#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:21 GMT TreeBASE (cc) 1994-2008 Study reference: Woudenberg J., Truter M., Groenewald J.Z., & Crous P.W. 2014. Large-spored Alternaria pathogens in section Porri disentangled. Studies in Mycology, 79. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15701] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=182; TAXLABELS Alternaria_acalyphicola_CBS_541_94 Alternaria_agerati_CBS_117221 Alternaria_agripestis_CBS_577_94 Alternaria_allii_CBS_107_28_ Alternaria_allii_CBS_109_41_ Alternaria_allii_CBS_116701 Alternaria_allii_CBS_121345 Alternaria_allii_CBS_225_76 Alternaria_alternariacida_CBS_105_51 Alternaria_anagallidis_CBS_101004_ Alternaria_anagallidis_CBS_107_44_ Alternaria_anagallidis_CBS_117128 Alternaria_anagallidis_CBS_117129 Alternaria_anodae_PPRI_12376 Alternaria_aragakii_CBS_594_93 Alternaria_argyroxiphii_CBS_117222 Alternaria_argyroxiphii_PPRI_11848 Alternaria_argyroxiphii_PPRI_11971 Alternaria_azadirachtae_CBS_116444 Alternaria_azadirachtae_CBS_116445 Alternaria_bataticola_CBS_117095 Alternaria_bataticola_CBS_117096 Alternaria_bataticola_CBS_531_63 Alternaria_bataticola_CBS_532_63_ Alternaria_bataticola_PPRI_10502 Alternaria_bataticola_PPRI_11930 Alternaria_bataticola_PPRI_11931 Alternaria_bataticola_PPRI_11934 Alternaria_blumeae_CBS_117215 Alternaria_blumeae_CBS_117364 Alternaria_calendulae_CBS_101498_ Alternaria_calendulae_CBS_116439_ Alternaria_calendulae_CBS_116650 Alternaria_calendulae_CBS_224_76 Alternaria_carthami_CBS_116440 Alternaria_carthami_CBS_117091 Alternaria_carthami_CBS_635_80 Alternaria_carthamicola_CBS_117092 Alternaria_cassiae_CBS_116119_ Alternaria_cassiae_CBS_117224 Alternaria_cassiae_CBS_117369 Alternaria_cassiae_CBS_478_81 Alternaria_catananches_CBS_137456 Alternaria_centaureae_CBS_116446 Alternaria_cichorii_CBS_102_33_ Alternaria_cichorii_CBS_117218 Alternaria_cirsinoxia_CBS_113261_ Alternaria_citrullicola_CBS_103_32 Alternaria_crassa_CBS_103_18_ Alternaria_crassa_CBS_109160_ Alternaria_crassa_CBS_109162_ Alternaria_crassa_CBS_110_38_ Alternaria_crassa_CBS_116647 Alternaria_crassa_CBS_116648 Alternaria_crassa_CBS_122590 Alternaria_cucumerina_CBS_116114_ Alternaria_cucumerina_CBS_117225 Alternaria_cucumerina_CBS_117226 Alternaria_cyamopsidis_CBS_117219 Alternaria_cyamopsidis_CBS_364_67 Alternaria_dauci_CBS_101592_ Alternaria_dauci_CBS_106_48_ Alternaria_dauci_CBS_111_38_ Alternaria_dauci_CBS_117097 Alternaria_dauci_CBS_117098 Alternaria_dauci_CBS_117099 Alternaria_dauci_CBS_117100 Alternaria_dauci_CBS_345_79 Alternaria_dauci_CBS_477_83 Alternaria_deserticola_CBS_110799_ Alternaria_dichondrae_CBS_117127 Alternaria_dichondrae_CBS_199_74 Alternaria_dichondrae_CBS_200_74 Alternaria_dichondrae_CBS_346_79 Alternaria_echinaceae_CBS_116117_ Alternaria_echinaceae_CBS_116118_ Alternaria_euphorbiicola_CBS_119410 Alternaria_euphorbiicola_CBS_133874 Alternaria_euphorbiicola_CBS_198_86 Alternaria_grandis_CBS_109158_ Alternaria_grandis_CBS_116695 Alternaria_gypsophilae_CBS_107_41_ Alternaria_ipomoeae_CBS_219_79_ Alternaria_ipomoeae_PPRI_8988 Alternaria_jesenskae_CBS_133855 Alternaria_limicola_CBS_117360 Alternaria_limicola_CBS_483_90 Alternaria_linariae_CBS_105_41 Alternaria_linariae_CBS_107_61 Alternaria_linariae_CBS_108_53 Alternaria_linariae_CBS_109156 Alternaria_linariae_CBS_109161_ Alternaria_linariae_CBS_109164_ Alternaria_linariae_CBS_116438 Alternaria_linariae_CBS_116441 Alternaria_linariae_CBS_116704 Alternaria_linariae_CPC_21620 Alternaria_macrospora_CBS_106_29_ Alternaria_macrospora_CBS_117228 Alternaria_montanica_CBS_121343 Alternaria_multirostrata_CBS_712_68 Alternaria_multirostrata_CBS_713_68 Alternaria_neoipomoeae_PPRI_11845 Alternaria_neoipomoeae_PPRI_11847 Alternaria_neoipomoeae_PPRI_13903 Alternaria_neoipomoeae_PPRI_8990 Alternaria_nitrimali_CBS_109163_ Alternaria_novae_guineensis_CBS_116120_ Alternaria_novae_guineensis_PPRI_12171 Alternaria_obtecta_CBS_117367 Alternaria_obtecta_CBS_134278 Alternaria_paralinicola_CBS_116652 Alternaria_passiflorae_CBS_113_38 Alternaria_passiflorae_CBS_116333_ Alternaria_passiflorae_CBS_117102 Alternaria_passiflorae_CBS_117103 Alternaria_passiflorae_CBS_166_77 Alternaria_passiflorae_CBS_629_93 Alternaria_passiflorae_CBS_630_93_ Alternaria_pipionipisi_CBS_116115_ Alternaria_pipionipisi_CBS_117365 Alternaria_pipionipisi_CBS_134265 Alternaria_porri_CBS_116649 Alternaria_porri_CBS_116698 Alternaria_porri_CBS_116699 Alternaria_protenta_CBS_116437 Alternaria_protenta_CBS_116651 Alternaria_protenta_CBS_116696 Alternaria_protenta_CBS_116697 Alternaria_protenta_CBS_121342 Alternaria_protenta_CBS_135189 Alternaria_protenta_CBS_347_79 Alternaria_pseudorostrata_CBS_119411 Alternaria_ranunculi_CBS_116330_ Alternaria_ricini_CBS_117361 Alternaria_ricini_CBS_215_31_ Alternaria_ricini_CBS_353_86 Alternaria_rostellata_CBS_117366 Alternaria_scorzonerae_CBS_103_46_ Alternaria_scorzonerae_CBS_116703 Alternaria_scorzonerae_CBS_478_83 Alternaria_sennae_CBS_477_81 Alternaria_sesami_CBS_240_73 Alternaria_sesami_CBS115264_ Alternaria_sidae_CBS_117730 Alternaria_silybi_CBS_134092 Alternaria_silybi_CBS_134093 Alternaria_silybi_CBS_134094 Alternaria_solani_CBS_106_21 Alternaria_solani_CBS_109157 Alternaria_solani_CBS_111_41_ Alternaria_solani_CBS_111_44_ Alternaria_solani_CBS_116442 Alternaria_solani_nigri_CBS_109155_ Alternaria_solani_nigri_CBS_113403_ Alternaria_solani_nigri_CBS_116332 Alternaria_solani_nigri_CBS_116334 Alternaria_solani_nigri_CBS_116447 Alternaria_solani_nigri_CBS_121347 Alternaria_solani_nigri_CBS117101 Alternaria_steviae_CBS_117362 Alternaria_steviae_CBS_631_88 Alternaria_steviae_CBS_632_88 Alternaria_tagetica_CBS_117217 Alternaria_tagetica_CBS_297_79 Alternaria_tagetica_CBS_298_79 Alternaria_tagetica_CBS_479_81 Alternaria_tagetica_CBS_480_81 Alternaria_thunbergiae_CBS_120986 Alternaria_thunbergiae_CBS_122597 Alternaria_thunbergiae_CBS116331_ Alternaria_tillandsiae_CBS_116116_ Alternaria_tropica_CBS_117216 Alternaria_tropica_CBS_631_93 Alternaria_venezuelensis_CBS_116121_ Alternaria_zinniae_CBS_107_48_ Alternaria_zinniae_CBS_108_61_ Alternaria_zinniae_CBS_117_59 Alternaria_zinniae_CBS_117223 Alternaria_zinniae_CBS_118_44 Alternaria_zinniae_CBS_299_79 Alternaria_zinniae_CBS_300_79 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=183; TAXLABELS Alternaria_acalyphicola_CBS_541_94 Alternaria_agerati_CBS_117221 Alternaria_agripestis_CBS_577_94 Alternaria_allii_CBS_107_28_ Alternaria_allii_CBS_109_41_ Alternaria_allii_CBS_116701 Alternaria_allii_CBS_121345 Alternaria_allii_CBS_225_76 Alternaria_alternariacida_CBS_105_51 Alternaria_anagallidis_CBS_101004_ Alternaria_anagallidis_CBS_107_44_ Alternaria_anagallidis_CBS_117128 Alternaria_anagallidis_CBS_117129 Alternaria_anodae_PPRI_12376 Alternaria_aragakii_CBS_594_93 Alternaria_argyroxiphii_CBS_117222 Alternaria_argyroxiphii_PPRI_11848 Alternaria_argyroxiphii_PPRI_11971 Alternaria_azadirachtae_CBS_116444 Alternaria_azadirachtae_CBS_116445 Alternaria_bataticola_CBS_117095 Alternaria_bataticola_CBS_117096 Alternaria_bataticola_CBS_531_63 Alternaria_bataticola_CBS_532_63_ Alternaria_bataticola_PPRI_10502 Alternaria_bataticola_PPRI_11930 Alternaria_bataticola_PPRI_11931 Alternaria_bataticola_PPRI_11934 Alternaria_blumeae_CBS_117215 Alternaria_blumeae_CBS_117364 Alternaria_calendulae_CBS_101498_ Alternaria_calendulae_CBS_116439_ Alternaria_calendulae_CBS_116650 Alternaria_calendulae_CBS_224_76 Alternaria_carthami_CBS_116440 Alternaria_carthami_CBS_117091 Alternaria_carthami_CBS_635_80 Alternaria_carthamicola_CBS_117092 Alternaria_cassiae_CBS_116119_ Alternaria_cassiae_CBS_117224 Alternaria_cassiae_CBS_117369 Alternaria_cassiae_CBS_478_81 Alternaria_catananches_CBS_137456 Alternaria_centaureae_CBS_116446 Alternaria_cichorii_CBS_102_33_ Alternaria_cichorii_CBS_117218 Alternaria_cirsinoxia_CBS_113261_ Alternaria_citrullicola_CBS_103_32 Alternaria_conidiophora_CBS_137457 Alternaria_crassa_CBS_103_18_ Alternaria_crassa_CBS_109160_ Alternaria_crassa_CBS_109162_ Alternaria_crassa_CBS_110_38_ Alternaria_crassa_CBS_116647 Alternaria_crassa_CBS_116648 Alternaria_crassa_CBS_122590 Alternaria_cucumerina_CBS_116114_ Alternaria_cucumerina_CBS_117225 Alternaria_cucumerina_CBS_117226 Alternaria_cyamopsidis_CBS_117219 Alternaria_cyamopsidis_CBS_364_67 Alternaria_dauci_CBS_101592_ Alternaria_dauci_CBS_106_48_ Alternaria_dauci_CBS_111_38_ Alternaria_dauci_CBS_117097 Alternaria_dauci_CBS_117098 Alternaria_dauci_CBS_117099 Alternaria_dauci_CBS_117100 Alternaria_dauci_CBS_345_79 Alternaria_dauci_CBS_477_83 Alternaria_deserticola_CBS_110799_ Alternaria_dichondrae_CBS_117127 Alternaria_dichondrae_CBS_199_74 Alternaria_dichondrae_CBS_200_74 Alternaria_dichondrae_CBS_346_79 Alternaria_echinaceae_CBS_116117_ Alternaria_echinaceae_CBS_116118_ Alternaria_euphorbiicola_CBS_119410 Alternaria_euphorbiicola_CBS_133874 Alternaria_euphorbiicola_CBS_198_86 Alternaria_grandis_CBS_109158_ Alternaria_grandis_CBS_116695 Alternaria_gypsophilae_CBS_107_41_ Alternaria_ipomoeae_CBS_219_79_ Alternaria_ipomoeae_PPRI_8988 Alternaria_jesenskae_CBS_133855 Alternaria_limicola_CBS_117360 Alternaria_limicola_CBS_483_90 Alternaria_linariae_CBS_105_41 Alternaria_linariae_CBS_107_61 Alternaria_linariae_CBS_108_53 Alternaria_linariae_CBS_109156 Alternaria_linariae_CBS_109161_ Alternaria_linariae_CBS_109164_ Alternaria_linariae_CBS_116438 Alternaria_linariae_CBS_116441 Alternaria_linariae_CBS_116704 Alternaria_linariae_CPC_21620 Alternaria_macrospora_CBS_106_29_ Alternaria_macrospora_CBS_117228 Alternaria_montanica_CBS_121343 Alternaria_multirostrata_CBS_712_68 Alternaria_multirostrata_CBS_713_68 Alternaria_neoipomoeae_PPRI_11845 Alternaria_neoipomoeae_PPRI_11847 Alternaria_neoipomoeae_PPRI_13903 Alternaria_neoipomoeae_PPRI_8990 Alternaria_nitrimali_CBS_109163_ Alternaria_novae_guineensis_CBS_116120_ Alternaria_novae_guineensis_PPRI_12171 Alternaria_obtecta_CBS_117367 Alternaria_obtecta_CBS_134278 Alternaria_paralinicola_CBS_116652 Alternaria_passiflorae_CBS_113_38 Alternaria_passiflorae_CBS_116333_ Alternaria_passiflorae_CBS_117102 Alternaria_passiflorae_CBS_117103 Alternaria_passiflorae_CBS_166_77 Alternaria_passiflorae_CBS_629_93 Alternaria_passiflorae_CBS_630_93_ Alternaria_pipionipisi_CBS_116115_ Alternaria_pipionipisi_CBS_117365 Alternaria_pipionipisi_CBS_134265 Alternaria_porri_CBS_116649 Alternaria_porri_CBS_116698 Alternaria_porri_CBS_116699 Alternaria_protenta_CBS_116437 Alternaria_protenta_CBS_116651 Alternaria_protenta_CBS_116696 Alternaria_protenta_CBS_116697 Alternaria_protenta_CBS_121342 Alternaria_protenta_CBS_135189 Alternaria_protenta_CBS_347_79 Alternaria_pseudorostrata_CBS_119411 Alternaria_ranunculi_CBS_116330_ Alternaria_ricini_CBS_117361 Alternaria_ricini_CBS_215_31_ Alternaria_ricini_CBS_353_86 Alternaria_rostellata_CBS_117366 Alternaria_scorzonerae_CBS_103_46_ Alternaria_scorzonerae_CBS_116703 Alternaria_scorzonerae_CBS_478_83 Alternaria_sennae_CBS_477_81 Alternaria_sesami_CBS_240_73 Alternaria_sesami_CBS115264_ Alternaria_sidae_CBS_117730 Alternaria_silybi_CBS_134092 Alternaria_silybi_CBS_134093 Alternaria_silybi_CBS_134094 Alternaria_solani_CBS_106_21 Alternaria_solani_CBS_109157 Alternaria_solani_CBS_111_41_ Alternaria_solani_CBS_111_44_ Alternaria_solani_CBS_116442 Alternaria_solani_nigri_CBS_109155_ Alternaria_solani_nigri_CBS_113403_ Alternaria_solani_nigri_CBS_116332 Alternaria_solani_nigri_CBS_116334 Alternaria_solani_nigri_CBS_116447 Alternaria_solani_nigri_CBS_121347 Alternaria_solani_nigri_CBS117101 Alternaria_steviae_CBS_117362 Alternaria_steviae_CBS_631_88 Alternaria_steviae_CBS_632_88 Alternaria_tagetica_CBS_117217 Alternaria_tagetica_CBS_297_79 Alternaria_tagetica_CBS_298_79 Alternaria_tagetica_CBS_479_81 Alternaria_tagetica_CBS_480_81 Alternaria_thunbergiae_CBS_120986 Alternaria_thunbergiae_CBS_122597 Alternaria_thunbergiae_CBS116331_ Alternaria_tillandsiae_CBS_116116_ Alternaria_tropica_CBS_117216 Alternaria_tropica_CBS_631_93 Alternaria_venezuelensis_CBS_116121_ Alternaria_zinniae_CBS_107_48_ Alternaria_zinniae_CBS_108_61_ Alternaria_zinniae_CBS_117_59 Alternaria_zinniae_CBS_117223 Alternaria_zinniae_CBS_118_44 Alternaria_zinniae_CBS_299_79 Alternaria_zinniae_CBS_300_79 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=181; TAXLABELS Alternaria_acalyphicola_CBS_541_94 Alternaria_agerati_CBS_117221 Alternaria_agripestis_CBS_577_94 Alternaria_allii_CBS_107_28_ Alternaria_allii_CBS_109_41_ Alternaria_allii_CBS_116701 Alternaria_allii_CBS_121345 Alternaria_allii_CBS_225_76 Alternaria_alternariacida_CBS_105_51 Alternaria_anagallidis_CBS_101004_ Alternaria_anagallidis_CBS_107_44_ Alternaria_anagallidis_CBS_117128 Alternaria_anagallidis_CBS_117129 Alternaria_anodae_PPRI_12376 Alternaria_aragakii_CBS_594_93 Alternaria_argyroxiphii_CBS_117222 Alternaria_argyroxiphii_PPRI_11848 Alternaria_argyroxiphii_PPRI_11971 Alternaria_azadirachtae_CBS_116444 Alternaria_azadirachtae_CBS_116445 Alternaria_bataticola_CBS_117095 Alternaria_bataticola_CBS_117096 Alternaria_bataticola_CBS_531_63 Alternaria_bataticola_CBS_532_63_ Alternaria_bataticola_PPRI_10502 Alternaria_bataticola_PPRI_11930 Alternaria_bataticola_PPRI_11931 Alternaria_bataticola_PPRI_11934 Alternaria_blumeae_CBS_117215 Alternaria_blumeae_CBS_117364 Alternaria_calendulae_CBS_101498_ Alternaria_calendulae_CBS_116439_ Alternaria_calendulae_CBS_116650 Alternaria_calendulae_CBS_224_76 Alternaria_carthami_CBS_116440 Alternaria_carthami_CBS_117091 Alternaria_carthami_CBS_635_80 Alternaria_carthamicola_CBS_117092 Alternaria_cassiae_CBS_116119_ Alternaria_cassiae_CBS_117224 Alternaria_cassiae_CBS_117369 Alternaria_cassiae_CBS_478_81 Alternaria_catananches_CBS_137456 Alternaria_centaureae_CBS_116446 Alternaria_cichorii_CBS_102_33_ Alternaria_cichorii_CBS_117218 Alternaria_cirsinoxia_CBS_113261_ Alternaria_citrullicola_CBS_103_32 Alternaria_conidiophora_CBS_137457 Alternaria_crassa_CBS_103_18_ Alternaria_crassa_CBS_109160_ Alternaria_crassa_CBS_109162_ Alternaria_crassa_CBS_110_38_ Alternaria_crassa_CBS_116647 Alternaria_crassa_CBS_116648 Alternaria_crassa_CBS_122590 Alternaria_cucumerina_CBS_116114_ Alternaria_cucumerina_CBS_117225 Alternaria_cucumerina_CBS_117226 Alternaria_cyamopsidis_CBS_117219 Alternaria_cyamopsidis_CBS_364_67 Alternaria_dauci_CBS_101592_ Alternaria_dauci_CBS_106_48_ Alternaria_dauci_CBS_111_38_ Alternaria_dauci_CBS_117097 Alternaria_dauci_CBS_117098 Alternaria_dauci_CBS_117099 Alternaria_dauci_CBS_117100 Alternaria_dauci_CBS_345_79 Alternaria_dauci_CBS_477_83 Alternaria_deserticola_CBS_110799_ Alternaria_dichondrae_CBS_117127 Alternaria_dichondrae_CBS_199_74 Alternaria_dichondrae_CBS_200_74 Alternaria_dichondrae_CBS_346_79 Alternaria_echinaceae_CBS_116117_ Alternaria_echinaceae_CBS_116118_ Alternaria_euphorbiicola_CBS_133874 Alternaria_euphorbiicola_CBS_198_86 Alternaria_grandis_CBS_109158_ Alternaria_grandis_CBS_116695 Alternaria_gypsophilae_CBS_107_41_ Alternaria_ipomoeae_CBS_219_79_ Alternaria_ipomoeae_PPRI_8988 Alternaria_jesenskae_CBS_133855 Alternaria_limicola_CBS_483_90 Alternaria_linariae_CBS_105_41 Alternaria_linariae_CBS_107_61 Alternaria_linariae_CBS_108_53 Alternaria_linariae_CBS_109156 Alternaria_linariae_CBS_109161_ Alternaria_linariae_CBS_109164_ Alternaria_linariae_CBS_116438 Alternaria_linariae_CBS_116441 Alternaria_linariae_CBS_116704 Alternaria_linariae_CPC_21620 Alternaria_macrospora_CBS_106_29_ Alternaria_macrospora_CBS_117228 Alternaria_montanica_CBS_121343 Alternaria_multirostrata_CBS_712_68 Alternaria_multirostrata_CBS_713_68 Alternaria_neoipomoeae_PPRI_11845 Alternaria_neoipomoeae_PPRI_11847 Alternaria_neoipomoeae_PPRI_13903 Alternaria_neoipomoeae_PPRI_8990 Alternaria_nitrimali_CBS_109163_ Alternaria_novae_guineensis_CBS_116120_ Alternaria_novae_guineensis_PPRI_12171 Alternaria_obtecta_CBS_117367 Alternaria_obtecta_CBS_134278 Alternaria_paralinicola_CBS_116652 Alternaria_passiflorae_CBS_113_38 Alternaria_passiflorae_CBS_116333_ Alternaria_passiflorae_CBS_117102 Alternaria_passiflorae_CBS_117103 Alternaria_passiflorae_CBS_166_77 Alternaria_passiflorae_CBS_629_93 Alternaria_passiflorae_CBS_630_93_ Alternaria_pipionipisi_CBS_116115_ Alternaria_pipionipisi_CBS_117365 Alternaria_pipionipisi_CBS_134265 Alternaria_porri_CBS_116649 Alternaria_porri_CBS_116698 Alternaria_porri_CBS_116699 Alternaria_protenta_CBS_116437 Alternaria_protenta_CBS_116651 Alternaria_protenta_CBS_116696 Alternaria_protenta_CBS_116697 Alternaria_protenta_CBS_121342 Alternaria_protenta_CBS_135189 Alternaria_protenta_CBS_347_79 Alternaria_pseudorostrata_CBS_119411 Alternaria_ranunculi_CBS_116330_ Alternaria_ricini_CBS_117361 Alternaria_ricini_CBS_215_31_ Alternaria_ricini_CBS_353_86 Alternaria_rostellata_CBS_117366 Alternaria_scorzonerae_CBS_103_46_ Alternaria_scorzonerae_CBS_116703 Alternaria_scorzonerae_CBS_478_83 Alternaria_sennae_CBS_477_81 Alternaria_sesami_CBS_240_73 Alternaria_sesami_CBS115264_ Alternaria_sidae_CBS_117730 Alternaria_silybi_CBS_134092 Alternaria_silybi_CBS_134093 Alternaria_silybi_CBS_134094 Alternaria_solani_CBS_106_21 Alternaria_solani_CBS_109157 Alternaria_solani_CBS_111_41_ Alternaria_solani_CBS_111_44_ Alternaria_solani_CBS_116442 Alternaria_solani_nigri_CBS_109155_ Alternaria_solani_nigri_CBS_113403_ Alternaria_solani_nigri_CBS_116332 Alternaria_solani_nigri_CBS_116334 Alternaria_solani_nigri_CBS_116447 Alternaria_solani_nigri_CBS_121347 Alternaria_solani_nigri_CBS117101 Alternaria_steviae_CBS_117362 Alternaria_steviae_CBS_631_88 Alternaria_steviae_CBS_632_88 Alternaria_tagetica_CBS_117217 Alternaria_tagetica_CBS_297_79 Alternaria_tagetica_CBS_298_79 Alternaria_tagetica_CBS_479_81 Alternaria_tagetica_CBS_480_81 Alternaria_thunbergiae_CBS_120986 Alternaria_thunbergiae_CBS_122597 Alternaria_thunbergiae_CBS116331_ Alternaria_tillandsiae_CBS_116116_ Alternaria_tropica_CBS_117216 Alternaria_tropica_CBS_631_93 Alternaria_venezuelensis_CBS_116121_ Alternaria_zinniae_CBS_107_48_ Alternaria_zinniae_CBS_108_61_ Alternaria_zinniae_CBS_117_59 Alternaria_zinniae_CBS_117223 Alternaria_zinniae_CBS_118_44 Alternaria_zinniae_CBS_299_79 Alternaria_zinniae_CBS_300_79 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23603] TITLE 'Large-spored Alternaria pathogens in section Porri ITS GAPDH RPB2 TEF1 Alta1'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=2722; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_acalyphicola_CBS_541_94 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCGCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTTTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGATCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCTATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACCACC-TTTTATATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_agerati_CBS_117221 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTGGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAACTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAATGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCCACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_agripestis_CBS_577_94 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCCTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCCACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTGTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAATGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_allii_CBS_107_28_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAGTCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCGGAATGCAGGCTAACAAATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCTAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGTCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTCGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCACGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_allii_CBS_109_41_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAGTCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCGGAATGCAGGCTAACAAATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCTAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGTCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTCGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCACGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_allii_CBS_116701 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAGTCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCGGAATGCAGGCTAACAAATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCTAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGTCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTCGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCACGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_allii_CBS_121345 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAGTCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCGGAATGCAGGCTAACAAATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCTAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGTCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTCGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCACGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_allii_CBS_225_76 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAGTCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCGGAATGCAGGCTAACAAATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCTAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGTCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTCGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCACGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_alternariacida_CBS_105_51 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTTGTTGAAAACGACATCCGAAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCCGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_anagallidis_CBS_101004_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCCATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTTTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCCATGACATCACTTT--TTCTTTCACATGGACTGCCGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGGACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCACTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCAAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCACGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATAGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_anagallidis_CBS_107_44_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCCATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGCGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAGCCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCCATGACATCACTTT--TTCTTTCACATGGACTGCCGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGGACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCACTCTTCGCCGCCGCCGGCCTTGCTGCCGCCGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCAAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCACGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATAGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_anagallidis_CBS_117128 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCCATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTTTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCCATGACATCACTTT--TTCTTTCACATGGACTGCCGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGGACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCACTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCAAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCACGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATAGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_anagallidis_CBS_117129 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCCATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTTTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCCATGACATCACTTT--TTCTTTCACATGGACTGCCGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGGACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCACTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCAAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCACGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATAGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_anodae_PPRI_12376 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTCTTGT---CTCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGCCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGGGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTTTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCCAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGCACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGACGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCATAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTATATTCAGATATACTAACTT--CTGCCTAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_aragakii_CBS_594_93 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT--CCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACTCTACCCAGGCGCCTACATGGGGAGCGCTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTCGTCTGCACTGGTGTCTCT Alternaria_argyroxiphii_CBS_117222 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCTCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGATA-TTAGCCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATCGATTCAGCTACTTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTTGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCAGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGTCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTGCAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCTCTC-GCGCTTTTCGCTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_argyroxiphii_PPRI_11848 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCTCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGATA-TTAGCCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATCGATTCAGCTACTTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTTGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCAGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTGCAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCTCTC-GCGCTTTTCGCTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_argyroxiphii_PPRI_11971 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCA{GT}CCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCTCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGATA-TTAGCCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATCGATTCAGCTACTTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTTGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCAGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTGCAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCTCTC-GCGCTTTTCGCTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_azadirachtae_CBS_116444 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTTTTTTTGT---CCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAGCAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTTTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAGAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACTCTACCCAGGCGCCTACATGGGGAGCGCTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_azadirachtae_CBS_116445 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTTTTTTTGT---CCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAGCAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTTTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAGAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACTCTACCCAGGCGCCTACATGGGGAGCGCTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_bataticola_CBS_117095 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTTCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATATAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGTATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCGGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCTACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCTGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTCCC-TTTTACATTGAGATATGCTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_bataticola_CBS_117096 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTTCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATATAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGTATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCGGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCTACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCTGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTCCC-TTTTACATTGAGATATGCTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_bataticola_CBS_531_63 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTTCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATATAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGTATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCGGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCTACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCTGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTCCC-TTTTACATTGAGATATGCTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_bataticola_CBS_532_63_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTTCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATATAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGTATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCGGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCTACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCTGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTCCC-TTTTACATTGAGATATGCTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_bataticola_PPRI_10502 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTTCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATATAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGTATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCGGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCTACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCTGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTCCC-TTTTACATTGAGATATGCTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_bataticola_PPRI_11930 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTTCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATATAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCG{GT}AAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGTATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCGGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCGCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCTACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_bataticola_PPRI_11931 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTTCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATATAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGTATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCGGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCTACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCTGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTCCC-TTTTACATTGAGATATGCTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_bataticola_PPRI_11934 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTTCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATATAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGTATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCGGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCAATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCTACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_blumeae_CBS_117215 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-CCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTGGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAATGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTTTTTTTTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTTTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATAATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCCACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_blumeae_CBS_117364 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT--CCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTGGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAATGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTTT-TTTTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTTTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATAATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCCACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_calendulae_CBS_101498_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATTGCAATCAGCGTCAGTAAC-AACGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAG-CCCAAGGTCTAGCATCCACCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATGCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATATAGTCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGGAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAAGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTACGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGGCATCACTTT--TTCTTTTACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGTGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCGG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCTTGGCGACTACAC-GGGGGCGTGATGATGCACATCTAGTTCCTCTACCCTGGTCGCAGAAGGCTAACG-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCTGTCTCTACCCAGGGTGACTACGTCTGGAAGCTCTCAGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATTAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_calendulae_CBS_116439_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCGTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATTGCAATCAGCGTCAGTAAC-AACGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAG-CCCAAGGTCTAGCATCCACCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATGCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATATATTCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGGAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAAGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTACGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGGCATCACTTT--TTCTTTTACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAACGTGCAGCCAAACTCTGGCTTATGGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCGG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCTTGGCGACTACAC-GGGGGCGTGATGATGCACATCTAGTTCCTCTACCCTGGTCGCAGAAGGCTAACG-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCTGTCTCTACCCAGGGTGACTACGTCTGGAAGCTCTCAGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATTAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_calendulae_CBS_116650 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATTGCAATCAGCGTCAGTAAC-AACGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAG-CCCAAGGTCTAGCATCCACCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATGCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATATAGTCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGGAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAAGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTACGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGGCATCACTTT--TTCTTTTACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAACGTGCAGCCAAACTCTGGCTTATGGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCGG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCTTGGCGACTACAC-GGGGGCGTGATGATGCACATCTAGTTCCTCTACCCTGGTCGCAGAAGGCTAACG-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCTGTCTCTACCCAGGGTGACTACGTCTGGAAGCTCTCAGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATTAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_calendulae_CBS_224_76 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCGTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATTGCAATCAGCGTCAGTAAC-AACGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAG-CCCAAGGTCTAGCATCCACCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATGCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATATATTCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGGAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAAGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTACGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGGCATCACTTT--TTCTTTTACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAACGTGCAGCCAAACTCTGGCTTATGGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCGG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCTTGGCGACTACAC-GGGGGCGTGATGATGCACATCTAGTTCCTCTACCCTGGTCGCAGAAGGCTAACG-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCTGTCTCTACCCAGGGTGACTACGTCTGGAAGCTCTCAGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATTAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_carthami_CBS_116440 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACCACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_carthami_CBS_117091 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACCACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_carthami_CBS_635_80 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACCACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_carthamicola_CBS_117092 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACCACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cassiae_CBS_116119_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-TTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-ATAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCGTCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTTGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGACTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cassiae_CBS_117224 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT--CCCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-ATAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTTGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cassiae_CBS_117369 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-ATAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTTGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATTGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cassiae_CBS_478_81 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-ATAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTTGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_catananches_CBS_137456 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATAGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTCATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATGCAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCTTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGTTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGACTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACCACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCCGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_centaureae_CBS_116446 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACCAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGACTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACATCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTCCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cichorii_CBS_102_33_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGACTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACCACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCCGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cichorii_CBS_117218 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGACTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACCACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCCTGCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cirsinoxia_CBS_113261_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGTTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGACTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACCACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_citrullicola_CBS_103_32 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCAAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGGTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_conidiophora_CBS_137457 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACC-TTTTGTAATAGCAGTCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAG-CCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGAATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACGATACAGCCATGGCCATCCGCGTCGCGACA-TTAGTCCTTGCAATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCGCCTGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACACGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCAGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAACCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTGACTACC-TTTTACATTCAGATATACTGACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_crassa_CBS_103_18_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CTCCCCCATGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-TTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACGACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATAGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGACTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCATTCGTCTTCCTCTTTCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCACCACTCTTCTCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_crassa_CBS_109160_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CTCCCCCATGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACGACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATAGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGACTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCATTCGTCTTCCTCTTTCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCACCACTCTTCTCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_crassa_CBS_109162_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CTCCCCCATGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCCTTTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACGACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATAGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGACTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCATTCGTCTTCCTCTTTCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCACCACTCTTCTCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_crassa_CBS_110_38_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CTCCCCCATGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-TTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACGACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATAGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGACTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCATTCGTCTTCCTCTTTCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCACCACTCTTCTCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_crassa_CBS_116647 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CTCCCCCATGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-TTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACGACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATAGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGACTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCATTCGTCTTCCTCTTTCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCACCACTCTTCTCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_crassa_CBS_116648 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CTCCCCCATGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACGACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATAGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGACTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCATTCGTCTTCCTCTTTCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCACCACTCTTCTCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_crassa_CBS_122590 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CTCCCCCATGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-TTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACGACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATAGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGACTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCATTCGTCTTCCTCTTTCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCACCACTCTTCTCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cucumerina_CBS_116114_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAGCAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTATATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGCGTCTCT Alternaria_cucumerina_CBS_117225 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAATAAGCTCAAGCAGGAGCAGCAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTATATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cucumerina_CBS_117226 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCAACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTATATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cyamopsidis_CBS_117219 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT--CCCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCATGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCTTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAACTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACGCAGCGCAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTTACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAAATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGCCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGGGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACTCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_cyamopsidis_CBS_364_67 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT--CCCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCATGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCTTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAACTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACGCAGCGCAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTTACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAAATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGCCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGGGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACTCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_dauci_CBS_101592_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTGCAGCCCCAAGGTCTAGCATCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_dauci_CBS_106_48_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_dauci_CBS_111_38_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTGCAGCCCCAAGGTCTAGCATCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_dauci_CBS_117097 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCATTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TCCTTTCACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCTCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_dauci_CBS_117098 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGATTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TCCTTTCACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCTCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_dauci_CBS_117099 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_dauci_CBS_117100 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACCAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGCGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TCCTTTCACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCTCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCTAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_dauci_CBS_345_79 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TCCTTTCACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCTCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_dauci_CBS_477_83 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGATTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACGCACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGATTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTTGGCCGACAAGCTTGAGGATCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GTGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTATGTCTGCAATGGTGTCTCT Alternaria_deserticola_CBS_110799_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCTATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTGAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTCGTCATTTCTGCTCCTTCCGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAATATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTTACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAAATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACTTAGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTATAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCATGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGATGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_dichondrae_CBS_117127 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTACAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCAAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATGTACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTCCTGCCGCGCTGGCGGTAACGGCTCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_dichondrae_CBS_199_74 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTACAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCAAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATGTACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTCCTGCCGCGCTGGCGGTAACGGCTCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_dichondrae_CBS_200_74 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTACAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCAAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATGTACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTCCTGCCGCGCTGGCGGTAACGGCTCC-AGGACTTTGTCTGCACTGGTGTCTCT Alternaria_dichondrae_CBS_346_79 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTACAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCAAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATGTACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTCCTGCCGCGCTGGCGGTAACGGCTCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_echinaceae_CBS_116117_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAATACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACATGGACTGCCGCATCCACCTTGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAGAACCGAACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACGT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCTTC-ACGCTTATGACTGCC-TTTTGCATTCAGATGTACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_echinaceae_CBS_116118_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAATACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACATGGACTGCCGCATCCACCTTGTGCTTCCTCTGAGCGCGCTGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAGAACCGAACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACGT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCTTC-ACGCTTATGACTGCC-TTTTGCATTCAGATGTACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_euphorbiicola_CBS_119410 ATCATTACACAAATATGAAGGCGGGCTGACACCCTTC-GGGGCGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAA-CCATAAACC-TTTTGTAATTGCAATCAGCGTCAGTAAC-AAAATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTT------GTCTCCACTTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTTCCAG-CTCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATTCATTGATATAATCGATCAGATCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCTGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTTCCCCAAGCCCTCACGCTACAGCTACAGCCATCCGCATCGCGACA-TCCGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCCGCAGAATACAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGATTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGCCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAGCAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGCGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGGGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCGCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACAGACTGCTGCATCCACCTGGTGCTTTCTCTGAGCGCGAAGCCAAAGCCTGGCTTATCGTGATGAGGGGCATTTTTGATGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGTGGTGTTCCCAAACTCCGACATCATCACACGCCATGCAACAAGGAAATCGAACACCCTACCCTGGCGACTACATGGGGAGCGTTTGTCTTTCTCTTGTTGGCGATATCATATCCTGTCGACTACCC-GGGGGCGTGACGACGCACATCTCATTTCTCTATCCTGGTCGCAGCAGGCTAACAGGTCTCATAGGAAGCCGCCGAACT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Alternaria_euphorbiicola_CBS_133874 ATCATTACACAAATATGAAGGCGGGCTGACACCCTTC-GGGGCGG-CAGCCTTGCTGAATTATC-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAA-CCATAAACC-TTTTGTAATTGCAATCAGCGTCAGTAAC-AAAATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTT------GTCTCCACTTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTTCCAG-CTCAAGGTCTAGCATCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATTCATTGATATAATCGATCAGATCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCTGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTTCCCCAAGCCCTCACGCTACAGCTACAGCCATCCGCATCGCGACA-TCCGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCCGCAGAATACAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGCCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAGCAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGCGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGGGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCGCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACAGACTGCTGCATCCACCTGGTGCTTTCTCTGAGCGCGAAGCCAAAGCCTGGCTTATCGTGATGAGGGGCATTTTTGATGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGTGGTGTTCCCAAACTCCGACATCATCACACGCCATGCAACAAGGAAATCGAACACCCTACCCTGGCGACTACATGGGGAGCGTTTGTCTTTCTCTTGTTGGCGATATCATATCCTGTCGACTACCC-GGGGGCGTGACGACGCACATCTCATTTCTCTATCCTGGTCGCAGCAGGCTAACAGGTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCTGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACTGCATCCTGCCCTGTCGTCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAATGGAGGAACTCTCGACTTCACCTGCTCTGCTCAGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCCTTCGACAGCGACCGCAGTGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTGCCCTC-ACATTTTTGACTACC-TTTTACACTCAGACATACTAACAT--TTTTCCAGCATCACCTATGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAATGACTTTGTCTGCAACGGTGTCTCT Alternaria_euphorbiicola_CBS_198_86 ATCATTACACAAATATGAAGGCGGGCTGACACCCTTC-GGGGCGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAA-CCATAAACC-TTTTGTAATTGCAATCAGCGTCAGTAAC-AAAATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTT------GTCTCCACTTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTTCCAG-CTCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATTCATTGATATAATCGATCAGATCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCTGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTTCCCCAAGCCCTCACGCTACAGCTACAGCCATCCGCATCGCGACA-TCCGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCCGCAGAATACAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGATTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGCCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAGCAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGCGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGGGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCGCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACAGACTGCTGCATCCACCTGGTGCTTTCTCTGAGCGCGAAGCCAAAGCCTGGCTTATCGTGATGAGGGGCATTTTTGATGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGTGGTGTTCCCAAACTCCGACATCATCACACGCCATGCAACAAGGAAATCGAACACCCTACCCTGGCGACTACATGGGGAGCGTTTGTCTTTCTCTTGTTGGCGATATCATATCCTGTCGACTACCC-GGGGGCGTGACGACGCACATCTCATTTCTCTATCCTGGTCGCAGCAGGCTAACAGGTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCTGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACTGCATCCTGCCCTGTCGTCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAATGGAGGAACTCTCGACTTCACCTGCTCTGCTCAGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCCTTCGACAGCGACCGCAGTGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTGCCCTC-ACATTTTTGACTACC-TTTTACACTCAGACATACTAACAT--TTTTCCAGCATCACCTATGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAATGACTTTGTCTGCAACGGTGTCTCT Alternaria_grandis_CBS_109158_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGATATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_grandis_CBS_116695 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGATATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_gypsophilae_CBS_107_41_ ATCATTACACAAATATGAAGGCGGGCTGAAATCTCTC-GGGGTTA-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACCAA-CCCTAAACC-TTTTGTAATTGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TCTGCTTGGTGTTGGGCGTCTTGT------CTCCAGTTTCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAG--CCAAGGTCAGCAATCCACAAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGCATTGTCTTCCGCAATGCGTAGGTTTCGCCCATCCCATTGATATAATGTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACCCACACTACAGCCACAGCCATCCAAATCACGACACCCAGTCCTTGTGATGCGCTAGAGCTCCTCCACAGTCGCAGAATGCAGGCTAACACATGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCACTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCATAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAATGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGGCCATTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAGGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATTACTT---TTCTTACACGCGGACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGCA-------TGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGATGTTCGCGAACTCCAACACC----------------------------------------------------------------------C------------------------------------------ATGACGCACATCCAAATTCCCCATTTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCCGCTCCCCTCGAGTCTCGCCAGGATACGGCTTCCTGCCCCGTCTCCACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCAGCGGACGCAAGCCTGAGGGAACCTACTACAACGTCATTGCCTTCAACGTCACGGCCACCAACGGCGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCAAGGACAGTTTCATGGACTTTTCTTTCGACAGCGACCGCAACGGCCTACTGTTCAAGCAGGAGGTCAGCGACAAGTAAGTCTTCATC-ATACTT-TGAATATT-CCACAACTACAGATATACTAATATTTCTCTCTAGCATCACCTATGTCGCTACCACTACCATCGACAACTACTGCCACGCCGGCGGTAACGGTCCCAAGGACCTCGCCTGCCAGGGTCTCTCT Alternaria_ipomoeae_CBS_219_79_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCATGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCACAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTAAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGCCTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACGCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCGCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGCTCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACT-TCTCACATACAGACATACTAACTT--CTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTGTGCACTGGTGTCTCT Alternaria_ipomoeae_PPRI_8988 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCATGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCACAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTAAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGCCTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACGCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCGCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGCTCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACT-TCTCACATACAGACATACTAACTT--CTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTGTGCACTGGTGTCTCT Alternaria_jesenskae_CBS_133855 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATAGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACTCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTGCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATTTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGACATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCCTGCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_limicola_CBS_117360 ATCATTACACAAATATGAAGGCGGGCTGACACCCTTC-GGGGCGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAA-CCATAAACC-TTTTGTAATTGCAATCAGCGTCAGTAAC-AAAATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTT------GTCTCCACTTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTTCCAG-CTCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATTCATTGATATAATCGATCAGATCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCTGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTTCCCCAAGCCCTCACGCTACAGCTATAGCCATCCGCATCGCGACA-TCCGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCCGCAGAATACAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGCCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAGCAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGCGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATACGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACGGACTGCTGCATCCACCTGGTGCTTTCTCTGAGCGCGAAGCCAAAGCCTGGCTTATCGTGATGAGGGGCATTTTTGATGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGTGGTGTTCCCAAACTCCGACATCATCACACGCCATGCAACAAGGAAATCGAACACCCTACCCTGGCGACTACATGGGGAGCGTTTGTCTTTCTCTTGTTGGCGATATCATATCCTGTCGACTACCC-GGGGGCGTGATGACGCACATCTCATTTCTCTATCCTGGTCGCAGCAGGCTAACAGGTCTCATAGGAAGCCGCCGAACT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Alternaria_limicola_CBS_483_90 ATCATTACACAAATATGAAGGCGGGCTGACACCCTTC-GGGGCGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAA-CCATAAACC-TTTTGTAATTGCAATCAGCGTCAGTAAC-AAAATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTT------GTCTCCACTTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTTCCAG-CTCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCCAATTCATTGATATAATCGATCAGATCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCTGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTTCCCCAAGCCCTCACGCTACAGCTATAGCCATCCGCATCGCGACA-TCCGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCCGCAGAATACAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGCCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAGCAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGCGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATACGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTTACACGGACTGCTGCATCCACCTGGTGCTTTCTCTGAGCGCGAAGCCAAAGCCTGGCTTATCGTGATGAGGGGCATTTTTGATGGTGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCTTGTGGTGTTCCCAAACTCCGACATCATCACACGCCATGCAACAAGGAAATCGAACACCCTACCCTGGCGACTACATGGGGAGCGTTTGTCTTTCTCTTGTTGGCGATATCATATCCTGTCGACTACCC-GGGGGCGTGATGACGCACATCTCATTTCTCTATCCTGGTCGCAGCAGGCTAACAGGTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCTGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGGCTCGCCAGGACACTGCATCCTGCCCTGTCGTCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAATGGAGGAACTCTCGACTTCACCTGCTCTGCTCAGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCCTTCGACAGCGACCGCAGTGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTGCCCTC-ACATTTTTGACTACC-TTTTACACTCAGACATACTAACAT--TTTTCCAGCATCACCTATGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCAACGGTGTCTCT Alternaria_linariae_CBS_105_41 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCATCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CBS_107_61 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTTACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CBS_108_53 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCATCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CBS_109156 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCATCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CBS_109161_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTTACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CBS_109164_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTTACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CBS_116438 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTTACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CBS_116441 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTTACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CBS_116704 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCATCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_linariae_CPC_21620 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGTCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGACGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCCGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTTACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAATTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_macrospora_CBS_106_29_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTTACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_macrospora_CBS_117228 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CTACCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTTACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_montanica_CBS_121343 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAAGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC-TTTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_multirostrata_CBS_712_68 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTATTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCAATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACAGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAACCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACCAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_multirostrata_CBS_713_68 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTATTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCAATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACAGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAACCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACCAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_neoipomoeae_PPRI_11845 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCATGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCACAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCCCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTAAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCGCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCTTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGCTCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACT-TCTCACATACAGGCATACTAACTT--CTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTGTGCACTGGTGTCTCT Alternaria_neoipomoeae_PPRI_11847 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCATGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCACAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCCCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTAAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCGCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCTTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGCTCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACT-TCTCACATACAGGCATACTAACTT--CTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTGTGCACTGGTGTCTCT Alternaria_neoipomoeae_PPRI_13903 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCATGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCACAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCCCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTAAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCGCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCTTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGCTCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACT-TCTCACATACAGGCATACTAACTT--CTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTGTGCACTGGTGTCTCT Alternaria_neoipomoeae_PPRI_8990 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCATGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCACAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TCAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAATACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCCCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCTAAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCCACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACTCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCGCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCTTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGCTCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACT-TCTCACATACAGGCATACTAACTT--CTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTGTGCACTGGTGTCTCT Alternaria_nitrimali_CBS_109163_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT----CTCTCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCGGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TCCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTGAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGATGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGTGCAGCCAAATTCTGGCTTATTGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTAGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAATTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCACACCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAACGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_novae_guineensis_CBS_116120_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCTAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTTTTGT--CTCCCCCCTCTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATACCATAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCCGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGCCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCATCTCATTTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACTCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGGCTGCTGCATCCGCCTGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACTCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGTGATATCGTACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATTTAACTTCTCAACTATGGTCACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGCACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGACAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_novae_guineensis_PPRI_12171 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCTAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTTTTGT--CTCCCCCCTCTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATACCATAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCCGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGCCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCATCTCATTTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGGCTGCTGCATCCGCCTGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACTCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGTGATATCGTACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATTTAACTTCTCAACTATGGTCACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGCACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGACAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_obtecta_CBS_117367 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCTAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTTTTGT--CTCCCCCCTCTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATCCATTGATACAATCGACCAGAGCTGACCACATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATCCAGCCATGGCCATCAGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTATCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCATTCCAACGCTCAACAACTCGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAGCAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGATCGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTAGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCATCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGGGTGATGATGCACATCTAACTTCACAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACGCTCGACTTCACCTGCTCTGCCTCGGCAGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTGACTACCCTTTTGCATTCAGATATACTAACTC--TACTCCAGCATCACCTACGTCGCCACCACTACTCTTCCCAACTACTGCCGCGCTGGTGGAAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_obtecta_CBS_134278 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCTAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTTTTGT--CTCCCCCCTCTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATCCATTGATACAATCGACCAGAGCTGACCACATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATCCAGCCATGGCCATCAGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTATCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCATTCCAACGCTCAACAACTCGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAGCAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGATCGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTAGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCATCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGGGTGATGATGCACATCTAACTTCACAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACGCTCGACTTCACCTGCTCTGCCTCGGCAGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTGACTACCCTTTTGCATTCAGATATACTAACTC--TACTCCAGCATCACCTACGTCGCCACCACTACTCTTCCCAACTACTGCCGCGCTGGTGGAAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_paralinicola_CBS_116652 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCCGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_passiflorae_CBS_113_38 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTCAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTTGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATAACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_passiflorae_CBS_116333_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTCAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTTGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATAACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_passiflorae_CBS_117102 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTCAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTTGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATAACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_passiflorae_CBS_117103 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTCAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTTGGTCGTGACGGAAAGCTGGCTAACCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGAACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATAACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_passiflorae_CBS_166_77 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTCAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTTGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATAACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_passiflorae_CBS_629_93 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTCAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTTGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATAACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_passiflorae_CBS_630_93_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC--TTTTTTTTTCAAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTTGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATAACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_pipionipisi_CBS_116115_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTGT--------CTCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTCGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATAGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTTGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGTTTTTCACTACC-TTTTACATTCAGATATACTAACTT--TTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_pipionipisi_CBS_117365 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTGT--------CTCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTCGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATAGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTTGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGTTTTTCACTACC-TTTTACATTCAGATATACTAACTT--TTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_pipionipisi_CBS_134265 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTGT--------CTCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGTCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGTATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTCGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATAGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTTGACTTCACCTGCTCTGCCTCGGCCAACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGTTTTTCACTACC-TTTTACATTCAGATATACTAACTT--TTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_porri_CBS_116649 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAGTCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCGGAATGCAGGCTAACAAATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCTAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGTCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTCGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCACGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_porri_CBS_116698 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAGTCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCGGAATGCAGGCTAACAAATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCTAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTCGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCACGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_porri_CBS_116699 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCTCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAGTCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCGGAATGCAGGCTAACAAATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCTAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATTTAACTTCTCAACCCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTCGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCACGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_protenta_CBS_116437 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_protenta_CBS_116651 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_protenta_CBS_116696 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_protenta_CBS_116697 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_protenta_CBS_121342 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_protenta_CBS_135189 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_protenta_CBS_347_79 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_pseudorostrata_CBS_119411 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACC-TTTTGCAATTGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAG-CCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTCCGCCCGATTCATTGATACAATTGATTTGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCACCGCGACA-TTGGTCCTTGCGATGCGCCAGAGCTCCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAAAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTCGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACTAGCACACGACAGGGATGGAGTCAAGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACACACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGAACTTTTTACGCGCTAGCGCTAGCCCGCTTGCGG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGGGCGTTTGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATCCAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTTTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGGCTCGCCAGAACACCGCAACCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGCTCTCTGAGTTCTACGGACGCAAGCCCCAAGGAACCTACTACAACAGACTCAGCTTCAACATGAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCGCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCTTGCTCTTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_ranunculi_CBS_116330_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATAGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTATTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACAGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTTGTTGAAAACGACATCCGAAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAAACGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCTTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATAGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_ricini_CBS_117361 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCGCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTTTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACCACC-TTTTATATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_ricini_CBS_215_31_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCGCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTTTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACCACC-TTTTATATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_ricini_CBS_353_86 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCGCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTTTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACCACC-TTTTATATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_rostellata_CBS_117366 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CTCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTATCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACGGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCGACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAACTCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTATAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGTGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCCGGCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_scorzonerae_CBS_103_46_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCCGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_scorzonerae_CBS_116703 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCCGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_scorzonerae_CBS_478_83 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCCGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_sennae_CBS_477_81 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC---TCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGCAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCATTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATTGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_sesami_CBS_240_73 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCGCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTTTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_sesami_CBS115264_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CCCCCCGCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTTTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_sidae_CBS_117730 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGTCCCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGCAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCATTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGCCTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCAGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTAGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCATCTGCTCTGCCTCTGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTTCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_silybi_CBS_134092 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTTGTTGAAAACGACATCCGAAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_silybi_CBS_134093 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTTGTTGAAAACGACATCCGAAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_silybi_CBS_134094 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACGGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACCCTGTCCTACGAGATGAGCCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTTGTTGTTGAAAACGACATCCGAAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTACGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_solani_CBS_106_21 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_solani_CBS_109157 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_solani_CBS_111_41_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_solani_CBS_111_44_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_solani_CBS_116442 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATACAATCGACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCTAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTAATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TCCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCC----CAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATGCCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTCACCACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCAATGGTGTCTCT Alternaria_solani_nigri_CBS_109155_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCGTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATGCAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_solani_nigri_CBS_113403_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCGTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATGCAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_solani_nigri_CBS_116332 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCGTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATGCAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_solani_nigri_CBS_116334 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCGTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATGCAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_solani_nigri_CBS_116447 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCGTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATGCAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_solani_nigri_CBS_121347 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCGTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATGCAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_solani_nigri_CBS117101 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCCC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCGTTTTGCAATGGCAATCAGCGTCAGTAAC-AATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATGCAATCGATCACAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTTATGACATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCGATGCAAGAGGAAGACCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGCGCGACGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAAGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACGC--TTTTCCAGCATCACCTACGTCGCTACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_steviae_CBS_117362 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGTCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTGTTGT--CTCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATCCATTGATACAATCGACCAGAGCTGACCACATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACCCGCAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAGCGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCTCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGTCAGGGATGGAGCCAGGATGAGATTGATTCAGCTACTTATGGCTGGCGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCAGCAGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCACGCAAGAGGAAAATCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGTGGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGCGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGATTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTGACTACCTTTTTGCATTCAGATATACTAACTC--TTCTCCAGCATCACCTATGTCGCCACCACTACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_steviae_CBS_631_88 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGTCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTGTTGT--CTCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATCCATTGATACAATCGACCAGAGCTGACCACATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACCCGCAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAGCGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCTCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGTCAGGGATGGAGCCAGGATGAGATTGATTCAGCTACTTATGGCTGGCGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCAGCAGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCACGCAAGAGGAAAATCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGTGGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGCGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGATTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTGACTACCTTTTTGCATTCAGATATACTAACTC--TTCTCCAGCATCACCTATGTCGCCACCACTACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_steviae_CBS_632_88 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGTCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTGTTGT--CTCCCCCCTTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATCCATTGATACAATCGACCAGAGCTGACCACATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACCCGCAATACAGCCATGGCCATCCGCATCGCGACA-CTAGTCCTTGCGATGCGCTAGAGCTCCTCTACAGCTGCAGAGCGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCTCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGTCAGGGATGGAGCCAGGATGAGATTGATTCAGCTACTTATGGCTGGCGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCAGCAGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCACGCAAGAGGAAAATCGAACACCCCACCCAGGCGACTACATGGGGAGCGTTCATCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGTGGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGCGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGATTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTGACTACCTTTTTGCATTCAGATATACTAACTC--TTCTCCAGCATCACCTATGTCGCCACCACTACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_tagetica_CBS_117217 ATCATTACACAAATATGAAGGCGGACTGGCACCTCTCGGGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAGTGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CTCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-TTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTTATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGC-TTCCCCAAGCACTCAAAATGCAGCCTTGGCCATCCGCATCGCGACA-TTAGTCCTTGCCATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTTACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTATTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACATCCCACCCAGACGACTACATGGGGAGCGTTCGTCTTCCTCATGGTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAATCCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAAGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACTAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTGACTACT-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_tagetica_CBS_297_79 ATCATTACACAAATATGAAGGCGGACTGGCACCTCTCGGGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CTCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTTATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGC-TTCCCCAAGCACTCAAAATGCAGCCTTGGCCATCCGCATCGCGACA-TTAGTCCTTGCCATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTTACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTATTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACATCCCACCCAGACGACTACATGGGGAGCGTTCGTCTTCCTCATGGTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAATCCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAAGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACTAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTGACTACT-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_tagetica_CBS_298_79 ATCATTACACAAATATGAAGGCGGACTGGCACCTCTCGGGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CTCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTTATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGC-TTCCCCAAGCACTCAAAATGCAGCCTTGGCCATCCGCATCGCGACA-TTAGTCCTTGCCATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTTACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTATTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACATCCCACCCAGACGACTACATGGGGAGCGTTCGTCTTCCTCATGGTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAATCCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAAGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACTAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTGACTACT-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_tagetica_CBS_479_81 ATCATTACACAAATATGAAGGCGGACTGGCACCTCTCGGGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CTCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTTATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGC-TTCCCCAAGCACTCAAAATGCAGCCTTGGCCATCCGCATCGCGACA-TTAGTCCTTGCCATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTTACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTATTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACATCCCACCCAGACGACTACATGGGGAGCGTTCGTCTTCCTCATGGTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAATCCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAAGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACTAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTGACTACT-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_tagetica_CBS_480_81 ATCATTACACAAATATGAAGGCGGACTGGCACCTCTCGGGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAGTGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT---CTCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCCTTTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTTATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGC-TTCCCCAAGCACTCAAAATGCAGCCTTGGCCATCCGCATCGCGACA-TTAGTCCTTGCCATGCGCTAGAGCTCCTCTACAGCTGCAGAACGCAGGCTTACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTATTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACATCCCACCCAGACGACTACATGGGGAGCGTTCGTCTTCCTCATGGTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAATCCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAAGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACTAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTGACTACT-TTTTACATTCAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGTCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_thunbergiae_CBS_120986 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTCTTGT----CTCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCTATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTGAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCCGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACTAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGTATCCACCCGGTTCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAACTCGAACACCCTACCCAGGCGCCTACGTGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACATGGGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTTGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAATCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAACGACTTTGTCTGCACTGGTGTCTCT Alternaria_thunbergiae_CBS_122597 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATCTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTCTTGT----CTCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCTATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTGAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCCGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGCCAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACTAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTTCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAACTCGAACACCCTACCCAGGCGCCTACGTGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACATGGGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTTGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAATCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAACGACTTTGTCTGCACTGGTGTCTCT Alternaria_thunbergiae_CBS116331_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTCTTGT----CTCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCTATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTGAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCCGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACTGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAATGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACTAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGTATCCACCCGGTTCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAACTCGAACACCCTACCCAGGCGCCTACGTGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACATGGGGGGTGTGATGATGCACATCTAACTTCTCAACCATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTTGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAATCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTACATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAACGACTTTGTCTGCACTGGTGTCTCT Alternaria_tillandsiae_CBS_116116_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTTGCTTGGTGTTGGGCGTCTTCTTGT---CTCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-TTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCCCAATTCATTGATGCAATCGACCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACCCGCAATACAGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCCGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGCCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCTGGTGCATCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGTTGGCGATATCATACCCTGGCGACTACAT-GGGGGGGTGATGATGCACATCTAACTTCACAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACGCTCGACTTCACCTGCTCTGCCTCGGCAGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-ACGCTTTTGACTACCCTTTTGCATTCAGATATACTAACTC--TACTCCAGCATCACCTACGTCGCCACCACTACTCTTCCCAACTACTGCCGCGCTGGTGGAAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_tropica_CBS_117216 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCTCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGATA-TTAGCCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATCGATTCAGCTACTTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTTGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCAGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGTCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTGCAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAATATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_tropica_CBS_631_93 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGG-CAGCCTTGCTGAATTATT-CACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AACATAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-----CTCCCCTTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTACGTTTCGCTCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACAGCCATGGCCATCCGCATCGCGATA-TTAGCCCTTGCGATGCGCTAGAGCTTCTCTACAGCTGCAGAACGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCATTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATCGATTCAGCTACTTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTTGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCAGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACAGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAACCGAACACCCTACCCAGGCGTCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTGCAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACCCTGGTTACAGTAGGCTAACA-GTCGCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCGTCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAATATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCTC-GCGCTTTTCACTACC-TTTTACATTGAGATATACTAACTC--TTTTCCAGCATCACCTACGTCGCCACCACCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCACCGGTGTCTCT Alternaria_venezuelensis_CBS_116121_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAACAAATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT--CCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAATTCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAAGCGCCCACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-AGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTATATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_zinniae_CBS_107_48_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-CCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_zinniae_CBS_108_61_ ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-CCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_zinniae_CBS_117_59 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-CCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTGGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_zinniae_CBS_117223 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-CCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_zinniae_CBS_118_44 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-CCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_zinniae_CBS_299_79 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-CCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT Alternaria_zinniae_CBS_300_79 ATCATTACACAAATATGAAGGCGGGCTGGCACCTCTC-GGGGTGGCCAGCCTTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCATAAACCTTTTTGTAATGGCAATCAGCGTCAGTAAC-AATGTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGC-TTTGCTTGGTGTTGGGCGTCTTTTTGT-CCCCCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCGCTCTCTTCCAGCCCCAAGGTCTAGCATCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCGCCGTATCGTCTTCCGCAATGCGTATGTTTCGCCCAAATCATTGATACAATCGATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGC-TTCCCCAAGCACTCACAATACTGCCATGGCCATCCGCATCGCGACA-TTAGTCCTTGCGATGCGCTAAAGCTTCTCTACAGCTGCAGAATGCAGGCTAACACATCCAGGCCTACATGCTCAAATATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCTATGGCATCACTTT--TTCTTTCACACGGACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCAAACTCTGGCTTATCGCGATGAGGGGCATTTTTGGTGGTGGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG------------CCGACATCATCACACGCCATGCAAGAGGAAAATCGAACACCCTACCCAGGCGCCTACATGGGGAGCGTTCGTCTTCCTCTTGCTGGCGATATCATACCCTGGCGACTACAT-GGGGGTGTGATGATGCACATCTAACTTCTCAACTATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTCTCTCTCTTCGCCGCCGCCGGCCTTGCTGCCGCTGCTCCTCTCGAGACTCGCCAGGACACCGCATCCTGCCCCGTCTCCACCCAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCCGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACTCTCGACTTCACCTGCTCTGCCTCGGCCGACAAGCTTGAGGACCACAAGTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTTTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTCAGCGACGAGTAAGTTGCCCCC-GCGCTTTTCACTACC-TTTTAAATTCAGATATACTAACTT--CTGTCCAGCATCACCTACGTCGCCACCGCCACTCTTCCCAACTACTGCCGCGCTGGTGGTAACGGTCCCAAGGACTTTGTCTGCACTGGTGTCTCT ; END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri RAxML RPB2'; LINK TAXA = Taxa1; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_catananches_CBS_137456, 181 Alternaria_novae_guineensis_PPRI_12171, 182 Alternaria_anodae_PPRI_12376; TREE RAxML_RPB2 = [&R] ((96:2.73445828304707E-6,((91:2.73445828304707E-6,106:2.73445828304707E-6)74:2.73445828304707E-6,((41:0.0015905346942846276,(181:2.73445828304707E-6,45:0.0015767975082795996)100:0.00983842390888998)52:0.004894533606798371,(((((39:2.73445828304707E-6,100:0.0015939652059943062)63:0.0015957573975288498,(11:2.73445828304707E-6,((101:2.73445828304707E-6,(158:2.73445828304707E-6,102:2.73445828304707E-6)11:2.73445828304707E-6)8:2.73445828304707E-6,46:2.73445828304707E-6)5:2.73445828304707E-6)37:2.73445828304707E-6)78:0.0016120136447983309,(((141:2.73445828304707E-6,19:2.73445828304707E-6)35:2.73445828304707E-6,140:2.73445828304707E-6)53:2.73445828304707E-6,((98:2.73445828304707E-6,76:2.73445828304707E-6)20:2.73445828304707E-6,(112:2.73445828304707E-6,16:2.73445828304707E-6)10:2.73445828304707E-6)66:0.0015919786071868186)94:0.004877896112314672)74:0.003210249100088396,((182:0.012768276905540898,(108:0.010955662670859618,(((((115:2.73445828304707E-6,48:2.73445828304707E-6)74:2.73445828304707E-6,121:0.0015700177591907337)96:0.0063662935356776215,28:0.0015681591161982179)39:2.73445828304707E-6,(95:2.73445828304707E-6,146:2.73445828304707E-6)100:0.014932426674631539)31:0.0015378769139515731,(((126:2.73445828304707E-6,40:2.73445828304707E-6)33:2.73445828304707E-6,107:2.73445828304707E-6)99:0.00964976554670728,(31:0.009639588575823251,((120:2.73445828304707E-6,((5:2.73445828304707E-6,27:2.73445828304707E-6)7:2.73445828304707E-6,(63:2.73445828304707E-6,30:2.73445828304707E-6)38:2.73445828304707E-6)8:2.73445828304707E-6)2:2.73445828304707E-6,(25:2.73445828304707E-6,62:2.73445828304707E-6)9:2.73445828304707E-6)98:0.004774911551069629)28:2.73445828304707E-6)52:0.0032220266007104174)62:0.006124082378305587)30:0.004695682849757473)20:0.0022421143734282748,((((110:2.73445828304707E-6,44:2.73445828304707E-6)22:2.73445828304707E-6,99:2.73445828304707E-6)17:2.73445828304707E-6,149:2.73445828304707E-6)86:0.001614762907041565,((111:0.001547548741130564,147:0.0016579396131325978)100:0.01367437641585065,((156:0.0015901518410636518,((145:2.73445828304707E-6,((104:2.73445828304707E-6,38:2.73445828304707E-6)26:2.73445828304707E-6,137:2.73445828304707E-6)11:2.73445828304707E-6)4:2.73445828304707E-6,133:2.73445828304707E-6)33:2.73445828304707E-6)77:0.0012356449490139477,(58:2.73445828304707E-6,59:2.73445828304707E-6)95:0.0035750555439877083)90:0.006914829787753972)39:0.0017151348526661453)47:0.00489017829928339)7:2.73445828304707E-6)22:0.0016281858218533682,((127:2.73445828304707E-6,109:2.73445828304707E-6)100:0.018887142930304218,((((114:0.01639624328091977,((((((((83:2.73445828304707E-6,(3:2.73445828304707E-6,12:2.73445828304707E-6)31:2.73445828304707E-6)14:2.73445828304707E-6,81:2.73445828304707E-6)8:2.73445828304707E-6,32:2.73445828304707E-6)69:0.0015622525706951583,(142:2.73445828304707E-6,(42:2.73445828304707E-6,43:2.73445828304707E-6)99:0.006372973278188948)21:0.001565802700357226)2:2.73445828304707E-6,((82:2.73445828304707E-6,148:2.73445828304707E-6)77:0.0015629314134575313,84:0.003160393863739976)15:2.73445828304707E-6)5:2.73445828304707E-6,(15:0.0031847164210302616,((((179:2.73445828304707E-6,(170:2.73445828304707E-6,171:2.73445828304707E-6)8:2.73445828304707E-6)19:2.73445828304707E-6,177:2.73445828304707E-6)98:0.006415901942915751,(134:2.73445828304707E-6,178:2.73445828304707E-6)97:2.73445828304707E-6)90:0.006527579497520418,((90:2.73445828304707E-6,89:2.73445828304707E-6)70:2.73445828304707E-6,1:2.73445828304707E-6)98:0.003191667408388112)39:0.003182120114250102)24:0.0015771060239274644)14:0.004775411653253449,(((172:2.73445828304707E-6,97:2.73445828304707E-6)8:2.73445828304707E-6,92:2.73445828304707E-6)5:2.73445828304707E-6,(162:2.73445828304707E-6,176:2.73445828304707E-6)11:2.73445828304707E-6)99:0.006626835102351741)13:0.004783428320932076,((2:2.73445828304707E-6,54:2.73445828304707E-6)32:2.73445828304707E-6,(135:2.73445828304707E-6,65:2.73445828304707E-6)25:2.73445828304707E-6)99:0.007988268586233372)1:2.73445828304707E-6)1:0.0016112398972644864,(((105:2.73445828304707E-6,163:2.73445828304707E-6)29:2.73445828304707E-6,161:2.73445828304707E-6)100:0.015813807768682003,(((75:2.73445828304707E-6,(((8:2.73445828304707E-6,(29:2.73445828304707E-6,(17:2.73445828304707E-6,26:2.73445828304707E-6)4:2.73445828304707E-6)0:2.73445828304707E-6)1:2.73445828304707E-6,168:2.73445828304707E-6)0:2.73445828304707E-6,18:2.73445828304707E-6)0:2.73445828304707E-6)0:2.73445828304707E-6,(53:2.73445828304707E-6,56:2.73445828304707E-6)17:2.73445828304707E-6)1:2.73445828304707E-6,22:2.73445828304707E-6)100:0.015472008585295901)28:0.001048301806638901)1:0.001641705265729221,((((130:2.73445828304707E-6,113:2.73445828304707E-6)32:2.73445828304707E-6,122:2.73445828304707E-6)95:0.0032046555166590435,(153:2.73445828304707E-6,103:2.73445828304707E-6)96:0.0016383768921696116)100:0.02046477456396801,(((36:2.73445828304707E-6,180:2.73445828304707E-6)64:0.0015968839102927636,((60:2.73445828304707E-6,4:2.73445828304707E-6)30:2.73445828304707E-6,94:2.73445828304707E-6)49:2.73445828304707E-6)100:0.01499810097722336,((((64:2.73445828304707E-6,71:2.73445828304707E-6)31:2.73445828304707E-6,72:2.73445828304707E-6)88:0.0031992814025007497,(((47:0.0014498179233376721,(((9:2.73445828304707E-6,124:2.73445828304707E-6)26:2.73445828304707E-6,125:2.73445828304707E-6)18:2.73445828304707E-6,123:2.73445828304707E-6)92:0.00341986823753355)94:0.00996813330648806,(((55:2.73445828304707E-6,164:2.73445828304707E-6)35:2.73445828304707E-6,77:2.73445828304707E-6)97:0.005171840689177876,(((165:2.73445828304707E-6,166:2.73445828304707E-6)85:0.0016212207869033338,(((132:2.73445828304707E-6,88:2.73445828304707E-6)28:2.73445828304707E-6,(143:2.73445828304707E-6,131:2.73445828304707E-6)20:2.73445828304707E-6)64:0.0015905681469908911,(((87:0.00320999715636658,(((((159:2.73445828304707E-6,50:2.73445828304707E-6)5:2.73445828304707E-6,160:2.73445828304707E-6)1:2.73445828304707E-6,86:2.73445828304707E-6)1:2.73445828304707E-6,129:2.73445828304707E-6)2:2.73445828304707E-6,35:2.73445828304707E-6)30:2.73445828304707E-6)61:0.0015875407829874628,((((57:2.73445828304707E-6,23:2.73445828304707E-6)4:2.73445828304707E-6,(34:2.73445828304707E-6,(33:2.73445828304707E-6,68:2.73445828304707E-6)6:2.73445828304707E-6)0:2.73445828304707E-6)2:2.73445828304707E-6,(10:2.73445828304707E-6,24:2.73445828304707E-6)11:2.73445828304707E-6)87:0.0031903065448435305,157:0.0031864770572706293)17:2.73445828304707E-6)3:2.73445828304707E-6,67:2.73445828304707E-6)9:2.73445828304707E-6)63:0.0015758656144705958)82:0.0036240719534790357,167:0.01276784908363126)36:0.0018053437779919446)38:0.004389632533800534)35:0.0017164255079209305,((52:2.73445828304707E-6,(51:2.73445828304707E-6,(((((49:2.73445828304707E-6,37:2.73445828304707E-6)9:2.73445828304707E-6,85:2.73445828304707E-6)0:2.73445828304707E-6,(144:2.73445828304707E-6,119:2.73445828304707E-6)7:2.73445828304707E-6)0:2.73445828304707E-6,70:2.73445828304707E-6)0:2.73445828304707E-6,(66:2.73445828304707E-6,(21:2.73445828304707E-6,69:2.73445828304707E-6)2:2.73445828304707E-6)0:2.73445828304707E-6)0:2.73445828304707E-6)0:2.73445828304707E-6)0:2.73445828304707E-6,((128:2.73445828304707E-6,116:2.73445828304707E-6)8:2.73445828304707E-6,61:2.73445828304707E-6)0:2.73445828304707E-6)77:0.0015884705747765283)14:2.73445828304707E-6)64:0.006624516565791588,(((136:2.73445828304707E-6,118:2.73445828304707E-6)42:2.73445828304707E-6,(13:2.73445828304707E-6,20:2.73445828304707E-6)42:2.73445828304707E-6)8:2.73445828304707E-6,73:2.73445828304707E-6)93:0.0031971576683727746)47:0.0032835297438200206)13:2.73445828304707E-6)4:0.001556157768757349)0:0.00311423757322344,(((117:0.008643364180793272,((7:2.73445828304707E-6,74:2.73445828304707E-6)32:2.73445828304707E-6,(150:2.73445828304707E-6,78:2.73445828304707E-6)28:2.73445828304707E-6)91:0.00309191165296655)70:0.006711100028125643,6:0.011530539660743718)10:2.73445828304707E-6,((((151:2.73445828304707E-6,(93:2.73445828304707E-6,138:2.73445828304707E-6)22:2.73445828304707E-6)17:2.73445828304707E-6,152:2.73445828304707E-6)9:2.73445828304707E-6,139:2.73445828304707E-6)96:0.0031411757749311505,((((154:2.73445828304707E-6,(79:2.73445828304707E-6,173:2.73445828304707E-6)3:2.73445828304707E-6)1:2.73445828304707E-6,((175:2.73445828304707E-6,155:2.73445828304707E-6)23:2.73445828304707E-6,169:2.73445828304707E-6)0:2.73445828304707E-6)1:2.73445828304707E-6,174:2.73445828304707E-6)2:2.73445828304707E-6,80:2.73445828304707E-6)96:0.006604009713088286)62:0.006432423828538067)1:0.0016577707952795215)2:0.0016303079436451747)3:0.004935239890915763)2:0.0016834894738374931)46:0.013183940630171836)24:0.0015803954707759621):0.05499390135190991,14:0.05499390135190991); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri RAxML Alta1'; LINK TAXA = Taxa3; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_ricini_CBS_117361, 104 Alternaria_steviae_CBS_117362, 105 Alternaria_blumeae_CBS_117364, 106 Alternaria_pipionipisi_CBS_117365, 107 Alternaria_rostellata_CBS_117366, 108 Alternaria_obtecta_CBS_117367, 109 Alternaria_cassiae_CBS_117369, 110 Alternaria_sidae_CBS_117730, 111 Alternaria_zinniae_CBS_118_44, 112 Alternaria_pseudorostrata_CBS_119411, 113 Alternaria_thunbergiae_CBS_120986, 114 Alternaria_protenta_CBS_121342, 115 Alternaria_montanica_CBS_121343, 116 Alternaria_allii_CBS_121345, 117 Alternaria_solani_nigri_CBS_121347, 118 Alternaria_crassa_CBS_122590, 119 Alternaria_thunbergiae_CBS_122597, 120 Alternaria_euphorbiicola_CBS_133874, 121 Alternaria_silybi_CBS_134092, 122 Alternaria_silybi_CBS_134093, 123 Alternaria_silybi_CBS_134094, 124 Alternaria_pipionipisi_CBS_134265, 125 Alternaria_obtecta_CBS_134278, 126 Alternaria_protenta_CBS_135189, 127 Alternaria_passiflorae_CBS_166_77, 128 Alternaria_euphorbiicola_CBS_198_86, 129 Alternaria_dichondrae_CBS_199_74, 130 Alternaria_dichondrae_CBS_200_74, 131 Alternaria_ricini_CBS_215_31_, 132 Alternaria_ipomoeae_CBS_219_79_, 133 Alternaria_calendulae_CBS_224_76, 134 Alternaria_allii_CBS_225_76, 135 Alternaria_sesami_CBS_240_73, 136 Alternaria_tagetica_CBS_297_79, 137 Alternaria_tagetica_CBS_298_79, 138 Alternaria_zinniae_CBS_299_79, 139 Alternaria_zinniae_CBS_300_79, 140 Alternaria_dauci_CBS_345_79, 141 Alternaria_dichondrae_CBS_346_79, 142 Alternaria_protenta_CBS_347_79, 143 Alternaria_ricini_CBS_353_86, 144 Alternaria_cyamopsidis_CBS_364_67, 145 Alternaria_sennae_CBS_477_81, 146 Alternaria_dauci_CBS_477_83, 147 Alternaria_cassiae_CBS_478_81, 148 Alternaria_scorzonerae_CBS_478_83, 149 Alternaria_tagetica_CBS_479_81, 150 Alternaria_tagetica_CBS_480_81, 151 Alternaria_limicola_CBS_483_90, 152 Alternaria_bataticola_CBS_531_63, 153 Alternaria_bataticola_CBS_532_63_, 154 Alternaria_acalyphicola_CBS_541_94, 155 Alternaria_agripestis_CBS_577_94, 156 Alternaria_aragakii_CBS_594_93, 157 Alternaria_passiflorae_CBS_629_93, 158 Alternaria_passiflorae_CBS_630_93_, 159 Alternaria_steviae_CBS_631_88, 160 Alternaria_tropica_CBS_631_93, 161 Alternaria_steviae_CBS_632_88, 162 Alternaria_carthami_CBS_635_80, 163 Alternaria_multirostrata_CBS_712_68, 164 Alternaria_multirostrata_CBS_713_68, 165 Alternaria_jesenskae_CBS_133855, 166 Alternaria_linariae_CPC_21620, 167 Alternaria_bataticola_PPRI_10502, 168 Alternaria_neoipomoeae_PPRI_11845, 169 Alternaria_neoipomoeae_PPRI_11847, 170 Alternaria_argyroxiphii_PPRI_11848, 171 Alternaria_bataticola_PPRI_11930, 172 Alternaria_bataticola_PPRI_11931, 173 Alternaria_bataticola_PPRI_11934, 174 Alternaria_argyroxiphii_PPRI_11971, 175 Alternaria_neoipomoeae_PPRI_13903, 176 Alternaria_ipomoeae_PPRI_8988, 177 Alternaria_neoipomoeae_PPRI_8990, 178 Alternaria_conidiophora_CBS_137457, 179 Alternaria_catananches_CBS_137456, 180 Alternaria_novae_guineensis_PPRI_12171, 181 Alternaria_anodae_PPRI_12376; TREE RAxML_Alt_a_1 = [&R] ((((((((((((28:0.006494957937079658,(((27:1.31046647243463E-6,62:1.31046647243463E-6)7:1.31046647243463E-6,(25:1.31046647243463E-6,(((118:1.31046647243463E-6,63:1.31046647243463E-6)5:1.31046647243463E-6,30:1.31046647243463E-6)1:1.31046647243463E-6,5:1.31046647243463E-6)1:1.31046647243463E-6)1:1.31046647243463E-6)83:0.004304311567473097,((40:1.31046647243463E-6,124:1.31046647243463E-6)31:1.31046647243463E-6,106:1.31046647243463E-6)98:0.008661346957444431)12:1.31046647243463E-6)36:0.0021511389607489946,(6:0.0021622147653692562,(156:0.0021534725685365594,((11:1.31046647243463E-6,102:1.31046647243463E-6)66:0.00214890408705746,((95:1.31046647243463E-6,144:1.31046647243463E-6)63:0.002148904052894628,(31:0.006533502264353269,107:0.0023179896150352505)6:1.31046647243463E-6)1:1.31046647243463E-6)1:1.31046647243463E-6)0:1.31046647243463E-6)2:1.31046647243463E-6)3:1.31046647243463E-6,((119:1.31046647243463E-6,48:1.31046647243463E-6)31:1.31046647243463E-6,113:1.31046647243463E-6)94:0.006531535172390168)8:1.31046647243463E-6,((((((103:1.31046647243463E-6,143:1.31046647243463E-6)14:1.31046647243463E-6,(154:1.31046647243463E-6,131:1.31046647243463E-6)17:1.31046647243463E-6)65:0.002146810027770921,39:0.002145656002034455)8:1.31046647243463E-6,((100:1.31046647243463E-6,101:1.31046647243463E-6)15:1.31046647243463E-6,46:1.31046647243463E-6)16:1.31046647243463E-6)21:1.31046647243463E-6,181:0.010873945427597174)50:0.00214655958715928,((((((98:1.31046647243463E-6,76:1.31046647243463E-6)5:1.31046647243463E-6,(147:1.31046647243463E-6,44:1.31046647243463E-6)1:1.31046647243463E-6)0:1.31046647243463E-6,16:1.31046647243463E-6)0:1.31046647243463E-6,((111:1.31046647243463E-6,((138:1.31046647243463E-6,((59:1.31046647243463E-6,19:1.31046647243463E-6)6:1.31046647243463E-6,58:1.31046647243463E-6)1:1.31046647243463E-6)0:1.31046647243463E-6,99:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6,139:1.31046647243463E-6)0:1.31046647243463E-6)6:1.31046647243463E-6,((109:0.0021387096373353606,145:1.31046647243463E-6)57:0.002152055411298305,110:0.008686535322287818)19:1.31046647243463E-6)10:1.31046647243463E-6,((105:1.31046647243463E-6,96:1.31046647243463E-6)25:1.31046647243463E-6,91:1.31046647243463E-6)62:0.002168212810988147)49:0.002156003497982623)43:1.31046647243463E-6)92:0.010058397382458607,(((72:1.31046647243463E-6,71:1.31046647243463E-6)72:1.31046647243463E-6,(((134:1.31046647243463E-6,(64:1.31046647243463E-6,20:1.31046647243463E-6)15:1.31046647243463E-6)2:1.31046647243463E-6,13:1.31046647243463E-6)3:1.31046647243463E-6,(116:1.31046647243463E-6,73:1.31046647243463E-6)10:1.31046647243463E-6)68:0.0021494678270209573)99:0.012254980873832954,112:0.03392429235491158)29:3.0332525271569604E-4)40:0.0024962728095041056,((176:1.31046647243463E-6,132:1.31046647243463E-6)89:1.31046647243463E-6,(((168:1.31046647243463E-6,169:1.31046647243463E-6)12:1.31046647243463E-6,175:1.31046647243463E-6)12:1.31046647243463E-6,177:1.31046647243463E-6)88:0.004369667961301414)99:0.02103127164931235)42:0.004633695669002525,(((133:1.31046647243463E-6,(54:1.31046647243463E-6,2:1.31046647243463E-6)33:1.31046647243463E-6)19:1.31046647243463E-6,65:1.31046647243463E-6)100:0.01788320415945151,(178:0.011090710134910664,((((((((126:1.31046647243463E-6,(((10:1.31046647243463E-6,69:1.31046647243463E-6)1:1.31046647243463E-6,70:1.31046647243463E-6)2:1.31046647243463E-6,52:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6,(66:1.31046647243463E-6,33:1.31046647243463E-6)3:1.31046647243463E-6)0:1.31046647243463E-6,114:1.31046647243463E-6)0:1.31046647243463E-6,((24:1.31046647243463E-6,23:1.31046647243463E-6)5:1.31046647243463E-6,(68:1.31046647243463E-6,57:1.31046647243463E-6)8:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6,(142:1.31046647243463E-6,34:1.31046647243463E-6)0:1.31046647243463E-6)85:0.004434126343442898,(((141:1.31046647243463E-6,(88:1.31046647243463E-6,129:1.31046647243463E-6)25:1.31046647243463E-6)56:1.31046647243463E-6,130:1.31046647243463E-6)99:0.008850700299165248,((4:1.31046647243463E-6,(148:1.31046647243463E-6,9:1.31046647243463E-6)14:1.31046647243463E-6)25:1.31046647243463E-6,179:1.31046647243463E-6)76:0.002076904811932784)50:0.002191891784363617)26:0.002149800404191765,((7:1.31046647243463E-6,67:1.31046647243463E-6)32:1.31046647243463E-6,74:1.31046647243463E-6)75:0.0021080384539640144)64:0.00445902337516243,(((127:1.31046647243463E-6,(((121:1.31046647243463E-6,((8:1.31046647243463E-6,(60:0.0021672329623186807,(155:0.00436581340370865,((((21:1.31046647243463E-6,(61:1.31046647243463E-6,51:1.31046647243463E-6)10:1.31046647243463E-6)2:1.31046647243463E-6,85:1.31046647243463E-6)1:1.31046647243463E-6,(49:1.31046647243463E-6,(117:1.31046647243463E-6,37:1.31046647243463E-6)3:1.31046647243463E-6)1:1.31046647243463E-6)46:0.002161201347236908,((86:1.31046647243463E-6,(56:1.31046647243463E-6,(87:1.31046647243463E-6,(36:1.31046647243463E-6,(162:1.31046647243463E-6,((26:1.31046647243463E-6,(22:1.31046647243463E-6,(18:1.31046647243463E-6,(29:1.31046647243463E-6,(35:1.31046647243463E-6,(158:1.31046647243463E-6,(166:1.31046647243463E-6,(50:1.31046647243463E-6,(17:1.31046647243463E-6,((53:1.31046647243463E-6,((((55:1.31046647243463E-6,(165:1.31046647243463E-6,94:1.31046647243463E-6)72:1.31046647243463E-6)3:1.31046647243463E-6,75:1.31046647243463E-6)0:1.31046647243463E-6,123:1.31046647243463E-6)0:1.31046647243463E-6,122:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6,38:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6,157:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6,47:0.0021638904186114766)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6,135:1.31046647243463E-6)0:1.31046647243463E-6)0:1.31046647243463E-6,78:1.31046647243463E-6)0:1.31046647243463E-6,77:1.31046647243463E-6)0:1.31046647243463E-6)2:1.31046647243463E-6,115:1.31046647243463E-6)6:1.31046647243463E-6,(164:1.31046647243463E-6,163:1.31046647243463E-6)64:0.002166844632554091)44:0.002329028002720639)20:1.31046647243463E-6)46:0.0049727116585536885)11:0.0014859085257715524)26:0.002518121864873913,((((92:1.31046647243463E-6,160:1.31046647243463E-6)93:0.0021644341341261666,((170:1.31046647243463E-6,174:1.31046647243463E-6)34:1.31046647243463E-6,97:1.31046647243463E-6)97:0.0066023398555470295)70:0.00416008738991868,(((15:0.002150976264275039,(89:1.31046647243463E-6,(90:1.31046647243463E-6,1:1.31046647243463E-6)20:1.31046647243463E-6)64:1.31046647243463E-6)98:0.008867905380567998,((((146:1.31046647243463E-6,(83:1.31046647243463E-6,((82:1.31046647243463E-6,(81:1.31046647243463E-6,32:1.31046647243463E-6)11:1.31046647243463E-6)1:1.31046647243463E-6,140:1.31046647243463E-6)0:1.31046647243463E-6)1:1.31046647243463E-6)1:1.31046647243463E-6,3:1.31046647243463E-6)2:1.31046647243463E-6,12:1.31046647243463E-6)47:1.31046647243463E-6,84:0.002136933807803962)98:0.008785479392317599)79:0.0023014642962297925,((171:1.31046647243463E-6,173:1.31046647243463E-6)86:1.31046647243463E-6,(((152:1.31046647243463E-6,167:1.31046647243463E-6)17:1.31046647243463E-6,80:1.31046647243463E-6)6:1.31046647243463E-6,((79:1.31046647243463E-6,153:1.31046647243463E-6)16:1.31046647243463E-6,172:1.31046647243463E-6)5:1.31046647243463E-6)96:0.006511947299294508)80:0.00418600007316142)40:0.002143765392540741)24:1.31046647243463E-6,(180:1.31046647243463E-6,45:1.31046647243463E-6)99:0.006648625771432264)71:0.00435445761431396)38:0.002360162225405622,((((136:1.31046647243463E-6,150:1.31046647243463E-6)13:1.31046647243463E-6,93:1.31046647243463E-6)7:1.31046647243463E-6,137:1.31046647243463E-6)7:1.31046647243463E-6,149:1.31046647243463E-6)99:0.010900531213422113)35:0.0021351319641837833,((42:1.31046647243463E-6,43:1.31046647243463E-6)100:0.011023149670412683,(((104:1.31046647243463E-6,159:1.31046647243463E-6)30:1.31046647243463E-6,161:1.31046647243463E-6)98:0.007376215805832276,((108:1.31046647243463E-6,41:1.31046647243463E-6)34:1.31046647243463E-6,125:1.31046647243463E-6)100:0.010262991645538394)87:0.006431501965504187)65:0.0022249893420606334)71:0.021829603724785138,(151:0.0020367450498002954,(128:1.31046647243463E-6,120:1.31046647243463E-6)91:0.0022388314470853147)98:0.029075703900462466):0.10556751262303075,14:0.10556751262303075); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri RAxML TEF1'; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_conidiophora_CBS_137457, 181 Alternaria_catananches_CBS_137456, 182 Alternaria_novae_guineensis_PPRI_12171, 183 Alternaria_anodae_PPRI_12376; TREE RAxML_TEF1 = [&R] (((((122:1.69141629440116E-6,130:1.69141629440116E-6)32:1.69141629440116E-6,113:1.69141629440116E-6)89:0.005747632711150821,(103:1.69141629440116E-6,153:1.69141629440116E-6)87:1.69141629440116E-6)100:0.04490178221970062,((((((((((105:1.69141629440116E-6,161:1.69141629440116E-6)30:1.69141629440116E-6,163:1.69141629440116E-6)100:0.019071309044920916,(((((16:1.69141629440116E-6,((19:1.69141629440116E-6,(98:1.69141629440116E-6,140:1.69141629440116E-6)3:1.69141629440116E-6)0:1.69141629440116E-6,(((104:1.69141629440116E-6,111:1.69141629440116E-6)2:1.69141629440116E-6,38:1.69141629440116E-6)1:1.69141629440116E-6,102:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6,((133:1.69141629440116E-6,((112:1.69141629440116E-6,147:1.69141629440116E-6)3:1.69141629440116E-6,141:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6,((((((107:1.69141629440116E-6,40:1.69141629440116E-6)39:1.69141629440116E-6,126:1.69141629440116E-6)87:0.0060728794992546105,156:0.003020310455551945)6:1.69141629440116E-6,((106:1.69141629440116E-6,91:1.69141629440116E-6)97:0.009127247639792804,96:0.003019762012502463)8:1.69141629440116E-6)0:1.69141629440116E-6,((((44:0.006057955279740778,(99:1.69141629440116E-6,(110:1.69141629440116E-6,149:1.69141629440116E-6)20:1.69141629440116E-6)47:1.69141629440116E-6)61:0.0030199344928400268,28:0.015292516228587027)10:1.69141629440116E-6,(((100:1.69141629440116E-6,39:1.69141629440116E-6)20:1.69141629440116E-6,101:1.69141629440116E-6)54:1.69141629440116E-6,((((30:1.69141629440116E-6,27:1.69141629440116E-6)17:1.69141629440116E-6,63:1.69141629440116E-6)4:1.69141629440116E-6,120:1.69141629440116E-6)0:1.69141629440116E-6,((62:1.69141629440116E-6,5:1.69141629440116E-6)4:1.69141629440116E-6,25:1.69141629440116E-6)1:1.69141629440116E-6)99:0.015349222620650783)48:0.00302168059154685)1:1.69141629440116E-6,145:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6,(76:1.69141629440116E-6,137:1.69141629440116E-6)1:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6,(11:1.69141629440116E-6,6:1.69141629440116E-6)6:1.69141629440116E-6)0:1.69141629440116E-6,((31:1.69141629440116E-6,(108:1.69141629440116E-6,(121:1.69141629440116E-6,(48:1.69141629440116E-6,115:1.69141629440116E-6)82:0.003011863684831303)98:0.012235889121720259)41:0.0030258494274837265)20:0.003020329412933602,46:0.00913769207824647)2:1.69141629440116E-6)3:1.69141629440116E-6,((59:1.69141629440116E-6,158:1.69141629440116E-6)28:1.69141629440116E-6,58:1.69141629440116E-6)84:0.006068520881857757)47:0.0029300719293018176)33:0.006183809033600391,(((183:0.009121846744633767,(45:1.69141629440116E-6,182:1.69141629440116E-6)100:0.021626852670739428)21:1.69141629440116E-6,(95:1.69141629440116E-6,146:1.69141629440116E-6)62:1.69141629440116E-6)11:1.69141629440116E-6,((41:1.69141629440116E-6,127:1.69141629440116E-6)33:1.69141629440116E-6,109:1.69141629440116E-6)95:0.009253122386790404)23:1.69141629440116E-6)47:0.006202361330873643,((173:0.006062516327669251,(((154:1.69141629440116E-6,(174:1.69141629440116E-6,169:1.69141629440116E-6)6:1.69141629440116E-6)2:1.69141629440116E-6,(175:1.69141629440116E-6,79:1.69141629440116E-6)8:1.69141629440116E-6)6:1.69141629440116E-6,(155:1.69141629440116E-6,80:1.69141629440116E-6)23:1.69141629440116E-6)51:1.69141629440116E-6)69:0.003018930879118895,((172:1.69141629440116E-6,176:1.69141629440116E-6)65:1.69141629440116E-6,((162:1.69141629440116E-6,97:1.69141629440116E-6)29:1.69141629440116E-6,92:1.69141629440116E-6)68:0.003032758177049698)87:0.0061449158106474675)82:0.009389814490722884)24:0.0029486110380338433,(((((43:1.69141629440116E-6,42:1.69141629440116E-6)99:0.009194039265405405,((15:1.69141629440116E-6,1:1.69141629440116E-6)16:1.69141629440116E-6,(90:1.69141629440116E-6,89:1.69141629440116E-6)17:1.69141629440116E-6)98:0.006054621624360471)97:0.009380178812991207,((((170:1.69141629440116E-6,177:1.69141629440116E-6)27:1.69141629440116E-6,171:1.69141629440116E-6)16:1.69141629440116E-6,179:1.69141629440116E-6)91:0.0029736773855653237,(134:1.69141629440116E-6,178:1.69141629440116E-6)99:0.009339846904998015)77:0.00301773485518905)93:0.012335343594329123,((47:1.69141629440116E-6,(71:1.69141629440116E-6,((136:1.69141629440116E-6,(72:1.69141629440116E-6,13:1.69141629440116E-6)7:1.69141629440116E-6)1:1.69141629440116E-6,(20:1.69141629440116E-6,(73:1.69141629440116E-6,(118:1.69141629440116E-6,64:1.69141629440116E-6)10:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6)2:1.69141629440116E-6)98:0.01215724354017091)92:0.0060045732133312945,(((((165:1.69141629440116E-6,166:1.69141629440116E-6)69:0.0030477039766692846,(143:1.69141629440116E-6,(131:1.69141629440116E-6,(88:1.69141629440116E-6,132:1.69141629440116E-6)19:1.69141629440116E-6)11:1.69141629440116E-6)29:1.69141629440116E-6)48:0.0030457080909364054,117:0.0030412383464442556)3:1.69141629440116E-6,((37:1.69141629440116E-6,(119:1.69141629440116E-6,(85:1.69141629440116E-6,51:1.69141629440116E-6)6:1.69141629440116E-6)1:1.69141629440116E-6)1:1.69141629440116E-6,(21:1.69141629440116E-6,(49:1.69141629440116E-6,61:1.69141629440116E-6)9:1.69141629440116E-6)3:1.69141629440116E-6)25:1.69141629440116E-6)24:1.69141629440116E-6,(((129:1.69141629440116E-6,(((159:1.69141629440116E-6,160:1.69141629440116E-6)7:1.69141629440116E-6,86:1.69141629440116E-6)1:1.69141629440116E-6,87:1.69141629440116E-6)2:1.69141629440116E-6)2:1.69141629440116E-6,(35:1.69141629440116E-6,50:1.69141629440116E-6)17:1.69141629440116E-6)66:0.0031059572086564297,(9:1.69141629440116E-6,(60:0.003089484216811207,((167:0.0031022048563404776,((150:1.69141629440116E-6,((125:1.69141629440116E-6,(7:1.69141629440116E-6,67:1.69141629440116E-6)7:1.69141629440116E-6)1:1.69141629440116E-6,(124:1.69141629440116E-6,(74:1.69141629440116E-6,123:1.69141629440116E-6)5:1.69141629440116E-6)0:1.69141629440116E-6)2:1.69141629440116E-6)9:1.69141629440116E-6,((157:0.003123561669301814,((75:1.69141629440116E-6,((22:1.69141629440116E-6,18:1.69141629440116E-6)16:1.69141629440116E-6,8:1.69141629440116E-6)19:1.69141629440116E-6)74:0.003093748656517822,(168:1.69141629440116E-6,(53:1.69141629440116E-6,(56:1.69141629440116E-6,(29:1.69141629440116E-6,(17:1.69141629440116E-6,26:1.69141629440116E-6)33:1.69141629440116E-6)15:1.69141629440116E-6)6:1.69141629440116E-6)9:1.69141629440116E-6)70:0.0030920126077340236)16:1.69141629440116E-6)61:0.0030980126873038885,(((55:1.69141629440116E-6,4:1.69141629440116E-6)6:1.69141629440116E-6,((94:1.69141629440116E-6,181:1.69141629440116E-6)5:1.69141629440116E-6,(164:1.69141629440116E-6,36:1.69141629440116E-6)2:1.69141629440116E-6)1:1.69141629440116E-6)0:1.69141629440116E-6,(78:1.69141629440116E-6,77:1.69141629440116E-6)4:1.69141629440116E-6)65:0.00310221144224249)11:1.69141629440116E-6)8:1.69141629440116E-6)56:0.003099306549868633,(((66:1.69141629440116E-6,((10:1.69141629440116E-6,(((((69:1.69141629440116E-6,116:1.69141629440116E-6)5:1.69141629440116E-6,(34:1.69141629440116E-6,(68:1.69141629440116E-6,52:1.69141629440116E-6)4:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6,144:1.69141629440116E-6)0:1.69141629440116E-6,24:1.69141629440116E-6)0:1.69141629440116E-6,(70:1.69141629440116E-6,128:1.69141629440116E-6)6:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6,23:1.69141629440116E-6)0:1.69141629440116E-6)0:1.69141629440116E-6,33:1.69141629440116E-6)0:1.69141629440116E-6,57:1.69141629440116E-6)18:1.69141629440116E-6)43:0.0030949546260936565)5:1.69141629440116E-6)7:1.69141629440116E-6)76:0.006210409929417102)100:0.02219412524706471)81:0.009417381440050852)30:1.69141629440116E-6,180:0.012273629637207524)65:0.003048496471214415)8:1.69141629440116E-6,114:0.021887800087518505)26:0.006116906933649716,(((148:1.69141629440116E-6,83:1.69141629440116E-6)29:1.69141629440116E-6,12:1.69141629440116E-6)68:0.003007075026434357,(((((82:1.69141629440116E-6,84:1.69141629440116E-6)33:1.69141629440116E-6,81:1.69141629440116E-6)15:1.69141629440116E-6,142:1.69141629440116E-6)89:0.006053397619286671,32:1.69141629440116E-6)2:1.69141629440116E-6,3:1.69141629440116E-6)43:1.69141629440116E-6)95:0.012442923496719122)12:1.69141629440116E-6,(93:1.69141629440116E-6,(((151:1.69141629440116E-6,139:1.69141629440116E-6)13:1.69141629440116E-6,138:1.69141629440116E-6)6:1.69141629440116E-6,152:1.69141629440116E-6)11:1.69141629440116E-6)100:0.028494437801251233)82:0.02563027790072127,(((135:1.69141629440116E-6,54:1.69141629440116E-6)32:1.69141629440116E-6,65:1.69141629440116E-6)90:0.006141707491297832,2:1.69141629440116E-6)100:0.023509503576731677)76:0.02515613250535899):0.09120130956919988,14:0.09120130956919988); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri RAxML concatenated genes'; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_conidiophora_CBS_137457, 181 Alternaria_catananches_CBS_137456, 182 Alternaria_novae_guineensis_PPRI_12171, 183 Alternaria_anodae_PPRI_12376; TREE RAxML_concatenated_dataset = [&R] (((((130:2.09260850432541E-6,113:2.09260850432541E-6)84:4.2877318189616634E-4,122:4.2777496774966286E-4)100:0.0026913825755841333,(103:2.09260850432541E-6,153:2.09260850432541E-6)100:0.0011951186610514683)100:0.027581643482010143,((((((((148:8.657508212095701E-4,(12:2.09260850432541E-6,83:2.09260850432541E-6)81:2.09260850432541E-6)41:4.3183974444654325E-4,(((142:4.3201845391414834E-4,(84:0.001300900695091039,82:4.318054239185105E-4)14:2.09260850432541E-6)38:4.3097916507968924E-4,81:4.3371167833842166E-4)67:8.663327877017321E-4,(3:2.09260850432541E-6,32:2.09260850432541E-6)85:4.326784033369645E-4)24:2.09260850432541E-6)100:0.00634169845033558,((173:8.674431369881183E-4,(175:2.09260850432541E-6,((((80:2.09260850432541E-6,155:2.09260850432541E-6)36:2.09260850432541E-6,174:2.09260850432541E-6)8:2.09260850432541E-6,(79:2.09260850432541E-6,169:2.09260850432541E-6)8:2.09260850432541E-6)9:2.09260850432541E-6,154:2.09260850432541E-6)94:0.0013042767420939467)60:2.09260850432541E-6)100:0.004943616277229064,((92:2.09260850432541E-6,162:2.09260850432541E-6)99:4.118220293908357E-4,(97:2.09260850432541E-6,(172:2.09260850432541E-6,176:2.09260850432541E-6)68:4.3362527719249935E-4)91:0.0017661800132803113)100:0.006719559434800398)96:0.002111018049278326)88:0.0018234628732034333,(((15:0.0013276186529278078,(1:2.09260850432541E-6,(90:2.09260850432541E-6,89:2.09260850432541E-6)73:2.09260850432541E-6)100:0.0017082745914764096)100:0.005247366910261346,(42:2.09260850432541E-6,43:2.09260850432541E-6)100:0.007701091869978096)84:0.00177346503691729,(((177:2.09260850432541E-6,(170:2.09260850432541E-6,179:2.09260850432541E-6)23:2.09260850432541E-6)18:2.09260850432541E-6,171:2.09260850432541E-6)100:0.0035295812103835543,(134:2.09260850432541E-6,178:2.09260850432541E-6)100:0.0013037460124062173)100:0.008889804999277268)93:0.0037664592289006443)89:0.0026158647630037477,(((93:2.09260850432541E-6,152:2.09260850432541E-6)71:4.2914308846028217E-4,(138:2.09260850432541E-6,(139:2.09260850432541E-6,151:2.09260850432541E-6)37:2.09260850432541E-6)73:2.09260850432541E-6)100:0.015003887252215532,(((45:4.2989688295075383E-4,182:2.09260850432541E-6)100:0.009834297161826648,(((105:2.09260850432541E-6,161:2.09260850432541E-6)36:2.09260850432541E-6,163:2.09260850432541E-6)100:0.01433289722082123,(41:0.007035848729720808,(127:2.09260850432541E-6,109:2.09260850432541E-6)100:0.008904190666973706)97:0.002910804643158576)92:0.00348373153613524)72:0.001025918735232266,(183:0.007347999549046812,((108:0.005334895417825426,(((95:2.09260850432541E-6,146:2.09260850432541E-6)100:0.007896678263064914,((31:0.0057348762238427975,((115:2.09260850432541E-6,48:2.09260850432541E-6)99:4.183304499085594E-4,121:8.7110393182363E-4)100:0.006654904245576184)46:0.0012697441978078835,(28:0.007366703187075702,(((107:2.09260850432541E-6,40:2.09260850432541E-6)34:2.09260850432541E-6,126:2.09260850432541E-6)100:0.007321450736250269,(((((5:2.09260850432541E-6,62:2.09260850432541E-6)13:2.09260850432541E-6,30:2.09260850432541E-6)13:2.09260850432541E-6,120:2.09260850432541E-6)16:2.09260850432541E-6,(63:2.09260850432541E-6,25:2.09260850432541E-6)67:2.09260850432541E-6)53:2.09260850432541E-6,27:2.09260850432541E-6)100:0.006171916558160581)63:6.732150918265031E-4)74:0.0018922659830419826)37:2.09260850432541E-6)31:0.0013158832623716393,6:0.005265756783174504)16:4.0245937538623124E-4)29:0.0013258890636537492,(((96:8.565290000100909E-4,(91:2.09260850432541E-6,106:2.09260850432541E-6)100:0.001308538612357924)100:0.0048509405185545515,(((19:2.09260850432541E-6,(141:2.09260850432541E-6,140:2.09260850432541E-6)23:2.09260850432541E-6)57:2.09260850432541E-6,(((98:2.09260850432541E-6,112:2.09260850432541E-6)29:2.09260850432541E-6,16:2.09260850432541E-6)43:2.09260850432541E-6,76:4.3245378326214353E-4)64:4.3199039735208173E-4)99:0.002141564440043265,(((44:8.620063950350679E-4,(99:2.09260850432541E-6,149:2.09260850432541E-6)57:2.09260850432541E-6)50:2.09260850432541E-6,110:8.624184719095064E-4)97:0.0013309282767476312,((147:0.0010099557762518348,111:0.0025510880430258693)100:0.0037318863543779873,((((38:2.09260850432541E-6,137:2.09260850432541E-6)100:0.004825886465046435,156:8.662274833079153E-4)53:4.3193648706008574E-4,((133:2.09260850432541E-6,104:2.09260850432541E-6)33:2.09260850432541E-6,145:2.09260850432541E-6)83:2.09260850432541E-6)99:0.002128427319165717,(59:2.09260850432541E-6,58:2.09260850432541E-6)100:0.0022320038518370963)88:0.0021965393626515923)44:6.071759838518574E-4)73:0.0021164097585685167)38:4.611394415481692E-4)37:8.698634243403935E-4,(((11:2.09260850432541E-6,102:8.653147599121938E-4)97:0.0012986384413662603,((101:2.09260850432541E-6,(39:4.3230691275615156E-4,100:4.3117891518271303E-4)68:4.323340974241583E-4)80:4.3282807220390373E-4,46:0.001299622958971399)71:4.3084900737689084E-4)53:2.09260850432541E-6,158:0.001732285035030235)62:8.622301291783486E-4)37:8.722546768182716E-4)53:0.0023845541363354287)100:0.007830275469445577)84:0.003008113301090969)70:0.002290200250148057)60:0.0013662894113729395,(180:0.01066300668031021,(47:0.006857379400261393,((((((118:2.09260850432541E-6,73:2.09260850432541E-6)17:2.09260850432541E-6,20:2.09260850432541E-6)7:2.09260850432541E-6,(136:2.09260850432541E-6,13:2.09260850432541E-6)11:2.09260850432541E-6)99:0.003478126666372783,64:2.09260850432541E-6)50:4.316574823257649E-4,(71:2.09260850432541E-6,72:2.09260850432541E-6)74:2.09260850432541E-6)100:0.008678252042738246,(((85:2.09260850432541E-6,(51:2.09260850432541E-6,(119:2.09260850432541E-6,21:2.09260850432541E-6)4:2.09260850432541E-6)1:2.09260850432541E-6)1:2.09260850432541E-6,((37:2.09260850432541E-6,49:2.09260850432541E-6)11:2.09260850432541E-6,61:2.09260850432541E-6)3:2.09260850432541E-6)99:0.002292864547648477,(((((70:2.09260850432541E-6,69:2.09260850432541E-6)51:2.09260850432541E-6,66:2.09260850432541E-6)13:2.09260850432541E-6,((128:2.09260850432541E-6,116:2.09260850432541E-6)18:2.09260850432541E-6,52:2.09260850432541E-6)5:2.09260850432541E-6)5:2.09260850432541E-6,144:2.09260850432541E-6)97:9.983015641141515E-4,((((34:2.09260850432541E-6,((57:2.09260850432541E-6,(33:2.09260850432541E-6,23:2.09260850432541E-6)14:2.09260850432541E-6)13:2.09260850432541E-6,10:2.09260850432541E-6)43:2.09260850432541E-6)78:2.09260850432541E-6,(24:2.09260850432541E-6,68:2.09260850432541E-6)89:4.349985409313118E-4)95:0.0017482001266203916,((((((((((50:2.09260850432541E-6,86:2.09260850432541E-6)20:2.09260850432541E-6,160:2.09260850432541E-6)2:2.09260850432541E-6,159:2.09260850432541E-6)2:2.09260850432541E-6,35:2.09260850432541E-6)2:2.09260850432541E-6,129:2.09260850432541E-6)59:2.09260850432541E-6,87:8.721306424821499E-4)100:0.002207802032643636,(((((55:2.09260850432541E-6,164:2.09260850432541E-6)34:2.09260850432541E-6,77:2.09260850432541E-6)98:0.0010592614694771266,((78:8.634004834516556E-4,(117:0.005285632711310604,((7:2.09260850432541E-6,74:2.09260850432541E-6)89:2.09260850432541E-6,150:8.728578300122786E-4)88:0.0031680896575636626)14:2.09260850432541E-6)45:0.0014633087542338255,((((((18:2.09260850432541E-6,22:2.09260850432541E-6)24:2.09260850432541E-6,75:2.09260850432541E-6)13:2.09260850432541E-6,8:2.09260850432541E-6)84:8.701110858317982E-4,(56:2.09260850432541E-6,(168:2.09260850432541E-6,26:2.09260850432541E-6)21:2.09260850432541E-6)55:2.09260850432541E-6)50:4.3456646289964315E-4,((53:2.09260850432541E-6,29:2.09260850432541E-6)25:2.09260850432541E-6,17:2.09260850432541E-6)58:2.09260850432541E-6)100:0.006315296434361245,(36:8.576237926587476E-4,(60:0.002631863119091301,((181:0.005765532840238033,4:2.09260850432541E-6)81:0.002633727193354294,94:2.09260850432541E-6)32:2.09260850432541E-6)68:0.001334045181064154)90:0.003528383335862386)31:0.0010965108304803592)50:0.002588963204028455)32:0.0016186594449810918,167:0.004822322070101536)30:0.0013860727640165884,157:0.003097558112898453)17:4.0863101514562224E-4)19:9.13246706933326E-4,(165:2.09260850432541E-6,166:2.09260850432541E-6)100:0.004856188865976951)4:0.001326482146933161,67:0.0012803816415882716)3:4.7179090544592964E-4,(((143:2.09260850432541E-6,88:2.09260850432541E-6)25:2.09260850432541E-6,131:2.09260850432541E-6)49:2.09260850432541E-6,132:2.09260850432541E-6)100:0.0043852629165673)5:2.09260850432541E-6)10:0.0017742444882696262,(9:0.0017516806776720119,((125:2.09260850432541E-6,124:2.09260850432541E-6)33:2.09260850432541E-6,123:2.09260850432541E-6)88:0.0022085927708516096)84:0.003575062851895775)20:0.0012037062790688793)64:0.0022374867782089)87:0.003801389029299296)23:0.0012305175879347167)99:0.005952690147656568)85:0.0020943519917403647)83:0.0020769849857527243,114:0.019164963135729046)90:0.006981748064177692,(2:2.09260850432541E-6,((135:2.09260850432541E-6,54:2.09260850432541E-6)90:8.663388030430509E-4,65:2.09260850432541E-6)88:8.663575485006608E-4)100:0.011882432956086538)97:0.015899373577280072):0.06713331223926368,14:0.06713331223926368); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri RAxML GAPDH'; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_conidiophora_CBS_137457, 181 Alternaria_catananches_CBS_137456, 182 Alternaria_novae_guineensis_PPRI_12171, 183 Alternaria_anodae_PPRI_12376; TREE RAxML_GAPDH = [&R] ((((153:1.85500806942133E-6,103:1.85500806942133E-6)87:0.0019482859549162684,(122:1.85500806942133E-6,(130:1.85500806942133E-6,113:1.85500806942133E-6)74:0.0017268077080161523)83:0.0015073581091788475)100:0.023886051087174304,(((54:1.85500806942133E-6,135:1.85500806942133E-6)71:0.0017558953357351985,(2:1.85500806942133E-6,65:1.85500806942133E-6)69:1.85500806942133E-6)100:0.017323780239992214,((114:0.01663129036579348,((((38:1.85500806942133E-6,(137:1.85500806942133E-6,156:1.85500806942133E-6)28:1.85500806942133E-6)66:0.001724230915203663,(((((147:1.85500806942133E-6,111:1.85500806942133E-6)17:1.85500806942133E-6,(6:0.00172634652446477,(149:1.85500806942133E-6,((99:1.85500806942133E-6,44:1.85500806942133E-6)27:1.85500806942133E-6,110:1.85500806942133E-6)16:1.85500806942133E-6)66:0.001738742764643161)6:1.85500806942133E-6)12:1.85500806942133E-6,((141:1.85500806942133E-6,(((19:1.85500806942133E-6,16:1.85500806942133E-6)19:1.85500806942133E-6,(112:1.85500806942133E-6,140:1.85500806942133E-6)17:1.85500806942133E-6)1:1.85500806942133E-6,98:1.85500806942133E-6)1:1.85500806942133E-6)2:1.85500806942133E-6,76:1.85500806942133E-6)62:0.0017384557722215032)58:0.0017262534481155513,(91:1.85500806942133E-6,(106:1.85500806942133E-6,96:1.85500806942133E-6)22:1.85500806942133E-6)62:0.0017262035650167354)7:1.85500806942133E-6,((145:1.85500806942133E-6,133:1.85500806942133E-6)8:1.85500806942133E-6,(104:1.85500806942133E-6,(59:1.85500806942133E-6,(58:1.85500806942133E-6,158:1.85500806942133E-6)3:1.85500806942133E-6)1:1.85500806942133E-6)0:1.85500806942133E-6)6:1.85500806942133E-6)12:1.85500806942133E-6)61:0.0017263219259639321,((46:1.85500806942133E-6,(101:1.85500806942133E-6,((100:1.85500806942133E-6,39:1.85500806942133E-6)10:1.85500806942133E-6,(108:1.85500806942133E-6,183:1.85500806942133E-6)7:1.85500806942133E-6)1:1.85500806942133E-6)1:1.85500806942133E-6)12:1.85500806942133E-6,((((48:1.85500806942133E-6,115:1.85500806942133E-6)29:1.85500806942133E-6,121:1.85500806942133E-6)53:1.85500806942133E-6,31:0.001729538352939236)96:0.005240371899512089,((102:1.85500806942133E-6,11:1.85500806942133E-6)78:0.0017315948780522606,((((5:1.85500806942133E-6,(120:1.85500806942133E-6,62:1.85500806942133E-6)16:1.85500806942133E-6)4:1.85500806942133E-6,25:1.85500806942133E-6)3:1.85500806942133E-6,(30:1.85500806942133E-6,(27:1.85500806942133E-6,63:1.85500806942133E-6)16:1.85500806942133E-6)3:1.85500806942133E-6)74:0.001730775074090624,(((107:1.85500806942133E-6,126:1.85500806942133E-6)32:1.85500806942133E-6,40:1.85500806942133E-6)73:0.0017169371793411487,28:0.008732657991946802)31:1.85500806942133E-6)67:0.001726555033517294)59:0.0017363241204032276)11:1.85500806942133E-6)2:1.85500806942133E-6)21:1.85500806942133E-6,(95:1.85500806942133E-6,146:1.85500806942133E-6)96:0.005208963708521331)91:0.007255163925728288)17:1.85500806942133E-6,((((((((90:1.85500806942133E-6,89:1.85500806942133E-6)9:1.85500806942133E-6,((1:1.85500806942133E-6,15:1.85500806942133E-6)10:1.85500806942133E-6,(43:1.85500806942133E-6,42:1.85500806942133E-6)9:1.85500806942133E-6)2:1.85500806942133E-6)78:0.0017158606601912626,((177:1.85500806942133E-6,((171:1.85500806942133E-6,170:1.85500806942133E-6)12:1.85500806942133E-6,179:1.85500806942133E-6)9:1.85500806942133E-6)66:0.0017391372627913626,(134:1.85500806942133E-6,178:1.85500806942133E-6)58:1.85500806942133E-6)78:0.0017757929043230242)95:0.005311150470966307,(((81:0.0017642835148178112,(83:1.85500806942133E-6,(82:1.85500806942133E-6,((142:1.85500806942133E-6,(148:1.85500806942133E-6,(3:1.85500806942133E-6,84:1.85500806942133E-6)11:1.85500806942133E-6)1:1.85500806942133E-6)0:1.85500806942133E-6,(12:1.85500806942133E-6,32:1.85500806942133E-6)13:1.85500806942133E-6)1:1.85500806942133E-6)2:1.85500806942133E-6)31:1.85500806942133E-6)71:0.0017556003316461753,((((((155:1.85500806942133E-6,174:1.85500806942133E-6)13:1.85500806942133E-6,169:1.85500806942133E-6)1:1.85500806942133E-6,(79:1.85500806942133E-6,(80:1.85500806942133E-6,154:1.85500806942133E-6)5:1.85500806942133E-6)0:1.85500806942133E-6)2:1.85500806942133E-6,173:1.85500806942133E-6)1:1.85500806942133E-6,175:1.85500806942133E-6)92:0.0035083860150092413,(162:1.85500806942133E-6,((172:1.85500806942133E-6,176:1.85500806942133E-6)23:1.85500806942133E-6,(97:1.85500806942133E-6,92:1.85500806942133E-6)37:1.85500806942133E-6)9:1.85500806942133E-6)98:0.007072099959278231)32:1.85500806942133E-6)69:0.0018232770393691953,41:0.008955662830559782)35:0.0016997925295308988)27:0.0017503537717658353,(182:1.85500806942133E-6,45:1.85500806942133E-6)97:0.005271977382738846)5:1.85500806942133E-6,((((139:1.85500806942133E-6,152:1.85500806942133E-6)38:1.85500806942133E-6,138:1.85500806942133E-6)4:1.85500806942133E-6,(93:1.85500806942133E-6,151:1.85500806942133E-6)6:1.85500806942133E-6)100:0.014629235898459112,181:0.010917123042741058)36:0.0016447969837287604)1:1.85500806942133E-6,180:0.01072240159071327)6:0.0017386325213483848,((((((85:1.85500806942133E-6,119:1.85500806942133E-6)18:1.85500806942133E-6,(((49:1.85500806942133E-6,21:1.85500806942133E-6)8:1.85500806942133E-6,51:1.85500806942133E-6)2:1.85500806942133E-6,37:1.85500806942133E-6)14:1.85500806942133E-6)2:1.85500806942133E-6,61:1.85500806942133E-6)61:0.0017349900211193479,(((((159:1.85500806942133E-6,55:1.85500806942133E-6)1:1.85500806942133E-6,160:1.85500806942133E-6)0:1.85500806942133E-6,78:1.85500806942133E-6)0:1.85500806942133E-6,(117:1.85500806942133E-6,(((77:1.85500806942133E-6,36:1.85500806942133E-6)4:1.85500806942133E-6,(((35:1.85500806942133E-6,50:1.85500806942133E-6)6:1.85500806942133E-6,164:1.85500806942133E-6)0:1.85500806942133E-6,167:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6,((86:1.85500806942133E-6,87:1.85500806942133E-6)1:1.85500806942133E-6,129:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6,157:1.85500806942133E-6)9:1.85500806942133E-6)12:1.85500806942133E-6,(((26:1.85500806942133E-6,((75:1.85500806942133E-6,168:1.85500806942133E-6)21:1.85500806942133E-6,8:1.85500806942133E-6)2:1.85500806942133E-6)1:1.85500806942133E-6,(22:1.85500806942133E-6,(56:1.85500806942133E-6,18:1.85500806942133E-6)6:1.85500806942133E-6)3:1.85500806942133E-6)63:0.0017293401131885677,((29:1.85500806942133E-6,17:1.85500806942133E-6)22:1.85500806942133E-6,53:1.85500806942133E-6)34:1.85500806942133E-6)59:0.001733005127191349)56:0.001745986273811585,((((((((94:1.85500806942133E-6,125:1.85500806942133E-6)5:1.85500806942133E-6,(123:1.85500806942133E-6,(74:1.85500806942133E-6,((60:1.85500806942133E-6,(67:1.85500806942133E-6,124:1.85500806942133E-6)6:1.85500806942133E-6)1:1.85500806942133E-6,(9:1.85500806942133E-6,4:1.85500806942133E-6)13:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6,7:1.85500806942133E-6)3:1.85500806942133E-6,150:1.85500806942133E-6)26:1.85500806942133E-6,((166:1.85500806942133E-6,165:1.85500806942133E-6)84:0.0017626430728766168,47:0.0017375241103690195)67:0.001760743329066302)43:0.0017433241112547841,((88:1.85500806942133E-6,132:1.85500806942133E-6)21:1.85500806942133E-6,(143:1.85500806942133E-6,131:1.85500806942133E-6)15:1.85500806942133E-6)62:0.0017433790830481768)3:1.85500806942133E-6,((((24:1.85500806942133E-6,68:1.85500806942133E-6)65:0.001741284503532173,((118:1.85500806942133E-6,(64:1.85500806942133E-6,71:1.85500806942133E-6)19:1.85500806942133E-6)6:1.85500806942133E-6,(((73:1.85500806942133E-6,72:1.85500806942133E-6)65:1.85500806942133E-6,136:1.85500806942133E-6)2:1.85500806942133E-6,(20:1.85500806942133E-6,13:1.85500806942133E-6)16:1.85500806942133E-6)2:1.85500806942133E-6)96:0.007067923375811497)13:1.85500806942133E-6,((66:1.85500806942133E-6,((33:1.85500806942133E-6,((128:1.85500806942133E-6,(34:1.85500806942133E-6,70:1.85500806942133E-6)4:1.85500806942133E-6)0:1.85500806942133E-6,(23:1.85500806942133E-6,10:1.85500806942133E-6)7:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6,57:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6,69:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6,((116:1.85500806942133E-6,144:1.85500806942133E-6)3:1.85500806942133E-6,52:1.85500806942133E-6)0:1.85500806942133E-6)0:1.85500806942133E-6)20:1.85500806942133E-6,((127:1.85500806942133E-6,109:1.85500806942133E-6)99:0.005452274577243953,((105:1.85500806942133E-6,163:1.85500806942133E-6)31:1.85500806942133E-6,161:1.85500806942133E-6)99:0.007253538825883445)66:0.0052800457851724806)14:0.0017420562046231278)5:1.85500806942133E-6)25:0.003297839485949568)54:0.006379877483091404)73:0.010544308604709136):0.028280820649818444,14:0.028280820649818444); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri MrBayes GAPDH'; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_conidiophora_CBS_137457, 181 Alternaria_catananches_CBS_137456, 182 Alternaria_novae_guineensis_PPRI_12171, 183 Alternaria_anodae_PPRI_12376; TREE MrBayes_GAPDH = [&R] (14:1.816110531232454,((103:0.04741621229172027,153:0.04528123186732569)0.952:0.1449065647984645,((113:0.04263365353660086,130:0.04771920878263112)0.992:0.1139387951168521,122:0.04976438253634949)0.666:0.09948178344269797)1.000:0.8449938968729562,((((((1:0.04450775483249578,15:0.04971363946493537,42:0.04518855697655755,43:0.0449238365597017,89:0.04945340779937637,90:0.04862728081110491)0.877:0.1107155960904516,(134:0.04393720219922349,(170:0.04669717993015463,171:0.04856526732348875,177:0.04479720929417676,179:0.04470452955839949)0.981:0.1106427588915765,178:0.04262807969579754)0.994:0.1248230988946248)1.000:0.2709331675856609,(((3:0.04571285730592228,12:0.04545301271210941,32:0.04903351539802712,81:0.1134760676411916,82:0.04346131216376953,83:0.04489770542353566,84:0.04550295669079688,142:0.04644880213447591,148:0.04368821146846683)0.939:0.1119590925009219,(79:0.0491155018854782,80:0.04543260501184904,154:0.04737881617200246,155:0.04801977096203567,169:0.04573037647052032,173:0.0431427921584519,174:0.04854825539020034,175:0.04965206094432854)1.000:0.1766617837240581,(92:0.04400518365854538,97:0.04952955193531479,162:0.04373979324218782,172:0.05249590213483527,176:0.04970373377594842)1.000:0.3245274608192035)0.993:0.1244991945280839,41:0.371379951722536)0.800:0.118289644922088)0.669:0.1027182344602007,(4:0.04774023094934024,7:0.04548889262735031,9:0.04699357127653749,(47:0.1139656355827271,(165:0.04729729061795836,166:0.04310379147963197)0.996:0.1141156019550173)0.988:0.1153822211795519,60:0.04572500308086713,67:0.05028953157464908,74:0.04740388362760764,94:0.04518484859516082,123:0.04948672326375779,124:0.04443593428358426,125:0.04494492712118115,150:0.04643249233896381)0.776:0.1133836733478364,(((8:0.04883339503053784,18:0.04500037098660231,22:0.04487421319423156,26:0.04601697808036086,56:0.04917052236719419,75:0.04610248047721913,168:0.0438715886280873)0.959:0.1120089037811378,17:0.05100732575235766,29:0.04765696745734586,53:0.04655295170690822)0.927:0.1187090763972756,(21:0.04629017075255489,37:0.0511619268425242,49:0.04602240963918669,51:0.04554871597889906,61:0.0456182582598705,85:0.04551800829646598,119:0.04822710261082989)0.972:0.1162084648643018,35:0.04762276507483577,36:0.04657699106234661,50:0.04440695929150064,55:0.05116843005758925,77:0.04905696701210418,78:0.04834547337247534,86:0.04718721016626428,87:0.04486262121909809,117:0.04678571769768033,129:0.04873595705443546,157:0.04730811992155048,159:0.04505124740142342,160:0.04734613073041762,164:0.04195597578117243,167:0.04770977405492759)0.989:0.1286785306280509,10:0.04862038787908995,(13:0.04684473275324229,20:0.05042951905577636,64:0.04587272617079471,71:0.04756099589489787,72:0.0435100903550614,73:0.0485988585195922,118:0.04583886080238345,136:0.05069163863925322)1.000:0.3176935020760314,23:0.04497067079312639,(24:0.04607478508390883,68:0.04609330002497877)0.939:0.1161822332729348,33:0.04615590659018207,34:0.04876621699520305,(45:0.04790705324384054,182:0.04654556879388938)1.000:0.2647183260890177,52:0.04391613056715838,57:0.04561957155645301,66:0.04820055212989546,69:0.04728648292848928,70:0.04848019073955878,(88:0.04635886247978376,131:0.04586931845090742,132:0.04427913235617068,143:0.04524925109414082)0.963:0.115883011375601,((93:0.04556536715811702,138:0.04815125069390539,139:0.04593683221704235,151:0.0466328580379664,152:0.04592056239110263)1.000:0.6188020187970658,181:0.4720246677045282)0.576:0.111190308106849,((105:0.0479341109519441,161:0.04684993238591117,163:0.0453302366409708)1.000:0.3157762422609305,(109:0.04708878685737164,127:0.04224887856833125)1.000:0.2587562712592529)0.975:0.2412694248943317,116:0.0466156967468092,128:0.04901788411893653,144:0.04340264101447027,180:0.441802721611988)0.654:0.1666221984072362,((((5:0.04767310630878432,25:0.04406810981452951,27:0.04529313941191282,30:0.04111838996652265,62:0.04722915749276174,63:0.04652578027294126,120:0.04600208686799583)0.992:0.1060099197685679,28:0.37419368235478,(40:0.04628534188341928,107:0.0446246259121098,126:0.04559391146461144)0.973:0.1061142408865245)0.956:0.1204820942192028,(11:0.04606726908574511,102:0.04229593381207047)0.987:0.1182438139575634)0.921:0.1143382678639993,((6:0.1162514305752646,(16:0.04703804232770583,19:0.04235551742935143,76:0.04856911831827523,98:0.04529668503146444,112:0.04529162365834353,140:0.04571869896594957,141:0.04800101354728405)0.998:0.1106886183041319,(44:0.04531581343023926,99:0.0479328183662363,110:0.04440231154416259,149:0.04600091777327919)0.998:0.1092023193781847,111:0.0501137565024055,147:0.04739010359387839)0.975:0.1060066100390106,(38:0.04524574811964467,137:0.04977682983226289,156:0.04841597559421552)0.974:0.1164747211065301,58:0.04960286127824505,59:0.04518514547883647,(91:0.04759208010919511,96:0.04843003057657232,106:0.04662493439317805)0.989:0.1152401390484175,104:0.04598214666913344,133:0.04713407835938247,145:0.04829790590216714,158:0.04692325285098584)0.964:0.1125519125909436,(31:0.1152376347083885,48:0.04753461606902402,115:0.04554428949736406,121:0.04596049711169378)1.000:0.2526154140495252,39:0.04813345020964723,46:0.04846439211491438,(95:0.04748287981264929,146:0.04673082351304118)1.000:0.2517977548255174,100:0.04425878241230385,101:0.0453669943121422,108:0.05015291767001522,183:0.0493551216039413)1.000:0.3398254800486277,114:0.6523353098589411)0.987:0.3045589796259982,(2:0.04346792398330011,(54:0.04482643235151356,135:0.0423300144637672)0.998:0.113554218878,65:0.04402129979933303)1.000:0.6379754792128144)1.000:0.5191093985822226); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri MrBayes RPB2'; LINK TAXA = Taxa1; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_catananches_CBS_137456, 181 Alternaria_novae_guineensis_PPRI_12171, 182 Alternaria_anodae_PPRI_12376; TREE MrBayes_RPB2 = [&R] (14:2.467400624561821,6:0.3899236741493407,114:0.532345178011116,(105:0.0366758021788702,161:0.03426629820127137,163:0.03597909724196678)1.000:0.5131716826628525,(4:0.03697783450001493,(36:0.03572554851399917,180:0.03543152353340836)0.971:0.08556004821312296,60:0.03387734657873475,94:0.03342154823502529)1.000:0.4967173811869526,(92:0.03430895420652616,97:0.03578130991435906,162:0.03462213642857285,172:0.03545279374729094,176:0.03476494070902395)1.000:0.2577207573600557,(109:0.03664215970009221,127:0.03374147704942134)1.000:0.601729926637554,(2:0.03462395354176638,54:0.03373833012388573,65:0.03470540115787014,135:0.03496952708730194)1.000:0.2696024753459404,(8:0.03255330278843942,17:0.0346500164787247,18:0.03677287605370234,22:0.0338369931283834,26:0.03627895504142141,29:0.03557219967662881,53:0.03586860557398119,56:0.0344565208182154,75:0.03614332941439987,168:0.03495314364224614)1.000:0.4230048883913796,((103:0.0353277278193657,153:0.03337886311941618)0.990:0.0856168356675713,(113:0.03643207985118702,122:0.03566886771879137,130:0.03474515044618251)1.000:0.1317313370759447)1.000:0.6024944311461573,((7:0.03489061223824048,74:0.03520494952249742,78:0.03553460035761464,150:0.03410818910263952)0.969:0.1349441793559508,117:0.2921886276687412)0.999:0.2233021635660312,((79:0.03493820723163668,80:0.03414767723243243,154:0.03523227417480733,155:0.0355684873373062,169:0.03398728404819996,173:0.03513517864887115,174:0.03441246142890578,175:0.03409436876884422)0.992:0.2077305235434535,(93:0.03482734265493433,138:0.03430216987745544,139:0.03648489743229956,151:0.03530873733062815,152:0.03397787354988657)0.968:0.1654828230143766)0.957:0.2014731268392898,(((((9:0.03632639185814494,123:0.03535586597459893,124:0.03502112347768464,125:0.03589045308434041)0.997:0.1440599581160127,47:0.07926835883675677)1.000:0.3476235267239259,(((((10:0.03531930689573948,23:0.03467711065879636,24:0.03512095864255044,33:0.03303781629015699,34:0.03402664075731338,57:0.03424587943650344,68:0.03522033559876363)0.999:0.1364261429774914,(35:0.03504184758309795,50:0.03592140878061771,86:0.03262179988992892,87:0.1322461446256608,129:0.03689121971483779,159:0.03438170058722467,160:0.03593851001888322)0.899:0.08515652522160867,67:0.03623515279157286,(88:0.03541366389192121,131:0.03302491934486824,132:0.03496735203502963,143:0.03290880943879541)0.942:0.08158192809290242,157:0.1353286667348395)0.838:0.08450543746169552,(165:0.03346740222808966,166:0.03692098461601346)0.985:0.09469592993725383)0.993:0.1545553502082574,167:0.4481083971631428)0.618:0.10109003312654,(55:0.03551327024783139,77:0.03446946568385433,164:0.03417627185675911)0.999:0.2091608017223473)0.649:0.1689955087037167)0.595:0.09525458710022336,(21:0.03476071692071856,37:0.03581473963716825,49:0.0349368473569771,51:0.03432495448471647,52:0.03313944757231042,61:0.03319749808911863,66:0.03512539467855431,69:0.035266016048911,70:0.03706443957033245,85:0.03512167130512165,116:0.03583755210933107,119:0.03391183544663036,128:0.0348762765669622,144:0.03443796410188729)0.691:0.08540013525944476,(64:0.03565484525778953,71:0.03618123324531172,72:0.03636328816881514)0.999:0.1420788306099702)0.743:0.2481477843190426,(13:0.03518484851963918,20:0.03419889361900232,73:0.03628075957765737,118:0.03417326266688081,136:0.03439208974793803)0.987:0.1440132788541229)0.710:0.1383632552270178,(((((((5:0.03525602773504629,25:0.03600519682189768,27:0.03430932562449603,30:0.03333080226532939,62:0.03498578685385818,63:0.03454014121782055,120:0.03421566486450079)1.000:0.185358652758331,31:0.3346066756461142,(40:0.03295846662589675,107:0.03427183591668429,126:0.03573949522144599)1.000:0.3202489235368671)0.871:0.1630806311965609,28:0.08339069311639753,(48:0.03525864756406589,115:0.03448850427066093,121:0.08174185551461448)0.972:0.2314458923471261,(95:0.03516300965022319,146:0.03422133693401692)1.000:0.4745979850419942)0.937:0.2329842704859264,108:0.3632461200688504)0.858:0.2197096757846268,182:0.3692429887483028)0.515:0.1200335160143248,(((11:0.03565946575850709,(39:0.03623906222978059,100:0.08581653268111473)0.971:0.08251838553380637,46:0.03494951057560015,101:0.03540697523448001,102:0.03563087536217171,158:0.0341257192187796)0.871:0.08809944792480984,((16:0.03382608397384389,76:0.0363077247872106,98:0.03570636587521067,112:0.03714204489437818)0.951:0.08446398184658657,19:0.03444065111273216,140:0.03478095402198671,141:0.03574028814205236)1.000:0.1931829371236305)0.994:0.1495503654276852,(((38:0.03439465799345087,(58:0.03260818797811035,59:0.03649139646757044)0.999:0.1686866029920575,104:0.03580676940543056,133:0.03507857843223065,137:0.03470022334598358,145:0.03525009395658438,156:0.08422659657310438)1.000:0.2396943458293608,(111:0.08313812879543764,147:0.08549114293258939)1.000:0.4110064981755486)0.856:0.119810031062851,(44:0.03520040527911662,99:0.03508032913304472,110:0.03447531052409308,149:0.03382112903327427)0.924:0.09011624783938751)0.966:0.1776935179314038)0.552:0.08310068956919671,(41:0.1085711379397157,(45:0.08070684116428749,181:0.03470598078973761)1.000:0.3181576011258456)0.843:0.1763944627245086)0.511:0.1804100459647011,(91:0.03453168347020528,96:0.08297103532484977,106:0.03457434118710968)0.949:0.3588479144676255)0.538:0.2046546956896311,((((1:0.03327644623672151,89:0.03376845484938004,90:0.03464369877780384)0.995:0.1446717160376713,(134:0.0336790595199822,(170:0.03454650631416805,171:0.03541270283662795,177:0.03442429531976519,179:0.03470595839465402)1.000:0.236646808494919,178:0.03434567697579449)1.000:0.2306919683221713)0.905:0.1338597118419127,15:0.1543880454367974)0.555:0.08635743065565214,(3:0.03534678157289655,12:0.03411269421636889,32:0.03621394091558277,81:0.03440005908843719,83:0.03457076263632526)0.928:0.08313713427778419,(42:0.03541338687069814,43:0.03413363763307176)1.000:0.2255039152536824,(82:0.03280760873047568,148:0.03461176940671588)0.965:0.08208718365528389,84:0.1336547265718193,142:0.04376020101240213)0.523:0.1323966791679322); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri MrBayes concatenated genes'; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_conidiophora_CBS_137457, 181 Alternaria_catananches_CBS_137456, 182 Alternaria_novae_guineensis_PPRI_12171, 183 Alternaria_anodae_PPRI_12376; TREE MrBayes_concatenated_dataset_ = [&R] (14:4.303376186908832,((103:0.009234469853781712,153:0.01015936938420402)1.000:0.04846442310966367,((113:0.008822988976224523,130:0.008006448911448518)0.982:0.02000651858076634,122:0.01992740651851931)1.000:0.09568838593059817)1.000:0.9340665960184736,(((((((((1:0.00986260824789088,89:0.01018722083879011,90:0.0100172770289462)1.000:0.0697626349329823,15:0.05952237987426871)1.000:0.2017836067310386,(42:0.009704254764572817,43:0.009653177418345704)1.000:0.3015005555997494)0.998:0.07863450595625865,((134:0.009749276406917553,178:0.009904755468662667)1.000:0.05844331999002681,(170:0.01011464522682245,171:0.01004618404625903,177:0.01002838574013731,179:0.009956364677581734)1.000:0.1391519320320173)1.000:0.3383193750535342)1.000:0.1526464165874285,(((3:0.009346091125886085,32:0.009660342838301434)0.999:0.02662781148478163,(12:0.009569613556541815,83:0.00917930306298953,148:0.03665881259153537)0.823:0.02520540040917135,(81:0.02903392779594125,(82:0.02397227847167033,84:0.05708358824883637,142:0.02403849153310762)0.745:0.02355677808682455)0.999:0.04093104959999015)1.000:0.2440618766274148,(((79:0.01113985125106968,80:0.01084267883119142,154:0.01083867183046679,155:0.0112149969120259,169:0.01077491524597332,174:0.01112612408888438)1.000:0.05867153052846166,173:0.04281569698116439,175:0.01172168025632839)1.000:0.1959581140125018,((92:0.008947876986670452,162:0.00932269120198895)0.906:0.02713736337139127,(97:0.01220552131913311,(172:0.00972935283658251,176:0.008985477779550215)0.831:0.02012008152662904)1.000:0.07174803739235854)1.000:0.2538747454582184)1.000:0.09019232605735474)1.000:0.0810411051879036)1.000:0.1015638024099749,((((((((5:0.01093948599260828,25:0.01079770290546575,27:0.0118759374459773,30:0.0100086519723583,62:0.01155010612966063,63:0.01079918582498836,120:0.01099205437045982)1.000:0.2409927105427823,28:0.2834525346059919,(40:0.0111916221357531,107:0.01077049816825039,126:0.01139824249728846)1.000:0.288246755056181)0.999:0.06789487919214102,(31:0.233456264449412,((48:0.01165057308105114,115:0.01126076437056583)0.939:0.02644311010440591,121:0.04355654381121026)1.000:0.2517126317715231)0.997:0.06133240782507131)0.931:0.068491536884571,108:0.2027216501628761)0.600:0.03360713273829413,(6:0.1847793963855458,((((11:0.0104495501707931,102:0.04318996039089805)1.000:0.05869111419646812,(((39:0.0275495131291739,100:0.02711783675323954)0.989:0.02729150939488171,101:0.01093928490323614)0.984:0.02617362087471784,46:0.0596738370540789)0.965:0.02757502960244829)0.754:0.02452074706231261,158:0.06337976604924686)0.919:0.03644946414192429,((((16:0.01205469637325684,76:0.02668493539409165,98:0.01071157023631204,112:0.0115862223840109)0.959:0.0266921888901635,19:0.01137038596356435,140:0.01060547512929877,141:0.01090108675047585)1.000:0.08797656444151546,((((((38:0.01164843515423633,137:0.01147100739008639)1.000:0.1891179701416796,156:0.05064569871785988)0.514:0.0275883050814262,104:0.01046184226177019,133:0.01074266969641543,145:0.01077089740251)1.000:0.07675780223502486,(58:0.01106291555421459,59:0.01151215918337127)1.000:0.09967591996913419)1.000:0.093549545266796,(111:0.09899279021994284,147:0.05227944174840579)1.000:0.1509430713103087)0.675:0.03801219973222372,(44:0.04192242302543732,99:0.01110676365142185,110:0.04400258060285713,149:0.01169280429565845)1.000:0.06578812097381011)1.000:0.0896103192253631)0.671:0.02959619418770931,((91:0.009772759488253013,106:0.009878102397313116)1.000:0.05694816425092008,96:0.04213554014524423)1.000:0.1932799296285133)0.912:0.03320392899985966)0.991:0.06575987714235154)0.639:0.05981782319465576)0.926:0.09822256723340791,((95:0.00895985859811903,146:0.00862225680150947)1.000:0.264829130397127,183:0.2450141620347685)0.573:0.0762462158424507)1.000:0.3228892178684715,(((41:0.2726763336320379,(109:0.01016556365977812,127:0.0099153717459554)1.000:0.3404754458409858)1.000:0.1160369912145544,(105:0.00752774547770597,161:0.00739898508513468,163:0.007485620915404661)1.000:0.524686937929337)1.000:0.1459955664452573,(45:0.02401603794848543,182:0.00939327551920521)1.000:0.3593766033891147)0.996:0.06058789436717601)1.000:0.1241779685961428,((93:0.00840764311278253,152:0.007830139812948311)0.995:0.021077667912549,138:0.008637025219155022,139:0.008374393643473898,151:0.008499676189652782)1.000:0.5584369080661397)0.999:0.09831041822566237)0.998:0.06481236981489896,((((((((((4:0.01097864395249988,181:0.2236025152014556)1.000:0.1073871140655842,60:0.1052296155933072,94:0.01130083470916191)1.000:0.06086225892917178,36:0.04173681478165865)1.000:0.1479457665848364,(((8:0.009560648875682445,18:0.009339478320783266,22:0.009877676958608786,75:0.00935470111469101)0.977:0.03636542464565438,26:0.009804134219992476,56:0.009697583422681502,168:0.009466013784497736)0.822:0.02328890350357369,17:0.00945231778709132,29:0.009246345245309076,53:0.009683618731811216)1.000:0.2442246083835697)0.929:0.04657245239013073,(((7:0.01121518448599618,74:0.01086061089610878,150:0.04319268731868622)1.000:0.1246172811356597,78:0.03893873473671594)0.682:0.03134540485786533,117:0.1969751872196887)0.999:0.06047937493227838)0.946:0.09254273333436333,(55:0.009975638105652647,77:0.01036213157313246,164:0.009851905153018708)0.982:0.07308064486937914)0.843:0.04961054387372656,(9:0.153757391412409,123:0.01022114235717944,124:0.009863282638254152,125:0.009608636216032213)1.000:0.1820414214525414,((((((10:0.01061819317063354,23:0.01030368766239412,(24:0.01002775148976703,68:0.01060297396494457)0.990:0.02499794689600501,33:0.01068402001914391,34:0.01070539504817271,57:0.01025141755815563)0.991:0.04414547275731217,(52:0.01077888537009672,66:0.01088064886799171,69:0.01145606106538488,70:0.01105209182882986,116:0.01110696312269906,128:0.01182367125828008,144:0.01129469269873338)0.797:0.1208957404707495)0.758:0.04418027265643434,(88:0.0103447877524985,131:0.01055235054364108,132:0.009965982039853709,143:0.01018702265036703)1.000:0.1679564031907669)0.689:0.03300987238078511,67:0.05148350400774681)0.727:0.06055523161143848,(165:0.01039196667575261,166:0.01048059451411911)1.000:0.1869022238610543)0.592:0.04721462507267479,(35:0.009536492246383171,50:0.00966847060020987,86:0.009796213081784976,87:0.04100210432085694,129:0.009259695234913908,159:0.009932376121648028,160:0.009361278507789715)1.000:0.09850776688894564,157:0.1252401384044412)0.584:0.06480745448223936,167:0.1767141114547945)0.999:0.1074466076126623,(21:0.01015317676226135,37:0.01063152322128864,49:0.01050624978297081,51:0.01046854042531033,61:0.01046397783852133,85:0.01033154392403763,119:0.01099648150267053)1.000:0.09169374513507746)1.000:0.1535509751723689,((((13:0.01081586413875676,20:0.01071701731907041,73:0.01112528970398204,118:0.0109565510315956,136:0.01144743091678899)1.000:0.1377084813557531,64:0.01310320471642756)0.667:0.02657638462752465,71:0.01119392081000386,72:0.01054790213057388)1.000:0.3489433767547183,47:0.2489830016323318)0.639:0.06273901427727548)1.000:0.2181577534431901,180:0.4047946245600922)0.998:0.08818010839257963)0.999:0.08914053594502581,114:0.7133931303874194)1.000:0.2801161890175459,(2:0.01022585515169189,((54:0.009364297275496343,135:0.009098171967277045)1.000:0.04193177026415206,65:0.01015079944683067)1.000:0.04036952511099654)1.000:0.4407061499357021)1.000:0.6343071845629725); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri RAxML ITS'; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_conidiophora_CBS_137457, 181 Alternaria_catananches_CBS_137456, 182 Alternaria_novae_guineensis_PPRI_12171, 183 Alternaria_anodae_PPRI_12376; TREE RAxML_ITS = [&R] ((((153:1.05041477102104E-6,((130:1.05041477102104E-6,103:1.05041477102104E-6)20:1.05041477102104E-6,113:1.05041477102104E-6)19:1.05041477102104E-6)67:1.05041477102104E-6,122:0.0020380623843681933)100:0.01998039837412582,(180:0.004160368796256183,((((54:1.05041477102104E-6,135:1.05041477102104E-6)73:0.0020244084526505326,(2:1.05041477102104E-6,65:1.05041477102104E-6)49:1.05041477102104E-6)48:1.05041477102104E-6,(((((162:1.05041477102104E-6,(((((((15:1.05041477102104E-6,(90:1.05041477102104E-6,89:1.05041477102104E-6)12:1.05041477102104E-6)28:1.05041477102104E-6,1:1.05041477102104E-6)61:0.002034638641601405,(43:1.05041477102104E-6,42:1.05041477102104E-6)65:0.002037878657652094)5:1.05041477102104E-6,(155:1.05041477102104E-6,(((169:1.05041477102104E-6,(((175:1.05041477102104E-6,174:1.05041477102104E-6)17:1.05041477102104E-6,173:1.05041477102104E-6)2:1.05041477102104E-6,79:1.05041477102104E-6)1:1.05041477102104E-6)0:1.05041477102104E-6,80:1.05041477102104E-6)0:1.05041477102104E-6,154:1.05041477102104E-6)1:1.05041477102104E-6)56:0.002037881165508393)1:1.05041477102104E-6,92:1.05041477102104E-6)0:1.05041477102104E-6,((179:1.05041477102104E-6,((177:1.05041477102104E-6,134:1.05041477102104E-6)2:1.05041477102104E-6,(178:1.05041477102104E-6,170:1.05041477102104E-6)5:1.05041477102104E-6)4:1.05041477102104E-6)4:1.05041477102104E-6,171:1.05041477102104E-6)58:0.002063709867644608)0:1.05041477102104E-6,(148:1.05041477102104E-6,84:1.05041477102104E-6)5:1.05041477102104E-6)0:1.05041477102104E-6)3:1.05041477102104E-6,((3:1.05041477102104E-6,32:1.05041477102104E-6)68:0.002037678177568704,((142:1.05041477102104E-6,(81:1.05041477102104E-6,(83:1.05041477102104E-6,82:1.05041477102104E-6)7:1.05041477102104E-6)2:1.05041477102104E-6)2:1.05041477102104E-6,12:1.05041477102104E-6)7:1.05041477102104E-6)5:1.05041477102104E-6)13:0.0020204852700744314,(176:1.05041477102104E-6,(172:1.05041477102104E-6,97:1.05041477102104E-6)26:1.05041477102104E-6)35:1.05041477102104E-6)27:0.004079735517959855,((102:0.0019742991297186548,((183:1.05041477102104E-6,41:1.05041477102104E-6)64:0.0019322818629870478,((152:1.05041477102104E-6,93:1.05041477102104E-6)77:0.0019381117891803126,(139:1.05041477102104E-6,(151:1.05041477102104E-6,138:1.05041477102104E-6)31:1.05041477102104E-6)62:1.05041477102104E-6)87:0.0038953880389405717)14:1.05041477102104E-6)18:1.05041477102104E-6,(((99:1.05041477102104E-6,((149:1.05041477102104E-6,110:1.05041477102104E-6)28:1.05041477102104E-6,44:1.05041477102104E-6)14:1.05041477102104E-6)25:1.05041477102104E-6,((146:1.05041477102104E-6,(95:1.05041477102104E-6,((58:1.05041477102104E-6,59:1.05041477102104E-6)67:0.0019686022313315796,147:0.0016865627988537312)25:2.572186938908814E-4)7:1.05041477102104E-6)8:1.05041477102104E-6,(((163:1.05041477102104E-6,161:1.05041477102104E-6)37:1.05041477102104E-6,105:1.05041477102104E-6)93:0.0040215921762682925,((45:1.05041477102104E-6,(109:1.05041477102104E-6,127:1.05041477102104E-6)13:1.05041477102104E-6)21:1.05041477102104E-6,182:1.05041477102104E-6)94:0.003986559101243125)53:0.0019499350132482795)12:1.05041477102104E-6)22:0.0019305963783100447,(((28:0.001986671954801687,(121:0.0019563221732301008,(48:1.05041477102104E-6,115:1.05041477102104E-6)72:1.05041477102104E-6)62:0.001959734572565728)29:1.05041477102104E-6,(((25:1.05041477102104E-6,63:1.05041477102104E-6)58:1.05041477102104E-6,(((30:1.05041477102104E-6,5:1.05041477102104E-6)21:1.05041477102104E-6,62:1.05041477102104E-6)11:1.05041477102104E-6,120:1.05041477102104E-6)14:1.05041477102104E-6)41:1.05041477102104E-6,27:1.05041477102104E-6)71:0.001978829649108679)65:0.003918411165603594,((((106:1.05041477102104E-6,158:1.05041477102104E-6)12:1.05041477102104E-6,(76:0.0019733276219801635,(141:1.05041477102104E-6,(((16:1.05041477102104E-6,((112:1.05041477102104E-6,98:1.05041477102104E-6)5:1.05041477102104E-6,19:1.05041477102104E-6)1:1.05041477102104E-6)1:1.05041477102104E-6,(111:1.05041477102104E-6,91:1.05041477102104E-6)3:1.05041477102104E-6)0:1.05041477102104E-6,140:1.05041477102104E-6)1:1.05041477102104E-6)9:1.05041477102104E-6)12:1.05041477102104E-6)3:1.05041477102104E-6,46:1.05041477102104E-6)5:1.05041477102104E-6,(101:1.05041477102104E-6,((100:1.05041477102104E-6,((11:1.05041477102104E-6,6:1.05041477102104E-6)12:1.05041477102104E-6,((((((145:1.05041477102104E-6,(104:1.05041477102104E-6,137:1.05041477102104E-6)7:1.05041477102104E-6)2:1.05041477102104E-6,38:1.05041477102104E-6)3:1.05041477102104E-6,133:1.05041477102104E-6)7:1.05041477102104E-6,156:1.05041477102104E-6)58:0.0019831450799188363,96:1.05041477102104E-6)3:1.05041477102104E-6,31:1.05041477102104E-6)0:1.05041477102104E-6)4:1.05041477102104E-6)0:1.05041477102104E-6,39:1.05041477102104E-6)1:1.05041477102104E-6)4:1.05041477102104E-6)8:1.05041477102104E-6)4:1.05041477102104E-6)17:0.0019285569929004605)14:0.001942353476434448)2:0.001971868349354731,((108:0.0019707835151046484,((40:1.05041477102104E-6,126:1.05041477102104E-6)31:1.05041477102104E-6,107:1.05041477102104E-6)85:0.0020481804740158788)22:0.0019746133598182803,((181:1.05041477102104E-6,167:1.05041477102104E-6)75:0.001997480935333035,((((68:1.05041477102104E-6,24:1.05041477102104E-6)27:1.05041477102104E-6,((60:0.0019711625263376573,((86:1.05041477102104E-6,87:1.05041477102104E-6)5:1.05041477102104E-6,(((35:1.05041477102104E-6,129:1.05041477102104E-6)5:1.05041477102104E-6,159:1.05041477102104E-6)3:1.05041477102104E-6,(160:1.05041477102104E-6,50:1.05041477102104E-6)5:1.05041477102104E-6)1:1.05041477102104E-6)86:0.003963633014640402)3:1.05041477102104E-6,((((128:1.05041477102104E-6,57:1.05041477102104E-6)3:1.05041477102104E-6,(((94:1.05041477102104E-6,(((69:1.05041477102104E-6,66:1.05041477102104E-6)4:1.05041477102104E-6,(52:1.05041477102104E-6,33:1.05041477102104E-6)6:1.05041477102104E-6)0:1.05041477102104E-6,144:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6,70:1.05041477102104E-6)0:1.05041477102104E-6,10:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6,(23:1.05041477102104E-6,((((157:0.001974509466370048,((((49:1.05041477102104E-6,51:1.05041477102104E-6)8:1.05041477102104E-6,(85:1.05041477102104E-6,119:1.05041477102104E-6)10:1.05041477102104E-6)1:1.05041477102104E-6,61:1.05041477102104E-6)2:1.05041477102104E-6,(37:1.05041477102104E-6,21:1.05041477102104E-6)25:1.05041477102104E-6)52:0.0019832092709645413)3:1.05041477102104E-6,(((29:1.05041477102104E-6,(56:1.05041477102104E-6,(53:1.05041477102104E-6,18:1.05041477102104E-6)3:1.05041477102104E-6)0:1.05041477102104E-6)1:1.05041477102104E-6,(150:1.05041477102104E-6,74:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6,(124:1.05041477102104E-6,((117:1.05041477102104E-6,(26:1.05041477102104E-6,22:1.05041477102104E-6)2:1.05041477102104E-6)0:1.05041477102104E-6,((17:1.05041477102104E-6,7:1.05041477102104E-6)3:1.05041477102104E-6,((168:1.05041477102104E-6,(123:1.05041477102104E-6,125:1.05041477102104E-6)3:1.05041477102104E-6)0:1.05041477102104E-6,(67:1.05041477102104E-6,34:1.05041477102104E-6)2:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6,(75:1.05041477102104E-6,4:1.05041477102104E-6)1:1.05041477102104E-6)0:1.05041477102104E-6,8:1.05041477102104E-6)3:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6,116:1.05041477102104E-6)1:1.05041477102104E-6)1:1.05041477102104E-6)5:1.05041477102104E-6,(9:1.05041477102104E-6,(55:1.05041477102104E-6,((78:1.05041477102104E-6,77:1.05041477102104E-6)20:1.05041477102104E-6,(164:1.05041477102104E-6,(36:1.05041477102104E-6,((72:1.05041477102104E-6,13:1.05041477102104E-6)5:1.05041477102104E-6,(118:1.05041477102104E-6,(71:1.05041477102104E-6,((136:1.05041477102104E-6,(20:1.05041477102104E-6,64:1.05041477102104E-6)4:1.05041477102104E-6)0:1.05041477102104E-6,73:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6)0:1.05041477102104E-6)2:1.05041477102104E-6)28:1.05041477102104E-6)2:1.05041477102104E-6)3:1.05041477102104E-6)26:1.05041477102104E-6)47:0.0019704328411270697)44:0.0019704931458863384,((47:0.0019808068997962014,(165:1.05041477102104E-6,166:1.05041477102104E-6)67:1.05041477102104E-6)48:0.0019988464091718746,((131:1.05041477102104E-6,(132:1.05041477102104E-6,88:1.05041477102104E-6)17:1.05041477102104E-6)8:1.05041477102104E-6,143:1.05041477102104E-6)24:1.05041477102104E-6)3:1.05041477102104E-6)4:1.05041477102104E-6)46:0.001978609416657608)2:1.05041477102104E-6)14:0.0039547767358693985)10:0.001979965625528392,114:0.002017247795564038)1:1.05041477102104E-6)34:0.003596051068913526):0.02409372019547,14:0.02409372019547); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri MrBayes TEF1'; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_conidiophora_CBS_137457, 181 Alternaria_catananches_CBS_137456, 182 Alternaria_novae_guineensis_PPRI_12171, 183 Alternaria_anodae_PPRI_12376; TREE MrBayes_TEF1 = [&R] (14:2.182808223992109,(103:0.03116086529176674,(113:0.03118199881497812,122:0.03120240656158295,130:0.0305564527534981)0.999:0.1302559484631511,153:0.03152498130633753)1.000:0.835172901887262,(((((((1:0.0454876762297465,15:0.04156156170696676,89:0.04003184838300948,90:0.0451723966252881)0.993:0.1619533680548833,(42:0.04363082872693041,43:0.04448036122658207)1.000:0.2344822137059159)1.000:0.2336660522583227,((134:0.04111633144204156,178:0.04140755606211057)1.000:0.2382314796593729,(170:0.04264838668185853,171:0.04425723623925497,177:0.04088796327549382,179:0.04415346207462842)0.928:0.1012422800089811)0.916:0.1063208180627614)1.000:0.2907316918364793,((((((4:0.03850796215249552,36:0.04305437598405731,55:0.04113346181502351,77:0.04292308349733637,78:0.04267410243863978,94:0.04210301523474318,164:0.04644718258135788,181:0.04059646849830154)0.939:0.109978646707287,7:0.04201595167284538,((8:0.04130379497070934,18:0.0439104400061883,22:0.04443797187173931,75:0.0429790272032086)0.967:0.1026013829558712,(17:0.04550901869920769,26:0.04506107996859445,29:0.04560913659150177,53:0.04137932024554294,56:0.04331557393875988,168:0.04224236099721451)0.963:0.1056933569583636,157:0.1066924074959109)0.929:0.1028506192906708,67:0.04168081980670801,74:0.04144642427988578,123:0.04130631156575856,124:0.04481066723488762,125:0.04529440678139544,150:0.04364630875750802,167:0.1016660125065063)0.908:0.1064430714488192,(9:0.04271674149931837,(35:0.04346091984948493,50:0.04337497239600514,86:0.04315408839990266,87:0.0447139654344095,129:0.04177212862638143,159:0.04457168997098262,160:0.04562789378764488)0.996:0.1080264669981877,60:0.1029737167434069)0.747:0.1023592027998363,10:0.04176879725575891,23:0.04409214697872722,24:0.04372777619236867,33:0.0438830195128544,34:0.04260413801793644,52:0.041437779368919,57:0.04231018004061238,66:0.04163989600518048,68:0.04136358595205207,69:0.04367865955388961,70:0.04383262249454524,116:0.04400394457027467,128:0.04003635124374017,144:0.04515730641944182)0.995:0.1682880753086331,88:0.04179146645212491,131:0.04453046471843369,132:0.04291094729821479,143:0.0392801546547819,(165:0.04231199635701295,166:0.04806816859427492)0.981:0.1055604313003728)0.752:0.09625004742996161,21:0.04522566755612287,37:0.04305673691172464,49:0.04226912576729275,51:0.04198875449969133,61:0.04278574090846608,85:0.04148679388153544,117:0.100060352445777,119:0.03933629395441443)1.000:0.4717825848015682,((13:0.04444903948620491,20:0.03927207494833827,64:0.0448459866630427,71:0.04383418707702389,72:0.04626442906407752,73:0.04247868126049185,118:0.04146058414165806,136:0.04042731377646052)1.000:0.2718405193623233,47:0.04580929222839301)0.998:0.1655081119055166)1.000:0.2316797813799704,180:0.2836658945864869)0.937:0.1053965247491863,(((((5:0.04203118533679409,25:0.0424559955558819,27:0.0407109254525909,30:0.04297873833572974,62:0.04242592123991414,63:0.03911027503497783,120:0.04177398222808021)1.000:0.3325981850712034,39:0.04375846257098359,100:0.04466344338814573,101:0.04240868642737813)0.781:0.1050299090512314,6:0.04688801477240037,11:0.0445476858471444,16:0.04426861594661007,19:0.04130510260697638,28:0.3525768950841303,31:0.073717557941968,38:0.04226746022639918,(40:0.04301943830458938,107:0.04263358697899042,126:0.04394422309187587)1.000:0.1604020817467108,(44:0.1622129567969651,99:0.04335190517208973,110:0.04487016697800285,149:0.04470546904178377)0.873:0.1025970420044744,46:0.2301558043030226,(((48:0.0446346433860992,115:0.04200285006542665)0.979:0.09509342786652991,121:0.04130733994076534)1.000:0.2531146978316148,108:0.1035764452300182)0.602:0.1026745323058855,(58:0.04569906368158916,59:0.04179979108884614,158:0.04263126223608937)1.000:0.1658449299114314,76:0.04424754206671337,(91:0.04047230089721281,106:0.03836845948743389)1.000:0.2223699399244084,96:0.0971537278162996,98:0.04169736559729462,102:0.03945397872426885,104:0.04266914227443074,(105:0.04390410888259731,161:0.04344939388382481,163:0.03957683594643936)1.000:0.4699815329771893,111:0.04302904731053994,112:0.04139922632214318,133:0.04680961376660396,137:0.04234987773379539,140:0.04316163942364038,141:0.04567959553228133,145:0.04331103347639585,147:0.04329854986732847,156:0.1033611254331297)0.970:0.208608610420814,(41:0.04198098635951831,109:0.04252768054300142,127:0.04074620172452588)1.000:0.2197534224347912,(45:0.04361244008227824,182:0.04217149654701714)1.000:0.4755369852850672,95:0.041545252189921,146:0.04454278581509109,183:0.2189061660900863)0.993:0.1802748329924941,((79:0.0425426426674947,80:0.04447278079098863,154:0.04219997729668321,155:0.04249907629045432,169:0.04309846859328568,173:0.1732742420470908,174:0.04383778952119327,175:0.0428259955940446)0.787:0.1037783726505895,((92:0.04199132006150735,97:0.04369099556910299,162:0.0415817325197998)0.981:0.1020729464227528,172:0.04333338766414852,176:0.04196154252306789)0.999:0.1782062309543394)1.000:0.239811902000274)0.612:0.1012415851670395,114:0.455079566071431)0.988:0.1613941336515947,(3:0.04596994230934941,(12:0.04114786851450902,83:0.04432249622783006,148:0.0406677807893831)0.951:0.1004292683598962,32:0.04137824446196348,(81:0.04147962161860958,82:0.04044296828806963,84:0.0401256000814155,142:0.0453970306733377)1.000:0.1607219966899912)1.000:0.2906240648152978,(93:0.04188180958270216,138:0.04236252995052268,139:0.04106278679386864,151:0.04295999741119713,152:0.0439068651274633)1.000:0.6001743789590068)1.000:0.5289037395747441,(2:0.04071767401707978,(54:0.03994967745450299,65:0.03896263003449021,135:0.0459155627180794)1.000:0.1642249287716674)1.000:0.5090416176407351)0.995:0.5528878893899202); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri MRbayes ITS'; LINK TAXA = Taxa2; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_limicola_CBS_117360, 104 Alternaria_ricini_CBS_117361, 105 Alternaria_steviae_CBS_117362, 106 Alternaria_blumeae_CBS_117364, 107 Alternaria_pipionipisi_CBS_117365, 108 Alternaria_rostellata_CBS_117366, 109 Alternaria_obtecta_CBS_117367, 110 Alternaria_cassiae_CBS_117369, 111 Alternaria_sidae_CBS_117730, 112 Alternaria_zinniae_CBS_118_44, 113 Alternaria_euphorbiicola_CBS_119410, 114 Alternaria_pseudorostrata_CBS_119411, 115 Alternaria_thunbergiae_CBS_120986, 116 Alternaria_protenta_CBS_121342, 117 Alternaria_montanica_CBS_121343, 118 Alternaria_allii_CBS_121345, 119 Alternaria_solani_nigri_CBS_121347, 120 Alternaria_crassa_CBS_122590, 121 Alternaria_thunbergiae_CBS_122597, 122 Alternaria_euphorbiicola_CBS_133874, 123 Alternaria_silybi_CBS_134092, 124 Alternaria_silybi_CBS_134093, 125 Alternaria_silybi_CBS_134094, 126 Alternaria_pipionipisi_CBS_134265, 127 Alternaria_obtecta_CBS_134278, 128 Alternaria_protenta_CBS_135189, 129 Alternaria_passiflorae_CBS_166_77, 130 Alternaria_euphorbiicola_CBS_198_86, 131 Alternaria_dichondrae_CBS_199_74, 132 Alternaria_dichondrae_CBS_200_74, 133 Alternaria_ricini_CBS_215_31_, 134 Alternaria_ipomoeae_CBS_219_79_, 135 Alternaria_calendulae_CBS_224_76, 136 Alternaria_allii_CBS_225_76, 137 Alternaria_sesami_CBS_240_73, 138 Alternaria_tagetica_CBS_297_79, 139 Alternaria_tagetica_CBS_298_79, 140 Alternaria_zinniae_CBS_299_79, 141 Alternaria_zinniae_CBS_300_79, 142 Alternaria_dauci_CBS_345_79, 143 Alternaria_dichondrae_CBS_346_79, 144 Alternaria_protenta_CBS_347_79, 145 Alternaria_ricini_CBS_353_86, 146 Alternaria_cyamopsidis_CBS_364_67, 147 Alternaria_sennae_CBS_477_81, 148 Alternaria_dauci_CBS_477_83, 149 Alternaria_cassiae_CBS_478_81, 150 Alternaria_scorzonerae_CBS_478_83, 151 Alternaria_tagetica_CBS_479_81, 152 Alternaria_tagetica_CBS_480_81, 153 Alternaria_limicola_CBS_483_90, 154 Alternaria_bataticola_CBS_531_63, 155 Alternaria_bataticola_CBS_532_63_, 156 Alternaria_acalyphicola_CBS_541_94, 157 Alternaria_agripestis_CBS_577_94, 158 Alternaria_aragakii_CBS_594_93, 159 Alternaria_passiflorae_CBS_629_93, 160 Alternaria_passiflorae_CBS_630_93_, 161 Alternaria_steviae_CBS_631_88, 162 Alternaria_tropica_CBS_631_93, 163 Alternaria_steviae_CBS_632_88, 164 Alternaria_carthami_CBS_635_80, 165 Alternaria_multirostrata_CBS_712_68, 166 Alternaria_multirostrata_CBS_713_68, 167 Alternaria_jesenskae_CBS_133855, 168 Alternaria_linariae_CPC_21620, 169 Alternaria_bataticola_PPRI_10502, 170 Alternaria_neoipomoeae_PPRI_11845, 171 Alternaria_neoipomoeae_PPRI_11847, 172 Alternaria_argyroxiphii_PPRI_11848, 173 Alternaria_bataticola_PPRI_11930, 174 Alternaria_bataticola_PPRI_11931, 175 Alternaria_bataticola_PPRI_11934, 176 Alternaria_argyroxiphii_PPRI_11971, 177 Alternaria_neoipomoeae_PPRI_13903, 178 Alternaria_ipomoeae_PPRI_8988, 179 Alternaria_neoipomoeae_PPRI_8990, 180 Alternaria_conidiophora_CBS_137457, 181 Alternaria_catananches_CBS_137456, 182 Alternaria_novae_guineensis_PPRI_12171, 183 Alternaria_anodae_PPRI_12376; TREE MrBayes_ITS = [&R] (14:1.71580303945815,(103:0.05608661916818052,113:0.05751129623811429,122:0.1314898539414983,130:0.05573242733085122,153:0.05666055056333416)1.000:0.7801833684808012,((((((1:0.05741176860784689,15:0.05447417039252812,89:0.05408147773638006,90:0.05574054484579115)0.984:0.1295878178971345,(3:0.05772538461424059,32:0.05610595449235369)0.992:0.1343567143927304,12:0.05542936409220516,(42:0.05857262821084919,43:0.05820720160307601)0.978:0.1347830750475558,(79:0.06008821849893598,80:0.05556928324506811,154:0.05491103506500659,155:0.05357958654995223,169:0.05648652898544758,173:0.05709488750462052,174:0.05592918049065816,175:0.05747604512427908)0.965:0.1347535495007551,81:0.05560097500472896,82:0.05430371982789056,83:0.05819777661055647,84:0.05464398524457436,92:0.05812431914699134,(134:0.05466313452346176,170:0.05618465488109619,171:0.05561318478427615,177:0.06094989107774415,178:0.05388086014794184,179:0.05581032574706164)0.995:0.1330987017715899,142:0.05326478600404498,148:0.05452515799923054,162:0.05447699607660297)0.839:0.1390425973258418,97:0.05731795112602552,172:0.05558583767532227,176:0.0559223331627226)0.870:0.2364149290435838,((4:0.05588553789926933,7:0.05581644981942998,8:0.05701761049023103,(9:0.05512278744891055,13:0.05561661903917847,20:0.05489858870688519,36:0.05330710025294452,55:0.05907244512691397,64:0.05670565900627872,71:0.05760226044608723,72:0.05873148246633765,73:0.05407964585956342,77:0.05567313560554323,78:0.05698610660616475,118:0.05572490978787632,136:0.05366608164252967,164:0.05485897719731923)0.888:0.1354844398138192,10:0.05797971582145113,17:0.05483377589531441,18:0.05660461446084768,(21:0.05626802508502272,37:0.05391189702283439,49:0.05518988289896887,51:0.05828265159466746,61:0.05447374419434219,85:0.05580210884112585,119:0.05499306487456981)0.986:0.1373058674748682,22:0.05466008772488985,23:0.05530816717039078,24:0.05510781979630828,26:0.05667681046577493,29:0.05482442644503403,33:0.05927215338588019,34:0.0579667868559349,(35:0.0542790036977293,50:0.05679649653245924,86:0.05353159537979721,87:0.05452924089500099,129:0.05451000164868391,159:0.05485505878072063,160:0.0537909881046485)1.000:0.2191430635069104,52:0.05706935621255972,53:0.05466967123229889,56:0.06017295447559698,57:0.05665094366566306,60:0.1394119862226166,66:0.05725176481267063,67:0.05393006262386152,68:0.05426533349550033,69:0.0563795917151861,70:0.06018573451684344,74:0.05456514368784014,75:0.05632412597186372,94:0.05671140815985037,116:0.05564521714473615,117:0.05501598471264727,123:0.05872287411337089,124:0.05490322651121782,125:0.05490141495443734,128:0.0547956316126603,144:0.05386569582232304,150:0.05502323494823471,157:0.1307895665441163,168:0.05563125902755393)0.874:0.1342285090729856,(47:0.1260219814749764,(165:0.05629564319156605,166:0.05560580255588389)0.550:0.102298955032669)0.690:0.1426274091402027,88:0.05544153840958579,131:0.05493986626970267,132:0.0542730119983256,143:0.05491729817773953,(167:0.05304916936923412,181:0.05399517272202063)0.767:0.1203901656768687)0.957:0.1422679490000147,(((5:0.05870461487274734,25:0.05775500456567692,27:0.05325198756300232,30:0.05409422862217912,62:0.05501999472061452,63:0.05706241444344632,120:0.05606869869605755)0.993:0.1331188866547241,28:0.137196825956237,(48:0.05772695531636585,115:0.0532253226365407,121:0.1343515121322034)0.986:0.1368423764170069)0.996:0.2041633798172725,6:0.05687275299575955,11:0.05549477353379096,16:0.05757517974156299,19:0.05531429241129306,31:0.05519293819081418,(38:0.05748419756475814,104:0.0544208509892195,133:0.05796654943296069,137:0.05414137057998887,145:0.0566561007727813,156:0.05723578088801482)0.989:0.1328855902332695,39:0.05294993085817494,(41:0.05748799188042264,183:0.05591148407108307)0.987:0.1372211122466585,(44:0.05457740349883732,((45:0.05621271753429811,109:0.05483144900215541,127:0.0567579309191349,182:0.05672568171749532)1.000:0.2185826244038753,(105:0.05672110032021829,161:0.05534181960967816,163:0.05577570462205982)0.999:0.2151047705787576)0.796:0.1315585574434182,(58:0.06171789719369403,59:0.05624694621001801)0.974:0.1372988443580982,95:0.05490793998564004,99:0.05503467859788278,110:0.05872231733826637,146:0.05552555644883238,147:0.1141058127708772,149:0.05388066343802425)0.646:0.132013294656961,46:0.05247898208739484,76:0.1325523342961602,91:0.05775190040788856,((93:0.05802849142010591,152:0.05293393974630443)0.997:0.1313119366208329,138:0.05487265934269027,139:0.05502734431676563,151:0.0519781706351968)1.000:0.2139308412813003,96:0.0555993983518313,98:0.05255949373023192,100:0.0542214690606532,101:0.05598711433337106,102:0.1340199868657847,106:0.05525699341318809,111:0.05558892415668237,112:0.0560532773971365,140:0.05525209000904811,141:0.05564697528936381,158:0.05533190852457724)0.555:0.1660340436687454,(40:0.05390331732803855,107:0.05602448047670388,126:0.05608630441456466)0.999:0.1697118490871848,108:0.118380335466405)0.864:0.1844225731770577,2:0.0567552238613461,(54:0.05631056469210252,135:0.05693124446914258)0.998:0.1371808640968025,65:0.05844816201692336)0.841:0.1349275008944162,114:0.1329827384351986,180:0.2164043033064911)0.896:0.2233751878151188); END; BEGIN TREES; TITLE 'Large-spored Alternaria pathogens in section Porri MrBayes Alta1'; LINK TAXA = Taxa3; TRANSLATE 1 Alternaria_anagallidis_CBS_101004_, 2 Alternaria_calendulae_CBS_101498_, 3 Alternaria_dauci_CBS_101592_, 4 Alternaria_cichorii_CBS_102_33_, 5 Alternaria_crassa_CBS_103_18_, 6 Alternaria_citrullicola_CBS_103_32, 7 Alternaria_scorzonerae_CBS_103_46_, 8 Alternaria_linariae_CBS_105_41, 9 Alternaria_alternariacida_CBS_105_51, 10 Alternaria_solani_CBS_106_21, 11 Alternaria_macrospora_CBS_106_29_, 12 Alternaria_dauci_CBS_106_48_, 13 Alternaria_allii_CBS_107_28_, 14 Alternaria_gypsophilae_CBS_107_41_, 15 Alternaria_anagallidis_CBS_107_44_, 16 Alternaria_zinniae_CBS_107_48_, 17 Alternaria_linariae_CBS_107_61, 18 Alternaria_linariae_CBS_108_53, 19 Alternaria_zinniae_CBS_108_61_, 20 Alternaria_allii_CBS_109_41_, 21 Alternaria_solani_nigri_CBS_109155_, 22 Alternaria_linariae_CBS_109156, 23 Alternaria_solani_CBS_109157, 24 Alternaria_grandis_CBS_109158_, 25 Alternaria_crassa_CBS_109160_, 26 Alternaria_linariae_CBS_109161_, 27 Alternaria_crassa_CBS_109162_, 28 Alternaria_nitrimali_CBS_109163_, 29 Alternaria_linariae_CBS_109164_, 30 Alternaria_crassa_CBS_110_38_, 31 Alternaria_deserticola_CBS_110799_, 32 Alternaria_dauci_CBS_111_38_, 33 Alternaria_solani_CBS_111_41_, 34 Alternaria_solani_CBS_111_44_, 35 Alternaria_passiflorae_CBS_113_38, 36 Alternaria_cirsinoxia_CBS_113261_, 37 Alternaria_solani_nigri_CBS_113403_, 38 Alternaria_sesami_CBS115264_, 39 Alternaria_cucumerina_CBS_116114_, 40 Alternaria_pipionipisi_CBS_116115_, 41 Alternaria_tillandsiae_CBS_116116_, 42 Alternaria_echinaceae_CBS_116117_, 43 Alternaria_echinaceae_CBS_116118_, 44 Alternaria_cassiae_CBS_116119_, 45 Alternaria_novae_guineensis_CBS_116120_, 46 Alternaria_venezuelensis_CBS_116121_, 47 Alternaria_ranunculi_CBS_116330_, 48 Alternaria_thunbergiae_CBS116331_, 49 Alternaria_solani_nigri_CBS_116332, 50 Alternaria_passiflorae_CBS_116333_, 51 Alternaria_solani_nigri_CBS_116334, 52 Alternaria_protenta_CBS_116437, 53 Alternaria_linariae_CBS_116438, 54 Alternaria_calendulae_CBS_116439_, 55 Alternaria_carthami_CBS_116440, 56 Alternaria_linariae_CBS_116441, 57 Alternaria_solani_CBS_116442, 58 Alternaria_azadirachtae_CBS_116444, 59 Alternaria_azadirachtae_CBS_116445, 60 Alternaria_centaureae_CBS_116446, 61 Alternaria_solani_nigri_CBS_116447, 62 Alternaria_crassa_CBS_116647, 63 Alternaria_crassa_CBS_116648, 64 Alternaria_porri_CBS_116649, 65 Alternaria_calendulae_CBS_116650, 66 Alternaria_protenta_CBS_116651, 67 Alternaria_paralinicola_CBS_116652, 68 Alternaria_grandis_CBS_116695, 69 Alternaria_protenta_CBS_116696, 70 Alternaria_protenta_CBS_116697, 71 Alternaria_porri_CBS_116698, 72 Alternaria_porri_CBS_116699, 73 Alternaria_allii_CBS_116701, 74 Alternaria_scorzonerae_CBS_116703, 75 Alternaria_linariae_CBS_116704, 76 Alternaria_zinniae_CBS_117_59, 77 Alternaria_carthami_CBS_117091, 78 Alternaria_carthamicola_CBS_117092, 79 Alternaria_bataticola_CBS_117095, 80 Alternaria_bataticola_CBS_117096, 81 Alternaria_dauci_CBS_117097, 82 Alternaria_dauci_CBS_117098, 83 Alternaria_dauci_CBS_117099, 84 Alternaria_dauci_CBS_117100, 85 Alternaria_solani_nigri_CBS117101, 86 Alternaria_passiflorae_CBS_117102, 87 Alternaria_passiflorae_CBS_117103, 88 Alternaria_dichondrae_CBS_117127, 89 Alternaria_anagallidis_CBS_117128, 90 Alternaria_anagallidis_CBS_117129, 91 Alternaria_blumeae_CBS_117215, 92 Alternaria_tropica_CBS_117216, 93 Alternaria_tagetica_CBS_117217, 94 Alternaria_cichorii_CBS_117218, 95 Alternaria_cyamopsidis_CBS_117219, 96 Alternaria_agerati_CBS_117221, 97 Alternaria_argyroxiphii_CBS_117222, 98 Alternaria_zinniae_CBS_117223, 99 Alternaria_cassiae_CBS_117224, 100 Alternaria_cucumerina_CBS_117225, 101 Alternaria_cucumerina_CBS_117226, 102 Alternaria_macrospora_CBS_117228, 103 Alternaria_ricini_CBS_117361, 104 Alternaria_steviae_CBS_117362, 105 Alternaria_blumeae_CBS_117364, 106 Alternaria_pipionipisi_CBS_117365, 107 Alternaria_rostellata_CBS_117366, 108 Alternaria_obtecta_CBS_117367, 109 Alternaria_cassiae_CBS_117369, 110 Alternaria_sidae_CBS_117730, 111 Alternaria_zinniae_CBS_118_44, 112 Alternaria_pseudorostrata_CBS_119411, 113 Alternaria_thunbergiae_CBS_120986, 114 Alternaria_protenta_CBS_121342, 115 Alternaria_montanica_CBS_121343, 116 Alternaria_allii_CBS_121345, 117 Alternaria_solani_nigri_CBS_121347, 118 Alternaria_crassa_CBS_122590, 119 Alternaria_thunbergiae_CBS_122597, 120 Alternaria_euphorbiicola_CBS_133874, 121 Alternaria_silybi_CBS_134092, 122 Alternaria_silybi_CBS_134093, 123 Alternaria_silybi_CBS_134094, 124 Alternaria_pipionipisi_CBS_134265, 125 Alternaria_obtecta_CBS_134278, 126 Alternaria_protenta_CBS_135189, 127 Alternaria_passiflorae_CBS_166_77, 128 Alternaria_euphorbiicola_CBS_198_86, 129 Alternaria_dichondrae_CBS_199_74, 130 Alternaria_dichondrae_CBS_200_74, 131 Alternaria_ricini_CBS_215_31_, 132 Alternaria_ipomoeae_CBS_219_79_, 133 Alternaria_calendulae_CBS_224_76, 134 Alternaria_allii_CBS_225_76, 135 Alternaria_sesami_CBS_240_73, 136 Alternaria_tagetica_CBS_297_79, 137 Alternaria_tagetica_CBS_298_79, 138 Alternaria_zinniae_CBS_299_79, 139 Alternaria_zinniae_CBS_300_79, 140 Alternaria_dauci_CBS_345_79, 141 Alternaria_dichondrae_CBS_346_79, 142 Alternaria_protenta_CBS_347_79, 143 Alternaria_ricini_CBS_353_86, 144 Alternaria_cyamopsidis_CBS_364_67, 145 Alternaria_sennae_CBS_477_81, 146 Alternaria_dauci_CBS_477_83, 147 Alternaria_cassiae_CBS_478_81, 148 Alternaria_scorzonerae_CBS_478_83, 149 Alternaria_tagetica_CBS_479_81, 150 Alternaria_tagetica_CBS_480_81, 151 Alternaria_limicola_CBS_483_90, 152 Alternaria_bataticola_CBS_531_63, 153 Alternaria_bataticola_CBS_532_63_, 154 Alternaria_acalyphicola_CBS_541_94, 155 Alternaria_agripestis_CBS_577_94, 156 Alternaria_aragakii_CBS_594_93, 157 Alternaria_passiflorae_CBS_629_93, 158 Alternaria_passiflorae_CBS_630_93_, 159 Alternaria_steviae_CBS_631_88, 160 Alternaria_tropica_CBS_631_93, 161 Alternaria_steviae_CBS_632_88, 162 Alternaria_carthami_CBS_635_80, 163 Alternaria_multirostrata_CBS_712_68, 164 Alternaria_multirostrata_CBS_713_68, 165 Alternaria_jesenskae_CBS_133855, 166 Alternaria_linariae_CPC_21620, 167 Alternaria_bataticola_PPRI_10502, 168 Alternaria_neoipomoeae_PPRI_11845, 169 Alternaria_neoipomoeae_PPRI_11847, 170 Alternaria_argyroxiphii_PPRI_11848, 171 Alternaria_bataticola_PPRI_11930, 172 Alternaria_bataticola_PPRI_11931, 173 Alternaria_bataticola_PPRI_11934, 174 Alternaria_argyroxiphii_PPRI_11971, 175 Alternaria_neoipomoeae_PPRI_13903, 176 Alternaria_ipomoeae_PPRI_8988, 177 Alternaria_neoipomoeae_PPRI_8990, 178 Alternaria_conidiophora_CBS_137457, 179 Alternaria_catananches_CBS_137456, 180 Alternaria_novae_guineensis_PPRI_12171, 181 Alternaria_anodae_PPRI_12376; TREE MrBayes_Alt_a_1 = [&R] (14:4.209262927622409,((120:0.03923889000775221,128:0.03647768818836254)0.984:0.09609497910982732,151:0.09297127725879993)1.000:0.7832440044584232,((((((1:0.03906379529733424,15:0.08881982870018992,89:0.03928035802641207,90:0.03924860585918668)1.000:0.2787688150602038,(3:0.03686101487925862,12:0.03926151542616998,32:0.04188861409110528,81:0.04361507602302597,82:0.03876678703477157,83:0.04140347525941335,84:0.09887165213787386,140:0.03790882262710106,146:0.03781616343238825)1.000:0.2657451234219243)0.964:0.133570223792527,(45:0.04101391021040647,180:0.04029810562675869)1.000:0.2250835550886155,((79:0.03820927370977672,80:0.03745874069086781,152:0.03949531942436214,153:0.04071924187376431,167:0.04007866240481687,172:0.04031726670866476)1.000:0.2136928193146798,171:0.03922750691639562,173:0.03848233332079249)0.985:0.1418749349699736,((92:0.03869266896962191,160:0.03807298914616749)0.963:0.09929036235182627,(97:0.03843310056810281,170:0.04070856423983212,174:0.04214571704497929)1.000:0.2113991376601037)0.922:0.112517472039011)0.999:0.1578984635723619,((2:0.04066507006986483,54:0.04058165276801579,65:0.03733383752359407,133:0.03762633419499532)1.000:0.4955340580920622,(((4:0.03877805754106396,9:0.03978971427186039,(88:0.04102095834091778,129:0.03861027016546382,130:0.03879594668227344,141:0.03854453921975227)1.000:0.3049171383177249,148:0.03708672766904542,179:0.0378517568151372)0.791:0.1144947996758733,(7:0.03957347328360286,67:0.04270466431855618,74:0.04252473198047437)0.606:0.09955807573144125,(10:0.03999845578965671,23:0.03840739953585517,24:0.0373283363694035,33:0.03777827828557337,34:0.03906854880835581,52:0.037837374132399,57:0.04196876340286646,66:0.03905874183783537,68:0.03801677425160031,69:0.03837467908120578,70:0.04072531603650159,114:0.03939876554763477,126:0.03766267051356409,142:0.03585081374797336)0.996:0.1760692587991428)0.989:0.200220652516918,8:0.03926541645642175,17:0.04159560019127999,18:0.04378049847278463,(21:0.04175528595985299,37:0.04072665761726044,49:0.03607198149899044,51:0.0384291253314738,61:0.03929639632453217,85:0.04070431605710794,117:0.04135481912739202)0.617:0.1034535943533334,22:0.03871134042861783,26:0.03737160264778631,29:0.04087775410401778,35:0.03647806318282779,36:0.03960872270519186,38:0.04425491142442749,47:0.09891369559928201,50:0.04149496798472954,53:0.03784388025551942,55:0.04201311058302938,56:0.03640313094102957,60:0.09374951139648055,75:0.04120965174360287,77:0.03748430960177387,78:0.04079887228838106,86:0.04040680719554094,87:0.03960764689518193,94:0.03547263284417535,115:0.03896857492534341,121:0.03877830668197119,122:0.04024639868505618,123:0.0398585167688135,127:0.04013904709307065,135:0.04272063182434192,155:0.1605360661254105,157:0.03789255428549392,158:0.04185727867098169,162:0.03869351724426969,(163:0.04249640585868599,164:0.0398672291275535)0.982:0.09458379274750246,165:0.03832684112832971,166:0.03733347764703424,178:0.3391198795278412)0.904:0.180786652440576,(((((5:0.03788382395339893,25:0.04091973000792452,27:0.04058183724840091,30:0.0397032647503682,62:0.04132189654434574,63:0.03844517037070821,118:0.0383250337522379)0.991:0.1502492465007272,28:0.2135444197872554,(40:0.04066541351490551,106:0.03895915966544073,124:0.03979189147393547)1.000:0.2675334049882453)0.803:0.09210695808693795,6:0.09906473236183998,(11:0.03980041174013849,102:0.04153363507320215)0.968:0.09494218231980954,(16:0.04093320524846927,19:0.04117940496246218,44:0.03858554333929284,58:0.03948434699795424,59:0.03803852637893118,76:0.03800261493948173,(91:0.0404352951771234,96:0.03891426677556788,105:0.03957966383412984)0.995:0.09571012238468851,98:0.03896258692402802,99:0.03884712021491108,(109:0.09792251342516915,145:0.04129395404265382)0.986:0.09632010839773997,110:0.2575273626165513,111:0.04058536990115434,138:0.03885748682743484,139:0.03772417102418575,147:0.0425036883022663)0.782:0.09363865926680998,31:0.2085699063540939,(39:0.0941915759080564,46:0.04157687081331878,100:0.03970660164257497,101:0.04306035506061943,(103:0.04004762755695052,131:0.03925600932735793,143:0.03903090691397841,154:0.03814875393042274)0.964:0.0950890700188462,181:0.3355749233169156)0.674:0.09228758495924566,(48:0.03771113677717514,113:0.04255360827734224,119:0.04328662986698226)1.000:0.2099268557288126,(95:0.03940766061275049,144:0.04145770827728881)0.961:0.0979724737319042,107:0.09294654596837251,156:0.09721670956880375)1.000:0.2969653304800058,((13:0.03660743987916809,20:0.03803460412354792,64:0.03924558585263169,73:0.04027523618733313,116:0.03626156173963247,134:0.0399514405566282)0.928:0.09170807524558858,71:0.03715550090627564,72:0.04277815119560519)1.000:0.3469489740243384,112:0.8546950592633721)0.831:0.09687115115951203,(132:0.03864982984569831,(168:0.03899278598260409,169:0.0385063795994861,175:0.03705642091901182,177:0.03947670801377867)1.000:0.1549311579796855,176:0.04089414695689592)1.000:0.6026595524367439)0.968:0.1621392128101966)0.835:0.1150752144935105)0.890:0.1225212785805713,(93:0.04142776005951672,136:0.03686892128287306,137:0.04266799909457662,149:0.03943930911435713,150:0.04116196654940209)0.999:0.3101175355611894)0.720:0.1012623307674188,(((41:0.03433824801938148,108:0.03352245092248835,125:0.03564276987803058)1.000:0.2746559417756297,(104:0.0339871634947552,159:0.03586423160927937,161:0.03576731395385883)0.999:0.2152963215366713)0.998:0.2160867240572603,(42:0.04156361310176608,43:0.0399062137015021)1.000:0.3253175274577475)0.899:0.1099056707985587)0.994:0.571419906807844); END;