#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:55 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., & Takamatsu S. 2014. Notes on the powdery mildews (Erysiphales) in Japan III. Golovinomyces and Podosphaera. Mycoscience, 56(2): 243-251. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15835] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=51; TAXLABELS Cystotheca_lanestris_ex_Quercus_AB000933 Cystotheca_wrightii_ex_Quercus_AB000932 Podosphaera_astericola_ex_Aster_AB040335 Podosphaera_astericola_ex_Aster_AB040353 Podosphaera_clandestina_ex_Crataegus_AB525930 Podosphaera_clandestina_ex_Crataegus_AB525931 Podosphaera_curvispora_ex_Aria_alnifolia_AB525928 Podosphaera_elsholtziae_ex_Ajuga_AB026142 Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB046987 Podosphaera_euphorbiae_hirtae_ex_Acalypha_AB040306 Podosphaera_intermedia_ex_Clerodendrum_AB026145 Podosphaera_leucotricha_ex_Molus_AB027231 Podosphaera_leucotricha_ex_Molus_AF073353 Podosphaera_longiseta_ex_Padus_AB000945 Podosphaera_photiniae_ex_Photinia_AB026147 Podosphaera_phtheirospermi_ex_Melampyrum_AB040332 Podosphaera_pseudofusca_ex_Fatoua_AB040320 Podosphaera_sp._ex_Cayratia_AB026151 Podosphaera_sp._ex_Cerasus_AB026138 Podosphaera_sp._ex_Dunbaria_AB040334 Podosphaera_sp._ex_Hibiscus_AB040308 Podosphaera_sp._ex_Peristrophe_AB026135 Podosphaera_sp._ex_Photinia_AB525934 Podosphaera_sp._ex_Saintpaulia_AB040338 Podosphaera_sp._ex_Verbena_AB040347 Podosphaera_tridactyla_ex_Cerasus_leveilleana_MUMH274 Podosphaera_tridactyla_ex_Microcerasus_AB000943 Podosphaera_tridactyla_ex_Padus_AY833652 Podosphaera_tridactyla_ex_Prunus_armeniaca_AY833657 Podosphaera_tridactyla_ex_Prunus_cerasifera_AY833658 Podosphaera_tridactyla_ex_Prunus_sp._AY833659 Podosphaera_xanthii_ex_Calendula_AB040317 Podosphaera_xanthii_ex_Carthamus_AB040298 Podosphaera_xanthii_ex_Coreopsis_EF442023 Podosphaera_xanthii_ex_Cosmos_AB040300 Podosphaera_xanthii_ex_Cucumis_AB040323 Podosphaera_xanthii_ex_Cucurbita_AB040315 Podosphaera_xanthii_ex_Euryops_DQ205330 Podosphaera_xanthii_ex_Farfugium_AB040346 Podosphaera_xanthii_ex_Gynostemma_D84378 Podosphaera_xanthii_ex_Lactuca_AB040294 Podosphaera_xanthii_ex_Lactuca_AB040352 Podosphaera_xanthii_ex_Parasenecio_hastatus_AB040314 Podosphaera_xanthii_ex_Petasites_AB040307 Podosphaera_xanthii_ex_Physalis_AB040336 Podosphaera_xanthii_ex_Rudbeckia_AB040296 Podosphaera_xanthii_ex_Verbena_AB046985 Podosphaera_xanthii_ex_Verbena_bonariensis_AB462804 Podosphaera_xanthii_ex_Verbena_brasiliensis_MUMH856 Podosphaera_xanthii_ex_Vigna_AB040297 Podosphaera_xanthii_ex_Zinnia_AB040354 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=26; TAXLABELS Cystotheca_lanestris_ex_Quercus_AB022353 Cystotheca_wrightii_ex_QuercusAB022355 Podosphaera_asericola_ex_Aster_AB462779 Podosphaera_astericola_ex_Aster_AB462760 Podosphaera_balsaminae_ex_Impatiens_AB462787 Podosphaera_balsaminae_ex_Impatiens_AB462788 Podosphaera_elsholtziae_ex_Ajuga_AB462794 Podosphaera_erigerontis_canadensis_ex_Conyza_AB462772 Podosphaera_euphorbiae_hirtae_ex_Acalypha_AB462770 Podosphaera_intermedia_ex_Clerodendrum_AB462777 Podosphaera_longiseta_ex_Padus_AB022423 Podosphaera_sp._ex_Hibiscus_MUMH605 Podosphaera_sp._ex_Solanum_AB462769 Podosphaera_sp._ex_Verbena_AB462780 Podosphaera_sp._ex_Vigna_AB462784 Podosphaera_tridactyla_ex_Cerasus_leveilleana_MUMH274 Podosphaera_tridactyla_ex_Microcerasua_AB022393 Podosphaera_xanthii_ex_Cosmos_AB462797 Podosphaera_xanthii_ex_Cucurbita_AB462766 Podosphaera_xanthii_ex_Gerbera_AB462763 Podosphaera_xanthii_ex_Helianthus_AB462781 Podosphaera_xanthii_ex_Lactuca_AB462773 Podosphaera_xanthii_ex_Parasenecio_hastatus_MUMH177 Podosphaera_xanthii_ex_Verbena_brasiliensis_MUMH856 Podosphaera_xanthii_ex_Zehneria_AB462792 Podosphaera_xanthii_ex_Zinnia_AB462782 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M22261] TITLE Podosphaera_ITS_51taxa; LINK TAXA = Taxa1; DIMENSIONS NCHAR=496; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cystotheca_lanestris_ex_Quercus_AB000933 CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCGGGCG-TGGCTGACCCTCCACCCGTGTCTAT--CTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGC--TGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATT--TCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAATACCCATC--TTAACAGG Cystotheca_wrightii_ex_Quercus_AB000932 CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCAGGCG-TGGCTGACCCTCCACCCGTGTCTAT--CTTCTCATGTTGCTTTGGCGGGCCGGGCCCTGTGCCCTCCCGGCGCCTGCTGGGACGCGCCCGCCAGAGCCACCCTAACGCGTGC--TGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTGGCTTGGTCTTGGAGCGCGCCCCGCGGGGCGGCTCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATT--TCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAAGCCTCATC--ATACTAGG Podosphaera_astericola_ex_Aster_AB040335 CTGAGCGCGAGGCCCCGCAGTACGC---AAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGC--TATCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCCAA---TTTTTGG Podosphaera_astericola_ex_Aster_AB040353 CTGAGCGCGAGGCCCCGCAGTGCGC---AAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCAGC--TATCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCCAA---TTTTTGG Podosphaera_clandestina_ex_Crataegus_AB525930 CTGAGCGCGAGGCCACGCAGGACAC---TTGTCCTGCG-CGGTTGACCCTCCACCCGTGTGAAC--TGAT-TTTGTTGCTTTGGCGGGCCGGGCTC---GACCCACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--AGTTAGTGCAGTCTGAGAAAAAATTTAATAA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGTGCG-CCAGCTCGGCGTCCCCTAAACGTAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACG--TATCTCGCGACAGAGTTGCACTGAGACCTGCCAGAACCCCCCTT-TTTTTATGG Podosphaera_clandestina_ex_Crataegus_AB525931 CTGAGCGCGAGGCCACGCAGGACAC---TTGTCCTGCG-CGGTTGACCCTCCACCCGTGTGAAC--TGAT-TTTGTTGCTTTGGCGGGCCGGGCTC---GACCCACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--AGTTAGTGCAGTCTGAGAAAAAATTTAATAA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTGGCTTGGTCTTGGGGTGCG-CCAGCTCGGCGTCCCCT-AACGTAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACG--TATCTCGCGACAGAGTTGCACTGAGACCTGCCAGAACCCCCCTT-TTTTTATGG Podosphaera_curvispora_ex_Aria_alnifolia_AB525928 CTGAGCGTGAGGCTACGCAGGACAC---TTGTTCTGCG-TGGCCGACCCTCCACCCGTGTGAAC--TATT-TGTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGT--AGTCAGTGTAGTCTGAGTCTAAATT-AATAA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCA?AATTTAGTGAATCATCAAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGCGCG-CCAGTTTGGCGTCCCCTAAATACAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCCACGACGGCGCTTGCCAGAA--CCCCAT--TCTCTTGG Podosphaera_elsholtziae_ex_Ajuga_AB026142 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCGCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCAGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCCAA---TTTTTGG Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB046987 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGTGTAGTCATG--TATCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCCAA---TTTTTGG Podosphaera_euphorbiae_hirtae_ex_Acalypha_AB040306 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_intermedia_ex_Clerodendrum_AB026145 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTGATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGCTGTGTGAGTGTTGTCTGAGGAAATGTGGAATGA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATGTATATCTCGCGACAGGGCGGCGACGGCACCCGCCAGAA--CCCCAA---TTTTTGG Podosphaera_leucotricha_ex_Molus_AB027231 CTGAGCGTGAGGCCACGCAGGACAC---TCGTTCTGCG-CGGCTGACCCTCCACCCGTGTGAAC--TATT-TGTGTTGCTTTGGCGGGCCGGGTTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGT--AGTTAGTGCAGTCTGAGTCTAAATT-AATAA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCG-CCAGTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACA--TATCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCCTTT----TTCATGG Podosphaera_leucotricha_ex_Molus_AF073353 CTGAGCGTGAGGCCACGCAGGACAC---TCGTTCTGCG-CGGCTGACCCTCCACCCGTGTGAAC--TATT-TGTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGT--AGTTAGTGCAGTCTGAGTCTAAATT-AATAA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCG-CCAGTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACA--TATCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCCTTT----TTCATGG Podosphaera_longiseta_ex_Padus_AB000945 CCGAGCGCGAGGCCACGCGGGGCGC---CTGTCCTGCGTTGGCTGACCCTCCACCCGTGTGAACTATATCTATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTCAGTGTGGTCTGAGTGAATGTGGAATTA--ATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTTGCTTGGTCTTGGGGCTCG-CCGGCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGGACCTGCCAGAAGCCTCAAT---TTTCTAG Podosphaera_photiniae_ex_Photinia_AB026147 CTGAGCGTGAGGCCATGCAGGGCGC---TTGTTCTGCG-TGGCTGACCCTCCACCCGTGTGTAC--TCGT-TTTGTTGCTTTGGCGGGCCGGGCAC---GACCTACCGGCTCCGGCTGGGGAGTGCCCGCCAGAGACACCCCAACTCGTGC--AGTTTGTGCAGTCTGAGTCGA-ATTGAATTATGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCACAGCTTGGTCTTGGGGCGCG-CCATGCTGGCGTCCCCTAAACAGAGTGGCGGTCTCCTTGGGCTCTCCGCGTAGTCACG--CATCTCGCGCCAGAGTCGCGATGGGACCTGCCAGAATACCACCT--TCTTTTGG Podosphaera_phtheirospermi_ex_Melampyrum_AB040332 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCTCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGCCAGGGCGGCGACGGCACCCGCCAGAA--CCCCAA---TTTTTGG Podosphaera_pseudofusca_ex_Fatoua_AB040320 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGCGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_sp._ex_Cayratia_AB026151 CTGAGCGCGAGGCCCTGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_sp._ex_Cerasus_AB026138 CTGAGCGCGAGGCCACGCGGGGCGC---ATGCTCTGCGTCGGCTGACCCTCCACCCGTGTGAAC--CGTCTTCTGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTCAGTGTAGTCTGAGTGAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA--CCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGACCCGGCGGCTCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGCGTAGTCACG--TATCTCGCGACAGGGCGGCGACGACACCCGCCAGAACCCCCCAT---TTTCTGG Podosphaera_sp._ex_Dunbaria_AB040334 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_sp._ex_Hibiscus_AB040308 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_sp._ex_Peristrophe_AB026135 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTC--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_sp._ex_Photinia_AB525934 CTGAGCGTGAGGCCACGCAGGACAC---TCGTTCTGCG-CGGCTGACCCTCCACCCGTGTGAAC--TATT-TGTGTTGCTTTGGCGGGCCGGGCTC---GACCTACCGGCTCCGGCTGGGGAGCGCCCGCCAGAGAAGCCCCAACTCGTGT--AGTTAGTGCAGTCTGAGTCTAAATT-AATAA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACATCCTCTCAAGCCTAGCTTGGTCTTGGGGTGCG-CCAGTGTGGCGTCCCCTAAACATAGTGGCGGTACCGTTGTGCTCTCCGCGTAGTCACA--TATCTCGCGACAGAGCCACCACGGCACCTGCCAGAATCCCTTT----TTCATGG Podosphaera_sp._ex_Saintpaulia_AB040338 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_sp._ex_Verbena_AB040347 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCCAG---TCTTTGG Podosphaera_tridactyla_ex_Cerasus_leveilleana_MUMH274 -----CGCGAGGC-ACGCGGGGCGC---ATGCTCTGCGTCGGCTGACCCTCCACCCGTGTGAAC--CGTCTTCTGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTCAGTGTAGTCTGAGTGAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA--CCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGACCCGGCGGCTCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGCGTAGTCACG--TATCTCGCGACAGGGCGGCGACGACACCCGCCAGAACCCCCCAT---TTTCTGG Podosphaera_tridactyla_ex_Microcerasus_AB000943 CCGAGCGCGAGGCCACGCAGGGCGC---CTGTCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCTATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTCAGTGTTGTCTGAGTGAATGTGGAATTA--ATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCCAA--TTTTCTTG Podosphaera_tridactyla_ex_Padus_AY833652 CTGAGCGCGAGGCCACGCAGGGCGC---CTGTCCTGTGTTGGCTGACCCTCCACCCGTGTGAATTATATCAATTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTCAGTGTTGTCTGAGTGAATGTGGAATTA--ATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCT-GGCGGCCCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGTGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGGACCTGCCAGAACCCCCCAA--TTTTCTTG Podosphaera_tridactyla_ex_Prunus_armeniaca_AY833657 CTGAGCGTGAGGCCACGCGGGGCGC---ATGCCTTGCGTCGGCTGACCCTCCACCCGTGTGAAC--TGTCATCTGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTCGTCTGAGCGAATGTGGAATAA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTCGCTTGGTCTTGGGGCCCG-CCGACCTGGCGGCCCCTAAACGCAGTGGCGGTCCCGTTGTGCTCTCCGCGTAGTCACG--TATCTCGCGACAGGGCGGCGACGGAACCTGCCAGAACCCCCAAG-TTTTTCTGG Podosphaera_tridactyla_ex_Prunus_cerasifera_AY833658 CTGAGCGTGAGGCCACGCGGGGCGC---ATGCCTTGCGTCGGCTGACCCTCCACCCGTGTGAAC--TGTCATCTGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGCGCGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTCGTCTGAGCGAATGTGGAATAA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTCGCTTGGTCTTGGGGCCCG-CCGACCTGGCGGCCCCTAAACGTAGTGGCGGTCCCGTTGTGCTCTCCGCGTAGTCACG--TATCTCGCGACAGGGCGGCGACGGAACCTGCCAGAACCCCCAAGTTTTTTCTGG Podosphaera_tridactyla_ex_Prunus_sp._AY833659 CTGAGCGCGAGGCCACGCGGGGCGC---ATGCTCTGCGTCGGCTGACCCTCCACCCGTGTGAAC--CGTCTTCTGTTGCTTTGGCGGGCCGGGCTC---GTCCTGCCGGCTCCGGCTGGGGAGTGCCCGCCAGAGAAGCCCCAACTCGTGC--TGTCAGTGTAGTCTGAGTGAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA--CCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGACCCGGCGGCTCCTAAACGCAGTGGCGGTGCCGTTGTGCTCTCCGCGTAGTCACG--TATCTCGCGACAGGGCGGCGACGACACCCGCCAGAACCCCCCAT---TTTCTGG Podosphaera_xanthii_ex_Calendula_AB040317 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Carthamus_AB040298 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Coreopsis_EF442023 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TCTCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Cosmos_AB040300 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCACTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Cucumis_AB040323 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Cucurbita_AB040315 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Euryops_DQ205330 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Farfugium_AB040346 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Gynostemma_D84378 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Lactuca_AB040294 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCCAG---TCTTTGG Podosphaera_xanthii_ex_Lactuca_AB040352 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCCAG---TCTTTGG Podosphaera_xanthii_ex_Parasenecio_hastatus_AB040314 CTGAGCGCGAGGCCCCGCAGCGCGC---AAGCACTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGTGACGGCACCCGCCAGAA--CCCCCG---TCTTTGG Podosphaera_xanthii_ex_Petasites_AB040307 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Physalis_AB040336 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCCAG---TCTTTGG Podosphaera_xanthii_ex_Rudbeckia_AB040296 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Verbena_AB046985 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Verbena_bonariensis_AB462804 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCCAG---TCTTTGG Podosphaera_xanthii_ex_Verbena_brasiliensis_MUMH856 ----------------GCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTGGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGTTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGCGGCGACGGCACCCGCCAGAACCCCCCAG---TCTTTGG Podosphaera_xanthii_ex_Vigna_AB040297 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG Podosphaera_xanthii_ex_Zinnia_AB040354 CTGAGCGCGAGGCCCCGCAGCGCGC---ACGCGCTGCGGCGGTTGACCCTCCACCCGTGTGAAC--TCTTATCTGTTGCTTTGGCGGGCCGGGCTC---GACCTGCCGGCTCCGGCTGGCGAGTGCCCGTCAGAGAAGCCCCAACTCGTGC--TGTGAGTGTTGTCTGAGGAAATGTGGAATTA--GTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAACA-CCCCTCAAGCCTAGCTTGGTCTTGGGGCTCG-CCGGCTCGGCGGCCCCTAAACGCAGTGGCGGTGCTGGTGTGCTCTCCGCGTAGTCATG--TATCTCGCGACAGAGTGGCGACGGCACCCGCCAGAA--CCCCAG---TCTTTGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Podosphaera_ITS_51taxa) = N: 1-496; CODONPOSSET CodonPositions (CHARACTERS = Podosphaera_ITS_51taxa) = N: 1-496; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M22260] TITLE Podosphaera_28S_26taxa; LINK TAXA = Taxa2; DIMENSIONS NCHAR=680; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Cystotheca_lanestris_ex_Quercus_AB022353 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTTGGAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTATGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCCCTTGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCTGGGGTTCTCCCCGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTCGGGGCAGTGTTATAGCCTCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTTAGGGTGCATCATCGACCGATCCGGATGTCT Cystotheca_wrightii_ex_QuercusAB022355 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTCGGGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCGTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTGCCCTTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCGGGGTTCTCCCCGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTCGGGGCAGTGTTATAGCCCCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTTAGGGTGCATCATCGACCGATCCGGATGTCT Podosphaera_asericola_ex_Aster_AB462779 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCCCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAGAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_astericola_ex_Aster_AB462760 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCCCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_balsaminae_ex_Impatiens_AB462787 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_balsaminae_ex_Impatiens_AB462788 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_elsholtziae_ex_Ajuga_AB462794 ---ACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCT------- Podosphaera_erigerontis_canadensis_ex_Conyza_AB462772 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_euphorbiae_hirtae_ex_Acalypha_AB462770 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_intermedia_ex_Clerodendrum_AB462777 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCGGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_longiseta_ex_Padus_AB022423 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC--GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_sp._ex_Hibiscus_MUMH605 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGA----- Podosphaera_sp._ex_Solanum_AB462769 ----CGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_sp._ex_Verbena_AB462780 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_sp._ex_Vigna_AB462784 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_tridactyla_ex_Cerasus_leveilleana_MUMH274 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGCCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTGGGGTTCTCCCTAGGGCACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC--GGGCAGTGTTATAGCCACTGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCGCACGGGTGCATCATCGACCGATCCTGA----- Podosphaera_tridactyla_ex_Microcerasua_AB022393 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCTCCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC--GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTGAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_xanthii_ex_Cosmos_AB462797 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCGAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_xanthii_ex_Cucurbita_AB462766 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_xanthii_ex_Gerbera_AB462763 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_xanthii_ex_Helianthus_AB462781 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_xanthii_ex_Lactuca_AB462773 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_xanthii_ex_Parasenecio_hastatus_MUMH177 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTC--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGA----- Podosphaera_xanthii_ex_Verbena_brasiliensis_MUMH856 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGA----- Podosphaera_xanthii_ex_Zehneria_AB462792 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT Podosphaera_xanthii_ex_Zinnia_AB462782 GTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC-TCGGGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGTCTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCGCCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCTCTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT--GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCAAGGGTGCATCATCGACCGATCCTGATGTCT ; END; BEGIN TREES; TITLE Podosphaera_28S_26_taxa; LINK TAXA = Taxa2; TRANSLATE 1 Podosphaera_xanthii_ex_Cucurbita_AB462766, 2 Podosphaera_sp._ex_Hibiscus_MUMH605, 3 Podosphaera_xanthii_ex_Parasenecio_hastatus_MUMH177, 4 Podosphaera_xanthii_ex_Verbena_brasiliensis_MUMH856, 5 Podosphaera_xanthii_ex_Helianthus_AB462781, 6 Podosphaera_xanthii_ex_Zinnia_AB462782, 7 Podosphaera_xanthii_ex_Zehneria_AB462792, 8 Podosphaera_balsaminae_ex_Impatiens_AB462788, 9 Podosphaera_sp._ex_Solanum_AB462769, 10 Podosphaera_euphorbiae_hirtae_ex_Acalypha_AB462770, 11 Podosphaera_sp._ex_Vigna_AB462784, 12 Podosphaera_xanthii_ex_Gerbera_AB462763, 13 Podosphaera_xanthii_ex_Lactuca_AB462773, 14 Podosphaera_sp._ex_Verbena_AB462780, 15 Podosphaera_xanthii_ex_Cosmos_AB462797, 16 Podosphaera_balsaminae_ex_Impatiens_AB462787, 17 Podosphaera_asericola_ex_Aster_AB462779, 18 Podosphaera_astericola_ex_Aster_AB462760, 19 Podosphaera_elsholtziae_ex_Ajuga_AB462794, 20 Podosphaera_erigerontis_canadensis_ex_Conyza_AB462772, 21 Podosphaera_intermedia_ex_Clerodendrum_AB462777, 22 Podosphaera_longiseta_ex_Padus_AB022423, 23 Podosphaera_tridactyla_ex_Microcerasua_AB022393, 24 Podosphaera_tridactyla_ex_Cerasus_leveilleana_MUMH274, 25 Cystotheca_wrightii_ex_QuercusAB022355, 26 Cystotheca_lanestris_ex_Quercus_AB022353; TREE Fig._1 = [&R] (((((((1,2,4,5,6,7,8,9,10,11,13,14),3,12,15,16),(19,20),21),17,18),24),(22,23)),(25,26)); END; BEGIN TREES; TITLE Podosphaera_ITS_51_taxa; LINK TAXA = Taxa1; TRANSLATE 1 Podosphaera_xanthii_ex_Physalis_AB040336, 2 Podosphaera_xanthii_ex_Verbena_bonariensis_AB462804, 3 Podosphaera_xanthii_ex_Verbena_brasiliensis_MUMH856, 4 Podosphaera_xanthii_ex_Euryops_DQ205330, 5 Podosphaera_xanthii_ex_Coreopsis_EF442023, 6 Podosphaera_xanthii_ex_Gynostemma_D84378, 7 Podosphaera_xanthii_ex_Verbena_AB046985, 8 Podosphaera_xanthii_ex_Vigna_AB040297, 9 Podosphaera_xanthii_ex_Cucurbita_AB040315, 10 Podosphaera_xanthii_ex_Cucumis_AB040323, 11 Podosphaera_sp._ex_Saintpaulia_AB040338, 12 Podosphaera_xanthii_ex_Zinnia_AB040354, 13 Podosphaera_euphorbiae_hirtae_ex_Acalypha_AB040306, 14 Podosphaera_sp._ex_Hibiscus_AB040308, 15 Podosphaera_sp._ex_Dunbaria_AB040334, 16 Podosphaera_xanthii_ex_Rudbeckia_AB040296, 17 Podosphaera_xanthii_ex_Petasites_AB040307, 18 Podosphaera_sp._ex_Cayratia_AB026151, 19 Podosphaera_xanthii_ex_Lactuca_AB040294, 20 Podosphaera_pseudofusca_ex_Fatoua_AB040320, 21 Podosphaera_sp._ex_Verbena_AB040347, 22 Podosphaera_xanthii_ex_Lactuca_AB040352, 23 Podosphaera_xanthii_ex_Cosmos_AB040300, 24 Podosphaera_xanthii_ex_Carthamus_AB040298, 25 Podosphaera_xanthii_ex_Parasenecio_hastatus_AB040314, 26 Podosphaera_xanthii_ex_Calendula_AB040317, 27 Podosphaera_xanthii_ex_Farfugium_AB040346, 28 Podosphaera_sp._ex_Peristrophe_AB026135, 29 Podosphaera_astericola_ex_Aster_AB040335, 30 Podosphaera_astericola_ex_Aster_AB040353, 31 Podosphaera_erigerontis_canadensis_ex_Taraxacum_AB046987, 32 Podosphaera_intermedia_ex_Clerodendrum_AB026145, 33 Podosphaera_elsholtziae_ex_Ajuga_AB026142, 34 Podosphaera_phtheirospermi_ex_Melampyrum_AB040332, 35 Podosphaera_tridactyla_ex_Padus_AY833652, 36 Podosphaera_tridactyla_ex_Prunus_armeniaca_AY833657, 37 Podosphaera_tridactyla_ex_Prunus_cerasifera_AY833658, 38 Podosphaera_tridactyla_ex_Prunus_sp._AY833659, 39 Podosphaera_tridactyla_ex_Cerasus_leveilleana_MUMH274, 40 Podosphaera_tridactyla_ex_Microcerasus_AB000943, 41 Podosphaera_longiseta_ex_Padus_AB000945, 42 Podosphaera_sp._ex_Cerasus_AB026138, 43 Podosphaera_clandestina_ex_Crataegus_AB525931, 44 Podosphaera_clandestina_ex_Crataegus_AB525930, 45 Podosphaera_leucotricha_ex_Molus_AF073353, 46 Podosphaera_leucotricha_ex_Molus_AB027231, 47 Podosphaera_sp._ex_Photinia_AB525934, 48 Podosphaera_photiniae_ex_Photinia_AB026147, 49 Podosphaera_curvispora_ex_Aria_alnifolia_AB525928, 50 Cystotheca_wrightii_ex_Quercus_AB000932, 51 Cystotheca_lanestris_ex_Quercus_AB000933; TREE Fig._2 = [&R] (((((((((1,2,3,(((6,7,8,9,10,11,12),13,14,15),16,17),18,19,20,21,22),4,5,(23,24,25),26,27,28),(29,30)),31,33,34),32),((36,37),(38,39,42))),((35,40),41)),(((43,44),((45,46,47),49)),48)),(50,51)); END;