGCATGAGAGCAGCACATCTTTGTAGGCAAACCATCCGGTGTTAAGAAATGGACCCGCGAACATCAAGTGGGAGAGGACAGTGCATAGTGGTCGAGTCACGGGGCCTTCACAAATGACAAGCCTCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGGGAGATGCCCCCATGTTTGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTAGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCGAAGGTGGTGCACGACAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCATGCTGTACGCTACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATTCCTCGTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGCTTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTTGTCGATTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCGATCAAGAGCAGTGAGAACGAGATGAAGGGCATTCTTGGTTACACGAGAGGCGTGTTCGAGGATTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_macrochlamydospora TACCGTTTCCAGAACAAGAAGCCGTTCATCAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCCTTCCCCTTCGTGGCCCACTTGTGTCCGACGAGAAGGAGCAGCTGTCTTCGAGGCTCTTGAGGCGCCGTGTTGCTGCTAACCGTTACCTGACCAAGTTGTGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCCTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCTCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGATCACCCACTCGCTGGGTGGGGCACTGGCTCCGGTATGGGCACGCTTCTGATCTCCAAGATCCGCGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTCTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAAGTCATGTGCTGGACAACGAGCTCTGTACGATATCTGCTTCCGTACGCTCAAGCTGACCACCCCACGTACGGCGACCTGAACCACCTCGTGTGCGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGCCAGCTCAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATTGGCTTCGCCCGCTCACGTCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGAGAGCAGATGCTGAACGTTCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGACTCAAGATGTCCACGACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGCATGGATGAGATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCAGGTATTGTTGGTACTACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTAATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTATATCCACCTTTATCAAGTGTTCAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCAATTAATTTCATATCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCAGGTGGGGGGGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTATCCAGTCCGCTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTGCTGAGGCTGACACTCAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCTAGCGGAGCCTCCACGGGCGAATTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAGAACGTGAACGAGATCTCGCTCCCGCTCTTGTCGGCAGGACGTGACGAGCAGGCCGAGATCGACCGTCATGGTGGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGCGGCGCCGCTGCCAAGAAGCAGCCCTGTGCACACATGCCGACCTGGCCGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCTGGAACAATTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGTGATGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGATCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCGGATCGGAAAGATTCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTATCAGCAAGATGTGTCCATTGAGGATCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTTCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCTAAGAAGGCCGGCTGGGGCATTATGCCAGCCACCGCAGGGTGAGACCGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGCATCGGCATGACCAAGGCGGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTGGCGAAAGGTGGTGTCCACTCCAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCTGCCGGCGGCTCGTTCACTGTCACGCCGACACGTCGGAGCCATCCCCGTGGCACTCGATGTCCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGATGAGGAGGAGGAGAGAAGGAGGAGGCGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTGAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCTAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTCTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTCATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACTCGGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCGGGGAGGAGATGACGTCCTTGAGACTACATCTCGCGCATGCCGGAGAACCAGCCGGGCATCTACTACGTCACTGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTCGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGAACAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGACGAGAGTGAGGACGAGAAGAAACGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTGCTCGACGACAAGGTGAGAAGGTGCAGATCTCGAACCGTATGTCGAGTCGCCGTGCGTCCTGTGACGGGGAGTACGGTGGTCCGCCAACATGGAGCGTATCATGAAGGCCCAGGCCCTGCGTGACCACACCTAAACTTTCCACGTGACCGTATTTTTGGGGATCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCCTTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCTGTATCAGTGTCCGTACATGAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTACCTGTTCTTCTCTTTGCCCGAAAAGCGTTGTGGAGGCTGCGGCGAGTGCTGAGGCGTGGGGAGAGGCTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGTACCGTAGCTGCTTGGCTTTGAACCGGGTGGGCGTCGCAAATTTGGGTAGTAACGGCGAGTGAAGCGGGAGGAGCTCAAGCTTAAAATCTCCGCGCCAGTTTGGCGTGGCGAATTGTAGTCTATGGACGCGTGGTCAGCGCGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTGATTCCTGGTGCTTGTGCGTACGACCCGTGGTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCTGCATATTTCATTGGCGGGCGTGTGCGTGTGTGGCTTTGGCAGTGGCTTGGCTGCGGTCTGTGCTTGCGTTGTCTGGCGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGGAATCTCTGTGTGGCGGTGTGCGGATAGCTTGCTATGCGTGTGCTGTTGTGCGTGGATTGAGGCCTGCTGTAGCTTGTTGCCGTTCGTCGAGGTCGTGGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCCAGCTGCGCTCGGACGTGCGCGTCAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCAGAGTTACCCTCGTGGGCCACTCGGAGCGTCGCGAAAGGGTGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGCCTCGGCGTCATGCCTGCATCGGCGAATCAAGGAGACCCGCGAGGCAATGAGACTGCCTTCATCACCAAGCAGCTGACGCCTACGCGGCCGATCAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCGTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGAACAAGGTGTCCCCTGAGGCGCCGAGAAGACCGGTATTACGGCGGATCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGATATGACGGGTTCCTCGTGGCAGCCCGACTTCCTAAGATCATAACGCGCAAACCCACCGAGAAGTCGGGGCGCGTCAAGTGCGATCAACGGCTTCGGCCGCATTGGCCGCTGGTGTCGTGCGCGCCAACCCGTGATCAACATTGTTGCCATAACGACCCTTCATCTCGACGACTACATGGATATATGCTCGAGTACGACACGGTGCACGGCAGTTGATGGCTCGGTGTCCCACGAGAGCAGCACGTTATTGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGCACAGTGCATAGTGGTCGAGTCACGGGGCTTTCAAACATGAGACGCCTCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCTGCCCCGTCCAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACCAGAAGGACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCTCGTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCCATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGAGGTGTTCCAGGACTTCATGGGACTCTCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_meadii TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCTTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAACAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTATCCGTTGCCACCCGTTCCAGGTCCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGATGTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGCTTCCAGATCACCCACTCGCTTGGTGGGGTACCGGTTCTGGTATGGGTACGCTTCTTATCTCGAAGATCCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACTGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCACCTACGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTCGTAAGTTGGCTGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTCCTGAGCTGACCCAGCAACAGTTTGATGCCAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCCAAGGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAATTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTATTGTTACTGCTCACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGGGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATATCATCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAATATGACGCTCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCGTCCACGGGCGAATTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCTGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACGAGCAGGCGGAGCTTGACCGTCATGGTGGAGCAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGTGTGTCCTGGCTCTGTGCCGTGGGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATTCTCCTGTGGGTGCCACAGCTTCACGGAGTCGATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGTCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATGGCTGCTTCGGAGTTCTACACCGGGCGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAAGTGTACGAGGCTTCATCGCCAAGGCGTATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACGCGTGTGCAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCTGGTATTGGTATGACCAAGGCCGACTTATCAACAACTGGGACGATCGCCAAGTCTGGCACCAAGGCTTCATGGAGGCTTGGCTGCTGGTGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCTGCCTATTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGCGGCTCGTTCACTGTGACGCCGACACTTCGGAGCCATTTGCGTGGTACGCGATGTCCTGACGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATTGGTTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAAGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGATGGTGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGATATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTCATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATTTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTTGAGTCCCCGTGCGTGCTGTGACTGGGAGTACGGTGGTCCGCCAACATGGAGCGTATTATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAAGTTTTAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGATGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCGTGGAGGTTGTGGTTGCTCCTTCCCAGGTGCACGCAGCTACTGTCAAGGCTTCGCTACGTTCCGACGTGCGTGTGAGGGCCAGGACGTCTGGAAACAGGGAAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACTCTGGTGGGTCACAGTGAACGTCGTGAAAGGGTGAGACAATGAGGTCGTGGCAAGAAGGCGCTATGCCTTGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGGAGCTCCGTGAGGCAACAAGACTGCGTACATTACGGAACAGCTTACGCCTACGCAGCTGATCAAGGACTGGGCCAAGTGTATTGCGTACGAGCCTATTTGGGCCATTGGCACGGCTCACGCTTCGCCTGACAGGCCCAGGAGGGCATGCCAGCATCCGTGCGTGGTTGAAGGAGAAGGTCTCCCCTGAGGCGCTGAGAAGACCGGTATTACGGTGGCTCGTCGGTGCTAAGAACGCTCCGAACTGTCGCAGAAGGAAGACATGACGGCTTCCTGGTGGTAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGTATTGGTCGCTGGTGTCGCGCGCGCCAACCCGTCATCAACATTGTGGCCATAACGACCGTTCATCTCTACTACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCTGGCTCACTTTCCCACGAGAGAAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGGCCAATATCAAGTGGGTGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCTGCTCACTGCAGAATGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGTGACGCTCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTTTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCTACGCAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGCGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGTTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTTGTGGATTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGAATTCTTGGATACACGAGAGGCGTGTTCCAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGTGCGGAT Phytophthora_megakarya TACCGTTTCCAGAACAAGAAGCCCTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGACGTGGGTAACAGAAGGCTTCGTCGACGCCTTCCCCTTCGTGGCCCACTTGTGTCTGACGAGAAGGAGCAGCTGTCGTCGAGGCTCTGGAAGCGCCGTGTGGCTGCTAACCGTTACTTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTG{CT}GCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGCCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGTAAGGAGGCAGAGAGCTGTGACTGTCTGCAGGGTTTCCAGATCACACACTCGCTCGGTGGGGCACTGGTTCTGGTATGGGAACGCTCCTTATCTCGAAGATTCGTGAGAGTACCCCGATCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGATACCGTCGTGGAGCCGTACAACGCGACGCTGTCAGTGCACCAGCTGGTCGAAAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTATACGACATTTGCTTCCGTACACTGAAGCTCACGACTCCACGTACGGTGACTTGAACCACTTGGTGTGCGCTGCCATGTCTGGTATCACACGTGCTCCGTTTCCCGGGTCAGTTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCGCTGACTTCGCGTGGCTCGCAGCAGTACCGTGCCTTGACGGTCCTGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCTGCCGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCCAAGGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAAATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTAGGTACAACTTTATCTCTATTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAATTATATAATGTTGTAGTTACTGCTCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAGGCACACTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCTTCAGGTGGTGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTTTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCGAGCGGAGCGTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGAGTTCTGAAGCCGTGAAAACGTGAACGACATCTCGCGCCTGCTCTGGTGGGCAGGACGTGACCCGCAGGCCGAGCTGGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTGGCTCTGTGCCGTGGGGTGCCGCCGCGAAGAAGCAGCCTTGTGAATACATGCCGACCTGGCCGGCAACCCCACGCCGTGCCTCCCGTGCCGTCGTTCAACATCATCAACGGCGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGCGCCACAGCTTCACGGAGGCCATGCAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCCGTGGGTGACGAGGGTGGTTCGCGCCGAACATCCAGTCGAACGCTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGATACACGGACAAGGTGCGCTCGGATGGATTGCCGCGTCGGAGTTCTTCACTGGGAGAGCTCGTTACAACTTGGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGGAACAGCAAGATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGATCAATTACTGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTGTTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCTATCGAGGCGTGACGATGGCGAAGAAGGCTGGTTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCGGATGGCTGTGGGTCTGAGCGCTGGTCAGATTAAGACGGCGGACTCTGGTATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTTATGGAGGCGTGGCGGCCGGCGCCGACATCAGATGATGGCCAGTTTGGTGTGGGCTTTACTCGGCCTACTGGTTGCGAAAGGTCGTGTGCACTCTAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGCGGCTCGTTCACCGTCACGCCGACACGTCGGAGCCATTTGCGTGGTACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAACGCAAGCTCAAGGACTCGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTCACCGAGACGAGGAGGAAGAGAGAAGGAGGAGACGACAAGCCCAAGGTCGAGGAGTAGAAGGCGAGAAGAAGAAGAAGACGAAGAAAATCAAGGAGGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCTATCTGGATGCGCAAACCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCTGTCAAGCATTTCTCAGTGGAGGGCAGCTTGAGTTAAGGCTGCTCTTCACCCTAAGCGGCTCCGTTGACATGTTCGAAGGGGGCGAAGAAGAAATTAATAACATCAAGCTGTATGTGCGCGCGTGTTCATTATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTTGACTCGGAGGACCTGCCGCTAACATCTCACGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAAAAGTGTTCGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACGAAATGCCAAGCTTCTGCGTTACCACTCGACCAAGTCTGGGAAGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAATCAACCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCATTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGATGTTCATGGTTGAGGCTATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAAGAGACAGAGGACGAGAAGAATCGTTGAGGAGGCTAAGGCGCTACGAGGGCCTGTGCAAGCTCATGAAGGAAGTCCTAGATGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCGTGTGTGCTGTGACGGGGAGTACGGTGGTCGGCTAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACCTCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCGTGTAGTCGGTGGAGGATATGCCAGATGTGAGGTGTCTTGCGTGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGTGTTGTGGAGGCTGCGGCGACTGCTGTGGCGTGGAGGAGTGTTCGATTCGCGGTATGATTGGCTTCGGCTGAGCTTATTGTGAACCGTAGTTACTTGGCTTTGAATGTAGTGGCGACCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGTAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGACTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGACTTTAACTTGTTGCCGTTCGTGGAGGTGGTGGTGGCCCCGTCGCAGGTGCACGCCGCTACCGTTAAGGCTTCGCTGCGCGCCGACGTGCGCGTCAGGGCCAGGACGTGTGGAAGCAGGGAAACGGCGCCTTCACGGGTGAGACATCGGCCGAGATGCTCAAGGATTGGGTGCCGAGTAACGCTCGTGGGCCACAGTGAGCGTCGCGAAAAGGCGAAACAACGAAGTCGTGGCAAGAAGGCGCTACGCCTTGAGAAGGGCCTTGGTGTCATGCCTGCATTGGAGAGACAAGGAGCACCGCGAAGCAACCAGACTGCCCACATCACAGAGCAGCTCACGCTTACGCCGCTGATCAAGGACTGGACCAAGTGTATTGCGTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCCACGCCTGACAAGCTCAGGAAGACACGCCACCATACGTGCTTGGTTGAAGGAGAAGGTGTCTCCAGACGCGCTGATAAGACCGGTATTACGGTGGCTCGTTGGCGCCAAGAACGCTGCGAACTCTCGCAGAAGGAGGACATGATGGATTCCTTGTGGTAGCCTGACTTTCTCAGATCATAATGCACAAAACCACGGACAAGTGGGGGCGCGTGAAGTGCCATCAACGGTTTCGGTCGTATCGGTCGCTTGTGTCGCGCGCACCAACCCGTAATCAACATTGTTGCTATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAATACGATACGGTCCATGGCAGTTGCTGGATCGCTGTCCCACGAGAGAAGAACATCTTTGTAGGCAAGCGATCCGGTCTTAAGAGATGAACCGGCCAATATTAACTGGGCGAGGACAGTGCATAGTGGTCGAGTCACTGGGCGTTCACACACGAGAAGCGTCGGCGCACTGAAAAACGGTGGAAAGGTGTGATCTCGGCCCCATCGAGCGACGCCCCTATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGCCTGATGACAACGTGCACGCTGTACGCGACACAGAAGACGTTGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGTGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCTAGTTTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCGGTGGTTGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGTGATATCAAGGCGCTATTAATCGCAGTGAGAACGAGATGAAGGGCATCCTGGGTTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGAAGCGGAT Phytophthora_megasperma TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACCTCGTGCGTCGTGGACACGTTCCCGTTCGTGGCTCACCTGTGTCCGACGAGAAGGAGCAGCTGTCGTCGAGGCCCTCGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCGTGCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGTGCCGGCGCTGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAAGACTCGTTCGGCCCCTCGGTGTTGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTCGACGTGTCCGCAAGGAAGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGCGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCATCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACACGTGCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCTCGTCTCCACTTCTTCATGATCGGTTTCGCCCATTGACGTCGCGCGGCTCGCAGCAGTACCGTGCCTTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGCTATTTAACTGCCGCCTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATTAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGCCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACCTTATCACTTTTAATCCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTCCCACGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCGTTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCCGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCCTTTCTTTTATTATTAACATTACCCGTATTAGCTGGTGCCATTACCATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCTGGGGGGGGGGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTTCTGAGGCTGACCGTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTGCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGATTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCATGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGTGGAGCGTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGCGTCCTTAAGCTGTGAAAACGTGAACGACATCTCGCCCCCGCTCTTATCGGCAGGACGTGACCAGCAGGAGGAGCTCGACCGTCATGGTTGAGAAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGTGTGTCCTTGCTCTGTGCCGCGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTTGCCGGCAACCCGAGCCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTTATCGAGGAGGCCATCAAGACTGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGTCGGTGTACGAGGCTTCATCGCGAAGGCGGCTCAGCAAGATGTGTCTATTGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCTATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGTCTGCTGGCCAGATCAAGACGGTGGACTCGGGCATCGGCATGACGAAGGCCGACTCATTAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCGGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTGGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCGGCCGGCGGCTCGTTCACCGTGACGCCGACACGACGGAGCCATCTGCGCGGCACGCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAGGAGACGAGAAGGAGAGGACGACAAGCCCAAGGTGGAGACGAGGGCGAGAAGAAGAAGAAGACGAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTTAACAGCCAGAAGCCCATCTGGATGCGCAAGCCTGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACGAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATTAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGCGTGGTTGACTCGGAGGACCTGCCGCTAACATTTCGCGCGAGACGCTGCAGCAAACAAGATTCTCGCGTGATAAGAAAATCTGTGAAGAAGTGCTCGAGATGTTCGCCGACTGCGAGGACAATGAAAAGTACCAGAAGTTTAGAATCCTTCTCGAAGAATCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCGAAGCTGCTGCGCTACCACTCGACCAAGTCGGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAGCCAGCCTGGCATATACTATGTGACGGGGAGAGCAAGAAGGCGGTGGAGAACTCGCCATTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTACATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACGGAGGACGAGAAGAAGCGTTGAGGAGGCCAAGGCGCCACGAGGGTCTGTGCAAGCTCATGAAGGAGGTGCTGGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTCGAGTCGCCCTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCGCTGCGCGACCACACCTAAAACTTCCACGTGACCGTATCAATTGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGTGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCGCGAAAAGCGTTGTGGAGGCTGCGGCGATAGCTGTGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGTGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGCGGCATATTTCATTGGCGAGTGTGTGCGCGCGTGGCTGTGGCAGCGGCTTGGCTGCGGTGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTACCAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGCGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAAGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTCAGGGCCAGGACGTGTGGACGCAGGGCAACGGCGCCTTCACAGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGTGAGCGTCGCGGAAGGGCGAGACAACACCGACGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTTATGCCTGCATCGGCGAGTCAAGGAGACCCGCGAGGCAACGAGACTTCGTACATCACTAAGCAGCTGACGCCTACGCCGCTGATCAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCTATTGGCACGGCTCACGCCTCGCCCGACAGGCGCAGGACGGCACGCCAGCATCCGCGCCTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTGGGCGCCAAGAACGCCCCGAGCTGTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTGGGGGCGCGTCAAGTGCCATCAACGGCTTCGGCCGCATCGGCCGCTCGTGTCGTGCGCGCCAACCCGTCATCAACATTGTGGCCATAATGACCGTTCATCTCGACCACTACATGGATATATGCTCGAGTACGACACGGTGCACGGCAGTTGGCGGCTCGCTCTCGCACGAGAGAAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCCGAGAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCAAACATGAGACGCCTCGGCTCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGCCTGGCTCCCTGGCGAAGGTTGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGCTGACCGGCATGTCTTCCGTGTGCCCACGCGATGTGTCGGTTGTGGACTGACGGCTCGTCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCCATTAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCCAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_melonis TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCCTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTCGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTCGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCCGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTCGGTGGGGTACTGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCATCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACTACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTGCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCATCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTCGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAATGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGCGACGAGGGTGGTTCGCGCCCAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACGCCAAGGTGGCGAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGCGGACTCGGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATTGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCCGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACACCGACACGTCGGAGCCATCTGCGCGGTACCCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTTAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGATGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTCTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATTTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACCAGAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCTGTCGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGTTGCTTGCCTTTGAACCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTCGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTTCATCACGGAGCAGCTCACGCCTACGCGGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTGTCCCCCGAGGCGCTGAGAAGACCGATATTATGGCGGCTCGTCGGCGCCAAGAACGCCCCGAACTCTCGCAGAAGGCCGACATGACGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTGGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTCATCAACATTGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTATGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCAAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGCGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCTTCTACGAGAGATTAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_mexicana TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTGGACGCCTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTTGATGTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCATCGCCAAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCCACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTCCCGAGCTGACCCAACAACAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCCAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAATAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCGTCCACGGGTGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACGAGCAGGCGGAGCTTGACCGTCATGGTGGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTCGGGCCAACGCCATCTGGGTGTGTCCTGGCTCTGTGCCGTGGGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATTCTCCTGTGGGCGCCACAGCTTCACGGAGTCGATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGTTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCTATCAAGGCTGCGGGTACACGAACCAGGTGCGCTTGGATGGATGGCCGCTTCGGAGTTCTACACCGGGCGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCTCCGGATCAGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTTATCGCCAAGGCGTATCAGCAAGATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCTAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCGGGTATTGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTTGCTGCTGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCTGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGTGGCTCGTTCACTGTGACGCCGACACTTCGGAGCCATTTGCGTGGTACGCGATGTCCTGACCCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGATGGTGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGATGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTCGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATTAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTTTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCTACGAGGGTCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTTGAGTCCCCGTGCGTGCTGTGACTGGGAGTACGGTGGTCCGCCAACATGGAGCGTATTATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGAGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGGGTGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGGCTGTGGCGGTGGCTTGGCTGCGGCGTGTGTGTGTGATGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTTGTGGTGGCCCCCTCGCAAGTGCACGCAGCTACCGTCAAGGCTTCGCTGCGTTCTGACGTGCGTGTGAGGGTCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCTGAGTAACGCTGGTGGGCCACAGTGAGCGTCGCGAAAGGGCGAAACAATGAGGTCGTGGCAAGAAGGCGCTATGCCTTGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGGAGCTCCGTGAGGCAACCAGACTGCGTACATCACGGAACAGCTCACGCCTATGCGGCTGATCAAGGACTGGACCAAGTGTATTGCATACGAACCCATCTGGGCCATTGGAACGGCTCACGCCTCACCTGACAGGCTCAGGAGGGCACGCCAGCATCCGTGCGTGGCTCAAGGAGAAGGTCTCCTCTGACGCGCTCAGAAGACCGGTATTACGGCGGATCGTCGGTGCTAAGAACGCCCCGAACTCTCGCAGAAGGAGGACATGATGGCTTCCTGGTGGTAGCCTGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGTGCGTGAAGTGCCATCAACGGCTTCGGCCGTATTGGCCGCTGGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAATGACCGTTCATCTCCACCACTACATGGATACATGCTCGAGTACGACACGGTCCACGGTAGTTGCTGGCTCGCTTTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGGCTAATATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACTGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGATAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGAGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAATGGCAAGTTGACTGGCATGTCTTCCGCGTTCCTACGCGATGTGTCTGTTGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGAATTCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCACCTCTTCATTTGAGCGAGGCGGAT Phytophthora_multivesiculata TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTGGGTAACAGAAGGCTTCGTTGACGCGTTCCCCTTCGTGGCTCACCTGTGTCCGACGAGAAGGAGCAGCTGTCTTCGAGGCCCTTGAGGCGCCGTGTGGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCCTTCCAGGTTCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCTGATAGACTTCAGACCGGTATGCGTCACGCCTATGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATCCGCGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACCGTTGTGGAGCCCTACAATGCCACGTTGTCAGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCTGGATAATGAGCCCTGTACGACATTTGCTTCCGTACGCTTAAGCTCACCACCCCACCTACGGTGACCTGAATCACCTGGTGTGTGCCGCCATGTCTGGTATCACACGTGCTGCGTTTCCCTGGTCAGCTGAACTCGGATCTCGTAAGCTGGCCGTAATCTGATTCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCGCTGACATCGCGTGGCTCGCAGCAGTACCGTGCCCTCACGGTCCTGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAATTCGTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCTCCCAAGGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATAGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAGTTATCTCAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTTTTTCTAGTTATGCCTGCTTTAATTGGCGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTCCCTCGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACCTTACCTGTATTAGCTGGTGCAATTACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGAGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAATCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTACGGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGACATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTCGAGGAGCTCGACGGCACGCAAATGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGTGTGTCCTCGCCCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACAGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTTGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCTTCGGAGTTCTACACTGGAAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAAGCTTCATCGCTAAGGCGTGTCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGTAACGCTTTTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGTAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCGGGTATCGGTATGACCAAGGCCGACTCATTAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGTGCCGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACCGTGACGCCGACACGTCGGAGCCATTTGCGTGGTACGCGATGTCCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGAAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACCGAGACGACGAGGAAGAGAGAAGGAGGGGACGACAAGCCTAAGGTCGAGGAGTAGAGGGCGACAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACTCATGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCTGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGGTGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTTGCCCCAAGCGGCCCCCTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGTTGTACGTCCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCACTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTCATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCATTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTTACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTCGAAGCCATGATGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCTAAGGCGCCACGAGGGCTTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCGCCCTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGACGTCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGACTGCGGCGACTGCTACGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGTTTTGAATCGAGCGGCGGCCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGCGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAATGTTTGCGTGCGTGGCTATGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGATGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGCGGATTGATGCAGGCTTTAACTTGTCGCCGTTCGTGGAGGTTGTGGTGGCCCCCTCGCAGGTGCACGCTGCTACCGTCAAGGCCTCGCTGCGCCCTGACGTGCGCGTCAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACTTCCGCCGAGATGCTCAAGGACTGGGCGCTGAGTAACGTTGGTGGGCCACAGTGAGCGTCGTGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTTGAGAAGGGCCTGGGCGTCATGCCTGCATTGGTGAGACAAGAAGCACCGTGAGGCAACCAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCGGCCGATCAAGGACTGGACCGAGTGTATTGCCTATGAGCCCATCTGGGCCATTGGCACGGCTCACGCCTCGCCTGACAGGCTCAGGAGGGCACGCCAGCATCCGTTCCTGGCTCAAGGAGAAGGTCTCCCCTGAGGCGCCGAGAAGACCGGTATTACGGCGGATCGTCAGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAGCCCACGACCAAGTCGGGGTGCGTGAAGTGCCATCAACGGCTTCGGCCGTATTGGCCGCTTGTGTCGTGCGCGCCAATCCGTCATCAACATCGTTGCCATAACGACCGTTTATCTCGACCACTACATGGATACATGCTCAAGTACGACACCGTGCACGGCAGTTGCTGGCTCGCTTTCGCACGAGAGAAGCACATTTACGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCAAACATGAGACGCTTCGGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGAGTGACGCTCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAATGCTCGTGCACAACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACAACGTGCACGCCGTACGCTACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTTGTGGACTGACTGCTCGTCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCTATTAATCGCAGTGAGAACGAGATGAAGGGAATTCTCGGCTACACGAGAGGCGTGTTCAAGGACTTCATGGGATTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_multivora TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCCTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTCGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGATGTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACTCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACCGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCACCTACGGTGACCTGAACCATCTGGTGTGCGCCGCCATGTCTGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCGCTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTCCTGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCCAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTTTATTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACATTCTGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCTACTATTTATAATATGCGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCAGGAGGAGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGTGGAGCGTCGACGGGTGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAGAACGTGAACGAGATCTCGCTCCCGCTCTCGTGGGCAGGACGTGACGAGCAGGCGGAGCTTGACCGTCATGGTGGAGCAGCTTGATGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTGGCTCTGTGCCGTGGGGTGCTGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATTCTCCCGTGGGCGCCACAGCTTCTCGGAGTCGATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTTGGTGACGAGGGTGGTTCGCGCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGTTACACGAACCAGGTGCGCTTGGATGGATTGCCGCTTCGGAGTTCTACACTGGGCGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGCCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGCAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCTGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCAGTGGCTGTGGGTCTGAGCGCGGGCCAGATCAAGACGGTGGACTCGGGTATTGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCTGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCCGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCCGGTGGCTCGTTCACTGTGACGCCGACACGACGGAGCCATTTGCGTGGTACGCGATGTCCTGACGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTCGTGAAAAGCACTCGATTCATTGGTTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGATGAGGAGGAAGAGAGAAGGAGGGGATGACAAGCCCAAGGTCGAGGAGTAGACGGCGAGAAGAAGAAGAAAACCAAGAAGATCAAGGAGGTGACGCACGAGTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCTGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCTGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGTGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTCATAAGAAAACCTGTGAAGAAATGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCTACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTCGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACGGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGTCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTCGAGATCTCGAACCGTATGTTGAGTCTCCCTGCGTGCTGTTACTGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGATGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCGTGGAGGTCGTGGTGGCCCCCTCGCAGGTGCACGCGGCCACCGTCAAGGCCTCGCTGCGTGCCGACGTGCGCGTGAGGGACAGGACGTCTGGAAGCAGGGCAACGGCGCTTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACTCTGGTGGGCCACAGTGAGCGTCGCGAAAGGGCGAGACAACGAAGTCGTGGCAAGAAGGCGCTATGCCTTGAGAAGGGCCTTGGCGTCATGCCTGCATCGGTGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCGTACATCACGGAGCAGCTCACGCCTACGCGGCGGATCAAGGACTGGACCAAGTGTATTGCGTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCCTCGCCCGACAGGCTCAGGACGGCACGCCAGCATCCGCGCGTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCTGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAACTCTCGCAGAAGGAGGACATGATGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGTATTGGACGCTGGTGTCGTGCGCGCCAACCCGTCATCAACATCGTGGCCATAACGACCGTTCATCTCCACCACTACATGGATACATGCTCGAGTACGATACGGTCCACGGCAGTTGCTGGCTCGCTTTCCCACGAGAGAAGCACATCTTCGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGACGCGTCGACCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCGCCCATGTTTGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCTACACAGAAGACGTGGACGGTCCGTCCAAGAAGGACTGGCGGGCGGCCGTGGCGCCTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCTTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCCACGCGATGTTTCTGTTGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCGATTAATCGCAGCGAGAACGAGATGAAGGGCATTCTTGGCTACACGAGAGGCGTGTTCCAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGTGCGGAT Phytophthora_nemorosa TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGCGTGCCCGACCCGAAGATCCGCATCTACGATGTGGGCAACCCAAGGCGTCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGCATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGCGCCGATAGACTGCAGACCGGTATGCGTCACGCCTACGGCAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATCATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGTCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCACTGGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCTTGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCAGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCCTTAATGATTGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGAACAGGTTGGACAGTTTATCCACCTTTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTGGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCAGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGTAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGACGTCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGCGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCGAGCGGAGCGTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTTGTCGGCAGGACGTGACCAGCAGACCGAGCTTGACCGTCATGGTCGAGCAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGCGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGCAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCCGTCGGTGACGAGGGCGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGACCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCCTCGGAATTCTTCACCGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCTAAGGCGTATCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGTAAGGACGTGCAGATGTGGGAGACTTACGGTAACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCGAGCCACCGCAGGGCGAGACCGAGGACACGTTCATCGCCGATGGCTGTGGGCCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCGTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACCGTGACGCCGACACGACGGAGCCATCTGCGCGGCACGCGATGTCCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTTGAGGAGTAGACGGCGACAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTATGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCTGACTGCGAGGACAACGAGAAGTACATTAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAGCCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAGCTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAAATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTTCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACTGTATCGATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCGTGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGTAGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAGCTTATTGTGAACCGTAGCTACTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGTTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCGTGGAGGTCGTGGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCGCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTCTGGCAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTCGGCGCGGAGTTACGCTGGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTGGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGGCGTCATGCCTGCATCGGAGAGACAAGGAGCACCGCGAGGCAACCAGACTGCCTACATCACCGAGCAGCTGACGCCTACGCCGCCGATCAAGGACTGGACCGAGTGTATTGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGCGAAGGTCTCCCCGGAGGAGCGGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATCGGCCGCTGGTGTCGCGCGCGCCAACCCGTCATTAACGTCGTGGCCATAACGACCGTTCATCTCGACCACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCGGGCTCGCTCTCGCACGAGAGCAGAACATCTACGTAGGCAAGCCATCCGGTGCAAAGAGATGAACCCGCGAACATCAAGTGGGCGAGCACAGTGCATAGTGGTCGAGTCACGGGGCTTTCACGCATGAGACGCCTCCGCTCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGAACGACGCCCCCATGTTTGTGATGGGGTGAACCACGAGCTGTACGAGAAGAGCATGCACGTGGTGTCAATGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCCATTAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_nicotianae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTCGACGCCTTCCCGTTCGTTGCTCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTGTTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTTGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGTAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTATCCCGACCGTATCATGTGCACATACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTTACCACTCCACCTACGGTGACCTGAACCACCTCGTGTGTGCCGCCATGTCTGGTATCACACGTGCTGCGATTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCTGCTTGTATGTTCCGTGGACGTATGAGCACAAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCCAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCTAGCGGAGCCTCCACGGGCGAATTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAGAACGTGAACGAGATCTCGCTCCCGCTCTTGTCGGCAGGACGTGACGAGCAGGCCGAGATCGACCGTCATGGTGGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGCGGCGCCGCTGCCAAGAAGCAGCCCTGTGCACACATGCCGACCTGGCCGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCTGGAACAATTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGTGATGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGATCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCGGATCGGAAAGATTCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTATCAGCAAGATGTGTCCATTGAGGATCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTTCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCTAAGAAGGCCGGCTGGGGCATTATGCCAGCCACCGCAGGGTGAGACCGAGGACACGTTCATCGCCAGTGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCTGGTATTGGTATGACGAAGGCTGACTCATTAACAACTGGGACGATCGCCAAGTCGGGCACAAAGGCTTCATGGAGGCTTGGCTGCCGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCTGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACCGTCACGCCGACACGTCGGAGCCATTCTCGTGGTACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAAGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTTGAGGAGTCGAAGGAGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACTAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAATTAAGGCTGTTGTTCACCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTCTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTGGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACGCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTCGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACGAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACTAAGTCTGGGAGGAGATGACTTCCTGGAGACTACATCTCGCGTATGCCGGAGAACCAGCCCGGTATCTACTACGTGACCGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGATGAGAAGAATCGTTGAGGAGGCTAAGGCGCTACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCGCCCTGCGTCCTGTGACGGGGAGTACGGTGGTCGGCTAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACATAAAACTTCCACGTGACCGTTTCAATGGGGATCCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGTCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGAACTTCTCTTTGCTCGAAAAGTGTTGTGAAGGCTGCGGCGACTGCTGCGGCATGGAAGAGTGTTCGATTCGTGGTATGGTTGGCTTCGGCTGAACTTATTGTGAACCATAGCTCCTTGGCTTTGAATTGGGTGGCAGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGCGAGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACTGAGGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTATGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGTGCGTGTTTGCGTTGTTTGCTGGTGCCCTGTGCTATGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCTAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTCTGTGAACTCTCTGTGTGGTGCTGTGTGGATAGCTTGCTATGTGCGTGGTGCTGTGCGTGGATTGAGGTCTGCTGTAACTTGTTGCCGTTCGTGGAGGTGGTCGTGGCGCCGTCGCAGGTGCACGCTGCCACCGTCAAGGCCTCACTGCGCGCCGACGTGCGTGTCAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAGATGCTCAAGGACTGGGTGCTGAGTAACACTCGTGGGCCACAGTGAGCGCCGCGAAAGGGCGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTTGAGAAGGGGCTTGGCGTCATGCCTGCATCGGTGAGACAAGGAGCACCGTGAAGCAACCAGACTACCTACATCACGGAGCAGCTCACGCTTACGCCGCCGATCAAGGACTGGACCAAGTGTATTGCTTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCCCCTGACAGGCTCAGGAGGACACGCCAGCATCCGTGCTTGGCTTAAGGAGAAGGTGTCGCCCGATGCGCTGACAAGACCGGTATTACGGTGGCTCGTTGGCGCTAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTGGTGGCAGCCTGACTTCCTCACATCATAACGCCCAAACCCACGACCAAGTCGGGGTGCGTGAAGTGCTATCAACGGCTTCGGCCGTATCGGTCGCTGGTGTCGTGCGCGCCAACCCGTCATCAACATCGTTGCTATAATGACCGTTCATTTCGACTACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGATGGCTCGCTCTCGCACGAGAGAAGCACATCTTCGTAGGCAAGCCATTCGGTGTTAAGAGATGAACCTGCCAACATCAAGTGGGAGAGGACAGTGCATAGTGGTGGAATCACGGGGCCTTTACACCTGAGAAGCATCGGCTCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTTTGGCTCCTTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTTGACGGTCCGTCCAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCGAGTCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGATGTGTCTGTGGTGGATTGACTGCTCGTCTGTGAACCCCGCCTCTACGAGAGATCAAGGCGCTATTAATCGCAGCGAGAACGAGATGAAGGGAATTCTCGGCTACACGAGAGGCGTGTTCGAGGATTTCATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_niederhauserii TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCCTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTCTCCTCGAGGCCCTCGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTCGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCCCTGCGTCGTGCCAAGTTCAAATTCCCCGGCCGCCAGAAAGTGCTGGGATTGACTCGTGCTAGACGTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTCCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATAGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTGCTCAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCATCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTGGAGCAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTGGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGCGACGAGGGTGGTTCGCGCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATCGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGGGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACGCCAAGGTGGCGAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCTGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGCGGACTCGGGCATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCCGCCTACTCGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGCGGTACCCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACCGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTCTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTCTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACCAGAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCCGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTGGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTTCATCACGGAGCAGCTCACGCCTACGCGGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTGTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTGATCAACATCGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGCGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_palmivora TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGTATCTACGATGTGGGTAACAGAAGGCTTCGTCGACGCCTTCCCGTTCGTGGCCCACTTGTGTCCGACGAGAAGGAGCAGCTGTCTTCGAGGCTCTTGAAGCGCCGTGTTGCTGCTAACCGTTACTTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTTGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTCCTGGATGTGTCCGTAAGGAGGCAGAGAGCTGTGACTGTCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATTTCTAAGATTCGTGAGAGTATCCCGATCGTATCATGTGCACGTACTCGGTGTGCCATCGCCAAGGTGTCGGACACCGTCGTGGAGCCTTACAACGCTACGCTGTCGGTCCACCAGCTCGTCGAGAACGCTGATGAAGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGTGACTTGAACCACCTGGTGTGTGCTGCCATGTCCGGCATCACACGTGCTTCGTTTCCCAGGTCAATTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCGCTGACTTCTCGTGGCTCACAGCAGTACCGTGCTCTGACGGTCCTGAGCTGACCCAACAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTCGAGAGCAGATGCTCAATGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCCAAGGGTCTGAAGATGAGCACCACGTTCATTGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTATCCGAACAGTTCACAGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTTCCCAGCGGAGCCTCTACTGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCTGCTCTTGTGGGCAGGATGTGACCCGCAGGCTGAGCTGGACCGTCATGGTGGAGACCCTGGACGGCACGCAAACGAGTGGGGTTGGTGCAAGAAGAAACTGGGGCCAATGCCATCTGGGTGTGTCCTGGCTCTGTGCCGTGGGGCGCTGCCGCGAAGAAGCAGCCTTGTGCATACATGCGGACCTGGCCGGTAACCCTACGCCGTGCTTGCCGTGCCGTCCTTCAACATCATCAACGGTGGTTCCACGCCGGAACAACTGGCGATGCAGGAGTTCATGATTCTCCTGTGGGCGCTACAGCTTCACGGAGGCCATGCAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATTAAGGGCCGCTACGGCCTGGAGCCACGGCTGTGGGCGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCTATCGACCTGATTGAGGAGGCCATCAAGGCTGCGGTTACACGAACCAGGTGCGCTCGGATGGATTGCTGCTTCGGAGTTCTACACTGGGCGAGCTCGTTACAACCTGGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGTTTCATTGCCAAGGCGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGATTAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGATTGACCGTGACAACCCACCCGTGTGAAGAAGGCATGAAAAGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCTATTGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCTGGTGGCTGTGGGTCTGAGCGCTGGTCAGATCAAGACGGCGGACTCGGGTATCGGTATGACGAAGGCGGACTCATTAACAACTGGGACGATCGCCAAGTCGGGTACCAAGGCTTCATGGAAGCTTGGCTGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTCGTGGCGAAAGGTTGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCTGCTGGCGGCTCGTTCACCGTCACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTCCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGATTGGTGAAAAGCACTCGATTCATTGGCTTCCCTATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAAGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTTGAGGAGTAGAGGGTGAAAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCGGAGGATGTGACACACGAGGAGTACGCTCTTCTACAAGTCGCTTACCAAGACTGGGAGGAGCACGCGCTGTTAAGCACTTCTCGGTGGAAGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCTCCCTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTTGTCAAGGGTGTTGTCGACTCGGAGGACTTGCCGCTAACATTTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACTTGTGAAGAAGTGCTGGAGATGTTCGCTGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCGGGGAGGAGATGACTTCCTGGAGACTACATTTCTCGCATGCCGGAGAACCAGCCAGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCATTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCTATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGTACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAAGCTAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTTGAGTCACCGTGTGTGCTGTGACGGGGAATACGGTGGTCGGCTAACATGGAACGTATCATGAAGGCACAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTAGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCGTGTAGTCGGTGGTGGATGTGCCAGATGTGAAGTGTCTTGCGTGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCCAAAAGCATTGTGGAGGCTGCGGCGACTGCTGTGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTACTTGGCTTTGAATTGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAAGTGGTTGTGGCTCCGTCGCAGGTCCACGCCGCCACAGTCAAGGCCTCGCTGCGCGCTGACGTGCGTGTGAGGGTCAGGATGTATGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAAATGCTCAAGGACTGGGTGCCGAGTAACCCTTGTGGGCCACAGCGAGCGCCGTGAAAGGGCGAGAGAACGAGATTGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTTGGCGTCATGCCTGCATTGGTGAGACAAGGAGCACCGTGAGGCAACCAGACTGCCTACATCACAGAGCAACTTATGCTTACGCTGCTAATCAAGGACTGGACCAAGTGTATTGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGACATGCCAGCATCCGTGCTTGGCTCAAGGAGAAGGTGTCCCCTGATGCGCTGACAAGACCGGTATTACGGCGGCTCGTAGGCGCCAAGAACGCTCCGAACTGTCGCAGAAGGAAGACATGATGGATTTCTTGTGGCAGCCTGACTTCCTCAGATCATAACGCACAAACCCACGGACAAGTGGGGGCGCGTAAAGTGCTATCAACGGCTTTGGCCGTATTGGTCGCTTGTGTCGCGCGCGCCAACCCGTCATCAACATTGTTGCTATAACGACCGTTCATTTCGACGACTACATGGATACATGCTTGAGTACGACACGGTCCACGGAAGTTGCCGGTTCGCTTTCCCACGAGAGAAACACATCATCGTAGGCAAGGCATCCGGTGTTAAGAGATGAACCTGCCAACATTAACTGGGCGAAGACAGTGCATAGTGGTCGAGTCACGGGGCCTTCACACACGAGAAGCTTCGGCTCACTGAAGAATGGTGGAAAGGTGTGATCTCTGCTCCGTCGAGCGACGCTCCCATGTTTGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCGAAGGTGGTGAATGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCTGTACGCTACACAGAAGACGTTGATGGTCCGTCTAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATTCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGTCTGAACGGCAAGTTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCCATTAATCGCAGCGAGAACGAGATGAAGGGCATTCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_porri TACCGTTTCCAGAACAAGAAGCCCTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCTGACCCCAAGATCCGCATTTACGATGTCGGTAACAGAAGGCGTCGTGGACCTTTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCTTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACTTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTATCCGTTGTCACCCGTTCCAGGTGTTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCTGATAGACTTCAGACCGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAAGACAACTTCGGCCCTTCGGTGTCGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAAAAAGTGCTGGGATTGACTCGTGTTGGATGTGTCCGCAAGGAGGCTGAGAGCTGCGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGGGTACTGGTTCCGGTATGGGAACGCTTTTGATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACATACTCCGTGTGCCGTCGCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCTGATGAAGTCATGTGCTTGATAACGAGCCTTGTACGACATTTGCTTCCGCACGCTTAAGCTCACCACCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGCATCACACTTGCTGCGTTTCCCGGGTCAGTTGAACTCGGACTTCGAAAGCTGGCCGTAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGACTGAAGATGAGTACAACATTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAAGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGCGCTTTTGCGGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTAGTAGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCCTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCGTTTCCCCGTATGAATAACATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCAATTGTTGAATCTGGTGCTGGTACTGGTTGGACGGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTTGATTTAGCAATTTTTAGTTTACATTTAACAGGAATTTCTTCATTGTTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGCTTACCTTTATTTGTATGGTCAATATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCGGGTGGAGGTGATCCGGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTTCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGATTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCCGGAAGGTCTGGCGCTGTCCCCAGTGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCTTGAAGCTGTCCGAACGTCAACGAGATCTCGCCCCCGCTCTTGTTGGCAGGACGTGACCAGCAGGCCGATCTCGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGTGTGTCCTCGCGCTGTGCCGCGCGGTGCTGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGTCTGCCGTGCCGTCGTTTAACATCATTAACGGTGGCTCCACGCTGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACAGAGGCCATGAAGATTGGTCGGAGGTGTACACAACTGAAGAAGGTGATTAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGAGACGAGGGTGGTTCGCCCCTAACATCCAGGCCAACGCCGAAGCCATCGATTTGATCGAAGAAGCCATTAAGGATGCGGCTACACCAAGCAGGTGCGCTTGGATGGATTGCCGCTTCGGAGTTCTACACCGGGAGAGCTCGCTACAATCTTGACTTCAAGAACGACGGCGCTGAACGGAAAGATCCGCAATTGTTGGAGATGTACGAGGCTTCATCTCGAAGGCGTATCAGCAAGATGTGTCGATTGAGGACCCGTTTGACCAGGACGACTGGGAGTCGTGGTGAAATACCGCAGGATGGAAAGGACGTGCAAATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAATGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACTATGGCCAAGAAGGCTGGCTGGGCTATCATGCCAGTCACCGTAGGGTGAGACGGAGGACACGTTCATTGCCGATGGCTGTGGGCCTGAGCGCCGGCCAGATTAAGACGGTGGACTCTGGTATCGGTATGACCAAGGCCGACTCATTAACAACTGGGACGATTGCAAAGTCTGGCACCAAGGCTTCATGGAGGCTTGGCTGCTGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTACACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCTGGCGGCTCGTTTACGGTCACGCCGACACGACCGAGCCATTTTCGTGGAACGCGATGTCCTTACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGTTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGATGACAAGCCCAAGGTCGAGGAGTAGACGGCGAGAAGAAGAAGAAGACGAAGAAGATTAAGGAGGTGACCCACGAGTGGGACCACTTAACAGCCAGAAGCCCATTTGGATGCGCAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACGAAGACTGGGAGGAACACGCGGTGTGAAGCACTTCTCGGTGGAGGGCAGCTTGAGTTAAGGCTGTTGTTCGCCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATTAAGCTGTATGTGCGCGTGTGTTCATTATGGACAACTGCGAAGACCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACCTACCGCTAACATTTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGTTGGAGATGTTTGCCGACTGTGAGGACAACGAAAAGTATAGCAAGTTTAGAGGCTTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACGAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGACGACGTCCTCGAGACTACATCTCGCGCATGCCTGAGACTCAGCCTGGCATTTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAGCTCGCCCTTATTGAGAAACTCAAGAAGAAGGGTAGAGTCATTTTCATGATTGATGCCATGACGAGTAGCGTCAGCAGTTAAGGAGTATGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAAGGTTTGTGCAAGCTTATGAAGGAGGTTCTGGACGACAAGGTGAGAAGGTTGAGATCTCGAACCGTATGTGGAGTCCCCGTGTGTGCTGTGACTGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCCCAGGCTCTTCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGAGCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAAACTGTATTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGTGTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGAGTGACGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCTGAGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATTGGCGAGTGTGTGCGTGTGTGGCTGTGGCAGCGGCTTAGCTGCGGTGTGCGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTTGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTTGTCGCCGTTCGTGGAGGTGGTCGTGGCTCCGTCGCAGGTGCACGCCGCCACCGTGAAGTCCGCTCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTCTGGCAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTCGGCGCCGAGTAACGCTTGTGGGTCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTGGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGTCTCGCCGTCATGCCTGCATTGGTGAGAGAAGGAAACCCGTGAGGCAACAAGACTGCTTACATCACGGAGCAGCTTACGCCTACGCTGCGGATTAAGGACTGGACCAAGTGTATCGCCTACGAACCTATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCGCAGGACGGCACGCCAGCATCCGTGCTTGGCTTAAGGAGAAGGTCTCTTCTGACGCGCCGAGAAGACCGGTATTACGGCGGCTCGTGGGTGCCATGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTTGTGGCAGCCCGACTTCCTCACATCATAACGCCCAAACCCACCGAGAAGTTGGGGCCCGTGAAGTGCCATCAACGGCTTCGGTCGCATCGGTCGCTTGTGTCGCGCGCGCCAACCCATCATCAACATTGTGGCGATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGGAATTGACGGCTCGCTCTCGCACGAGAGAAGCACATCTTTGTAGGTAAACCGTCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTCGAGTCACGGGGCCTTCACACCTGAGAAGCCTCAGCTCACTGCAGAATGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGTGACGCTCCTATGTTTGTCATGGGGTCAACCATGAACTGTATAAGAAGAACATGCACGTGGTGTCAATGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTGGATGGTCCGTCCAACAAGGATTGGCGGGTGGCCGTGGCGCTTGTTAACATTATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCGAGCCTGAACGGCAAGCTTACGGGTATGTCTTCCGTGTTCCCACGCGACGTATCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTATGAGAGATTAAGGCGCTATTAAGAGCAGTGAGAACGAGATGAAGGGCATCCTTGGTTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_primulae TACCGTTTCCAGAACAAGAAGCCCTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCTGACCCCAAGATCCGCATTTACGATGTCGGTAACAGAAGGCTTCGTGGACCTCTTCCCCTTCGTTGCTCACTTGTGTCCGACGAGAAGGAGCAGCTGTCATCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACTTGACCAAGTTGCGGAAGGAAACTTCCACATGCGTATCCGTTGTCACCCCTTCCAGGTGCTGCGTATTAACAAGATGCTTTCGTGCGCCGGTGCTGATAGACTTCAGACCGGTATGCGTCATGCCTACGGTAAGCCCGGTGTGGCGCTCGTGTGGCATTGGCCAGCCATTATTTCAGTTCGTCAAAGACAACTTCGGCCCTTCGGTGTTGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCGGAGAGCTGTGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGGGTACTGGTTCCGGTATGGGAACGCTTTTGATTTCCAAGATTCGTGAGAGTACCCAGACCGTATCATGTGCACATACTCTGTGTGCCGTCGCCAAAGTGTCAGACACAGTTGTGGAGCCCTACAACGCCACCCTCTCTGTACACCAGCTTGTCGAAAACGCTGATGAAGTCATGTGCTGGATAACGAGCCTTGTACGACATTTGCTTCCGTACGCTTAAGCTCACCACCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCTGCCATGTCCGGCATCACACGTGCTGCGTTTCCCTGGTCAGTTGAACTCGGACTTCGAAAGCTGGCTGTAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCTGAACTGACCCAACAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGCCGTTATTTAACTGCCGCGTGTATGTTCCGCGGGCGTATGAGTACGAAGGAAGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCAAGTGTGTGTGACATCCCGCCTAAGGGACTGAAGATGAGCACCACATTCATTGGTAACTCCACGCTATCCAAGAGATGTTCAAGCGTGTGTCTGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAAGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTAGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCCGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCAATTGTTGAATCCGGCGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATCTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGCTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGAGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTTCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGATTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCCGGAAGGTCTGGCGCTGTCCCCAGTGGAGCCTCCACGGGTGAGTTCGAGGCTCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCCTGAAGCTGTCCGAACGTAAATGAGATCTCGCCCCCGCTCTTGTCGGCAGGATGTGACCAGCAGGCCGAACTCGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCTAACGCCATCTGGGTGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCTTGTGCATACATGCCGATCTGGCCGGCAACCCGAGCCCCTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGATCCACGCTGGAACAACTGGCCATGCAGGAGTTTATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTATGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCCAACATCCAGGCCAACGCCGAAGCCATCGATTTGATCGAGGAAGCTATTAAGGATGCGGCTACACAAACCAGGTGCGCTTGGATGGATTGCCGCTTCGGAGTTCTACACCGGGAGAGCTCGCTACAACCTTGACTTTAAGAACGAGGGCGCTGATCGGAAAGATCCGCAACTGTTGGAGATGTACGAGGCTTCATCTCGAAAGCGTATCAGCAAGATGTGTCGATTGAGGACCCGTTTGACCAGGACGACTGGGAGTCGTGGTGAAATACGCCAAGATGGCAAGGACGTGCAAATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTAAAGGTGAACCAGATTGGAGCATCACCGAGTCGATCGAGGCGTGACTATGGCCAAGAAGGCTGGTTGGGCTATCATGCCAGCCACCGTAGGGTGAGACGGAGGACACGTTCATTGCCGATGGCCGTGGGCTTGAGCGCCGGCCAGATTAAGACGGTGGACTCTGGTATTGGTATGACCAAGGCCGACTTATTAACAACTGGGACGATTGCCAAGTCTGGTACCAAGGCTTTATGGAGGCTTGGCTGCTGGCGCTGACATCAGATGATGGACAGTTTGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCTGGCGGCTCGTTCACGGTCACGCCGACACGACTGAGCCATCTTCGCGGAACCCGATGTCCTTACGCTTAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGTTTCCCCATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAAGAGGAGGAGAGAAGGAAGGGATGACAAGCCTAAGGTTGAGGAGTGGACGGCGAGAAGAAGAAGAAGACCAAGAAGATTAAGGAGGTGACCCACGAATGGGACCACTTAACAGCCAGAAGCCCATTTGGATGCGCAAACCTGAAGATGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACTAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCAGTGGAGGGCAGCTTGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCGCCGTTGACATGTTTGAGGGGGGCCAAGAAGAAATTAACAACATTAAGCTGTATGTGCGCGTGTGTTCATTATGGACAACTGCGAGGACCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTTGCCGACTGCGAGGACAACGAGAAGTACAGCAAGTTTAGAGGCTTTCAGCAAGAACCTAAGTTGGGATCATGAGGACTCGACGAACCGACTAGATGCTAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGACGACGTCCTCGAGACTACATCTCGCGTATGCCTGAGACCCAGCCTGGTATCTACTATGTGACGGGGAGAGCAAGAAGTCGGTGGAGAGCTCACCGTTATTGAGAAGCTGAAGAAGAAGGGTAGAGTCATTTTCATGATTGACGCCATGATGAGTAGCGTCAGCAGTTAAGGAGTATGAGGGCAAGAAGCTATCTGGCACAAGGAAGGTCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAAGGATTGTGCAAGCTTATGAAGGAGGTCTTGGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTTGAGTCCCCGTGTGTGCTGTGACTGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCTCAAGCTTTGCGTGACCACACCTAAAACTCCCCCGTGACCGTATCAATGGGGAGCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAAACTGTATTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGTGTGGAGAAGTGTTTAATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGAGTGACGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCATGCAAGTTTTGTATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTTAGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCTGAGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGTGTGGCTGTGGCAGTGGCTTAGCTGCGGTGTGCGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTTGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTTGTCGCCGTTCGTGGAGGTGGTTGTGGCTCCTTCGCAGGTGCACGCCGCCACCGTTAAGTCCGCTCTGCGAGCTGATGTGCGCGTCAGGGCCAAGACGTCTGGCAGCAGGGCAACGGCGCTTTCACGGGCGAGACGTCAGCCGAGATGCTCAAGGACTCGGCGCCGAGTAACGCTTGTGGGTCACAGCGAGCGCCGTGAAAGGGCGAGACAACGAGGTGGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGCCGTCATGCATGCATTGGTGAGAGAAAGAAACCCGTGAGGCAACAAGACTGCTTACATCACGGAGCAGCTTACGCCTACGCTGCGGATTAAGGACTGGACCAAGTGTATCGCATACGAACCTATCTGGGCCATCGGCACGGCTCACGCCTCGCCTGACAGGCGCAAGATGGCACGCTAGCATCCGTGCTTGGCTTAAGGAGAAGGTCTCCTCTGACGCGCGGAGAAGACCGGTATTACGGCGGCTCGTGGGTGCCAAGAACGCCCCGAGCTCTCACAGAAGGAGGACATGACGGCTTCCTTGTGGTAACCCGACTTCCTCACATCATAACGCCCAAACCCACCGAGAAGTCGGGGCCCGTCAAGTGCCATCAACGGCTTCGGTCGTATCGGTCGCTTGTATCGCGCGCGCCAACCCATCATTAACATTGTGGCGATAACGACCGTTCATCTCGACGACTACATGGATACATGCTTGAGTACGACACGGTACACGGGAGTTGATGGTTCGCTCTCGCACGAGAGAAGCACATCTTTGTAGGTAAACCATCCGGTCTTAAGAGATGAACCGGCCAACATTAAGTGGGCGAGGACAGTGCATAGTTGTTGAGTCACGGGGCCTTCACACCTGAGAAGCTTCGACTCACTGCAGAATGGTCGAAAGGTGTGATTTCGGCTCCTTCCAGTGACGCTCCTATGTTTGTCATGGGGTCAACCAGGAACTGTATGAGAAGAATATGCACGTGGTGTCAATGCTCGTGCACAACGAACTGTCTGGCTCCCTAGCCAAGGTGGTGAACGACAAGTTTGGCATAGGAAGGTTTGATGACGACGTGCACGCTGTACGCCACACAGAAGACGTGGATGGTCCTTCCAACAAGGACTGGCGGGTGGTCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATTCCGAGCTTGAACGGCAAGCTTACGGGTATGTCTTCCGTGTTCCCACGCGACGTTTCTGTGGTGGACTGACTGCTCGTCTGTGAATCCTGCTTCTATGAGAGATTAAGGCGCTATTAAGAGCAGTGAAAACGAGATGAAGGGTATCCTTGGTTACACGAGAGGCGTGTTCTAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_pseudosyringae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCTGACCCGAAGATCCGCATCTACGATGTGGGTAACCCAAGGCATCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCGTCGAGGCCCTCGAGGCGCCGCATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGCGCCGATAGACTGCAGACCGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGTCGCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGCTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCATCGCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGACGAGGTCATGTGCTTGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCTATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCGGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACGGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACTGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACCATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTACGACCCTTCTGGTGGGGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGTAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGACGTCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGCGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCGAGCGGAGCGTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTTGTCGGCAGGACGTGACCAGCAGACCGAGCTTGACCGTCATGGTCGAGCAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGCGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGCAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCCGTCGGTGACGAGGGCGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGACCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCTGCCTCGGAGTTCTTCACCGGGAGAGCTCGCTACAACCTCGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTATCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAAGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGCGAGACCGAGGACACGTTCATCGCCGATGGCCGTGGGCCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCGTGGCCGCCGGCGCGGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCGGGCGGCTCGTTCACCGTGACGCCGACACGACGGAGCCATCTGCGCGGCACGCGATGTCCTGAAGCTCAAGGAGGACATGTTGAGTACCTGAGGAGCGTAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTAGAGGGTGACAAGAAGAAGAAGACCAAGAAGATTAAGGAGGTGACCCACGAATGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAACTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGTTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCTGACTGCGAGGACAACGAGAAGTACATTAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTATCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAGCCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCCGTGGAGAGCTCGCCCTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAAAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTTCTCGATGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACTGTATCGATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCGTGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGTGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAGCTTATTGTGAACCGTAGCTACTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGTTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCGTGGAGGTCGTGGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAGATGCTCAAGGACTCGGCGCCGAGTTACGCTGGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTGGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGGCGTCATGCCTGCATCGGAGAGACATGGAGCACCGCGAGGCAACCAGACTGCCTACATCACCGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGAGCGAGTGTATTGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCTTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGCGAAGGTCTCCCCCGAGGAGCGGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTTGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATCGGCCGCTGGTGTCGCGCGCGCCAACCCCTCATTAACGTCGTGGCCATAACGACCGTTCATCTCGACCACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCTGGCTCGCTCTCGCACGAGAGCAAAACATCTACGTAGGCAAGCCATCCGGTGCAAAGAGATGAACCCGCGAACATCAAGTGGGCGAGCACAGTGCATAGTGGTCGAGTCACGGGGCCTTCACGCATGAGACGCCTCCGCTCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCGAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCCATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_pseudotsugae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTTGGTAACAGAAGGCTTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAAGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTTCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTTGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCTAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAAGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGGGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATATACAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCTATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCTAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGAGCCTCCACGGGCGAATTCGAGGCTCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAGAACGTGAACGAGATCTCGCTCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCCGAGATCGACCGTCATGGTGGAGGAGCTTGATGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCACACATGCCGACCTGGCCGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCTGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCTGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCCGTTGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGATACACGGACAAGGTGCGCTTGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTGCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATTGCCAAGGCGTGTCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGATGACTGGGAGTCGTGGTGAAATACGGCAAGGTGGCAAAGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGGAATCATGCCAGCCACCGTAGGGAGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCGGGCCAGATCAAGACGGCGGACTCTGGTATTGGTATGACGAAGGCTGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCCGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACTGTGACGCCGACACGTCGGAGCCATCAGCGTGGTACGCGATGTGCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCAATAAGCTTTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAAGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTTGAGGAGTCGAAGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCCCCGTTGACATGTTTGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACTCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCTGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGTCGTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTTCTGCGTTACCACTCGACCAAGTCCGGGAGGAAGTGACGTCCTGGAGACTACATCTCGCGTATGCCCGAGAACCAGCCTGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGTCTGTGCAAGCTCATGAAGGAGGTTCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCCTGTGTGCTGTGACCGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTTTCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCCTTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAAGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCATAGCTCCTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTAATCCTGATGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGCTAGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAGGTCGTCGTGGCTCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCGCGCTGCGCTCCGACGTGCGCGTCAGGGCCAGGATGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCGGCCGAGATGCTCAAGGACTGGGTGCTGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGTGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGTCTCGCCGTCATGCCTGCATTGGTGAGACAAGGAGCTCCGCGAAGCAACCAGACTGCCTATATCACGGAGCAGCTCATGCTTACGCCGCCGATTAACGACTGGACCAAGTGTATTGCCTACGAGCCTATCTGGGCCATCGGCACGGCTCACGCCTCGCCTGACAGGCTCAGGAGGGCACGCCAGCATCCGTACCTGGCTCAAAGAGAAGGTGTCCCCCGAGGCGCTGACAAGACCGGTATTACGGTGGATCGTTGGTGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAAGACATGACGGTTTCCTGGTGGTAGCCCGACTTCCTCATATCATAACGCACAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATTGGTCGCTTGTGTCGCGCGCGCCAACCCGTCATCAACATCGTTGCCATAACGACCGTTCATCACGACGACTACATGGATACATGCTCGAGTACGACACGGTACACGGCAGTTGATGGCTCGCTCTCGCACGAGAGAAGCACATCTTTGTAGGCAAGCCATCCGGTGTTAAGAGATGAACCGGCCAACATCACGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCTTTCACACCTGAGAAGCCTCGGCTCACTGAAGAATGGTGGAAAGGTGTGATCTCGGCTCCGTCGAGCGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACCCAGAAGACGTTGACGGTCCGTCTAAGAAGGACTGGCGGGAGGCCGTGGCGCTTGTTAACATTATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCAAGCCTGAACGGCAAGCTCACGGGCATGTCTTCCGTGTGCCCACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCCTCTACGAGAGATCAAGGCGCCATTAATCGCAGCGAGAACGAGATGAAGGGCATTCTCGGCTACACGAGAGGCGTGTTCTAGGACTTTATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_psychrophila TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGCGTGCCCGACCCGAAGATCCGCATCTACGATGTGGGTAACCCAAGGCGTCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGCATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGCGCCGATAGACTGCAGACCGGTATGCGTCACGCCTACGGCAAGCCCGGTGTGGCGCCCGCGTGGCATTGGCCAGCCATCATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGTCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCTTGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGTATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCGGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTGTATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTTTTTCTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCATTAATGATTGGTGCACCCGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCAGGAACAGGTTGGACAGTTTATCCACCTTTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACGGCATTTCTTTTATTATTAACTTTACCAGTATTAGCGGGTGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAATATGACGCTCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGTAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGACGTCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGCGTGAACGGTGTATAAGCCGGCATGATCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCGAGCGGAGCGTCCACGGGCGAGCTTGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTTGTCGGCAGGACGTGACCAGCAGACCGAGCTTGACCGTCATGGTCGAGCAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTTGGGCTAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGCGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGTCGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTTATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGCAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCCGTTGGTGACGAGGGCGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGACCGCGGCTACACGAACCAGGTGCGCTTGGATGGATTGCCGCCTCGGAGTTCTTCACCGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTATCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCGAGCCACCGCAGGGCGAGACCGAGGACACGTTCATCGCCGATGGCTGTGGGCCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATTGCCAAGTCGGGCACCAAGGCTTCATGGAGGCGTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTTGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACCGTGACGCCGACACGACGGAGCCATCTGCGCGGCACGCGATGTCCTGAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGATGAGGAGGAAGAGAGAAGGAGGGGATGACAAGCCCAAGGTCGAGGAGTAGACGGCGACAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGATTGGGAGGAGCACGCGGCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTTGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCTGACTGCGAGGACAACGAGAAGTACATTAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGATCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAGCCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAGCTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTTCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACTGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCGTGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGTGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAGCTTATTGTGAACCGTAGCTACTTGGCTTTGAATCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGCGGTTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCGTGGAGGTCGTGGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCGCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTCTGGCAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCTGAGATGCTCAAGGACTCGGCGCCGAGTTACGCTGGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGATAACGAGGTGGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTCGGCGTCATGCCTGCATCGGAGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTACATCACCGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCGAGTGTATTGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGCGAAGGTCTCCCCGGAGGAGCGGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATCGGCCGCTGGTGTCGCGCGCGCCAACCCGTCATTAACGTCGTGGCCATAACGACCGTTCATCTCGACCACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCGGGCTCGCTCTCGCACGAGAGCAGAACATCTACGTAGGCAAGCCATCCGGTGCAAAGAGATGAACCCGCGAACATCAAGTGGGCGAGCACAGTGCATAGTGGTCGAGTCACGGGGCCTTCACGCATGAGACGCCTCCGCTCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAACGACGCCCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAAACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGTGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCCAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAGGCGCCATTAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_sansomea TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCCAAGATCCGCATCTACGATGTGGGTAACAGAAGGCTTCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCGGACGAGAAGGAGCAGCTGTCGTCGAGGCTCTCGAGGCGCCGTATCGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCCTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTCGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTCGTAAGCTGGCGGTAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGTGGACGTATGAGCACGAAGGAGGTCGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCGTCGACGGGCGAGTTCGAGGCCCTCGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTCAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCAGCAGGCCGAGCTGGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCTCTGTGCCGTGCGGTGCGGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAACAACGCGCCGGATCGGAAAGATCCGCAACTGCAGGAGATGTACGAGGCTTCATCTCGAAGGCGTCTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGTGGACTCGGGTATCGGTATGACGAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTCCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCTATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTCACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTGGAGGGCGAGAAGAAGAAAAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTTAACAGCCAGAAGCCCATCTGGATGCGCAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCTGTTAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCTGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTCGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTCCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGTCTGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGGGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGCGTGCGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTCGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTTGTCGCCGTTCGTCGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGACTCGCCGTCATGCCTGCATCGGAGAGAGAAGGAGACCCGCGAGGCAACGAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCCCCCGACAGGCGCAGGACGGCACGCCAGCATCCGTGCCTGGCTTAAGGAGAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGATCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACCGAGAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGCATCGGCCGCTTGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCGCGCTGTCGCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGTCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTCGAGTCACGGGGCTTTCACACCTGAGAAGCTTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCCGCCCCGTCCAGCGACGCCCCCATGTTCGTCATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACCAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCGATCAAGAGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_sinensis TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCCTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTCGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTCGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCCGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTCGGTGGGGTACTGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCATCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACTACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCTTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTGCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCATCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTCGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAATGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGCGACGAGGGTGGTTCGCGCCCAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACGCCAAGGTGGCGAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGCGGACTCGGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATTGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCCGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACACCGACACGTCGGAGCCATCTGCGCGGTACCCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTTAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGATGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTCTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATTTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCGGACTGCGAGGACAACGAGAAGTACCAGAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCTGTCGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGTTGCTTGGCTTTGAACCGAGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTCGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTTCATCACGGAGCAGCTCACGCCTACGCGGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTGTCCCCCGAGGCGCTGAGAAGACCGGTATTATGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTGGGGGCGCGTGAAGTGCTATCAACGGCTTCGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTCATCAACATTGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTATGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGCGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCTTCTACGAGAGATTAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCGTGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_sojae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCCTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTCGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCCCTGCGTCGTGCCAAGTTCAAATTCCCCGGCCGCCAGAAAGTGCTGGGATCGACTCGTTCTCGACGTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTCGTTGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACCCTGAAGCTCACGACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATTACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGCGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCATCTGGTGGGGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTTGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTGCTCAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCATCGGCAGGACGTGACCAGCAGGGTGAGCTTGACCGTCATGGTGGAGGAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTGGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGCGACGAGGGTGGTTCGCGCCGAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATCGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGGGTCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACGCCAAGGTGGCGAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCTGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGCGGACTCGGGCATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTTGGTGTGGGTTTTACTCCGCCTACTGGTGGCGAAAGGTCGTGTGCACTCCAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGCGGTACCCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCATGACTGGGACCACTGAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTCTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTCTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACCAGAAGTTTAGAGGCTTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACTAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTCACGGGGAGAGCAAGAAGGCCGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCCCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTTCATCACGGAGCAGCTCACGCCTACGCGGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTTACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTGTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTCGGTGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTGGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACGGACAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTTGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTGATCAACATTGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCAAGTACGACACGGTGCACGGCCCTTGGCGGCGAGATCTCGCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGCGGCCGTGGCGCGTGTTAACATTATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCTTCTACGAGAGATCAAGGCGCGATCAATCGCAGCGAGAACGAGATGCAGGGCATCCTCGGCTACACGAGACGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_sp._EL8701 TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCGTCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTGTCGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGTTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGCAAGGAGGCTGAGAGCTGCGACTGCTTGCAGGGTTTCCAGATCACCCACTCGCTCGGTGGGGTACCGGTTCCGGTATGGGCACGCTTCTTATTTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCGTACAACGCAACACTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTATGACATTTGCTTCCGTACGCTGAAGCTGACGACCCCACCTACGGTGACCTGAACCACCTAGTGTGTGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCGGGTCAGCTGAACTCCGACCTCGCAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCTCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCTGCCGACCCTCGCCACGGTCGCTATTTAACAGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTTGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACGCCATCCAGGAAATGTTCAAGCGTGTGTCCGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATAGTAGGTACTACTTTATCTCTTTTAATTAGAATTGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAATTATATAATGTTGTAGTTACTGCACACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTCTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCAATTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTATATCCACCTTTATCTAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATAAATTTTATATCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCGTCTGGGGGAGGTGATCCGGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCTCTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAACTGCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTGCCGAGCGGAGCGTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCTGCTCTTGTGGGCAGGACGTGACCAGCAGGCCGAGCTCGACCGTCATGGTGGAGACCCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCGGCGAAGAAGCAGCCCTGTGCATACATGCTGACCTGGCCGGCAATCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCCGCTTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCCGCCGATCAGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTTATCGCCAAGGCGTCTCAGCAAGATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGATTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGTAGGGTGAGACGGAGGACACGTTCATCGCTGATGGCTGTGGGTCTGAGCGCGGGCCAGATCAAAACGGTGGACTCGGGTATCGGCATGACCAAGGCCGACTCATCAACAACTCGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCCGCCGGCGCGGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCTGGCGGCTCGTTCACCGTCACGCCGACACGTCGGAGCCATCTGCGCGGCACGCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTCTACGTGAGAAGACCGAGGAGAAGGAGTCACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAAGAGTCGAGGGTGAGAAGAAGAAGAAGACTAAGAAGATTAAGGAGGTGACGCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTGAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTTTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTTTACGTGCGCGTGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTTAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCCGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCTTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCAACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTTCACGTGACCGTTGAGTTTGGGATCCGATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAAATGCCAGACGTGAAGTGTCTTGCGTGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGAGGAGGCGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACTGAGTGGCAGTCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGCGGCATGGCTGCGGCGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAGGTGGTCGTGGCGCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCCGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGCCTCGGCGTCATGCCTGCATCGGCGAGACAAGGAGCACCGTGAGTCAACCAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGAACAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTTGTGGCAGCCTGACTTCCTAAGATCATAACGCCCAAACCCACGGAGAAGTGGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGCATCGGCCGCTTGTGTCGCGCGCGCCAACCCGTGATCAACATTGTCGCGATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCTGGCTCGCTCTCGCACGAGAGAAGCACATCTTTGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATTAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCAAACATGAGACGCGTCCGCGCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCGCCGATGTTCGTGATGGGGTGAACCACGAGTTGTACGAGAAGAACATGCATGTGGTGTCAACGCTCGTGCACGACGAACTGCCTGGCGCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCGACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCCTCTACGAGAGATTAAGGCGCTATCAAGCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_sp._EL8703 TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCGTCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTGTCGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGTTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGCAAGGAGGCTGAGAGCTGCGACTGCTTGCAGGGTTTCCAGATCACCCACTCGCTCGGTGGGGTACCGGTTCCGGTATGGGCACGCTTCTTATTTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCGTACAACGCAACACTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTATGACATTTGCTTCCGTACGCTGAAGCTGACGACCCCACCTACGGTGACCTGAACCACCTAGTGTGTGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCGGGTCAGCTGAACTCCGACCTCGCAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCTCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCTGCCGACCCTCGCCACGGTCGCTATTTAACAGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTTGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACGCCATCCAGGAAATGTTCAAGCGTGTGTCCGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATAGTAGGTACTACTTTATCTCTTTTAATTAGAATTGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAATTATATAATGTTGTAGTTACTGCACACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTCTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCAATTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTATATCCACCTTTATCTAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATAAATTTTATATCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCGTCTGGGGGAGGTGATCCGGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTGGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAACTGCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTGCCGAGCGGAGCGTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCTCCTGCTCTTGTGGGCAGGACGTGACCAGCAGGCCGAGCTCGACCGTCATGGTGGAGACCCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCGGCGAAGAAGCAGCCCTGTGCATACATGCTGACCTGGCCGGCAATCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACCGCTGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGTGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCCGCTTCGGAGTTCTACACTGGGAGAGCTCGTTACAACCTTGACTTCAAGAAAAACGCCGCCGATCAGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTTATCGCCAAGGCGTCTCAGCAAGATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGATTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGTAGGGTGAGACGGAGGACACGTTCATCGCTGATGGCTGTGGGTCTGAGCGCGGGCCAGATCAAAACGGTGGACTCGGGTATCGGCATGACCAAGGCCGACTCATCAACAACTCGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCCGCCGGCGCGGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCTGGCGGCTCGTTCACCGTCACGCCGACACGTCGGAGCCATCTGCGCGGCACGCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATCGGCTTCCCCATAAGCTCTACGTGAGAAGACCGAGGAGAAGGAGTCACTGAGACGAGGAGGAAGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAAGAGTCGAGGGTGAGAAGAAGAAGAAGACTAAGAAGATTAAGGAGGTGACGCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTGAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTTTTCACCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTTTACGTGCGCGTGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTTAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGTGTGATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCCGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCTTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCAACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTTCACGTGACCGTTGAGTTTGGGATCCGATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCGTGTAGTCGGTGGAGGAAATGCCAGACGTGAAGTGTCTTGCGTGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGAGGAGGCGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACTGAGTGGCAGTCGATCATTTTGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGCGGCATGGCTGCGGCGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAGGTGGTCGTGGCGCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCCGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGCCTCGGCGTCATGCCTGCATCGGCGAGACAAGGAGCACCGTGAGTCAACCAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGAACAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTTGTGGCAGCCTGACTTCCTAAGATCATAACGCCCAAACCCACGGAGAAGTGGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGCATCGGCCGCTTGTGTCGCGCGCGCCAACCCGTGATCAACATTGTCGCGATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTCCACGGCAGTTGCTGGCTCGCTCTCGCACGAGAGAAGCACATCTTTGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATTAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCAAACATGAGACGCGTCCGCGCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCGCCGATGTTCGTGATGGGGTGAACCACGAGTTGTACGAGAAGAACATGCATGTGGTGTCAACGCTCGTGCACGACGAACTGCCTGGCGCCCTGGCGAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAGACGTGGACGGTCCGTCTAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGCTGACTGGCATGTCTTCCGTGTGCCGACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCCTCTACGAGAGATTAAGGCGCTATCAAGCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCGAGGCGGAT Phytophthora_sp._kelmania TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCCAAGATCCGCATCTACGATGTGGGCAACAGAAGGCCTCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCGGACGAGAAGGAGCAGCTGTCGTCGAGGCGCTCGAGGCGCCGTATCGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCCTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCTGGCGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCTCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTCGTAAGCTGGCGGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAGATGGAGTAATCATAAAGATATTGGCACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGTGGAGCGTCGACGGGCGAGTTCGAGGCCCTCGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTCAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCAGCAGGTCGAGCTGGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGCGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAACAACGCGCCGGATCGGAAAGATCCGCAACTGCAGGAGATGTACGAGGCTTCATCTCGAAGGCGTATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATCGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGCGGACTCGGGTATCGGTATGACGAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTCCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTCACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTGGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCTGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTTGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTCGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTTGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGACTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTCCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTCACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGATCGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGTCTGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGGGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTGGGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTTGTCGCCGTTCGTCGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGACTCGCCGTCATGCCTGCATCGGAGAGAGAAGGAGACCCGCGAGGCAACGAGACTGCCTACATCACGGAGCAGCTCACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCCCCCGACAGGCGCAGGACGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGATCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACCGAGAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGCATTGGCCGCTTGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGA{AG}TACGACACGGTGCACGGCAGTTGACGGCGCGCTGTCGCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGTCCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTCGAGTCACGGGGCTTTCACACCTGAGAAGCTTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCCGCCCCGTCCAGCGACGCCCCCATGTTCGTCATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACCAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCTACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCTTCTACGAGAGATCAAGGCGCGATCAAGAGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_syringae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGCGGAGTGCCCGACCCCAAGATCCGCATTTACGACGTGGGTAACAGAAGGCGTCGTGGACCTCTTCCCCTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCATCGAGGCTCTCGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTCTCGTGCGCCGGTGCTGATAGACTGCAGACCGGCATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATCATCTCGGTGCGTCAAGGACAACTTCGGCCCGTCGGTGTCGAGGCTCTGCGTCGCGCCAAGTTCAAATTCCCGGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAAGCCGAGAGCTGTGACTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGAGGGGTACCGGGTCCGGTATGGGAACGCTTCTGATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTCTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCTGGACAATGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACACGTGCTGCGCTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTGGCCGTAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGGTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCTGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATTCCGCCCAAGGGCCTGAAGATGAGCACGACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAAGGTATGGACGAGATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACACGCATTTATAATGGTTTTCTTCTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATTGGTGCTCCAGATATGGCCTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCTGCAATTGTAGAATCTGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCCGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGCGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAGCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGATGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGATGGCACTTGGCCGTGGTGACACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTGCGAGGCACCCGGGACAACGTGGATTAACGTAAGAAGTTCCGTAAGAGCTGCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCCGGAAGGTCTGGCGCTGTCCCCAGCGGAGCGTCCACGGGCGAGTTCGAAGCCCTGGAGATGCGGAGGGGGCGTACATGGGCAAGGGCGTGCTGAAGCCGTCAAAACGTGAACGAGATCTCGCGCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCCGAGCTGGACACTCATGGTGGAGACCCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCCCTGTGCCGTGGGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGAGCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCTGTGGGTGACGAGGGCGGTTCGCCCCCAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCTGCGGCTACACGGACCAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCTGGAGATGTACGAGGCTTCATCTCGAAGGCGTATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAAATACGGCAGGGTGGTAAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGTAACGCTTTTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCCAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGAGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGCATCGGCATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCCGACATCAGATGATGGCCAGTTCGGCGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACCGTCACGCCGACACGTCGGAGCCATCCGCGCGGCACGCGATGTGCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTGGACGGCGAGAAGGCCAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTGTACGTGCGCGTGTGTTCATCATGGACAACTGCGAGGACCTATGCCGAGTACCTCTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTCATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCCGACTGGGAAGACAACGAGAAGTACAGCAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTCGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGCAGACGTCCTCGAGACTACATCTCGCGCATGCCCGAGACGCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGATTTACATGATTGACGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGAAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAAACGTTGAGGAGGCCAAGGCGCCACGAGGGGCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTGGAGTCGCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCCCAAGCTCTGCGCGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGATGCCAGACGTGAAGTGTCTTGCGCGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGATAACTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGATGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACTGAGTGACGGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGACGAGTGTGTGTGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGCGTGTGTGTGCGTTGCTTGTTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTGCGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGTGCTTTAGCTTGTCGCCGTTCGTGGAGGTGGTCGTCGCCCCCTCGCAGGTGCACGCCGCCACCGTCAAGTCCGCTCTGCGCGGTGACGTGCGCGTCAGGGCCAGGACGTATGGCAGCAGGGCAACGGCGCCTTCACGGGCGAGACCTCCGCCGAGATGCTCAAGGATTGGGCGCCGAGTAACGCTCGTGGGCCACTCGGAGCGCCGCGAAAGGGCGAGACAACGCGGTGGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGTCTGGCTGTCATGCCTGCATCGGCGAGTCAAGGAGACCCGCGAGGCAACCAGACTGCTTACATCACGGAGCAGCTGACGCCTACGCCGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCTATTGGCACGGCTCACGCCTCGCCCGACAGGCGCAGGACGGCACGCCAGCATCCGTGCTTGGCTCAAGGAGAAGGTCTCGGCCGAGGCGCTGACAAGACCGGTATTACGGCGGCTCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTTGTGGCAGCCCGACTTCCTCACATCATAACGCCCAAACCCACGGAGAAGTTGGGGCCCGTGAAGTGCTATCAACGGCTTCGGCCGTATCGGACGCTTGTGTCGTGCGCGCCAACCCGTGATCAACATTGTGGCGATAACGACCCTTCATCTCTACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGTACGCTCTCACACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGACCAACATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACCTGAGAAGCCTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCTCCGTCCAGCGACGCCCCCATGTTCGTCATGGGGTCAACGACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACCAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCCACGCAGAAGACGTGGACGGCCCGTCCAAGAAGGACTGGCGGGTGGCCGTGGCGCTTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAATGGCAAGCTGACGGGCATGTCTTCCGTGTGCCCACGCGACGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTATGAGAGATCAAGGCGCTATCAAAGGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCTAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_tentaculata TACCGTTTCCAGAACAAGAAGCCCTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGTAACAGAAGGCTTCGTTGACGCCTTCCCGTTCGTGGCCCACTTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTATTGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTTCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACCGGTATGCGTCACGCTTACGGTAAGCCCGGTGTTGCGCTCGTGTGGCATTGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCTTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATTGACTCGTGCTCGACGTGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTATACGACATTTGTTTTCGCACGCTGAAGCTTACCACCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACACGTGCTGCGTTTCCCTGGTCAGTTGAACTCGGACTTCGTAAGCTGGCCGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAAGTTGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCCAAGGGACTGAAGATGAGCACCACGTTCATCGGTAACTCTACGCTATCCAGGAGATGTTTAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTGGGAACAACATTATCTCTTTTAATTAGGATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCGTTAATTGGTGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCTCGTATGAACAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCAATTACTATGTTATTAACTGATAGAAACTTAAATACTTCTTTCTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGATTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAATCGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTTCCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACTGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGCGGTGCCTCCACGGGTGAATTCGAGGCACTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTCCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTTATCGGCGGGACGTGACGAGCAGGCCGAGATCGACCGTCATGGTGGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGTGTGTCCTCGCTCTGTGCCGTGCGGTGCCGCTGCCAAGAAGCAGCCCTGTGCACACATGCTGACCTGGCCGGCAACCCGACCCCGTGCCTGCCGTGCCGTCGTTCAACATTATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATTCTCCTGTGGGCGCTACAGTTTCACGGAGGCCATGAAGATTGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACTGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGTCAAACGGTGAGGCCATCGACCTTATCGAAGAGGCCATCAAGGCTGCGGTTACACGAACCAGGTGCGCTTGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTTAAGAAAAATGCTGCGGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGTTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCCATTGAGGACCCGTTCGACCAGGACGACTGGGATTCGTGGTGAATTACGGCAAGGTGGCAACGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATTGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGGCATTATGCCAGCCATCGTAGGGTGAGACGGAGGACACGTTTATTGCCGATAGCTGTTGGTCTGAGCGCCGGCCAGATCAAGACGGTGGACTCTGGTATTGGTATGACGAAGGCGGACTCATTAACAACTGGGACGATCGCTAAGTCGGGCACTAAGGCTTCATGGAGGCTTGGCCGCTGGCGCCGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCTGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGATCGTTCACTGTGACCCCGACACGTCGGAGCCATCAGCGTGGTACGCGATGTGCTGAAGCTGAAGGAGGATATGCTGAGTACCTGAGGAGCGCAAGCTGAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGATGAGGAAGAGGAGAGAAGGAGGGGACGACAAACCCAAGGTGGAGGAGTCGAAGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAAGTGACCCACGAGTGGGACCACTCAACAGCCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCACTGACGAAGACTGGGAGGAGCACGCGGCGTCAAGCACTTTTCTGTGGAGGGCAGCTGGAGTTAAGGCTGTTGTTCACCCCAAGCGGCGCCGTTGACATGTTTGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTCTTCATCATGGACAACTGCGAGGAACTATGCCGAGTATCTGTCGTTTGTCAAGGGCGTGGTCGACTCGGAGGATCTGCCGCTAACATTTCGCGTGAGACGCTGCAGCAAACAAGATCCTCGGGTGATAAGAAAACCTGTCAAGAAGTGCTCGAGATGTTCGCCGACTGCGAGGACAACGATAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCGGGGAGGAAGTGACGTCCTGGAGACTACATCTCGCGCATGCCTGAGAACCAGCCCGGTATCTACTACGTCACCGGGAGAGCAAGAAGTCGGTGGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTGTTCATGGTGGAGGCTATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACGGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAAGGACTGTGCAAGCTCATGAAGGAGGTGCTGGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTCGAGTCGCCCTGTGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAAATTCCACGTGACCGTTTCAATGGGGATCCGAATTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTTCTTCGTGTAGTCGGTGGAGGAGATGTCAGATATGAAGTGTCTTGCGTGAGTCCTTTTAAATGTAACTGTACTTCTCTTTGCTCCAAAAGTGTTGTGGAGGCTGTGGCGACTGCTGCGGCGTGGAAGAGTGCTTGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCATAGCTCCTTGGCTTTGAATCGAGTGGCGACCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGATGCTTATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGGCTATGGCAGTGGCTTGGCTGCGGCGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCATGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCGTGGAGGTCGTCGTGGCTCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCTCCGACGTGCATGTCAGGGACAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGTGAGACCTCGGCCGAGATGCTCAAGGACTGGGTGCTGAGTAACACTTGTGGGCCACAGCGAGCGCCGTGAAAGGGCGAAACAACGAGATCGTGGCAAGAAGGCGCTACGCTTGGAGAAAGGCCTTGGCGTGATGCCTGCCTTGGTGAGACAAGGAGCTCCGTGAAGCAACCAGACTGCGTACATCACGGAGCAGCTCATGCCTACGCTGCTGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCTTCGCCCGACAGGCTCAGGAGGGCACGCCAGCATTCGTGCCTGGCTCAAGGAGAAGGTGTCCCCCGAGGCGCTGAGAAGACCGGTATTACGGTGGCTCGTAGGTGCTAAGAACGCGCCGAGCTCTCGCAGAAGGAAGACATGACGGTTTCCTGGTGGTAGGCCGACTTCCTCAGATCATAACGCCCAAACCCACGACCAAGTCGGGGCGCGTGAAGTGCTATTAACGGCTTCGGCCGTATCGGTCGCTCGTGTCGTGCGCGCCAATCCGTCATCAACATCGTTGCTATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGATGGTTCGCTCTCGCACGAGAAAAGCACATCTTCGTAGGCAAGCCATTCGGTGTTAAGAGATGAACCCGAGAATATCAAGTGGGCGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACCTGAGAAGCCTCAGCCCACTGAAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCCAGCGACGCTCCCATGTTCGTGATGGGGTGAACCACGAGCTGTATGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCTTGGCCAAGGTGGTGAACGACAAGTTTGGCATAGGAAGGTCTGATGACGACGTGCACGCTGTACGCCACGCAGAAGACGTTGATGGTCCGTCCAAGAAGGATTGGCGGGTGGTCGTGGCGCTTGTTAACATCATCCCAGTTCACGGGCGCAAGGCGTGGGAAGGTGATTCCGAGTCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTTCCGACGCGATGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCATCTACGAGAGATCAAGGCGCTATCAAAAGCAGCGAGAACGAGATGAAAGGTATCCTTGGTTACACGAAAGGCGTGTTCGAGGACTTCATGGGATTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_trifolii TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCCAAGATCCGCATCTATGATGTGGGTAACAGAAGGCTTCGTGGACGCCTTCCCCTTCGTGGCCCACTTGTGTCGGACGAGAAGGAGCAGCTGTCGTCGAGGCTCTCGAGGCGCCGTATTGCTGCTAACCGTTACTTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCCTTCCAGGTCCTGCGTATCAACAAAATGCTTTCGTGCGCTGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCTTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACAACTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGTCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACACACTCACTCGGTGGGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCGTCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACACATGCTACGTTTCCCGGGTCAGCTGAACTCAGACCTCGTAAGCTGGCGGTAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGGGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCATGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCTAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAAGAGATGTTCAAGCGAGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAAGGTATGGATGAGATGGAGTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTGTTGGTACAACATTATCCCTTTTAATCCGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACTGTTTACCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCACAGATTACCCTTATTCGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTACTAACATTACCGGTATTAGCTGGAGCAATTACTATGCTGCTAACTGATAGAAATTTAAATACTTCGTTTTATGACCCATCAGGTGGAGGTGATCCAGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGTGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTCGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTACACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCGGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCTTCCGAGGCCTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGTTTGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCTGTCCCCAGTGGAGCGTCGACGGGCGAGTTCGAGGCCCTTGAGATGCGGAGGGGAAGTACATGGGCAAGGGCGTCCTGAAGCCGTCAAAACGTGAACGAGATCTCGCTCCCGCTCTTGTGGGCAGGACGTGACCAGCAGGCTGAGCTGGACCGTCATGGTGGAGACTCTGGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCTCTGTGCCGTGGGGTGCCGCTGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCTGGTAACCCGAGCCCGTGCCTTCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGTGACGAGGGTGGTTCGCCCCGAACATCCAGGCCAACGCCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGTTACACGAACCAGGTGCGCTGGGATGGATTGCTGCGTCGGAGTTCTACACTGGGAGAGCCCGCTACAACCTTGACTTCAAGAACGACGCTCCGGATCGGAAAGATCCGCAACTGCAGGAGATGTACGAGGCTTCATCTCGAAGGCGCATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGAGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTTACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAATCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCCGGCTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCGATGGCTGTGGGTCTGAGTGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGTATGACGAAGGCCGACTCATCAACAACTGGGACGATTGCCAAGTCGGGCACCAAGGCTTTATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGTCAGTTCGGTGTGGGTTTTACTCGGCCTACTGGTCGCGAAAGGTCGTGTGCACTCGAAGCACAACGATGACGAGCAGTACGTGTGGGAGTCGCCGCCGGTGGCTCGTTCACGGTGACGCCGACACGTCGGAGCCATCTGCGTGGTACGCGATGTCCTGACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTTAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTCACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTTGAGGAGTGGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATTAAGGAGGTGACCCACGACTGGGACCACTTAACAGTCAGAAGCCCATTTGGATGCGTAAGCCTGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTCACCAAGACTGGGAGGAGCACGCGGTGTTAAGCACTTCTCGGTCGAGGGCAGCTAGAGTTAAGGCTGCTGTTTGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATTAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACTTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTCAAGAAGTGCTGGAGATGTTCGCCGACTGTGAGGACAACGAGAAGTACAACAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTCCTGCGTTACCACTCGACCAAGTCTGGGAGGAGATGACGTCCTCGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGTATCTACTACGTGACCGGGAGAGCAAGAAGGCTGTGGAGAACTCGCCATTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTTGAGGCTATGACGAGTAGCGTCAGCAGCTAAGGACTATGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACTGAGGACGAGAAGAATCTTTGAAGAGGCCAAGGCGCCACGAGGGTCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTCCTGTGACTGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGAATCCGACTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCGCGAGTCCTTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCAGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACTGGGTGTCTGTCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGGGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAATGTGTGCGTGCGTGGCTTTGGCAGTGGCTTGGCTGCGGCGTGCGTGTGCGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGTGCTTTAGCTTGTCGCCGTTCGTCGAGGTGGTTGTGGCCCCGTCGCAGGTGCACGCCGCCACCGTCAAGGCCTCGCTGCGCGCCGACGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAAACAACGATATCGTGGCAAGAAGGCGCTACGCCTGGAGAAGGGACTCGCCGTCATGCCTGCATCGGAGAGAGAAGGAGACCCGCGAGGCAACGAGACTGCCTACATCACGGAGCAGCTTACGCTTACGCTGCCGATTAAGGACTGGACCAAGTGTATTGCCTATGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCCCCTGACAGGCGCAGGACGGCACGCCAGCATCCGTGCGTGGCTCAAGGAGAAGGTCTCCCCCGAGGCGCCGAGAAGACCGGTATTACGGCGGATCGTGGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGAGGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAAACCCACTGAGAAGTCGGGGCGCGTGAAGTGCCATCAACGGCTTCGGCCGTATCGGCCGCTTGTGTCGTGCGCGCCAACCCGTCATCAACATTGTCGCCATAACGACCGTTCATCTCGACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCGCGCTGTCGCATGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGGACCGTCCAACATCAAGTGGGTGAGGACAGTGCATAGTGGTCGAGTCACGGGGCTTTCACACCTGAGAAGCTTCGACCCACTGCAGAACGGTGGAAAGGTGTGATCTCCGCCCCGTCCAGTGACGCCCCCATGTTCGTCATGGGGTCAACCACGAGCTGTACGAGAAGAACATGCACGTCGTGTCAACGCTCGTGCACGACCAACTGTCTGGCGCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTCATGACGACGTGCACGCCGTACGCTACGCAGAAGACGTGGACGGCCCATCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGACGTGTCTGTGGTGGACTGACTGCTCGTCTGTGAACCCTGCGTCTACGAGAGATCAAAGCGCTATTAATCGCAGCGAGAACGAGATGAAGGGGATCCTTGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCATCATTTGAGCGAGGCGGAT Phytophthora_uliginosa TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCTTCGTCGACGCCTTCCCATTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCCGCCAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGCTGCCACCCGTTCCAGGTGCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGTGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCGGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTGGACGTGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGATAACGAGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACACGTGCTCCGTTTCCCCGGCCAGCTGAACTCAGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCACGTCTCCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTCCCGAGCTGACGCAGCAGCAGTTCGATGCGAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAAGCTAGCGTGTGTGACATCCCGCCTAAGGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATCGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCGGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCGGGGGGGGGGGATCCGGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAGGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTTTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGCACCAGGATTATGGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTCCCCAGCGGAGCCTCCACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTTCTGAAGCCGTGAAAACGTGAACGACATCTCGCCCCCGCTCTTATCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTCGAGGAGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCATGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGTGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGAACCGCTACGGCCTGGAGCCACGGCTGTGGGCGACGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCCATCAACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATCGCTGCTTCGGAGTTCTACACGGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCTCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGCATCAGCAAGATGTGTCGATCGAGGACCCGTTCGACCAGGACGACTGGGCGTCGTGGTGAATTACGGCAAGGTGGCAAGGACGTGCAGATGTGGGAGACTGACGGTGACAATCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAATGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCGGGTTGGGCCATCATGCCAGCCACCGCAGGGTGAGACGGAGGACACGTTCATCGCCAGTGGCTGTGGGTCTGAGCGCCGGCCAGATCAAGACGGCGGACTCGGGTATCGGTATGACCAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCTTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGCTTTACTCGGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGCGGCACCCGATGTGCTCACGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAACTGAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACGAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACTCGCAGAAGCCCATCTGGATGCGCAAGCCTGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAACACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCGCCCCAAGCGGCCCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATGAACAACATCAAGCTGTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTTGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTGTGAAGAAGTGCTCGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACAGCAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAGCAGACTTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATTTACTACGTGACGGGGAGAGCAAGAAGGCCGTGGAGAACTCGCCCTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGATCTTCATGGTGGAGGCCATGATGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCCAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTTGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGTATGTCGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGTATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTATCAATGGGGATCCGAGTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGCAAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGCTGCTTGGCTTTGAACCGGGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGCGGCTTGGTTGCGGTGCGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTTGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTGGAGGTGGTCGTGGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGATGTGCGCGTGAGGGCCAGGACGTGTGGAAGCAGGGAAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGGCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTACATCACGGAGCAGCTGACGCCTACGCCGCCGATCAACGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATCGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTGTCCCCCGAGGCGCTGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTCGTGGCAGCCCGACTTCCTCAGATCATAACGCCCAGACCCACGACCAAGTGGGGGCGCGTGAAGTGCCATCAACGGATTCGGCCGCATCGGCCGCTGGTGTCGCGCGCGCCAACCCGTGATCAACGTTGTTGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGCGAGGACAGTGCGTAGTGGTGGAGTCACCGGGCCTTCACACACGAGAAGCCTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCCCCGTCCAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCTCCCTGGCCAAGGTGGTGAACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCTAGCCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCTACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCCTCTACGAGAGATCAAGGCGCTATCAATCGCAGTGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytophthora_vignae TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCCTCGTCGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCCCTCGAGGCGCCGTATTGCCGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTCCTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCTGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTCGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTACGGCCCCTCGGTGTCGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCCGGCCGCCAGAAAGTGCTGGGATCGACTCGTGCTTGACGTGTCCGAAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCGTCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCTGGATAATGAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCACGTACGGTGACCTAAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACACGTGCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTCGTAAGCTTGCCGTAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCTCTGACGGTCCCGAGCTTACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGAGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCCAAGGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGGAGGGTATGGACGAGATGGAGTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTCTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTATTGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAATATGACGCCCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATTTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGCAGGCCGTTACGAGAGATAAAAGAGTTCACTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGAAATCGAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACCCCCAAGCGCCTGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTATAAGCCGGCATGGTCGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCCTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTGCGCGTGGCTAGTGCTCGACTCAAGAAGACCGCAAGGGACCAGGATTACCGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACTCCCGTGCTGATGCCACACGCCACGTGCCTGAAGTTAAAGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTTCCCAGCGGAGCCTCGACGGGCGAGTTCGAGGCCCTGGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTGCTGAAGCCGTGAAAACGTGAACGAGATCTCGCCCCCGCTCTCATCGGCAGGACGTGACCAGCAGGCCGAGCTTGACCGTCATGGTCGAGGAGCTCGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAACTGGGGCCAACGCCATCTGGGCGTGTCCTCGCGCTGTGCCGCGCGGTGCCGCCGCCAAGAAGCAGCCCTGTGCATACATGCCGACCTGGCCGGCAACCCGACGCCGTGCCTGCCGTGCCGTCGTTCAACATCATCAACGGTGGCTCCACGCCGGAACAACTGGCCATGCAGGAGTTCATGATCCTCCCGTGGGCGCCACAGCTTCACGGAGGCCATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAAGGGCCGCTACGGCCTGGAGCCACGGCCGTGGGCGACGAGGGTGGTTCGCGCCCAACATCCAGTCGAACGGCGAGGCCATCGACCTGATCGAGGAGGCCATCAAGGCCGCGGCTACACGAACCAGGTGCGCTGGGATGGATTGCCGCGTCGGAGTTCTACACTGGGAGAGCTCGCTACAACCTTGACTTCAAGAAAAACGCCCCCGATCGGAAAGATCCGCAACTGCAGGAGGTGTACGAGGCTTCATCGCCAAGGCGTGTCAGCAAGATGTGTCGATTGAGGACCCGTTCGACCAGGACGACTGGGCTTCGTGGTGAATTACGCCAAGGTGGCGAGGACGTGCAGATGTGGGAGACTGACGGTGACAACCCACGCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAGATCGGAGCATCACGGAGTCGATTGAGGCGTGACGATGGCGAAGAAGGCTGGCTGGGCCATCATGCGAGCCACCGCAGGGTGAGACGGAGGACACGTTCATTGCCGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGCGGACTCGGGTATCGGTATGACTAAGGCCGACTCATCAACAACTGGGACGATCGCCAAGTCGGGCACCAAGGCTTCATGGAGGCCTGGCCGCCGGCGCTGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCCGCCTACTGGTGGCGAAAGGTCGTGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCCGCCGGCGGCTCGTTCACGGTCACGCCGACACGTCGGAGCCATCTGCGCGGTACCCGATGTGCTCAAGCTCAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTCAAAGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCCATAAGCTCTACGTGAGAAGACGGAGGAGAAGGAGTGACTGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCCAAGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACCAAGAAGATCAAGGAGGTGACCCACGACTGGGACCACTCAACTCGCAGAAGCCCATCTGGATGCGCAAGCCCGAGGACGTGACCCACGAGGAGTATGCTCTTCTACAAGTCGCTGACCAAGACTGGGAGGAGCACGCGCCGTCAAGCACTTCTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCCAAGCGGCTCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAATCAACAACATCAAGCTCTACGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGTGTCGTCGACTCGGAGGACCTGCCGCTAACATCTCGCGTGAGACCCTGCAGCAAACAAGATCCTCGCGTGATAAGAAAACCTATCAAGAAGTGCTGGAGATGTTCGCCGACTGCGAGGACAACGAGAAGTACCAGAAGTTTAGAGGCCTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACCAACCGACCAGATGCCAAGCTGCTGCGTTACCACTCGACCAAGTCTGGGAGGAAATGACGTCCTGGAGACTACATCTCGCGCATGCCCGAGAACCAGCCCGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCTGTCGAGAACTCGCCGTTATTGAGAAGCTCAAGAAGAAGGGTAGAGTGCTCTTCATGGTGGAGGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGCACAAGGAGGGCCTAAGATGGAGGAGACCGAGGACGAGAAGAATCGTTGAGGAGGCTAAGGCGCCACGAGGGCCTGTGCAAGCTCATGAAGGAGGTCCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTTGAGTCCCCGTGCGTGCTGTGACGGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGTGACCACACCTAAAACTTCCACGTGACCGTTTCAATGGGGATCCAATTTTTAAACCTTACTGTGGGGACGAAAGTCTCTGCTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGAGTCCCTTGAAATGTAACTGTACTTCTCTTTGCTCGAAAAGCGTTGTGGAGGCTGCGGCGACTGCTGCGGCGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAGCTTATTGTGAACCGTAGTTGCTTGGCTTTGAACCGGGTGGCGGCCGATCATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCTGAGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGGCTGTGGCAGTGGCTTGGCTGCGGTGTGTGTGTGTGTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCAGGAGGTAGGGCTTACGCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTGTGTCTCCGTGTGGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCGTCGAGGTGGTCGTTGCCCCGTCGCAGGTGCACGCCGCCACGGTCAAGGCCGCGCTGCGGCCCGACGTGCGCGTGAGGGCCAGGACGTCTGGAAGCAGGGCAACGGCGCCTTCACGGGCGAGACGTCGGCCGAGATGCTCAAGGACTGGGCGCCGAGTAACGCTCGTGGGCCACAGCGAGCGCCGCGAAAGGGCGAGACAACGAGGTCGTGGCAAGAAGGCGCTACGCCTCGAGAAGGGCCTGGCCGTCATGCCTGCATCGGCGAGACAAGGAGCTCCGCGAGGCAACCAGACTGCCTTCATCACGGAGCAGCTCACGCCTACGCGGCCGATCAAGGACTGGACCAAGTGTATCGCCTACGAGCCCATCTGGGCCATTGGCACGGCTCACGCCTCGCCCGACAGGCCCAGGAGGGCACGCCAGCATCCGTGCCTGGCTCAAGGAGAAGGTCTCCCCTGAGGCGCCGAGAAGACCGGTATTACGGCGGCTCGTCGGCGCCAAGAACGCCCCGAGCTCTCGCAGAAGGCCGACATGACGGCTTCCTGGTGGCAGCCCGATTTCCTCAGATCATAACGCTCAAACCCTCGGACAAGTTGGGGCGCGTGAAGTGCCATCAACGGATTCGGCCGCATCGGCCGCTCGTGTCGCGCGCGCCAACCCGTCATCAACATTGTGGCCATAACGACCCTTCATCTCCACGACTACATGGATACATGCTCGAGTACGACACGGTGCACGGCAGTTGACGGCACGCTGTCCCACGAGAGCAGCACATCTTCGTAGGCAAGCCATCCGGTCTTAAGAGATGAACCGGCCAACATCAAGTGGGTGAGGACAGTGCATAGTGGTGGAGTCACGGGGCCTTCACACACGAGAAGCGTCGGCCCACTGCAGAACGGTGGAAAGGTGTGATCTCGGCGCCGTCGAGCGACGCGCCCATGTTCGTGATGGGGTGAACCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTGGCCAAGGTGGTGCACGACAAGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACGCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGTGGCCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTGATCCCGGACCTGAACGGCAAGCTGACGGGCATGTCTTCCGTGTGCCGACGCGACGTGTCGGTGGTGGACTGACTGCTCGTCTGTGAACCCCGCTTCTACGAGAGATTAAGGCGCGATCAATCGCAGCGAGAACGAGATGAAGGGCATCCTCGGCTACACGAGAGGCGTGTTCGAGGACTTCATGGGACTCGCCTCGTCATTTGAGCAGCGCGGAT Phytopythium_vexans TACCGTTTCCAGAACAAGAAGCCGTTCATTAAGTCCGCTTCTGCCGTGGTGTGCCCGACCCGAAGATCCGCATCTACGATGTCGGCAACAGAAGGCGTCGTGGACGCCTTCCCGTTCGTGGCCCACCTGTGTCCGACGAGAAGGAGCAGCTGTCCTCGAGGCTCTTGAGGCGCCGTGTCGCTGCTAACCGTTACCTGACCAAGTTGCGGAAGGAAACTTCCACATGCGCATCCGTTGCCACCCGTTCCAGGTGTTGCGTATCAACAAGATGCTTTCGTGCGCCGGTGCCGATAGACTGCAGACGGGTATGCGTCACGCCTACGGTAAGCCCGGTGTGGCGCCCGCGTGGCATCGGCCAGCCATTATCTCGGTGCGTCAAGGACTCGTTCGGCCCCTCGGTGTGGAGGCTCTGCGTCGTGCCAAGTTCAAATTCCCTGGCCGCCAGAAAGTGCTGGGATTGACTCGTGCTGGACGTGTCCGGAAGGAGGCGGAGAGCTGCGATTGCCTCCAGGGCTTCCAGATCACGCACTCGCTCGGCGGGGTACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGCGAGAGTACCCGGACCGTATTATGTGCACGTACTCGGTGTGCCGTCGCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTCTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCTGGACAACGAGCTCTGTACGACATTTGCTTCCGTACGCTCAAGCTGACGACCCCACGTACGGCGACCTCAACCACCTTGTGTGCGCTGCGATGTCGGGCATCACACCTGCTGCGATTCCCCGGTCAGCTGAACTCTGACCTCGGAAGCTGGCTGTAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGGTTCGCCCGCTGACGTCGCGCGGCTCGCAGCAGTACCGTGCTCTGACCGTCCGGAGCTGACCCAGCAGCAGTTCGACGCGAAGAACATGATGTGCGCCGCGGATCCTCGCCACGGTCGTTACCTGACTGCCGCGTGTATGTTCCGTGGCCGCATGAGCACGAAGGAGGTGGAGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGTGTGTGTGACATTCCGCCGAAGGGTCTGAAGATGAGCACCACGTTCATCGGCAACTCGACGCCATTCAGGAGATGTTCAAGCGCGTCTCGGAGCAGTTCACGGCGATGTTCCGCCGCAAGGCCTTCTTGCACTGGTACACGGGGAGGGCATGGATGAGATGGAGTAATCATAAAGATATTGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGCAATAGTTGCAACAGTAATGTCTGTATTAATTAGAATTGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAAGTATATAATGTTATGATTACAGCACATGGTTTATTAATGATATTTTTTGTGGTTATGCCTATATTAGTTGGTGGTTTTGGTAATTGGTTTGTACCTATAATGGTAGGAGCACCAGATATGGCTTTTCCTCGTTTAAACAATATTAGTTTTTGGTTATTACCACCATCTTTATTACTATTAGTATCATCTGCTTTAGTTGAATCAGGTGCAGGTACAGGTTGGACAGCTTATCCACCATTATCAAGCGTAGCTGCACACTCAGGACCTTCAATAGATTTAGCTATTTTTAGTTTACACTTATCTGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTGTTACTATTTTTAATATGAGAGCTCCTGGATTAAGTATGCATAGAATGCCTTTATTTGTTTGGTCTCTTTTAATTACAGCTTTTCTTTTAGTTATAACTTTACCTGTATTTTCAGGTTCAATAACTATGTTATTAACTGATAGAAATTTTAATACTTCTTTTTATGATCCAGCAGGAGGAGGAGATCCAGTATTATTCCAATATGACGCTCCGGCACCGTGATTCATCAAAACATGATACGGGACTCCAGCGACTGGCCATCTGTGTGCTCGGGTGGCGATTGAGGCTGGTATCTCAAGGAGGGCAGACCGGAGCACGCCTCTTGCTTACCTGGGTAACAATGTGTGCATAACAAATGGAGACTCTCGTATGTAGGGAGGCCGTTACACGAGATAAAAGAGTACGCTACCTGAAGAAGGTGGTACAACCGCAAATCCTTCGTCCATTCGGCTGGGAGGGGACAACATGATGACGTCAAACATGCCGTGGTACAAGGGCCTACCTCCTGAGGCTGACACTGAACGCCCAAGCGCCCGACAAGCCCTCGCTCCCTCAGAGTGTAAAGATCGGCGGATGGCACGGTACCGTGGCGTGTGAACGGTGTCTAAGCCGGCATGGTTGCACTTGGCCGTGGTGTCACGGAAGTAAGTCGTGAGATGCACCACGAGTCGTCCGAGGCGTCCGGGACAACGTGGCTTAACGTAAGAAGTTCGGTAAGAGCTCCGCGTGGCTTGTGCTCGACTCAAGAAGACCGCAAGGGACGCTGATTACGGCCAGTATGTGCAACCACCCGGCAATGGCAACGGTACGCCCGTGCTGATGCCACACGCCACGTGCTTGAAGTTAAGGAGATCACGAGAAGATGGACCGTCGTCGGGAAGGTCTGGCGCCGTGCCGAGCGGTGCGTCGACGGGCGAGTTCGAGGCGCTCGAGATGCGGAGGGGAAGTACATGGGCAAGGGTGTTCTCAAGCTGTTAAAACGTGAACGAGATCTCGCGCCGGCTCTCATCGGCAGGACGTGAAGGGCAGGTCGCCATCGACAATCATGGTGGAGACGCTTGACGGCACGCAAACGAGTGGGGCTGGTGCAAGAAGAAGCTCGGGCCAACGCCATCTCGGTGTGTCCTCGCCGTGTGCCGTGCGGTGCCGCCGCGCGCAAGGTGCCCTGTGCACACATGCCGACCTTGCCGGCAACCCGTCGCCGTGCCTTCCGTCCCGTCGTTCAACATCATCAACGGTGGCTCCACGCTGGAACAACTGGCGATGCAGGAGTTCATGATCCTCCCGTGGGTGCTGAAGCTTCACGGAGGCGATGAAGATCGGTCGGAGGTGTACACAACTGAAGAAGGTGATCAACAAGCGCTACGGTCTGGAGCGACCGCGGTCGGTGATGAGGGTGGTTCGCCCCGAACATCCAGTCGAACGGCGAGGCGATCGACCTTATTGAGGAGGCCATCAACAACGCGGCTACACCGGCAAGGTTCGCTCGGATGGATTGCGTCGTCGGAGTTCTACACTGGGAGAAACCGCTACAACCTTGACTTCAAGAACAACGCTCCGGATCGGAAAGCTGCGCAACTGCAGGAGCTGTACGAGGCTTCATCGCGAAGCGAGAACAGCCCGATGTGTCGATCGAGGACCCGTTTGACCAGGACGACTGGAACTCGTGATCAATTACGCTGCCGTGGCCAGGACGTGCAGATGTGGGAGACTCACGGTGACAACCCACCCGTGTGAAGAAGGCATGAAAGGCTGCAACGCTTCTGCTGAAGGTGAACCAAATCGGTCGATCAGCGAGTCGATCGAGGCGTGACGATGGCTAAGAAGGCCGGCTGGGCGATCATGCGTCGCACCGTTCGGCGAGACCGAGGACACGTTCATCGCTGATGGCTGTGGGTCTGAGCGCTGGCCAGATCAAGACGGTGGACTCGGGTATCGGCATGACGAAGGCTGACTGATCAACAACTCGGACGATCGCCAAGTCTGGCACGAAGGCTTCATGGAGGCGTCCAGGCTGGCGCCGACATCAGATGATGGCCAGTTCGGTGTGGGTTTTACTCGGCGTACTCGTCGCGAAAGGTGATGTGCACTCGAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCGCTGCCGGCGGCTCGTTCACGGTGACGCCGACACGTCGGAGCCATTCCCGCGGCACGCGATGTGATGAAGCTGAAGGAGGACATGCTGAGTACCTGAGGAGCGCAAGCTGAAGGACTGGTGAAAAGCACTCGATTCATTGGCTTCCCGATAAGCTGTACGTGAGAAGACGGAGGAGAAGGAGTGACGGAGACGAGGAGGAGGAGAGAAGGAGGGGACGACAAGCCGACGGTCGAGGAGTCGAGGGCGAGAAGAAGAAGAAGACGAAGAAGATCAAGGAGGTGACCCACGAGTGGAACCACTGAACAGCCAGAAGCCCATCTGGATGCGCAAGCCGGAGGACGTGACCCACGAGGAGTACGCTCTTCTACAAGTCGCTGACGAAGACTGGGAGGAGCACGCTCGGTGAAGCACTTTTCGGTGGAGGGCAGCTGGAGTTAAGGCTGCTGTTCACCCGAAGCGGCGCCGTTGACATGTTCGAGGGGGGCCAAGAAGAAGTGAACAACATCAAGCTGTATGTGCGCGCGTGTTCATCATGGACAACTGCGAGGAGCTATGCCGAGTACCTGTCGTTCGTCAAGGGCGTTGTCGACTCGGAGGACCTGCCGCTAACATTTCGCGTGAGACGCTCCAGCAAACAAGATTCTCGCGTGATAAGAAAACCTGTGAAGAAGTGCTGGAGATGTTCGCGGAATGCGAGGACACGGAGAAGTACAACAAGTTTAGAGGCGTTCAGCAAGAACCTAAGCTGGGATCACGAGGACTCGACGAACCGACGAGATGCGAAGCTGCTGCGCTATCACTCGACGAAGTCGGGGAGGAGGTGACGTCCTGGAGACTACATCTCGCGCATGCCGGAGAACCAGCCGGGCATCTACTACGTGACGGGGAGAGCAAGAAGGCCGTGGAGAACTCGCCGTTATTGAGAAGCTGAAGAAGAAGGGTAGAGTGCTGTTCATGATCGACGCCATGACGAGTAGCGTCAGCAGCTAAGGAGTACGAGGGCAAGAAGCTATCTGGGACAAGGAGGGTCTAAGATGGAGGAGTCGGAGGACGAGAAGAACAGTAGAGGAGGCGAAGGCGCGACGAGGGTCTGTGCAAGCTGATGAAGGAGGTGCTCGACGACAAGGTGAGAAGGTGGAGATCTCGAACCGCATGTGGAGTCGCCGTGCGTGCTGTGACTGGGAGTACGGTGGTCGGCCAACATGGAGCGCATCATGAAGGCGCAGGCGCTGCGTGACCACACCTACACCTTCCACGTGACCGTTTTGTCGAGTATCCGTTTTTTAAACCTTACTGTGGGGACGAAAGTCCTCGCTTTACTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAACTTTTGAACGCATATTGCACTTTCGGGTTACGCCTGGAAGTATGCTGTATCAGTGTCCGTACACTAAACTTGCGTCTCTTCCGTCGTGTAGTCGTCGGTGTTTGATTCAGATGTGAGGTGTCTCGCGCGAGTCCCTTTAAAGTCGCGTGTTTTCCGTTTTGTGCTTGATGGGCGGCCGTGTCTGCGGTGACTTTGGCGATGGAGTGGATTGCTCGATTTGCGGTATGTTAGGCTTCGGCTGAGCTTATTGTGGTCGGTGGGTGCGTGTCTTTTCATCGCGTTTCGGTCGTCAATTTGGGTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGTTATCAGTGCAGCCGCGCGGGCCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCCTGCTGTGTGTTGTGCGTACGATGCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTGCCAGTGTCTATAATCTGCGGCATATTTCATTGTCGGATGCGGCCGTGCGGCCGTTTGGTAGTGGGTCTGCACCGCGTGTTGCTTGGTTTGTTTGGTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTGCTGGGAGGTAGGTCGGGGGTGCCCTCGGCTGTTATATCCTGGTGGACTAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGGGGTTTCTTCGTTTGGCGTCGGTTGGATAGCTTGCTATGCAGTTGGCGTTGTGTGCGGATGGATGTCTTTGCTAACTTGTTGCCGTTCGTCGAGGTGGTGGTGGCGCCGTCGGCGATCCACGCGGCCGAGGTGAAGCGCTCGCTGCGCGCGGACGTGCGCGTGAGGGCCAGGACGTGTGGAGCCAGGGCAACGGCGCGTTCACGGGCGAGACGTCGGCGGAGATGCTCAAGGAGCTGGCGCCGAGTAACGCTGGTGGGCCACTCGGAGCGTCGCCAAAGGGCGAGACAACGAGGTGGTGGCAAGAAGGCGCTACGCCTCGACAAGGGCCTCGGCGTCATGCGTGCATCGGCGAGACAAGGAGCAGCGCGAGTCAAGCAGACTGCGGTGGTGACGGAGCAGCTGACGCGTACGCCAAGCGTGAAGGACTGGTCGCGGTGTATCGCGTACGAGCCTGTGTGGGCTATCGGCACGGCTGACGCGACGCCCGACAGGCGCAGGAGGGCACGCGAGCATCCGCAACTGGCTGAAGACCAAGGTGAGCCAGTCCGCGCCGACTCGACCGATATTACGGCGGTTCGTGACGGCCGGCAACTCTGCGAGCTGTCGCAGAAGGCCGACATGACGGCTTCCTGGTGGTAGCCGGACTTCCTAAGATCATAACGCTCAAACCCACCGACAAGTCACGGAGCGTCAAGTGCGATCAACGGCTTCGGCCGTATCGGTCGCTCGTGTCGCTCTCCTCAACCCGTCGTGAACGTCGTGGCGATAACGACCGTTCATCGCTCCGCATACATGGATACATGCTCAAGTACGACACGGTGCACGGCACCTAAGGCGGACGTGAGCCACGAGACGAGCACGTGATCGTAGGCAAGAAATCCGGTGTAAAAAGCTGAACCTGCCGAGATCACGTGGACAAGGAGAGTGCATAGTGGTCGAGTCACTGGGCGTTCACACACGAGACGCGTCGGCCCACTCAAGAACGGTCGAAAGGTGTTATCTCTGCGCCGTCCAAGGACGCACCGATGTTCGTCGTTGGGTCAACCACGAGCTGTACGAGAAGGACATGCACGTGGTGTCAACGCTCGTGCACGACGAACTGTCTGGCGCCCTCGCGAAGGTGATCAACGACACGTTCGGCATAGGAGGGTCTGATGACGACGTGCACGCCGTACGCGACTCAGAAGACGTGGACGGTCCGTCGAAGAAGGACTGGCGGGCGGTCGTGGCGCGTGTTAACATCATCCCAGCTCACGGGCGCAAGGCGTGGGAAGGTCATCCCGTCGCTGAACGGCAAGCTCACGGGAATGTCTTCCGCGTGCCGACGCGACGTGTCGGTCGTGGACTCACGGCGCGCCTCAGAAGAAGGCGTCTACGAGAGATCAAGGCGCCGTCAACGGCAGCGAGACGAGCATGGCCGGCATCCTCGGCTACACGAGAGAGGTGTTCGAGGACTTTATGGGACTCTCTTCGTCATTTGAGCAGCGCGGAT ; END; BEGIN TREES; TITLE Phytophthora_spp._MP; LINK TAXA = Taxa1; TRANSLATE 1 Phytophthora_obscura_, 2 Phytophthora_sp._KPh2010_1_1_, 3 Phytophthora_sp._NBRC110062_, 4 Phytophthora_sp._KPh2010_4_1_, 5 Phytophthora_sp._KPh2011_1_1_, 6 Phytophthora_sp._KPh2013_1_1_, 7 Phytophthora_sp._NBRC110061, 8 Phytophthora_sp._KPh2013_4_1_, 9 Phytophthora_sp._CBS_137103, 10 Phytophthora_austrocedri, 11 Phytophthora_hibernalis_, 12 Phytophthora_lateralis_, 13 Phytophthora_trifolii_, 14 Phytophthora_porri_, 15 Phytophthora_primulae_, 16 Phytophthora_taxon_parsley_, 17 Phytophthora_taxon_castitis_, 18 Phytophthora_dauci_, 19 Phytophthora_brassicae_, 20 Phytophthora_lactucae_, 21 Phytophthora_cichorii_, 22 Phytophthora_sp._MAFF239556, 23 Phytophthora_cryptogea, 24 Phytophthora_drechsleri, 25 Phytophthora_erythroseptica, 26 Phytophthora_foliorum, 27 Phytophthora_kelmania, 28 Phytophthora_megasperma, 29 Phytophthora_medicaginis, 30 Phytophthora_ramorum, 31 Phytophthora_sansomeana, 32 Phytophthora_syringae; TREE PAUP_11 = [&R] (1:12.0,((((((2:0.0,3:0.0,4:0.0,5:0.0,6:0.0,7:0.0,8:0.0,9:0.0,22:0.0):8.0,17:6.0):2.0,((((14:6.0,(15:1.0,16:1.0):3.0):17.0,19:13.0):3.0,20:14.0):4.0,21:15.0):4.0):3.0,18:15.0):11.0,(((11:19.0,30:10.0):9.0,(12:16.0,26:19.0):4.0):7.0,(((((13:8.0,29:10.0):11.0,31:6.0):4.0,((23:0.0,25:0.0):11.0,27:4.0):9.0):4.0,24:7.0):10.0,28:27.0):8.0):9.0):11.0,32:11.0):7.0,10:12.0); END; BEGIN TREES; TITLE Phytophthora_spp._from_lettuce_ITS; LINK TAXA = Taxa2; TRANSLATE 1 Phytophthora_austrocedri, 2 Phytophthora_sp._CBS137103, 3 'Phytophthora sp. KPh2010-1-1 ', 4 Phytophthora_sp._NBRC110062, 5 'Phytophthora sp. KPh2010-4-1', 6 'Phytophthora sp. KPh2013-4-1 ', 7 'Phytophthora sp. KPh2011-1-1 ', 8 'Phytophthora sp. KPh2013-1-1 ', 9 Phytophthora_sp._NBRC110061, 10 Phytophthora_brassicae_, 11 Phytophthora_sp._MAFF239556, 12 Phytophthora_cichorii_, 13 Phytophthora_lactucae_, 14 Phytophthora_dauci_, 15 Phytophthora_taxon_castitis_, 16 Phytophthora_primulae_, 17 Phytophthora_porri_, 18 Phytophthora_taxon_parsley_, 19 Phytophthora_cryptogea_, 20 Phytophthora_drechsleri_, 21 Phytophthora_erythroseptica_, 22 Phytophthora_foliorum_, 23 Phytophthora_hibernalis_, 24 Phytophthora_lateralis_, 25 Phytophthora_megasperma_, 26 Phytophthora_medicaginis_, 27 Phytophthora_obscura_, 28 Phytophthora_ramorum_, 29 Phytophthora_sansomea, 30 Phytophthora_syringae_, 31 Phytophthora_trifolii, 32 Phytophthora_sp._kelmania_; TREE PAUP_8 = [&R] (1:23.0,(((((((2:0.0,(3:0.0,4:0.0):1.0,5:0.0,6:0.0,7:0.0,8:0.0,9:0.0,11:0.0,13:0.0):2.0,15:2.0):1.0,(14:0.0,17:0.0):2.0):1.0,10:10.0):2.0,(12:8.0,(16:0.0,18:0.0):12.0):3.0):55.0,(((((19:3.0,21:0.0):1.0,(20:14.0,32:3.0):1.0):4.0,((26:3.0,31:10.0):6.0,29:4.0):1.0):29.0,(22:6.0,((23:41.0,24:2.0):6.0,28:3.0):20.0):32.0):34.0,25:86.0):32.0):35.0,30:12.0):6.0,27:12.0); END; BEGIN TREES; TITLE Phytophthora_spp._from_lily; LINK TAXA = Taxa3; TRANSLATE 1 Phytopythium_vexans, 2 Phytophthora_sp._EL8701, 3 Phytophthora_sp._EL8703, 4 Phytophthora_bisheria, 5 Phytophthora_boehmeriae, 6 Phytophthora_botryosa, 7 Phytophthora_brassicae, 8 Phytophthora_cactorum, 9 Phytophthora_cajani, 10 Phytophthora_cambivora, 11 Phytophthora_capsici, 12 Phytophthora_cinnamomi, 13 Phytophthora_cinnamomi_var._parvispora, 14 Phytophthora_clandestina, 15 Phytophthora_colocasiae, 16 Phytophthora_cryptogea, 17 Phytophthora_cuyabensis, 18 Phytophthora_drechsleri, 19 Phytophthora_erythroseptica, 20 Phytophthora_europaea, 21 Phytophthora_fallax, 22 Phytophthora_foliorum, 23 Phytophthora_fragariae, 24 Phytophthora_glovera, 25 Phytophthora_gonapodyides, 26 Phytophthora_heveae, 27 Phytophthora_hibernalis, 28 Phytophthora_humicola, 29 Phytophthora_idaei, 30 Phytophthora_ilicis, 31 Phytophthora_infestans, 32 Phytophthora_insolita, 33 Phytophthora_inundata, 34 Phytophthora_ipomoeae, 35 Phytophthora_iranica, 36 Phytophthora_katsurae, 37 Phytophthora_kernoviae, 38 Phytophthora_macrochlamydospora, 39 Phytophthora_meadii, 40 Phytophthora_megakarya, 41 Phytophthora_megasperma, 42 Phytophthora_melonis, 43 Phytophthora_mexicana, 44 Phytophthora_multivesiculata, 45 Phytophthora_multivora, 46 Phytophthora_nemorosa, 47 Phytophthora_nicotianae, 48 Phytophthora_niederhauserii, 49 Phytophthora_palmivora, 50 Phytiophthora_phaseoli, 51 Phytophthora_porri, 52 Phytophthora_primulae, 53 Phytophthora_pseudosyringae, 54 Phytophthora_pseudotsugae, 55 Phytophthora_psychrophila, 56 Phytophhtora_ramorum, 57 Phytophthora_sansomea, 58 Phytophthora_sinensis, 59 Phytophthora_sojae, 60 Phytophthora_syringae, 61 Phytophthora_tentaculata, 62 Phytophthora_trifolii, 63 Phytophthora_uliginosa, 64 Phytophthora_vignae, 65 Phytophthora_sp._kelmania; TREE con_50_majrule = [&R] (1:0.639731,((((2:5.85E-4,3:2.62E-4):0.074726,(25:0.030909,((28:0.009324,33:0.004218):0.065753,41:0.053154):0.00818):0.074267):0.01115,(((((4:0.088186,((((6:0.013919,15:0.017328):0.003138,39:0.009774):0.037721,((11:0.002758,43:0.002683):0.003036,24:0.008995):0.035874):0.016268,45:0.036496):0.025873):0.012774,44:0.069966):0.020192,(((8:0.010855,29:0.011437):0.001603,54:0.005208):0.042827,((((14:0.026,35:0.017659):0.016742,61:0.049104):0.030883,((31:0.007249,34:0.008199):0.003189,50:0.015273):0.083069):0.012317,47:0.084945):0.013645):0.039398):0.008188,((30:0.012101,(46:0.008492,55:0.010366):0.001148):0.007705,53:0.019241):0.068641):0.010946,((26:0.008902,36:0.011481):0.061097,(40:0.11559,49:0.09672):0.034285):0.015102):0.015749):0.00571,(((((7:0.028821,(51:0.041099,52:0.075996):0.006997):0.115079,60:0.072888):0.03053,(22:0.040237,(27:0.101369,56:0.03332):0.017726):0.00956):0.008508,((((16:0.003816,19:0.004838):0.01734,65:0.005875):0.005847,18:0.018925):0.002605,(57:0.009006,62:0.048223):0.003334):0.041672):0.031447,(((((9:0.00466,64:0.005731):0.008093,(42:0.001516,58:0.001816):0.009106):0.0088,(48:0.009407,59:0.016737):0.007897):0.016137,(12:0.019674,13:0.01994):0.024928):0.008246,(((10:0.007485,23:0.015115):0.016316,20:0.014936):0.004402,63:0.011594):0.028283):0.037836):0.010138):0.026675,((5:0.064057,37:0.104954):0.091924,((17:0.084281,32:0.078938):0.013291,(21:0.117219,38:0.111121):0.013211):0.022708):0.036586); TREE con_50_majrule = [&R] (1:0.639731,((((2:5.85E-4,3:2.62E-4)1.00:0.074726,(25:0.030909,((28:0.009324,33:0.004218)1.00:0.065753,41:0.053154)0.91:0.00818)1.00:0.074267)0.81:0.01115,(((((4:0.088186,((((6:0.013919,15:0.017328)0.74:0.003138,39:0.009774)1.00:0.037721,((11:0.002758,43:0.002683)1.00:0.003036,24:0.008995)1.00:0.035874)1.00:0.016268,45:0.036496)1.00:0.025873)1.00:0.012774,44:0.069966)1.00:0.020192,(((8:0.010855,29:0.011437)0.76:0.001603,54:0.005208)1.00:0.042827,((((14:0.026,35:0.017659)1.00:0.016742,61:0.049104)1.00:0.030883,((31:0.007249,34:0.008199)1.00:0.003189,50:0.015273)1.00:0.083069)1.00:0.012317,47:0.084945)1.00:0.013645)1.00:0.039398)0.69:0.008188,((30:0.012101,(46:0.008492,55:0.010366)0.82:0.001148)1.00:0.007705,53:0.019241)1.00:0.068641)0.65:0.010946,((26:0.008902,36:0.011481)1.00:0.061097,(40:0.11559,49:0.09672)1.00:0.034285)0.98:0.015102)0.91:0.015749)0.71:0.00571,(((((7:0.028821,(51:0.041099,52:0.075996)0.50:0.006997)1.00:0.115079,60:0.072888)1.00:0.03053,(22:0.040237,(27:0.101369,56:0.03332)1.00:0.017726)1.00:0.00956)1.00:0.008508,((((16:0.003816,19:0.004838)1.00:0.01734,65:0.005875)1.00:0.005847,18:0.018925)0.98:0.002605,(57:0.009006,62:0.048223)0.97:0.003334)1.00:0.041672)1.00:0.031447,(((((9:0.00466,64:0.005731)1.00:0.008093,(42:0.001516,58:0.001816)1.00:0.009106)1.00:0.0088,(48:0.009407,59:0.016737)1.00:0.007897)1.00:0.016137,(12:0.019674,13:0.01994)1.00:0.024928)1.00:0.008246,(((10:0.007485,23:0.015115)1.00:0.016316,20:0.014936)0.78:0.004402,63:0.011594)1.00:0.028283)1.00:0.037836)0.88:0.010138)1.00:0.026675,((5:0.064057,37:0.104954)1.00:0.091924,((17:0.084281,32:0.078938)1.00:0.013291,(21:0.117219,38:0.111121)1.00:0.013211)1.00:0.022708)1.00:0.036586); END;