#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:44 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., & Takamatsu S. 2014. Notes on the powdery mildews (Erysiphales) in Japan II. Erysiphe sect. Microsphaera. Mycoscience, 56(1): 230-236. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15710] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=31; TAXLABELS Erysiphe_abbreviata_ex_Quercus_AB271785 Erysiphe_alphitoides_ex_Quercus_AB257431 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 Erysiphe_bremeri_ex_Alhagi_AB103077 Erysiphe_corylopsidis_ex_Corylopsis_AB478988 Erysiphe_cruciferarum_ex_Cardaria_AB102944 Erysiphe_epigena_ex_Quercus_AB292722 Erysiphe_friesii_ex_Rhamnus_AB022382 Erysiphe_glycines_ex_Desmodium_AB022397 Erysiphe_heraclei_ex_Chaerophyllum_AB103067 Erysiphe_heraclei_ex_Daucus_AB022391 Erysiphe_hypogena_ex_Quercus_AB292727 Erysiphe_hypophylla_ex_Quercus_AB292716 Erysiphe_ligustri_ex_Ligustrum_AB015917 Erysiphe_lycopsidis_ex_Anchusa_AB103072 Erysiphe_monascogera_ex_Styrax_AB331645 Erysiphe_multappendicis_ex_Berberis_AB103076 Erysiphe_nomurae_ex_Symplocos_AB331648 Erysiphe_paeoniae_ex_Paeonia_AB257438 Erysiphe_platani_ex_Platanus_MUMH5657 Erysiphe_pulchra_var._japonica_ex_Cornus_AB022389 Erysiphe_pulchra_var._pulchra_ex_Cornus_AB015935 Erysiphe_quercicola_ex_Quercus_AB292694 Erysiphe_staphyleae_ex_Staphylea_AB015922 Erysiphe_syringae_ex_Syringa_AB015920 Erysiphe_trifoliorum_ex_Trifolium_AB103078 Erysiphe_vanbruntina_ex_Sambucus_AB015925 Erysiphe_wallrothii_ex_Leucothoe_MUMH4752 Erysiphe_wallrothii_ex_Vaccinium_AB015930 Pseudoidium_hortensiae_ex_Hydrangea_MUMH281 Pseudoidium_sp._ex_Medicago_AB102942 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=33; TAXLABELS Erysiphe_abbreviata_AB271785 Erysiphe_alphitoides_AB237783 Erysiphe_aquilegiae_ex_Cimicifuga_AB000944 Erysiphe_aquilegiae_ex_Clematis_AB015929 Erysiphe_aquilegiae_ex_Clematis_AF154322 Erysiphe_castaneigena_AF298545 Erysiphe_circeae_ex_Circaea_AB104517 Erysiphe_epigena_AB292720 Erysiphe_glycines_ex_Desmodium_AB015927 Erysiphe_hypogena_AB292724 Erysiphe_hypophylla_AB292715 Erysiphe_liriodendri_AF011302 Erysiphe_macleayae_ex_Macleaya_AB016048 Erysiphe_magnifica_ex_Magnolia_AF011312 Erysiphe_magnifica_ex_Magnolia_GU195046 Erysiphe_monascogera_AB331646 Erysiphe_paeoniae_ex_Paeonia_AB257436 Erysiphe_paeoniae_ex_Paeonia_AB257437 Erysiphe_platani_ex_Platanus_JX997805 Erysiphe_platani_ex_Platanus_KF499270 Erysiphe_platani_ex_Platanus_MUMH5657 Erysiphe_pseudolonicerae_AB015915 Erysiphe_quercicola_AB292691 Erysiphe_quercicola_AB292694 Erysiphe_sedi_ex_Sidum_JX173290 Erysiphe_syringae_ex_Ligustrum_AB295461 Erysiphe_syringae_ex_Syringa_AB015920 Erysiphe_wallrothii_ex_Leucothoe_MUMH4752 Erysiphe_wallrothii_ex_Vaccinium_AB015930 Pseudoidium_hortensiae_ex_Hydrangea_JQ669944 Pseudoidium_hortensiae_ex_Hydrangea_MUMH281 Pseudoidium_neolycopersici_ex_Lycopersicon_AB032484 Pseudoidium_neolycopersici_ex_Lycopersicon_AB034722 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M21914] TITLE Microsphera_28S_Fig._1; LINK TAXA = Taxa1; DIMENSIONS NCHAR=773; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_abbreviata_ex_Quercus_AB271785 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACCCGGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGCAGGTG----------------------------------------------- Erysiphe_alphitoides_ex_Quercus_AB257431 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT--------------------------------------------------------------------------------- Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTCGGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_bremeri_ex_Alhagi_AB103077 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_corylopsidis_ex_Corylopsis_AB478988 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG--------------------------------------------------------------AATCTGGCTCCGTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCAGCCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCGTGAGTTCT-CTCTCGTGCACTCGTCAGCGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGAGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCTT---CATTGGAGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_cruciferarum_ex_Cardaria_AB102944 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGTTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGGAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_epigena_ex_Quercus_AB292722 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_friesii_ex_Rhamnus_AB022382 TTGACCTCGAATCAGGTAGGAATACCCGCTGAAC------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GTCGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTACGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_glycines_ex_Desmodium_AB022397 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-GTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATCTAGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTTGGGGAGTGTTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCC---TTT--GGGGTGCATCATCGACCGATCCTGATGTCTT Erysiphe_heraclei_ex_Chaerophyllum_AB103067 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGACGCTGCCGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTA?CTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---CTTTGGGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_heraclei_ex_Daucus_AB022391 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---CTTTGGGGGCGCATCATCGACCGATCCTGA------ Erysiphe_hypogena_ex_Quercus_AB292727 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCAGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATACGCGGAATGAAAGTGAACG----------------------------------------------------- Erysiphe_hypophylla_ex_Quercus_AB292716 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT--------------------------------------------------------------------------------- Erysiphe_ligustri_ex_Ligustrum_AB015917 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-CTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTTGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGT--- Erysiphe_lycopsidis_ex_Anchusa_AB103072 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCACGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGTTCTGCGCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGTGCATCATCGACCGATCCTGATGTCTT Erysiphe_monascogera_ex_Styrax_AB331645 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG???????????????????????????GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCAGACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_multappendicis_ex_Berberis_AB103076 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCATCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_nomurae_ex_Symplocos_AB331648 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCCAGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCCATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCATCTCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_paeoniae_ex_Paeonia_AB257438 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGGGCACTGCCGATCACCCTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTA-------------------------------------------------------------------------------- Erysiphe_platani_ex_Platanus_MUMH5657 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGGGCGCTGCCGATCACCCCGAGTTTT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_pulchra_var._japonica_ex_Cornus_AB022389 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCAGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_pulchra_var._pulchra_ex_Cornus_AB015935 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAG-------------------------------------------------- Erysiphe_quercicola_ex_Quercus_AB292694 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAGTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_staphyleae_ex_Staphylea_AB015922 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTGGGAGTCCGAGTTGTAATTTGTAGAAGCTGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTGCGCCTATGTAAAGCGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGGGTGCACTCGTCAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTTGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGT------------------------------------------------ Erysiphe_syringae_ex_Syringa_AB015920 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACCGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTCCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_trifoliorum_ex_Trifolium_AB103078 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA-------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_vanbruntina_ex_Sambucus_AB015925 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCTGCGCCTATGTAAAGCTCTTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCCGAGTTTT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTCCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC-------------------------------------------------------------------------------------------------------------------- Erysiphe_wallrothii_ex_Leucothoe_MUMH4752 --------------------------------------GCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTGGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_wallrothii_ex_Vaccinium_AB015930 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCT-TCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTGGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCCTGATGTCTT Pseudoidium_hortensiae_ex_Hydrangea_MUMH281 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAG?CCGTAGGAATGTAGCTCTCTTCGGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAA?CCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC---TTT--GGGGCGCATCATCGACCGATCC--------- Pseudoidium_sp._ex_Medicago_AB102942 ------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCC-TTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCATGGCCCGCGCCTCTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGGAGGAATGTAGCTCCCCTCGGGGAGTGTTATAGCCTACGGCGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCGTTCG--GGGGCGCATCATCGACCGATCCTGATGTCTT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Microsphera_28S_Fig._1) = N: 1-773; CODONPOSSET CodonPositions (CHARACTERS = Microsphera_28S_Fig._1) = N: 1-773; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M21915] TITLE Erysiphales_ITS_Fig._2; LINK TAXA = Taxa2; DIMENSIONS NCHAR=579; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_abbreviata_AB271785 CAGAGTGCGAGGCTCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGCTGCTGT-GCGCAAGGACATGCGGTGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTATTTTTTGTCGTCTTAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTGGTGTCGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGTCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAAG-AACCCACGTT------GTTCCAGTCACATGGAATCAAAGG Erysiphe_alphitoides_AB237783 CAGAGTGTGAGGCTCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTTTTGTCGTCTTAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAAC-AACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Erysiphe_aquilegiae_ex_Cimicifuga_AB000944 CAGAGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGG-TTTATTATAG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCC----------------------GTTCCAGTCACATGG-ATCACAGG Erysiphe_aquilegiae_ex_Clematis_AB015929 CAGAGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCC----------------------GTTCCAGTCACATGG-ATCACAGG Erysiphe_aquilegiae_ex_Clematis_AF154322 CAGAGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAA---AGCCCGTTT-------GTTCCAGTCACATGG-ATCACAGG Erysiphe_castaneigena_AF298545 CAGAGTGCGAGGCTCAGTC-GTGGCGTC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCATCGTCGCTGC-CCGCAAGGACCAGCGTCGGCCGCCCACCGG-TCTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTTTTGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAAAGAACCCACTT-------GTTCCAGTCACATGG-ATCACAGG Erysiphe_circeae_ex_Circaea_AB104517 CAGAGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGCGTCGGCTGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTACTGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAA---AGCCCGTTT-------GTTCCAGTCACATGG-ATCACAGG Erysiphe_epigena_AB292720 CAGAGTGTGAGGCACAGTC-GTGGCATC-TGCTGCGTACTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGC-CCGCAAGGACATGCGTCGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTTTTGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--TTGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAAC-AACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Erysiphe_glycines_ex_Desmodium_AB015927 CAGAGCGTGAGGCTCAGTCGCTGGCATC-TGCCACGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTTATAGATTGTTGCTTTGGCGGGCCGGGAC--CGTCCACGTCGT-TCACAGTGACGCGTGCGAGCTGCCCACCGG-CTTTGGCTGGAGCGTGTCCGCCAAAGACCCAACCCAAAACTCTTATATTTGTCATGGTAGTCTAAGT-AAAAGTATAT-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCGAGCTACCGTTGTGTGGCTGTGGTGTTGGGGCTCGCCGCGTCTCGCGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGATTCTCGCGACAGAGTGACGACGATGATCAGCCAAAA--AACCCCCTTTTAACCAAGTCCGGTCATACGATTTTACAGG Erysiphe_hypogena_AB292724 CAGAGTGTGAGGCCCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGC-CCGCAAGGACATGCGTCGGCCGCCCACCGG-CTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTA-TTTTTGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCGTTGTGTGGCTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAAC-AACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Erysiphe_hypophylla_AB292715 CAGAGCGTGAGGCTCAGTC-GTGGCATC-TGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGCTCCGCAAGGATATGCGTCGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTTTTGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGTTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAATAAACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Erysiphe_liriodendri_AF011302 CAGAGTGCGAGGCTCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TGTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGCCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTTCGGCTGGAGCGTGCCCGCCAAAGACCCCAATCAAAACTCATG--TTG-TTTTTGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCCTCCAGCTACCTTTGTGTGGCTGCGGCGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCGAACTTT------GTTCCAGTCACATGG-ATCACAGG Erysiphe_macleayae_ex_Macleaya_AB016048 CAGAGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACGCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCC----------------------GTTCCAGTCACATGG-ATCACAGG Erysiphe_magnifica_ex_Magnolia_AF011312 ------------------------CGTC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTCGTTGCTTTGGCGGGCCGGGCCGCCGTCGTCGCTGC-CCGCAAGGACATGCGTCGGCCGCCCACCGG-TTTCGGCTGGAACGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TTTTTGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGCGGCTTGCC----------------------GTTCCAGTCACATGG-ATCACAGG Erysiphe_magnifica_ex_Magnolia_GU195046 CAGAGTGCGAGGCTCAGTC-GTAGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTCGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGC-CCGCAAGGACATGCGTCGGCCGCCCACCGG-TTTCGGCTGGAACGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TTTTTGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGCGGCTTGCCAGAAC-AATCTACTTT------GTTCCAGTCACATGG-ATCACAGG Erysiphe_monascogera_AB331646 CAGAGTGTGAGGCTCAGTC-GTGGCATC-TGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGG-TTTCGGCTGGGGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTTTTGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATC{AG}AATCTTT{AG}AACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAAC-AACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Erysiphe_paeoniae_ex_Paeonia_AB257436 CAGAGCGTGAGGTCCAGTC-GTGGCGTC-TGCCGCGTGCTGGGCCAACCCTCCCACCCGTGTCGA-TATGTATCTTGTTGCTTTGGCGGGCCGGGTCG-TGTCGTCGCTGC-CCGCAAGGACATGCGTCGCCTGCCCACCGG-TTTCGGCTGGAGCGCGTCCGCCAAAGA-CCTAATCAAAACTCATG--TTG-TCTATGTAGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCACGTCGCA--GTGCGGCGGCTCTTAAAAATAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAAAA--CCTCTAATT-------GTTCCAGTCACATGG-ATCACAGG Erysiphe_paeoniae_ex_Paeonia_AB257437 CAGAGCGTGAGGTCCAGTC-GTGGCGTC-TGCCGCGTGCTGGGCCAACCCTCCCACCCGTGTCGA-TATGTATCTTGTTGCTTTGGCGGGCCGGGTCG-TGTCGTCGCTGC-CCGCAAGGACATGCGTCGCCTGCCCACCGG-TTTCGGCTGGAGCGCGTCCGCCAAAGA-CCTAATCAAAACTCATG--TTG-TCTATGTAGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCACGTCGCA--GTGCGGCGGCTCTTAAAAATAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAAAA--CCTCTAATT-------GTTCCAGTCACATGG-ATCACAGG Erysiphe_platani_ex_Platanus_JX997805 CAGAGTGCGAGGTCCCGCATGTAGCATCTTGCTACGTGTTGGGCCGACCCACCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGT-CCGCAAGGACATGCGTCGGCCGCCCACCGG-CTTCGGCTGGAGCGCGTCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTATTGTCGTCTCAGCTTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ACGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTAGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAAAAC-AACCCACTTT------GCTCCAGTCACATGG-ATCACAGG Erysiphe_platani_ex_Platanus_KF499270 CAGAGTGCGAGGTCCCGCATGTAGCATCTTGCTACATGTTGGGCCGACCCACCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGT-CCGCAAGGACATGCGTCGGCCGCCCACCGG-CTTCGGCTGGAGCGCGTCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTATTGTCGTCTCAGCTTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ACGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTAGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAAAAC-AACCCACTTT------GCTCCAGTCACATGG-ATCACAGG Erysiphe_platani_ex_Platanus_MUMH5657 --------------------GTAGCATCTTGCTACGTGTTGGGCCGACCCACCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGT-CCGCAAGGACATGCGTCGGCCGCCCACCGG-CTTCGGCTGGAGCGCGTCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTATTGTCGTCTCAGCTTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ACGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTAGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAAAAC-AACCCACTTT------GCTCCAGTCACATGG-ATCACAGG Erysiphe_pseudolonicerae_AB015915 CAGAGTGTGAGGCTCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCATGTTGCTTTGGCGGGCCGGGCCGCCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTTTTGTCGTCTTAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAAC-AACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Erysiphe_quercicola_AB292691 CAGAGCGTGAGGCTCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCCATCAAAACTCATG--TTG-TTTATGTCGTCTTAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTG--ATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAAC-AACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Erysiphe_quercicola_AB292694 CAGAGCGTGAGGCTCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCCATCAAAACTCATG--TTG-TTTATGTCGTCTTAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTG--ATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAAC-AACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Erysiphe_sedi_ex_Sidum_JX173290 ---AGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAA---AGCCCGTTT-------GTTCCAGTCACATGG-ATCACAGG Erysiphe_syringae_ex_Ligustrum_AB295461 CAGAGTGCGAGGCTCAGTC-GTAGCATC-TGCTGCGTGCTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGC-CCACACGGACAAGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCCAACCAAAACTCATGTTTTT-TTTTCGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGACGGCGGCTTGCCAGAAC-AACCCACTTT------GCTCCAGTCACATGG-ATCACAGG Erysiphe_syringae_ex_Syringa_AB015920 CAGAGTGCGAGGCTCAGTC-GTAGCATC-TGCTGCGTGCTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGC-CCACACGGACAAGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCCAACCAAAACTCATG--TTTTTTTTCGTCGTCTCAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGGGTGACGACGGCGGCTTGCCAGAAC-AACCCACTTT------GCTCCAGTCACATGG-ATCACAGG Erysiphe_wallrothii_ex_Leucothoe_MUMH4752 ------GTGAGGCTCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTTTTGTCGTCTTAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAG------------------------------------------------------------------ Erysiphe_wallrothii_ex_Vaccinium_AB015930 CAGAGTGTGAGGCTCAGTC-GTGGCATC-TGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCG-CGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGG-TTTCGGCTGGAGCGCGCCCGCCAAAGA-CCCAACCAAAACTCATG--TTG-TTTTTGTCGTCTTAGC-TTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCG--ATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAAC-AACCCACTT-------GCTCCAGTCACATGG-ATCACAGG Pseudoidium_hortensiae_ex_Hydrangea_JQ669944 CAGAGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAA---AGCCCGTTT-------GTTCCAGTCACATGG-ATCACAGG Pseudoidium_hortensiae_ex_Hydrangea_MUMH281 ----------------------------------------------------CCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGCGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGG-------------------------------------------------------------------------------------------------------- Pseudoidium_neolycopersici_ex_Lycopersicon_AB032484 CAGAGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGTGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAA---AGCCCGTTT-------GTTCCAGTCACATGG-ATCACAGG Pseudoidium_neolycopersici_ex_Lycopersicon_AB034722 CAGAGCGTGAGGCTCAGTC-GTGGCGTC-AGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTA-CGTCGTCGCTGC-CCGTACGGACATGTGTCGGCCGCCCACCGG-TTTCGACTGGAGCGCGTCCGCCAAAGA-CCTAACCAAAACTCATG--TTG-TCTTTGTCGTCTCAGC-TTTATTATTG-AATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCG--TTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAA---AGCCCGTTT-------GTTCCAGTCACATGG-ATCACAGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Erysiphales_ITS_Fig._2) = N: 1-579; CODONPOSSET CodonPositions (CHARACTERS = Erysiphales_ITS_Fig._2) = N: 1-579; END; BEGIN TREES; TITLE Fig._2_from_ITS_33_taxa; LINK TAXA = Taxa2; TRANSLATE 1 Erysiphe_glycines_ex_Desmodium_AB015927, 2 Erysiphe_liriodendri_AF011302, 3 Erysiphe_quercicola_AB292691, 4 Erysiphe_quercicola_AB292694, 5 Erysiphe_abbreviata_AB271785, 6 Erysiphe_castaneigena_AF298545, 7 Erysiphe_alphitoides_AB237783, 8 Erysiphe_pseudolonicerae_AB015915, 9 Erysiphe_monascogera_AB331646, 10 Erysiphe_hypophylla_AB292715, 11 Erysiphe_epigena_AB292720, 12 Erysiphe_hypogena_AB292724, 13 Erysiphe_aquilegiae_ex_Cimicifuga_AB000944, 14 Erysiphe_aquilegiae_ex_Clematis_AB015929, 15 Erysiphe_paeoniae_ex_Paeonia_AB257437, 16 Erysiphe_paeoniae_ex_Paeonia_AB257436, 17 Erysiphe_macleayae_ex_Macleaya_AB016048, 18 Erysiphe_aquilegiae_ex_Clematis_AF154322, 19 Erysiphe_circeae_ex_Circaea_AB104517, 20 Erysiphe_syringae_ex_Syringa_AB015920, 21 Erysiphe_syringae_ex_Ligustrum_AB295461, 22 Pseudoidium_neolycopersici_ex_Lycopersicon_AB032484, 23 Pseudoidium_neolycopersici_ex_Lycopersicon_AB034722, 24 Erysiphe_magnifica_ex_Magnolia_AF011312, 25 Erysiphe_magnifica_ex_Magnolia_GU195046, 26 Erysiphe_wallrothii_ex_Vaccinium_AB015930, 27 Erysiphe_wallrothii_ex_Leucothoe_MUMH4752, 28 Pseudoidium_hortensiae_ex_Hydrangea_MUMH281, 29 Erysiphe_platani_ex_Platanus_MUMH5657, 30 Erysiphe_platani_ex_Platanus_KF499270, 31 Erysiphe_sedi_ex_Sidum_JX173290, 32 Pseudoidium_hortensiae_ex_Hydrangea_JQ669944, 33 Erysiphe_platani_ex_Platanus_JX997805; TREE Fig._2 = [&R] (1,((((((2,(((20,21),(29,30,33)),(24,25))),(5,6)),((3,4),7,8,26,27)),(11,12)),9),10),(((13,14,17,18,((22,23),28,31,32)),19),(15,16))); END; BEGIN TREES; TITLE Fig._1_from_28S_31_taxa_Microsphera; LINK TAXA = Taxa1; TRANSLATE 1 Erysiphe_glycines_ex_Desmodium_AB022397, 2 Erysiphe_trifoliorum_ex_Trifolium_AB103078, 3 Erysiphe_multappendicis_ex_Berberis_AB103076, 4 Erysiphe_cruciferarum_ex_Cardaria_AB102944, 5 Erysiphe_lycopsidis_ex_Anchusa_AB103072, 6 Erysiphe_heraclei_ex_Chaerophyllum_AB103067, 7 Erysiphe_bremeri_ex_Alhagi_AB103077, 8 Erysiphe_alphitoides_ex_Quercus_AB257431, 9 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405, 10 Erysiphe_corylopsidis_ex_Corylopsis_AB478988, 11 Erysiphe_friesii_ex_Rhamnus_AB022382, 12 Erysiphe_heraclei_ex_Daucus_AB022391, 13 Erysiphe_hypophylla_ex_Quercus_AB292716, 14 Erysiphe_paeoniae_ex_Paeonia_AB257438, 15 Pseudoidium_sp._ex_Medicago_AB102942, 16 Erysiphe_quercicola_ex_Quercus_AB292694, 17 Erysiphe_abbreviata_ex_Quercus_AB271785, 18 Erysiphe_epigena_ex_Quercus_AB292722, 19 Erysiphe_hypogena_ex_Quercus_AB292727, 20 Erysiphe_ligustri_ex_Ligustrum_AB015917, 21 Erysiphe_monascogera_ex_Styrax_AB331645, 22 Erysiphe_nomurae_ex_Symplocos_AB331648, 23 Erysiphe_pulchra_var._japonica_ex_Cornus_AB022389, 24 Erysiphe_pulchra_var._pulchra_ex_Cornus_AB015935, 25 Erysiphe_staphyleae_ex_Staphylea_AB015922, 26 Erysiphe_syringae_ex_Syringa_AB015920, 27 Erysiphe_wallrothii_ex_Vaccinium_AB015930, 28 Erysiphe_vanbruntina_ex_Sambucus_AB015925, 29 Pseudoidium_hortensiae_ex_Hydrangea_MUMH281, 30 Erysiphe_wallrothii_ex_Leucothoe_MUMH4752, 31 Erysiphe_platani_ex_Platanus_MUMH5657; TREE Fig._1 = [&R] (1,((((((((((((((((2,3),(4,5)),(6,12)),7),11),((8,(27,30)),(16,(21,22)))),13),(26,31)),17),(18,19)),(10,24)),(14,20)),((9,29),15)),25),28),23)); END;