#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:33 GMT TreeBASE (cc) 1994-2008 Study reference: Barker F.K. 2014. Mitogenomic data resolve basal relationships among passeriform and passeridan birds. Molecular Phylogenetics and Evolution, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S15907] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=125; TAXLABELS Acanthisitta_chloris_AY325307 Acridotheres_cristatellus_NC_015613 Acrocephalus_scirpaceus_NC_010227 Agelaius_phoeniceus Agelaius_phoeniceus_JX516062 Alauda_arvensis_NC_020425 Amblyramphus_holosericeus_JX516063 Bombycilla_cedrorum Bucanetes_mongolicus Campylorhynchus_zonatus_KF509924 Cardinalis_cardinalis Carduelis_pinus Carduelis_psaltria Carduelis_sinica Carduelis_sinica_NC_015196 Carduelis_spinus_NC_015198 Carpodacus_cassinii Carpodacus_erythrinus Carpodacus_mexicanus Carpodacus_roseus Chlorophanes_spiza Chrysomus_cyanopus_JX516076 Chrysomus_icterocephalus_JX516060 Chrysomus_ruficapillus_JX516056 Chrysomus_thilius_JX516069 Chrysomus_xanthophthalmus_JX516059 Cnemotriccus_fuscatus_NC_007975 Coccothraustes_coccothraustes Coccothraustes_vespertinus Corvus_frugilegus_NC_002069 Curaeus_curaeus_JX516070 Cyanopica_cyanus_NC_015824 Cyanoptila_cyanomelana_NC_015232 Dives_dives_JX516061 Emberiza_chrysophrys_NC_015233 Emberiza_tristrami_NC_015234 Eopsaltria_australis_NC_019665 Epthianura_albifrons_NC_019664 Euphagus_cyanocephalus_JX516072 Ficedula_zanthopygia_NC_015802 Fringilla_coelebs Garrulax_canorus_NC_020429 Garrulus_glandarius_NC_015810 Gnorimopsar_chopi_JX516055 Gracula_religiosa_NC_015898 Gymnomystax_mexicanus_JX516075 Hemignathus_flavus Hemignathus_stejnegeri Hemignathus_virens Hemignathus_virens_wilsoni Himatione_sanguinea Hyliota_flavigaster Icterus_mesomelas_JX516068 Lampropsar_tanagrinus_JX516057 Lanius_tephronotus_JX486029 Leiothrix_argentauris_NC_015114 Leiothrix_lutea_NC_020427 Lepidothrix_coronata Leucosticte_arctoa Leucosticte_brandti Loxia_curvirostra Loxops_caeruleirostris Luscinia_calliope_NC_015074 Macroagelaius_imthurni_JX516073 Magumma_parva Malurus_melanocephalus Melamprosops_phaeosoma Menura_novaehollandiae_NC_007883 Molothrus_aeneus_JX516067 Molothrus_badius_JX516074 Nesopsar_nigerrimus_JX516054 Notiomystis_cincta Nucifraga_columbiana_KF509923 Oedistoma_iliolophum Oreomystis_bairdi Oreomystis_mana Oreopsar_bolivianus_JX516058 Oriolus_chinensis_NC_020424 Paroreomyza_montana Passer_domesticus Petroica_boodang_NC_019666 Petroica_goodenovii_NC_019667 Petroica_phoenicea_NC_019668 Pica_pica_NC_015200 Picathartes_gymnocephalus Pinicola_enucleator Podoces_hendersoni_NC_014879 Poecile_atricapilla Pseudoleistes_guirahuro_JX516071 Pseudoleistes_virescens_JX516066 Pseudonestor_xanthophrys Pseudopodoces_humilis_NC_014341 Pycnonotus_sinensis_NC_013838 Pycnonotus_taivanus_NC_013483 Pyrrhula_pyrrhula Regulus_calendula Scytalopus_magellanicus Serinus_albogularis Serinus_canaria Serinus_serinus Sitta_carolinensis Smithornis_sharpei_NC_000879 Sturnus_cineraceus_NC_015237 Sturnus_nigricollis_NC_020423 Sturnus_sericeus_NC_014455 Sturnus_tristis_NC_015195 Sylvia_atricapilla_NC_010228 Sylvia_crassirostris_NC_010229 Tachycineta_albilinea_NC_020601 Tachycineta_albiventer_NC_020602 Tachycineta_bicolor_NC_020596 Tachycineta_euchrysea_NC_020598 Tachycineta_leucorrhoa_NC_020603 Tachycineta_stolzmanni_NC_020600 Taeniopygia_guttata_NC_007897 Thamnophilus_nigrocinereus Thraupis_episcopus Tregellasia_leucops Turdus_migratorius Uragus_sibiricus Urocissa_erythrorhyncha_NC_020426 Vestiaria_coccinea Vidua_chalybeata_NC_000880 Vireo_olivaceus Xanthopsar_flavus_JX516065 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23765] TITLE 'Aligned Passerine Mitogenomes (tRNA-Phe to tRNA-Thr)'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=15392; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430 5440 5450 5460 5470 5480 5490 5500 5510 5520 5530 5540 5550 5560 5570 5580 5590 5600 5610 5620 5630 5640 5650 5660 5670 5680 5690 5700 5710 5720 5730 5740 5750 5760 5770 5780 5790 5800 5810 5820 5830 5840 5850 5860 5870 5880 5890 5900 5910 5920 5930 5940 5950 5960 5970 5980 5990 6000 6010 6020 6030 6040 6050 6060 6070 6080 6090 6100 6110 6120 6130 6140 6150 6160 6170 6180 6190 6200 6210 6220 6230 6240 6250 6260 6270 6280 6290 6300 6310 6320 6330 6340 6350 6360 6370 6380 6390 6400 6410 6420 6430 6440 6450 6460 6470 6480 6490 6500 6510 6520 6530 6540 6550 6560 6570 6580 6590 6600 6610 6620 6630 6640 6650 6660 6670 6680 6690 6700 6710 6720 6730 6740 6750 6760 6770 6780 6790 6800 6810 6820 6830 6840 6850 6860 6870 6880 6890 6900 6910 6920 6930 6940 6950 6960 6970 6980 6990 7000 7010 7020 7030 7040 7050 7060 7070 7080 7090 7100 7110 7120 7130 7140 7150 7160 7170 7180 7190 7200 7210 7220 7230 7240 7250 7260 7270 7280 7290 7300 7310 7320 7330 7340 7350 7360 7370 7380 7390 7400 7410 7420 7430 7440 7450 7460 7470 7480 7490 7500 7510 7520 7530 7540 7550 7560 7570 7580 7590 7600 7610 7620 7630 7640 7650 7660 7670 7680 7690 7700 7710 7720 7730 7740 7750 7760 7770 7780 7790 7800 7810 7820 7830 7840 7850 7860 7870 7880 7890 7900 7910 7920 7930 7940 7950 7960 7970 7980 7990 8000 8010 8020 8030 8040 8050 8060 8070 8080 8090 8100 8110 8120 8130 8140 8150 8160 8170 8180 8190 8200 8210 8220 8230 8240 8250 8260 8270 8280 8290 8300 8310 8320 8330 8340 8350 8360 8370 8380 8390 8400 8410 8420 8430 8440 8450 8460 8470 8480 8490 8500 8510 8520 8530 8540 8550 8560 8570 8580 8590 8600 8610 8620 8630 8640 8650 8660 8670 8680 8690 8700 8710 8720 8730 8740 8750 8760 8770 8780 8790 8800 8810 8820 8830 8840 8850 8860 8870 8880 8890 8900 8910 8920 8930 8940 8950 8960 8970 8980 8990 9000 9010 9020 9030 9040 9050 9060 9070 9080 9090 9100 9110 9120 9130 9140 9150 9160 9170 9180 9190 9200 9210 9220 9230 9240 9250 9260 9270 9280 9290 9300 9310 9320 9330 9340 9350 9360 9370 9380 9390 9400 9410 9420 9430 9440 9450 9460 9470 9480 9490 9500 9510 9520 9530 9540 9550 9560 9570 9580 9590 9600 9610 9620 9630 9640 9650 9660 9670 9680 9690 9700 9710 9720 9730 9740 9750 9760 9770 9780 9790 9800 9810 9820 9830 9840 9850 9860 9870 9880 9890 9900 9910 9920 9930 9940 9950 9960 9970 9980 9990 10000 10010 10020 10030 10040 10050 10060 10070 10080 10090 10100 10110 10120 10130 10140 10150 10160 10170 10180 10190 10200 10210 10220 10230 10240 10250 10260 10270 10280 10290 10300 10310 10320 10330 10340 10350 10360 10370 10380 10390 10400 10410 10420 10430 10440 10450 10460 10470 10480 10490 10500 10510 10520 10530 10540 10550 10560 10570 10580 10590 10600 10610 10620 10630 10640 10650 10660 10670 10680 10690 10700 10710 10720 10730 10740 10750 10760 10770 10780 10790 10800 10810 10820 10830 10840 10850 10860 10870 10880 10890 10900 10910 10920 10930 10940 10950 10960 10970 10980 10990 11000 11010 11020 11030 11040 11050 11060 11070 11080 11090 11100 11110 11120 11130 11140 11150 11160 11170 11180 11190 11200 11210 11220 11230 11240 11250 11260 11270 11280 11290 11300 11310 11320 11330 11340 11350 11360 11370 11380 11390 11400 11410 11420 11430 11440 11450 11460 11470 11480 11490 11500 11510 11520 11530 11540 11550 11560 11570 11580 11590 11600 11610 11620 11630 11640 11650 11660 11670 11680 11690 11700 11710 11720 11730 11740 11750 11760 11770 11780 11790 11800 11810 11820 11830 11840 11850 11860 11870 11880 11890 11900 11910 11920 11930 11940 11950 11960 11970 11980 11990 12000 12010 12020 12030 12040 12050 12060 12070 12080 12090 12100 12110 12120 12130 12140 12150 12160 12170 12180 12190 12200 12210 12220 12230 12240 12250 12260 12270 12280 12290 12300 12310 12320 12330 12340 12350 12360 12370 12380 12390 12400 12410 12420 12430 12440 12450 12460 12470 12480 12490 12500 12510 12520 12530 12540 12550 12560 12570 12580 12590 12600 12610 12620 12630 12640 12650 12660 12670 12680 12690 12700 12710 12720 12730 12740 12750 12760 12770 12780 12790 12800 12810 12820 12830 12840 12850 12860 12870 12880 12890 12900 12910 12920 12930 12940 12950 12960 12970 12980 12990 13000 13010 13020 13030 13040 13050 13060 13070 13080 13090 13100 13110 13120 13130 13140 13150 13160 13170 13180 13190 13200 13210 13220 13230 13240 13250 13260 13270 13280 13290 13300 13310 13320 13330 13340 13350 13360 13370 13380 13390 13400 13410 13420 13430 13440 13450 13460 13470 13480 13490 13500 13510 13520 13530 13540 13550 13560 13570 13580 13590 13600 13610 13620 13630 13640 13650 13660 13670 13680 13690 13700 13710 13720 13730 13740 13750 13760 13770 13780 13790 13800 13810 13820 13830 13840 13850 13860 13870 13880 13890 13900 13910 13920 13930 13940 13950 13960 13970 13980 13990 14000 14010 14020 14030 14040 14050 14060 14070 14080 14090 14100 14110 14120 14130 14140 14150 14160 14170 14180 14190 14200 14210 14220 14230 14240 14250 14260 14270 14280 14290 14300 14310 14320 14330 14340 14350 14360 14370 14380 14390 14400 14410 14420 14430 14440 14450 14460 14470 14480 14490 14500 14510 14520 14530 14540 14550 14560 14570 14580 14590 14600 14610 14620 14630 14640 14650 14660 14670 14680 14690 14700 14710 14720 14730 14740 14750 14760 14770 14780 14790 14800 14810 14820 14830 14840 14850 14860 14870 14880 14890 14900 14910 14920 14930 14940 14950 14960 14970 14980 14990 15000 15010 15020 15030 15040 15050 15060 15070 15080 15090 15100 15110 15120 15130 15140 15150 15160 15170 15180 15190 15200 15210 15220 15230 15240 15250 15260 15270 15280 15290 15300 15310 15320 15330 15340 15350 15360 15370 15380 15390 15400 15410 15420 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acanthisitta_chloris_AY325307 --------------------------------------------------C--CACA-TGAACCC-AAGGAC--AAAAGACTCAGTCCTAACCTTATAGTTAGTTTCTGCTAGATATATACATGCAAGTATCCGCACTCCAGTG-TAAATGCCCTCTAAC-CCCCTTACCA-------AGGCAATTAGGAGCAGGTATCAGGCGCA--CTAAACCCCC-----CTGTAGCCCAAGACACCTTGC-TCAGCCAC{AT}CCCCCACGGGTATTCAGCAGTAATTGACATTAAGCAATAAGTGAAAACTTGACTTAGTCATAGC{AG}{AG}CCCCATTTAGGGTTGGTAAATCTTGTGCCAGCCA{AC}CGCGGTCATACAAGAAACCCAAATTAACTTTT--A----TGCGGCGTAAAGAGTGGC{CT}CCAGTAATATCCCCAACAACTAAAATTAAAATACA{AC}CTAAGC{CT}GTCATAAGCCCAA{AG}ATGT-ACCTAAACCCCCT-----ACGAACATATTTTAGTCC--TAAGATTAACCACAA{CG}CCACGAAA{CG}CCAAGGCACAAACTGGGATTAGATACCCCACTATGCTTGGCCCTAAATCTTGATCCT-TCC---CCCACTGAAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCTCTAAACCCATCTAGAGGAGCCTGTTCTGTAATCGATAACCCACGATG-TACCTAACCCTCCCTCGC-CGA--AT--CAGCCTATATACCGCCGTCGCCAGTTCACCTTTA--CTGAAAGCCCAACAGTGAACACAATAG-TCCAG-GCCCACTAATAAGACAGGTCAAGGTATAGCCCATGGGAGG----------------------GA-AGAAATGGGCTACATTCTCTAAACTAGAGTA-T-----ACCGCAA-GGGACGTGAAATCTTCCCCAAAAGGCGGA-TTTAGCAGT-AAAGCGGAACAATAGTGTCCCCTTTAAACCGGCTCTAGAGCACGTACATACCGCCCGTCACCCTCCTCACAAG---------CTATCAGCCTACTAACTAATACACCAC-CA--AGCTAAAGATGAGGTAAGTCGTAACAAGGTAAGCGTACCGGAAGGTGCGCTTAGTCCA-CCGAGATGTAGCTATAAATA-AAAGCACTCAGCTTACGCCTGAAAGATACCTGCCT-CCCACAGGTCATCTCGA-AGCCAA-CTCTAGCCC--------AATG--ACA-TACAACCCACCTG---CTAACCAAAACTCACTTTCAACTA-GA-------AACTAAAACATT---TTCTCCTGA-CCTAGTATAGGCGATAGAAAAGTCCTACA-ATGGC-GCTATAGAGACTCACGTACCGTAAGGGAAAGATGAAATAATAATG-AACATAAC--CCAGCAA-ATAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGATTTAGCGAGAAC-ACCCAAGCAAAGTGC--ACTTAAGCTTGCCCCCCCGAAACTCGAGCGAGCTACTCTCAAGCAGCTATCCATTGAGCAAACCCGTCTCTGTCGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCCGAGTGATAGCTGGTTGCCTGTAAAATGAATTTAAGTTCCCCCCTGACCTTCCTCTACGGATGCTTAATCTAAACCTTAGCACGAAGC---AAGTCACGGGCTACTCAAAGGAGGTACAGCTCCTTTGAAAAAGAGTATATTCTCTCTCTAGTGGATA----------ATAACCCCCCCCCCCTTCCCCTGTAGGCCTTTAAGCAGCCAACAACAAAGAATGCGTCAAAGCTCCAT--ACAAAAAAATATAAA-AACCATAAGACTCCCTTCATGACTAACAGGCTAACCTATGCC--AATAGGAGAACTAATGCTAAAATGAGTAACTTGGGGGCACTACCCCCTCC----ATGGCGCGAGCTTACATTCCCC-CATTATTAACAAA--------CCACACAACTCATATCTTTAACCCCAG---ACAAGAA-GCGATATTA-AATACGTCTGTTAACCCCACTCA-GGAGCGCCCACC--AGAAAGACTAAAACCCGTAAAAGGAACTAGGCAAA-CCACCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCCAC-------TCAAGTATTGAAGGTGATGCCTGCCCAGTG--ACAT---T---GTTTAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCTCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACGGGTAGTCAGTGAAATTGATCTTCCTGTGCAAAAGCAGGAATAAACCCATAAGACGAGAAGACCCTGTGGAACTTAAAAATCAATGGCCACA---------CACATAAATCCCCCTCCTA--CTTAAGGTTTATTCAC-CCATTAATAA-T-GCTGGCC-TATA-TTTTTTGGTTGGGGCGACCCTGGAGAAAAAC-AAAACCTCCAG-AACTAGGACCACCCCTCTTAACCC-AGAGCAACCCCTCAACGTACTAACAGTAACCAGACCCAATAA--CATTGACCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCCCCTCCAAGAGCCCCCATCGACGAGGGGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGACG-GACTATCCCCAGTACGAAAGGACAGGGATAAGTGAAGCCAATGCTATAA-GCACGCCTCCTATACCAAGTAATGAACTCAACTAAACTACCAAAGAC-ACCCC-ACAAC-----CTA-CGTCCTAGAAAAGGA--CTAAGCTAGCGTGGCAGAGCTTG--GCAAATGCAAAAGGCTTAAGCCCTTTA-CCCAGAGGTTCAAATCCTCTCCCTAGCTACTCTTATAA----------ATGACGCAC----ATAAC----------TAACCCCCATATCCTAGCCAACCTCACCATATCCTTGTCCTACATTGCCCCAATCCTAATCGCTGTAGCCTTCCTGACACTGGTAGAACGAAAAATCCTAAGCTACATACAGGCCCGAAAAGGCCCAAATATTGTAGGCCCTTTCGGCCTACTACAACCCATAGCAGACGGAGTTAAACTTTTCATTAAAGAGCCAATTCGTC---------CATCCACCTCATCCCCCTACCTATTCATCACGACCCCAATCCTAGCCCTCATACTAGCAATCACAATTTGAGTCCCACTCCCCCTACCCTTCGCCCTCACTGACTTAAACTTGGGACTCCTATTCCTACTAGCCATATCTAGTCTAGCAGTATATTCAATCCTATGGTCGGGGTGGGCCTCAAATTCTAAATACGCCTTAATCGGAGCACTACGAGCAGTTGCCCAAACCATCTCTTACGAAGTAACACTAGCCATCATTCTTCTCTCTGTAATCATCCTAAGTGGCAATTACACCCTAAACACCCTTGCCATCACACAAGAGCCCCTGTACCTTATTTTCTCCTCTTGACCCCTTACAATAATATGATACATCTCAACCCTAGCTGAAACCAATCGCGCCCCGTTCGACCTCACAGAGGGAGAATCAGAGCTAGTTTCAGGGTTCAATGTAGAATACGCCGCCGGACCATTCGCACTTTTCTTTCTAGCCGAGTACGCAAACATTATACTAATAAACGCATTAACTGCCATCCTCTTCCTAAACCCAAGCTTCTTGAACCCCCCTAAAGAATTCTTCCCCATCATCCTTGCTACAAAAATCCTTCTTCTCTCTGCAGGGTTCTTGTGAATTCGTGCCTCATATCCACGATTTCGCTACGACCAGCTCATGCACCTACTCTGAAAAAATTTCCTCCCCCTGACACTGGCACTGTGCCTATGGCATATCAGCCTACCAATTTGCTACGCAGGCCTGCCT-----CCTTACCTA-A-----------------------GGAAATGTGCCTGAATACTA--AAGGGTCACTGTGATAAAGTGAACATAGAGGTACACCAGCCCTCTCATTTCCTAGTGGACC-------TTAGAAAAGTAGGAATTGAACCTACACATAAGGGATCAAAACCCTTCATACTCCCTTTATATTATTTCCT----------------AGTAAGGTCAGCTAATAAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACCCCTTCCCTCACTA-ATGAACCCCCAAGCAAAATTAATCTCCCTTACTAGCCTACTCCTAGGCACAACCATCACAATCTCCAGCAATCACTGAATAA---TGGCCTGAACCGGCCTAGAAATCAACACTCTTGCTATTCTCCCTCTCATTTCAAAATCCCACCACCCCCGAGCCATTGAGGCCACAATCAAATACTTCCTAGTACAAGCCTCTGCATCAGCACTAATTCTATTTTCTAGCACAATTAATGCTTGGACTACCGGCCAATGAGATATCACCCAACTAACCCACCCTCTAGCCTGCCTACTACTAACAACAGCAATTGCAATAAAACTAGGACTTGTCCCATTCCACTTCTGATTCCCAGAAGTCTTACAAGGCTCATCCCTGACCACTGCCCTCCTGCTCTCCACGGCCATGAAACTCCCTCCACTCGTTCTCCTCACCCTTTCACACCCATCACTCAACCCCCTACTACTAATCACCATGGCCGTTGCCTCAGCAGCCCTAGGGGGATGAATAGGACTAAACCAAACCCAAACTCGCAAAATCCTGGCTTTCTCCTCCATCTCCCATCTGGGGTGAATGGCTGCTATCA{CT}CGTCTTTAACCCAAAACTCTCACTATTAACTTTCTACCTGTACGCTTTAATAACCTCCTCTACATTCCTTACCCTTAACACAATAAAAACCCTCAAACTATCAACAATAATAACTGCATGGACAAAAACCCCTGCCCTAAGCATAACCCTCATGCTCACCCTCCTCTCCCTAGCAGGACTCCCCCCACTAACAGGCTTCCTCCCAAAATGAATAATTATCCAAGAGCTAACTAAACAAGAAATAACCCCTGCAGCCACAATCATAGCCCTCCTGTCCCTGTTAAGCCTATTTTTCTACCTCCGCCTGACATACTGCGCAACAATCACTCTGCCCCCAAACTCCGCAAATCACATAAAACAATGACGCATTAGCAAATCAACAAACCCCCTCCTCGCTCCCCTTCTAGCCCCGTCCATTATTCTACTTCCTCTCTCCCCCATAATCCCTGCAATTAC------CT-----AGAAACTTAG----GATCACCCCTAAACCGAAGGCCTTCAAAGCCTTAGACAAGAGTTTAACTCTCTTAGTTTCTGCTAAGACCCGCAGGATATTAACCTACATCTTCTAAATGCAACTCAGACACTTTAA-TTAAGCTAGAGTCTT--------ACCCCTAGGTAGATGGGCTTCGATCCCATAAAAC-TATAGTTAACAGCTAAATGCCTAAACC-AACTGGCTTCTACCT-AACACATCCGCCTTAGGCCCCAGTGCAAAT-TTAATGCACATCAATGAGCTTGCAACCCAACATGAACTTCACTATGGGGCC---GATAAGAAGAGGAATTAAACCTCTGTAAAAAGGACTACAGCCTAACGCCT-TTACACTCAGCCATC--------------TTACCAGTGACCTTCATTAATCGATGACTATTCTCCACCAACCACAAAGACATTGGCACACTTTACCTCATCTTCGGAGCATGAGCCGGAATGATCGGCACAGCCCTAAGCCTACTTATTCGAGCAGAACTAGGACAGCCTGGGACTCTACTAGGAGATGACCAAATTTATAATGTAATCGTTACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTCATACCAATTATAATCGGAGGATTTGGCAACTGACTAGTCCCCCTCATAATTGGCGCCCCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTGCTCCCCCCTTCCTTCCTGCTCTTACTCGCCTCCTCTACAGTAGAAGCTGGGGCTGGAACAGGGTGAACTGTCTACCCCCCTCTCGCCGGCAACCTAGCACACGCAGGAGCCTCAGTAGACCTGGCTATCTTCTCTCTTCACCTAGCAGGCATCTCCTCCATCCTCGGAGCAATTAACTTTATCACAACCGCCATTAACATAAAACCCCCAGCTCTTACACAGTACCAAACACCCTTATTTGTCTGATCTGTACTCATTACCGCCATCCTCTTACTATTGTCCCTTCCTGTCCTCGCCGCTGGCATCACAATATTACTCACAGACCGCAACCTAAACACTACATTCTTTGATCCTGCTGGAGGGGGAGACCCCATCCTGTACCAGCACCTATTCTGATTTTTCGGCCACCCAGAAGTCTACATCCTAATTCTCCCAGGATTCGGAATTATCTCCCACGTAGTAACCTACTACACAGGCAAAAAAGAGCCTTTTGGCTATATAGGAATGGTGTGAGCCATGCTCTCTATCGGATTCTTGGGCTTCATCGTCTGAGCACACCACATATTTACCGTGGGAATGGATGTAGATACCCGAGCTTATTTCACCTCCGCTACTATAATTATCGCTATTCCAACTGGAATTAAAGTCTTCAGCTGATTGGCTACACTGCACGGAGGGACAGTCAAGTGGGACCCTCCTATGCTATGAGCCCTAGGCTTTATCTTCTTATTCACTGTTGGAGGGCTAACAGGAATCGTACTAGCCAACTCTTCACTAGATATTGCCCTCCACGACACATACTACGTAGTAGCCCACTTCCATTATGTCCTCTCAATAGGGGCTGTTTTTGCAATTCTTGCAGGATTTACCCACTGATTCCCACTCTTTACAGGATATACCCTACACCCCACATGAGCCAAAGCCCATTTCGGAGCAATATTCGCTGGAGTCAACCTGACTTTCTTTCCACAACATTTCCTTGGCTTAGCAGGCATGCCACGACGATACTCAGACTACCCAGACGCTTACACTCTGTGAAACACCCTCTCCTCCATCGGCTCTCTTATCTCAATGACAGCAGTCATCATACTAATATTCATTATCTGAGAAGCCTTCGCATCAAAACGAAAAATCCAGCAACCAGCACTAACCAGCACCAACATTGAATGAATCCACGGTTGCCCACCCCCATACCACACCTTCGAGGAACCTGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAATCGAACCCTCAAATGATGGTTTCAAGCCAACCGC--AT-TAAACCCATTATGCTTCTTTCTT------TATGGAATGTTAGT-AAAACA-ATTACATAA-CCTTGTCAAGGTTAAATTATAGGTGAAACCCCCATACATCCCTA---CAC-----AATATGGCCAATCACTCACAATTTGGTTTTCAAGATGCCTCATCCCCTATCATAGAAGAACTAGTCGAATTCCACGACCACGCCCTAATAGTTGCACTAGCCATTTGCAGCTTGGTCCTTTATCTCCTAACTCTCATACTAGCAGAAAAATTGTCCTCAGACACTGTTGACGCCCAAGAAGTAGAACTAATCTGGACAATTCTACCTGCCATTGTCCTTATCATACTCGCACTCCCATCCCTACAAATCCTCTACATAATAGATGAGATCGACGAACCCGACCTGACTCTAAAAGCCATCGGCCATCAATGATACTGATCCTACGAATACACAGACTTTAAAGACTTGTCGTTTGACTCATACATAGTCCCCACAGCCGAGCTCCCACTAGGACATTTCCGCCTGCTAGAAGTAGACCACCGAGTTGTCATCCCCATAGAATCCCCCATCCGTATCATCGTCACTGCCGACGACGTCCTCCACTCATGAGCAGTACCAAGCCTGGGGGTAAAAACTGATGCAATCCCAGGGCGACTTAACCAAACATCATTCATCACTACTCGGCCCGGAATCTTCTACGGACAGTGCTCAGAAATCTGCGGGGCAAACCACAGTTATATGCCCATCGTAGTAGAATCCGCCCCCCTTACATATTTCGAGAGCTGATCCTCACTCC---TATCATCTT----------AATCGCTAAGAAGCTATGTACCAGCACTAGCCTTTTAAGCTAGAGAAAGAGGACT---GCCCCCTCCTTAGTGACATGCCACAACTAAACCCAAACCCATGATTCTTTATTATGCTCATTTCATGGCTAACCTTCTCACTCTTCATCCAACCAAAGCTTTTGTCATTTACCTCCCACAACCCCCCCTGCAACAAAG---ACTTCGCACCCACAAAAACCTCACCCTGACCCTGACCATGATCCTAAGCTTCTTTGACCAATTTGCAAGCCCATCCCTCCTAGGAATCCCTCTTGTCTTCTTAGCAACCCTATTCCCCGCCCTACTACTCCCAACACCAGACAATCGATGAATCTCCAACCGTCTGTCCACCCTCCAATCCTGACTCCTACTATCAGTTACAAAACAACTTATAATCCCACTAGATAAAAAAGGCCATAAATGAGCCCTGATCCTAATATCCCTATTAACCCTCCTACTCACAATCAACTTACTAGGCTTACTGCCTTATACATTCACTCCCACCACCCAACTATCAATAAACATAGCTCTAGCTTTCCCACTTTGACTCGCAACTCTACTCACAGGACTACGAAACCAACCATCAGCCTCTCTAGCCCACCTCCTCCCAGAAGGCACCCCCACCCCACTAATCCCAGCCCTGATCCTAATCGAAACTACTAGCCTACTCATTCGACCCCTGGCCTTGGGTGTTCGCTTAACAGCCAACCTCACAGCTGGCCACCTACTCATCCAACTAATCTCTACTGCTACCACTGTCTTATCTTTCACCATGCCCGCAGTATCCCTCCTAACCCTAACCGTCCTGCTCCTACTTACAATCCTAGAAGTGGCCGTAGCCCTAATTCAAGCCTACGTCTTTGTCCTTCTATTAAGCCTCTACCTCCAAGAAAACATCT-------------AATGGCCCACCAAGCACACTCATACCACCTTGTAGACCCCAGCCCATGGCCCATTTTTGGCGCCGCCGCCGCCCTACTCACCGCCTCAGGCTTAGTCATATGATTCCACCACAGCTCCCCGCAACTCCTAGGCCTAGGACTTCTTTCCACAGCACTAGTCATATACCAATGATGGCGGGACATTGTACGCGAAAGCACCTTCCAAGGCCACCACACTCCAACCGTACAAAAAGGCCTACGTTACGGCATAATCCTGTTTATCACATCAGAGGCATTCTTCTTCCTAGGGTTCTTCTGAGCATTCTTCCACTCCAGCCTAGTCCCAACCCCAGAGTTGGGCGGACAATGACCACCAACAGGGATTAAGCCCCTCAACCCCCTGGAGGTCCCCCTACTAAACACTGCCATCCTCCTTGCCTCTGGCGTCACCGTCACATGAGCCCATCACAGCATTACAGAAGCCAACCGAAAACAGGCAGTCCAAGCCCTAACCATAACAGTACTTCTAGGTTTCTACTTTACAGCACTCCAAATAATAGAATACTACGAAGCCCCATTCTCTATTGCCGACGGAGTTTACGGATCAACCTTCTTCGTCGCTACAGGATTCCACGGACTCCATGTTATCATTGGGTCCTCCTTCCTACTAGTCTGCCTCCTACGATTAACTAAATTCCACTTCACACCAAACCACCACTTCGGCTTCGAAGCTGCAGCCTGATACTGGCACTTCGTAGATGTCATCTGATTGTTCCTCTACATAACTATCTACTGATGAGGGTCTTGCTTTTCTAGTATATCA-ATTACAATAGACTTCCAATCTTTAAAATCTGGTCTAACCCCAGAGAAAAGCAATC---AACATAATCCTATTCATACTCACCCTCTCTCTAGCCCTAAGCACTATTCTAACTGCAGTAAACTTCTGACTAGCCCAAACAAACCCAGACACAGAAAAACTATCTCCATACGAATGCGGCTTTGATCCCCTCGGATCTGCACGACTCCCATTTTCGATCCGATTCTTCCTAGTTGCAATCTTATTCCTCCTGTTCGACCTGGAAATTGCCCTCTTACTCCCCCTGCCATGAGCAACCCAACTCCACTCCCCCCTCACCACCCTAACCTGAACCTCCACTATCATCCTGCTACTCACCATTGGCCTTGCCTACGAATGAACACAAGGCGGCCTGGAGTGGGCCGAGTAAC------AAGAAAGTTAGTCTAGCCAAGACAGTTGATTTCGGCTCAACAGACCACAGCT--AACCCTGTGACTTTCTCTATGTCCCTCCTACACATAAGTTTCTACTCAGCTTTCACCCTAAGCATTCTAGGCCTAGCCTTCCACCGAACCCACCTAATCTCAGCCCTCCTATGCTTAGAAAGCATAATATTATCCCTATACATTACTCTGTCCATATGACCAGTCGAAACTCAAACTGCATCTTCCGCCCTAATACCAATTCTTATGCTGACATTCTCCGCTTGCGAAGCCGGCACCGGCCTGGCCCTATTAGTTGCCTCCGCCCGGTCCCATGGCTCAGACCACCTGCACACCCTAAATCTCCTACAATGCTAAAAATCATCCTCCCCACCCTAATGCTCCTCCCAACAGCCCTTCTCTCCCCACCCAAATACCTCTGAGCCAACACCACCCTACACAGCCTCCTTGTTGCCACTATCAGCCTGCAATGACTCCTGCCCACCTACTACCCAAATAAAGCCCTAACCCAGTGGACCGGGATTGATTCAATCTCCTCTCCCCTGCTGACTTTATCCTGCTGACTCCTCCCCCTTGTAATTATAGCAAGCCAAAACCACCTCCAACAAGAGCCACTAACACGCAAACGAATCTTCATCACAACCGTAATTCTAATCCAACCCTTCATCATTCTTGCTTTTTCCGCCTCAGAACTAGCGTTATTCTATATCTCATTTGAAGCAACCCTAATCCCCACTATAATTCTAATCACACGATGAGGAAGCCAACCAGAACGCTTAAGCGCAGGTATCTATCTATTATTCTACACCCTAATCAGCTCCCTCCCCCTATTAATTACAATCATGTACCTCCATGCCCAAGCCGGCACCCTCCACCTAACAATCATTAAACTCTCACCCCCTATATCTACCACCTCATGAACAAACCTACTATCAAGCCTCGCCCTCCTCATTGCCTTCATAGTCAAAGCCCCCCTGTACGGCCTGCACCTATGACTCCCCAAAGCCCACGTAGAGGCCCCAATTGCAGGATCAATGCTACTTGCCGCCCTGCTACTAAAGCTAGGAGGCTACGGCATCATACGAACTACCACCCTAATAACCCCACTACTAAACCACCTACACTACCCCTTCCTCGCCCTAGCCCTATGAGGAGCCCTAATAACAAGCTCCATTTGCCTGCGCCAAATCGACCTAAAATCAATAATCGCATATTCCTCTGTCAGCCACATAGGTTTAGTTATTGCCGCAACCATAATCCAAACTAACTGAGCATTCACAGGCGCAATAATCCTAATAATTTCACACGGCCTAACTTCCTCAATACTATTCTGCCTGGCCAACACAAACTATGAACGCACCCACAGCCGAATTTTACTCCTCGCACGAGGCCTACAATCCCTCCTCCCACTCATAGCAACTTGATGACTTCTAGCAAACCTTACCAACATAGCATTACCCCCAACTACCAATCTGATAGCAGAACTAACCATCATAATCGCCCTATTCAACTGATCACCATTCACACTTATTCTCACTGGCATTGCAACCCTACTTACCGCCTCATACACCTTATTTATACTCCTCGTAACCCAACGAGGCCCACTACCCGCCCACATCCAATCCCTCCAAAACTCAAACACACGAGAACACCTCCTAATAACCCTCCACATCCTCCCGCTACTCCTCCTAATCCTAAAACCAGAACTAATTTCAAGAACCCCTCGAT-GCAAGTATAGTTT--AA-ACCAAACATTAGACTGTGATCCTAAAAATAGAAGTTAGACTCTTCTTACCTGCCGAGGAG-AGGTC-CAACCAACAAGAACTGCTAACTCCTGCGTCTGAGCTTAA-ACCCTCAGTCTCCTCAAACTTTTAAAGGATAATAGTAATCCATTGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTAAAAGTACAATGGCCCTCCCACTAGCCCTCAACACCCTCCTGGCCCTTACAATAGTAACCATCCTTATCCCCATGTTCCTTCCTCTCCTCTCAAACACCTTCCAAAACACCCCAACCACAATCACTCGTACCATCAAAACCGCCTTTTTTATCAGCACTCTTCCTACACTCATTTTTATACACTCAAACATAGAAAGCATTACCTCGCACTGAGAATGAAAGTTCATCATAAACTTTAAAATCCCTATGTCCCTAAAAATAGACCAATACTCCATAACGTTCCTCCCCATCGCACTATTCGTAACCTGGTCCATCCTCCAATTCGCAACCTGGTACATAGCCTCAGAGCCTTTCATCACCAAATTCTTCTCCTACCTCTTAATCTTCCTAATTGCCATACTACTATTAACCCTTGCCAACAACCTATTCCTACTATTTATCGGATGAGAAGGCGTAGGAATCATATCCTTCCTTCTCATCGGCTGATGATACGGCCGAGCAGAAGCCAACACCTCCGCCCTCCAAGCCGTCCTCTATAACCGAATCGGAGATATCGGACTCATTCTCTGCATAGCCTGACTAGCCTCTTCAACAAACACCTGAGAAATCCAACAAGCCTGCTCCCAACCCCAAACACCCACACTACCCTTACTCGGCCTCATCCTAGCCGCCACGGGAAAATCCGCCCAATTTGGTCTCCACCCATGACTCCCAGCAGCCATAGAAGGACCCACCCCAGTCTCAGCCCTATTACATTCCAGCACAATAGTCGTAGCCGGAATTTTCCTACTTATCCGAACCCATCCAATACTATCCAACAACCCAATAACCCTCTCGCTATGTTTATGCCTTGGATCCCTCACCACACTATTTGCAGCCACATGTGCCCTCACACAAAACGACATCAAAAAAATCATCGCTTTCTCCACATCAAGCCAACTAGGACTGATAATAGTTACAATCGGATTAGACCTCCCACAACTAGCATTCCTTCACATTTCAACCCACGCCTTCTTCAAAGCAATACTATTCCTCTGCTCAGGATCCATCATTCACAACCTTAACGGAGAACAAGATGTTCGAAAAATAGGAGGACTACAAAAAGTACTCCCAACAACCACCGCATGCCTAACCATTGGGAACCTAGCCCTCATAGGCACCCCCTTCCTGGCAGGATTCTACTCAAAAGATCTCATTATTGAAAGCCTAAACACATCATACCTAAACACCTGAGCACTACTCCTAACACTATTAGCTACAGCATTCACAGCAACCTACAGCCTACGCATATCCCTCTTAGTCCAAACAGGCTTCACCCGCACCCTCCCCCTCTCCCCAGTGAATGAAAACAACCCAACAATCACCAAACCAATTATTCGCCTTGCCCTAGGCAGCATCACAGCTGGCCTATTAATCACCTCATACATCATCC---CCACAAAAACCCCTCCAATAACCATACCCACCTCCACAAAAATAGCCGCAATTGTTGTTACCACACTGGGCATCATCCTAGCATTAGAGCTATCCAAAATAGCCCACCACCTAACTACCCCCAAACAAACTCCCCTTACAAACTTCTCCCTAACCCTAGGCTACTTCAACCCCCTAACCCATCGACTCAACACCACAAACCTACTAACCGCCGGTCAAAAAATTGCCTCCCACCTAATCGACCTCTCCTGGTACAAAAAAGCTGGCCCCGAAGGACTCGCCCTATTACAACTAAAAGCCTCCAAAACTTCAACCAACCTGCACACAGGATTAATCAAGACCTACCTGGGATCCTTTGCCCTCACCATCCTCATCATTCTAC---TAAC-ACAAACCTAACCCCCCCC-CTCCAATGGCCCCAAACATCCGCAAACACCACCCCCTCCTAAAAATAGTCAACGACTCCCTAATCGACCTACCAACCCCCTCAAACATTTCAGCCTGATGAAATTTCGGCTCCCTCTTAGGGATCTGCCTCATAACACAAATCATCACAGGCCTGCTACTAGCAACCCACTACACAGCGGACACCTCCTTAGCCTTCGCATCCGTTGCACACACATGCCGAAACGTCCAATTCGGCTGATTAATCCGCAATCTCCATGCAAACGGAGCTTCATTCTTCTTTATCTGTATCTACCTACATATTGGACGAGGCCTCTATTACGGTTCCTACCTATATAAAGAAACCTGAAACACAGGAGTCATCCTATTACTCACCCTCATAGCAACCGCCTTTGTCGGCTATGTCCTTCCGTGAGGACAAATATCGTTCTGAGGAGCCACCGTCATCACCAACCTATTTTCAGCCATCCCCTACATCGGACAAACACTTGTAGAATGAGCCTGAGGCGGATTCTCAGTAGACAACCCCACCCTCACTCGATTCTTCGCCCTTCACTTCCTCCTCCCCTTTGCAATCTCAGGACTAGTATTCATTCACCTAACCTTCCTCCACGAAACAGGATCAAACAACCCCCTGGGCATCTCCTCAAACTGTGACAAAATCCCATTCCACCCATACTTCTCAACAAAAGACCTCCTAGGTTTCACAATCATATTTATTCCACTAATAACCCTAGCCCTATTCTCCCCTAACCTCTTAGGAGACCCAGAAAATTTCACCCCAGCAAACCCATTAGTCACACCCCCCCACATCAAACCAGAGTGGTACTTCCTATTTGCTTACGCCATCCTCCGATCCATCCCCAACAAACTAGGAGGCGTCCTTGCCCTCGCCGCCTCCATTCTAGTCCTCTTCCTCAGCCCCCTCCTACATAAATCAAAACAACGCACAATAACCTTCCGACCTATATCCCAACTACTATTCTGAATCCTAATCTCCAACCTCCTCATCCTCACATGAATCGGAAGCCAACCAGTTGAACATCCCTTCATCATCATTGGCCAACTGGCCTCCCTAACCTACTTCACAACCCTCCTTATCCTATTCCCCATTATCGGAGCCCTCGAAAACAAAATACTTAATCT----------CTAAAATC----------AACTCTAATAGTTTATAAAAAACATTGGTCTTGTAAACCAAAGACTGAAGACCCCACCTCTTCTTAGAGTT Acridotheres_cristatellus_NC_015613 GTCCTTGTAGCTTACAC-AAAGCATGACACTGAAGATGTCAAGACGGCTGA-CCACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTGTTGCTAGGTTTATACATGCGAGTATCCGCGCGCCAGTG-CAGACGCCCTGGACC-CCT------TACCCCAAAGGCAGATAGGAGCAGGTATCAGGCTCA---------CCTTT--ACTGTAGCCCAAAACGCCTGGCAATTGCCACGCCTCCACAGGTTCTCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAC-----TTAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGATTAAAAGGCAACTGAGCTGTCATAAGCCCAAGATGC-CCATAAGGCCTCCGTCCTCAAAGAAGATCTTAGAAC--AACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-CTA--TTTTACCTGAGCGTCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTATGTAATCGATGATCCACGATACTACCTGACCATTCCTTGC-CCA-GAA--CAGCCTATATACCGCCGTCGCCAGCCCACCTTTA--CTGACAGCCCAACAGTGAGCGCAATAGCCCCCA--CCCGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGCTAGAACA------CACGGCAAAGGGACTTGAAACAGTCTCTTGAAGGCGGA-TTTAGCAGT-AAAGAGAGACCATAGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCAAAGG-CG---AACCAACACCCACAT-ACCTAATAAGCTAT-CC--AGCCAAAGAGGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGAACA-CCAAGACGTAGC-TTTAATA-AAAGCATTCAGCTTACACCTGAAAGATGTCTGTTC-AAACCAGATCGTCTTGA-TGCCAGATTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--AC-CTA-AACCC----AACTAAAGCATT---C--ACCAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGAAGTG-AAACAAGT--CAAGCTA-TAAAAAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACCTGCGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGCTGGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC--AACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAGTACAATCTCCA-CGAGCGGATA----AAT--AAC----CTACACATA-CCTATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCAGT-AACTCAAAAATATAAT-AACTTTATGAATCCCT-CCCCACTAACGGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--AC-TCCCTCT----ACGACGCAAGCTTACATCCATA-CATTATTAACAAA-TACCCA-ATATACGA--CTAAT---------CCA---ACAAGCA-CAG-TATTA-ATCACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGCAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACCC-GAT---GTTTAACGGCCGCGGTATCCTGACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCAGGCAATCGGTGAAATTGATCTCCCTGTGCGAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTCAAAACCAGCGGCCACC--CCAAAA-TACATA----AA-CACCCA--C-T-GGGCTCACTTAT-ACACTAA-GC-C-ACTGGCC-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AGATCCTCCAA-AAATTAGACCATCCCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCAACCAGACCCAATAT--AATTGATCTATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACAGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCCATCTATGATG-AACTCTTCCCCGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTGATGAAGCCAACTTAATCACAAAAGGCTATCAC-ATTCC---A-CCA-CACCCTAGAAAAGGG--C-TAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TT--------------CCTCCT--C----ATGAC----------CAACCACCCAATGCTAATCAACCTCATCATAGCCCTCTCCTATGCCTTACCAATCCTAATTGCAGTAGCCTTCCTAACACTAGTAGAACGTAAAATCCTAAGCTACATGCAAGGACGAAAAGGCCCAAACATCGTAGGCCCTTTCGGCCTACTACAACCCCTGGCAGACGGAATCAAGCTATTCATCAAAGAACCTATCCGCC---------CGTCAACATCCTCCCCATTTCTATTCATAGCGACCCCCATACTAGCCCTCCTTCTCGCAATTTCCATCTGAACCCCACTCCCTATGCCCTTCCCCCTCGCAGACCTTAACCTCGGCCTGTTATTCCTAGTAACCATGTCTAGCCTAGCAGTGTACTCCATTCTCTGGTCAGGATGAGCCTCAAATTCAAAATACGCCCTGATTGGGGCCCTCCGGGCAGTAGCTCAGACCATCTCCTACGAAGTCACCCTAGCTATCATCCTTCTATCCGTCGTCCTACTAAGTGGGGACTACACCCTGGGCACCCCGGCAGTCACCCAAGAACCCCTATATCTAATCTTTGCCTGCTGACCCCTGGCTATAATATGATACGTCTCCACCCTAGCCGAGACAAACCGAGCCCCCTTTGACCTCACAGAGGGAGAATCCGAACTAGTCTCCGGGTTCAACGTAGAGTATGCAGCAGGGCCATTCGCCCTATTCTTCCTAGCTGAGTATGCCAACATCATACTAATAAATACACTAACCGCCCTCCTGTTCTTCAACCCAAGTGCCCTCAACCCTCCCCCAGAGCTATACCCCGTGATCCTAGCCACTAAAGTCCTGCTTCTATCCGCAGGCTTCCTATGGATCCGTGCCTCATACCCACGATTCCGCTACGACCAACTAATACACCTACTCTGAAAAAACTTCCTCCCCCTCACACTAGCCCTATGCCTGTGACACATCAGCTTACCAATCTCCTATGCAGGCCTACCC-----CCATACATAAG--GATGCA----------CTAAAGGAAATGTGCCTGAACGC-T--AAGGGTCACTATGATAAAGTGAACATAGAGGTACACCAATCCTCTCATTTCCTAA--AATC-------TTAGAAAAGCAGGAATTGAACCTGCACTAAAGGGATCAAAACCCTCCATACTTCCCTTATATTATTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTTGCCTCCAGCCTACTCCTAGGATCAGCTATCACAATCTCAAGCAACCACTGAATCA---TAGCCTGAACCGGACTTGAGATCAACACCCTAGCAATCCTACCACTAATTTCCAAGTCCCACCACCCTCGAGCCATTGAAGCCGCAACCAAATATTTTCTGGTACAAGCAGCTGCCTCCACCCTACTCCTATTCTCCAGCATGATTAACGCATGACACACAGGACAGTGGGATATTACCCAACTGACCTGCCCAACATCCTGCGTGATCCTAACCGCAGCTATTGCAATGAAACTAGGACTAGCCCCATTCCACTTCTGGTTCCCCGAAGTACTACAAGGCTGCTCCATTACCACCGGACTCCTCCTTTCCACAGCCATGAAATTCCCACCAATCACACTCCTCTATATGACCTCGCAGTCACTAAACCCCTCCATACTAGTCACCATGGCCCTCCTCTCCGCAGCCCTGGGAGGGTGAATAGGACTTAACCAAACTCAGACCCGAAAAATCCTAGCCTTCTCATCCATCTCCCACCTAGGTTGAATAGCCGTAATCATTGCCTACAGCCCTAAACTAGCCCTACTTAACTTCTACCTATACGTGGTAATAACCGCAGCTGTATTCCTCACCCTGAACACAATTAAAACTTTAAACCTATCTACACTAATAACTACATGAGCAAAAACCCCAGCTTTAAGCGCAATGCTAATGCTAACCCTACTCTCCTTAGCAGGCCTACCCCCTCTAACAGGATTCCTGCCCAAATGACTAATCATTCAAGAGCTAGTAGACCAAGAAATAGCCCCAACTGCTACAATCATCGCCCTCCTATCCCTACTGGGCCTATTCTTCTATCTCCGTCTAGCATACTGTGCAACAATCACACTTCCCCCACACACTACAAACCACATGAAACAGTGGTATACCAACAAACCAACCAACACCTCAGTCGCTATCCTAGTCACACTATCCATCGCCCTTCTACCCATCTCCCCAATACTACGCACTATTGT------CT----AAGAAACTTAG----GATCACTA--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAGATTCGCAGGACATTACCCTGCATCTTCTGAATGCAACTCAGACACTTTAA-TTAAGCTAGAACCTT-----AGGCACCCTAGACAGGTGGGCTTTGACCCCACGATTA-TATAGTTAACAGCTATATGCCTAAACC-AACTGGCTTCTATCT-A-------------AGACCCCGGCACACAA-CTAATGTGCATCGATGAGCTTGCAACTCACCATGAACTTCACTACGGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTACCCGATGATTATTCTCAACCAACCACAAAGATATCGGCACCCTCTACCTAATTTTCGGCGCATGGGCCGGAATGGTAGGCACCGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGCCAACCAGGCGCTCTACTAGGAGACGACCAAGTCTACAACGTAGTAGTTACAGCCCACGCCTTCGTAATAATTTTCTTTATGGTTATACCAATCATGATCGGAGGCTTCGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCTTACTACTTCTAGCCTCCTCTACAGTCGAAGCAGGAGTAGGGACAGGCTGAACAGTGTACCCCCCTCTAGCAGGCAACCTAGCCCACGCTGGAGCCTCAGTAGACCTGGCCATCTTCTCCCTGCACCTAGCTGGTATTTCCTCAATCCTAGGGGCTATCAACTTCATCACAACAGCAATCAACATAAAACCACCCGCCTTGTCACAATACCAAACTCCCCTATTCGTTTGATCCGTACTAATCACTGCAGTATTACTGCTCCTATCACTCCCCGTTCTTGCCGCTGGCATTACAATGCTCCTCACCGACCGCAACCTCAACACCACCTTCTTCGATCCTGCAGGAGGAGGAGACCCTGTACTATATCAACACCTCTTCTGATTCTTCGGCCACCCCGAAGTATACATTCTAATCCTCCCAGGATTCGGAATCATCTCCCACGTCGTAGCCTACTACGCAGGAAAAAAAGAGCCCTTCGGATATATAGGAATAGTATGAGCCATGCTATCCATTGGATTCTTAGGGTTCATCGTCTGAGCCCACCACATATTCACCGTGGGAATGGACGTAGACACTCGAGCATACTTTACCTCCGCTACAATAATCATTGCCATCCCAACAGGAATCAAAGTATTCAGCTGACTAGCAACCCTACACGGCGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGCTTTATCTTCCTATTCACCATCGGAGGCCTAACAGGAATCGTGCTAGCAAACTCCTCACTGGATATCGCCCTACACGACACCTACTACGTTGTAGCCCACTTCCACTACGTACTATCAATAGGAGCAGTATTCGCTATCCTAGCCGGATTCACTCACTGATTCCCCCTATTCACCGGGTACACCCTTCACTCCACATGAGCCAAAGCCCAATTCGGAGTAATGTTCGTAGGAGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCCACACCCTATGAAACACAATCTCCTCAGTAGGCTCACTAATCTCCCTAACAGCCGTAATCATACTAGTCTTCATCATCTGAGAAGCCTTCGCGTCAAAACGCAAAGCCTTCCAACCAGAACTAACAAGCACAAACGTTGAATGAATTCACGGCTGCCCGCCCCCATTCCATACCTTCGAAGAACCCGCCTTTGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---AT---AGAGGTGTTAGT-AAAGCT-ATTACATAG-CCTTGTCAAGGCTAAATCACAGGTGAAACCCCAGTACACCTCAC---CATTC--AACCATGGCCAACCACTCACAATTCGGTTTCCAAGACGCCTCATCACCTATCATAGAAGAACTTATGCAATTTCACGACCATGCCCTAATGGTAGCCCTAGCTATCTGTAGCCTGGTCCTCTACATCCTAACCCTGATACTTACAGAAAAACTATCATCAAGCTCCGTAGACGCCCAAGAAATCGAGCTTGTCTGAACAATCCTCCCAGCTGCAGTCCTAATCATACTAGCCCTTCCCTCCCTACGAATCCTATATATAATGGACGAAATTAACGAGCCAGACCTCACCCTAAAAGCCATTGGCCACCAATGATATTGAACCTACGAGTACACAGACCTCAAAGAACTAACATTTGACTCCTACATGGTCCCCACATCAGACCTACCACTAGGACACTTCCGCCTACTAGAAGTAGACCACCGAGTCATCGTACCAACAGAGTCTAAAGTTCGAGTCATCGTCACCGCGGACGACGTACTACACTCATGAGCCGTACCAAGCCTAGGAGTAAAAACCGACGCAATCCCCGGCCGACTCAATCAAACTGCCTTCCTCGCCTCCCGTCCTGGGGTATACTACGGACAGTGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATGCCAATCGTAGTTGAGTCCACCCCCCTCGCCAACTTCGAGAACTGATCCTCCCTAC---TTTCCTCCT----------AATCATTAAGAAGCTATGAAACAGCACTAGCCTTTTAAGCTAGAGACAGAGGGCT---CACCCCTCCTTAATGGTATGCCTCAACTAAACCCAAATCCCTGATTTTTTATCATGATCATTACATGACTCACCTTCACCCTAATCATCCAACCAAAGCTACTCTCATTCACCTCCACAAACCCCCCACATAGCAAAA---AGCCTAAAACCTCCAAAACAACCCCCTGAACCTGACCATGAACCTAAGCTTTTTCGACCAATTCTCAAGCCCATCCCTACTAGGAATCCCCCTAATCCTTATCTCCATAACATTCCCAGCCCTCCTACTTCCTTCCCCAGGCAACCGATGAATCACCAGCCGACTCTCCACATTACAACTATGATTCATCAACCTAGTTACAAAACAATTAATGATACCACTAGATAAAAAAGGCCACAAATGAGCCTTAATCCTCACCTCACTAATAATCTTCCTACTTCTAATCAACCTACTAGGCCTCCTACCGTACACATTCACACCAACCACCCAACTGTCCATAAACCTGGCCCTAGCCTTCCCCCTATGACTAGCCACACTCCTTACAGGCCTGCGAAACCAACCCTCCGCCTCCCTAGGCCACCTCCTGCCTGAAGGCACCCCCACACCCCTAATCCCAGCCCTAGTTTTAATCGAAACAACAAGCCTCCTCATCCGACCTCTAGCACTAGGCGTCCGCCTGACAGCCAACCTAACAGCAGGGCACCTCCTCATCCAACTCATCTCCACCGCCTCAACCGCCCTATTCTCAACAATACCAGCAGTGTCACTCCTAACCCTGCTTATCCTGTTACTACTAACCATCCTAGAAGTAGCAGTGGCCATAATCCAGGCCTACGTCTTCGTTCTACTACTAAGCCTCTACCTACAAGAAAACATCTAACAC------CCAATGGCACACCAAGCACACTCTTACCACATAGTAGACCCAAGCCCATGACCCATCTTAGGAGCAGCAGCCGCCCTCCTTACCACCTCAGGACTCACCATATGATTCCACTACAACTCCCCTCTGCTCCTTATCATCGGCCTAACCTCCACCCTCCTAGTCATGTTCCAATGATGACGGGACATCGTACGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTCCAAAAAGGCCTACGATACGGCATAGCCCTGTTCATTACATCAGAAGCATTCTTTTTCCTAGGCTTCTTCTGAGCCTTCTTCCATTCAAGCCTAGCCCCTACCCCAGAACTAGGAGGCCAATGACCACCCGTAGGAATTACGCCCCTAAATCCCATGGAAGTCCCCCTACTAAACACTGCCATCCTCCTAGCCTCGGGGGCCACCGTCACATGAGCCCACCATAGTATCACAGAAGCTAACCGAAAACAAGCTATCCATGCCCTTACCCTCACAGTCCTCCTAGGATTCTACTTCACCGCCCTACAAGCCATAGAGTACTACGAAGCCCCATTTACCATCGCTGACGGAGTATACGGCTCAACATTCTTCGTAACCACAGGATTCCACGGACTACACGTAATCATCGGATCCACATTCCTCCTAGTATGCTTACTACGTCTAGTCAAATACCACTTCACATCAAACCACCACTTCGGATTCGAAGCAGCAGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTCTATATCTCTATCTACTGATGAGGATCCTGCTCTTCTAGTATAATC-AATACAATCGACTTCCAATCCTTAGAATCTGGTTCAACCCCAGAGAAGAGCAATG---AACATAATCCTATTCATACTCATCGCATCTCTAACCCTGAGCATCCTACTAACCGCCTTAAACTTTTGACTAGCCCAAATAAACCCAGACTCAGAAAAACTCTCCCCATACGAGTGTGGATTCGACCCCCTTGGGTCTGCCCGACTCCCCTTTTCAGTACGATTCTTCCTAGTAGCAATCCTATTCCTCCTATTCGACCTGGAAATCGCCTTGCTACTACCCCTACCATGAGCAATGCAACTCCAATCCCCCACCACCACATTGACCTGAGCCTCAATCCTCATCCTTCTCCTAACACTGGGACTGGTCTATGAATGAAAGCAAGGCGGGCTGGAATGGGCAGAGTA-G------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGGCTCAACAAATTATAGTATTCACCCTATAACTTTCTTTATGTCTTACCTACACTTTAGCTTCTATGCGGCCTTCACCCTGAGCAGCCTAGGCTTGGCCTTCCACCGAACCCACCTAATCTCCGCCCTACTATGTCTGGAGAGCATAATACTATCACTATACGTAGCCCTAACCATATGGCCAATCCAAACACAGACACCGTCCGCCTCCATCCTGCCTATCATCATATTAACATTCTCCGCCTGCGAAGCAGGGACCGGATTAGCACTATTAGTCGCCTCCACCCGAACTCACGGCTCCGACCACTTACACAACTTTAACCTACTACAATGCTAAAAATCATCATCCCAACCATCATACTCCTACCCCTAGCCACCCTATCCCCACACAAACACCTATGAACCAACATCACAGCACATAGCCTATTGATCGCCACTGTCAGCCTGCAATGACTAGCCCCAACATACTACCCAGGCAAAACCCTAACTCCCTGAGCCTCCGTAGACCAAATCTCCTCCCCCCTGCTAGTACTATCCTGCTGACTACTCCCCCTCATAATCATAGCTAGCCAAAACCACCTAGAGCAAGAACCCCCTATCCGCAAACGCATCTTCGCCGTAACATTAGTTCTAGCTCAACCATTCCTCATTCTAGCCTTTTCAGCCTCAGAACTAATACTATTCTACATTGCATTCGAGGCCACCCTAATCCCAACCCTAATCCTCATCACACGATGAGGCAACCAGCCAGAACGCTTAAGCGCCGGCATCTACCTCCTGTTCTACACCCTAGCCAGCTCCCTTCCCCTATTAATTGCCATCATACACCTGCACAACCAAATCGGCACACTATACTTCCCCCTACTCAAACTATCCCACCCCACAACCCCAGCCTCCTGAACAGGACTAATATCAAGTCTTGCCCTGCTCCTTGCCTTCATAGTTAAAGCACCCTTGTACGGACTACATCTATGACTACCCAAAGCCCACGTAGAGGCCCCAATCGCTGGATCCATGCTACTAGCCGCCCTCCTGCTAAAACTAGGAGGATACGGCATTATACGCATAACCCTACTAGTAAACCCATCAACAAACAACCTACACTACCCATTCATCATCCTAGCCCTATGAGGAGCACTAATAACTAGCGCCATCTGCTTACGGCAAATTGATCTAAAATCACTGATCGCATACTCATCCGTCAGCCACATGGGCCTAGTCGTAGCTGCAACCATAATCCAAACTCAATGAGCGTTCTCAGGCGCAATAATCCTAATAATCTCCCACGGACTAACCTCCTCCATACTATTCTGCCTGGCCAACACCAACTACGAGCGAACCCACAGCCGCATCCTCCTACTCGCCCGAGGCCTCCAACCCCTCCTACCCCTCATAGCCTCCTGATGACTTCTAGCCAACCTGGCCAACATAGCCCTCCCCCCAACAACAAACCTCATAGCAGAGCTCACAATCGTAATTACTCTCTTCAACTGATCCCCCCTAACACTCATCCTCACGGGGGCCACGATCCTACTAACCGCCTCATACACCCTGCACATGCTCATAACCACTCAACGAGGCACTATCCCGTCCCACATCACATCAATTCAAAACTCCTCTACACGAGAGCATCTCCTCATAGCCCTACACACAATCCCCATAGGGCTATTGATCCTAAAACCTGAGCTCATCTCAGGAATCCCTATAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAAGCCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAGCAGGAACTGCTAACTCTCGCATCTGAGCCTAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGTCCTAAATACGTTCATACTACTAACCCTAACAACCCTCCTCACCCCAATCATCTTCCCACTTCTCTCAAACAGCCTAAAAAACACCCCTAACACCATCACAAGCACAGTAAAAACCTCATTCCTAGTTAGCCTAATCCCTATAACAATCTTCATTCACTCAGGAACAGAAAGCCTAACCTCCCTCTGAGAATGAAAATTCATCACAAACTTCAAAATCCCCATTAGCCTAAAAATAGACTTCTACTCCCTAACATTCTTCCCAATCGCCCTATTCGTATCCTGGTCGATCCTACAATTCGCAACATGATACATAGCGTCAGATCCATATATCACAAAATTCTTCATCTACCTCCTGTTCTTTCTAGTAGCGATACTCATCCTAATCATTGCCAACAACTTCTTCATCCTATTCATCGGCTGAGAAGGCGTAGGAATCATATCCTTCCTCCTAATCAGCTGATGACACGGACGGGCAGAGGCCAATACCGCAGCTCTGCAAGCCGTATTATACAATCGGATCGGGGACATCGGCCTCATTCTCTGCATAGCATGACTAGCCTCCACCATCAACACCTGAGAAATCCAACAAATCTCCTCCCCCTCCCAAGCCCCAACACTGCCCCTTCTGGGCCTAATCCTGGCCGCAACAGGCAAATCAGCCCAATTCGGCCTCCACCCATGGCTCCCCGCCGCTATAGAAGGACCCACCCCAGTCTCCGCCCTACTTCACTCAAGCACCATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCACTATTCAACAACAACCAAACCGCCCTAACCCTGTGCCTATGCCTAGGGGCCCTCTCTACCCTATTCGCAGCCACATGCGCCCTAACCCAAAACGACATTAAAAAAATCATCGCCTTCTCCACCTCAAGCCAACTAGGCCTGATGATAGTAACAATCGGATTAAACCTACCACAACTAGCTTTCCTACACATCTCAACACACGCATTCTTCAAAGCCATGCTATTCCTATGTTCAGGCTCCATCATTCACTGTCTAAACGGAGAGCAAGACATTCGAAAAATGGGAGGACTACAAAAAATGCTACCAACAACCACCTCATGCCTAACCATTGGTAACCTGGCCCTAATAGGCACACCATTCCTTGCAGGATTCTACTCAAAAGACCAAATCATCGAATGCCTAAACACATCCTACCTAAACGCCTGGGCCCTACTACTAACCCTACTAGCCACCTCCTTCACCGCAGTATATACAATCCGCATAACTGTGCTAGTACAAACCGGGTTCACCCGAATCCCTCCCCTAACCCCAATAAACGAAAACAACCCAGCAGTAGTCGCCCCAATCACCCGCCTAGCACTAGGAAGCATCACAGCCGGACTTATCATCACCTCCTTCATCATTC---CAATGAAAACCCCACCTACAACCATGCCCCTGTACATCAAAATAACCGCCATACTAGTCACAGTCCTAGGCATCCTACTAGCCCTGGAAATTTCAAAAATAGCACAAACCCTCATCCTAACAAAACAAGGCCCCTTTTCAAATTTCTCCACATCACTAGGCTACTTCAACCCCCTAATACACCGCTTCACCACAACCAACCTGCTAAGTGGAGGCCAAAACATCGCCTCTCACCTAATCGACCTCTCCTGATACAAAAAACTAGGACCAGAGGGGCTAGCCAACCTGCAACTAATAGCAACCAAAACCTCCACTACTCTCCACTCAGGACTAATCAAAGCCTACCTAGGAGCTTTTGCCCTCTCCATCCTCATCGCCTTAA---TATCCACATACAGAAC--CAACC-----AATGGCCCTCAATCTTCGTAAAAACCACCCACTACTCAAAACCATCAACGACGCTCTAATCGACCTACCCACACCATCAAACATCTCAGCCTGATGAAACTTCGGATCCCTTCTAGGCATTTGCCTCATCACACAAATCATCACTGGCCTCTTACTAGCCACACACTACACAGCAGACACTTCCCTAGCTTTCAACTCAGTAGCCCACATATGCCGAAACGTGCAGTTCGGCTGATTAATCCGAAACCTCCACGCAAACGGAGCATCATTCTTTTTCATCTGCATCTACCTACACATCGGACGAGGGTTCTACTACGGATCCTATCTCAACAAAGAGACCTGAAATGTAGGAGTAATCCTTCTACTAACACTAATAGCAACTGCCTTCGTAGGATACGTCCTGCCCTGAGGACAGATATCGTTCTGAGGGGCTACAGTAATCACCAACCTATTCTCAGCGATCCCCTACATCGGCCAAACACTCGTAGAATGGGCCTGAGGAGGATTCTCAGTAGACAACCCCACCCTAACCCGATTCTTCGCACTACACTTCCTACTCCCATTCCTAATCGTAGGACTAACCCTAGTACACTTAACTTTCCTCCACGAAACAGGGTCTAACAACCCACTAGGAATCCCCGCAGACTGCGATAAAATCCCCTTCCACCCATACTACTCCACAAAAGACATTCTAGGATTTGCACTAATAATCATCCTACTCGTCTCCCTAGCCCTATTCTCTCCCAACCTACTAGGAGACCCAGAAAACTTCACCCCAGCAAACCCCCTAGCTACACCACCCCACATCAAACCCGAATGATACTTCCTATTTGCATACGCCATTCTCCGATCAATTCCAAACAAACTAGGCGGAGTCCTAGCCCTAGCTGCCTCCGTATTAGTCCTATTCCTAATACCCCTACTCCACACCTCCAAACTACGTTCAATAACATTCCGACCCATCTCACAAGTCCTCTTCTGAACCCTAGTCGCCAACCTTCTAATCCTCACCTGAGTAGGGAGCCAACCTGTCGAACATCCATTCATTATCATCGGCCAACTAGCCTCGCTCTCCTACTTCACAATCATTCTAGTCCTATTCCCCCTCGCAGCTGTACTAGAGAACAAAATACTAAAACT----------ATA-ACC-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGGATCAATCCCTTCTTAGAGTT Acrocephalus_scirpaceus_NC_010227 GTCTTTGTAGCTTATAA-AAAGCATAACACTGAAGATGTTAAGATGGATGC--TACA-CGCACCC-AAAGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTGTTGCTAGATATATACATGCGAGTATCCGCACTCCAGTG-TAGATGCCCTAGGCACCCT---GATCAC-----AGGTCGATAGGAGCGGGTATCAGGCACA--C------CAC-A--ACCGTAGCCCAAGACGCCTTGCAATTGCCACACCCCCACGGGCATTCAGCAGTAATTAAGATTAAGCAATGAGTGCAAACTTGACTTAGTCATAGCAAT-C---TTAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATCAACTTTA--T----AACGGCGTAAAGGGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCCGTCGCAAGCCCAAGATGC-GTATAAGGCCTCC--ATTCAAAGAAGATCTTAGACT--AACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAA--CCTTACCGAAGCATCCGCCCGAGAACTACGAGCGCAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-GACCTGACCATTTCTTGC-CAA--AA--CAGCCTATATACCGCCGTCGCCAGCCCACCCACC--ATGAAGGACCAACAGTGGACGCAATAG-CCCCA-TCCCGCTAATACGACAGGTCAAGGTATAGCCTATGAAATG----------------------GG-AGCAATGGGCTACATTTTCTAGATTAGAACA-C----AACGGCAAAGGGACATGAAACAGTCCCTGGAAGGAGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGACACGTACATACCGCCCGTCACCCTCCTCAAAAG-CG---ACCCCCCCCCCCCATAAATTAATAAGTTAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGACA-CCAAGACGTAGC--TTAACA-AAAGCATCCAGCTTACACCTGAAAGATATCTACTA-ACAACAGATCGTCTTGA-TGCCAAATTCTAGCCC--------AACAC-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--CC-ACACCACTA----AACCAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATAATAGTG--AACAAGA--CAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTCTTGCATCATGGTCTAGCAAGAAA-AACCAAGCGAAACGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAC-TGTTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCCCTCTTAATTCTTCTCCAAGG-AAAT-TCATA-AACCCCA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA---------AGCAGACTTCCACAAA-ACTACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTGT-ACTTCAAAAATATACA-AACCATGCGACTCCCT-CCCCACTAACAGGCCAACCTAT-TACAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGGACT--CC--CCCTCT----TCGACGCAAGCTTACATCTGTA-CATTATTAACAAA--CCCCA-GTATACGA--CAAAT---------CCA---ACAAGCA-GAG-TATTA-ACCATT-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCAACAGACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACAT-GAC---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGGGACCCGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAGACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAATCAGCAACCACC--CTAACA-CACATA----CA-CGCCCA-ACAC-GGGCTCACTCAT----CTAAAGG-CCACTGGTT-AGCATTTTTTCGGTTGGGGCGACCTCGGAGCAAAAC-AAAACCTCCAA-ACATTGGACCACACCTCCAGACTA-AGAGCAACACCTCAAAGTACTAACAGTACCCAGATCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCAAGAGTCCATATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGCTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGACG-AGCTCTTCCCAGTACGAAAGGATAGGAA-AAGCAAGGCCAATACCACAG-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTACCAC-ACCCA---ATCTA-AATCCTAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTTACCGACCCACCGACCAG---------ATGGC----------CAACCACCCCCTACTAATCAGCCTAGTCATAGCACTATCCTATGCCCTCCCAATCCTAATCGCAGTGGCCTTCTTAACACTAGTAGAACGTAAGGTCTTGAGCTACATACAAGGCCGAAAAGGCCCAAACATCGTGGGACCATTCGGACTACTCCAACCCTTGGCAGACGGTGTCAAGCTATTTATTAAGGAACCCATCCGCC---------CATCAACATCCTCCCCCATCCTATTCATCACGACCCCCATGCTAGCCCTTCTCCTTGCCATCTCAATCTGAACCCCCCTGCCCCTACCATTCTCCCTCGCAGACCTAAATCTAGGCATTCTGTTTCTGCTGGCCATGTCAAGCTTAGCAGTATACTCAATCCTATGGTCAGGGTGGGCCTCCAACTCGAAATATGCCCTAATCGGAGCACTACGAGCAGTAGCCCAGACTATCTCCTACGAAGTCACCCTAGCAATTATCCTCCTATCCATCGTCCTACTTAGTGGCAATTACACGCTTAGTACCCTAGCAGTCACCCAAGAGCCCTTATACCTATTCTTCTCCTGCTGACCACTTGCTATGATGTGATACGTGTCCACGCTAGCCGAGACAAACCGAGCCCCCTTTGACCTAACAGAAGGGGAGTCAGAGCTAGTCTCAGGGTTCAACGTGGAATACGCAGCAGGACCCTTTGCCCTGTTTTTCCTAGCTGAATATGCCAACATCATACTCATAAACACACTGACAGCCATTCTATTCTTCAACCCAAGCCTATTTAACCTGCCTCAAGAACTATTCCCCGTAGTATTAGCCACCAAAGTCCTCTTCCTGTCAGCGGGCTTCCTATGAGTTCGTGCTTCATACCCACGATTTCGATACGACCAACTGATGCATCTCTTATGGAAAAACTTCCTACCGCTCACACTAGCCCTATGCCTATGACACACCAGCATGCCAATCTGCTACGCGGGAGTACCA-----CCCCACCTA-A--GAACCA----------CTCAAGGAAATGTGCCTGAGCAC-CCAAAGGGCCACTGTGATAAAGTGGACACAGAGGTATACTAGTCCTCTCATTTCCTTA--CAGT-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGAGATCAAAACCCTCCATACTCCCTTTATATTACTTTCT----------------AGCAAGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCTTCCCCTGCTA-ATGAACCCCCAGGCAAAACTAGTGTTCATCGCTAGCCTCTTTCTAGGGACAATAATTACAATCTCAAGCAATCATTGAATCA---CAGCTTGAACAGGACTTGAGATCAACACCCTCGCTGTTTTACCCCTAATCTCAAAATCCCACCACCCCCGAGCCATTGAGGCTGCAACCAAATACTTCTTAGCACAAGCAACCGCTTCTGCCCTGGTCCTATTCTCCAGCATAACCAATGCATGACACACTGGACAATGGGACATCACCCAACTAACTCACCCAGTATCATGCCTGCTTCTAACCTCGGCCATTGCAATAAAACTCGGACTGGTACCGTTTCACTTCTGATTCCCAGAGGTACTTCAAGGCACCAGCCTAACCACCGGCCTGCTGCTATCCACAGCCATAAAATTCCCACCAATCACACTACTCTTCATGACATCCGCATCATTAAACCCAACAGTACTCACCTGCATAGCCGTACTATCTGCGGCCCTGGGCGGCTGAATGGGCCTAAACCAGACACAAATTCGAAAAATCCTAGCCTTCTCCTCCATCTCCCACCTAGGCTGAATAACCATTATTATCCCCTACAGCCCCAAACTCACCCTACTAAACTTCTACCTATACGCCCTAATAACTGCAGCCGTATTTCTCACTCTAAATTCAATAAAAGTATCAAAACTATCTACCTTAATGACAGCTTGGACAAAAATCCCCTCCCTAAACGCAATGCTTCTACTAACCCTGCTCTCCCTAGCAGGGCTTCCACCAATAACAGGATTCCTGCCAAAATGACTCATCATCCAGGAACTAACCAAACAAGACATGGCCCCCGCAGCGACAATGATCTCCCTACTATCCCTACTAAGCCTATTCTTCTACCTCCGCCTTGCGTACTGCACAACGATCACACTCCCACCACACACCACAAACCACATAAAACAATGACACACTAGCAAGGCAACCAGCACCCTAGTCGCCTCCCTAGTCACCATATCAATCACACTGCTCCCTATCTCCCCCATCATTTACATCATCGT------CT---AAAGAAACTTAG----GATTACCC--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAGACCCGCAGGATACTACCCTGCATCTCCTGAATGCAACCCAGACACTTTAA-TTAAGCTAGGGCCTT------------CTAGACAGATGGGCCTCGATCCCATAACAG-TATAGTTAACAGCTATATGCCCCAACC-AGCAGGCTTCTGCCT-AAC-----------AGGCTTCGGCGCACGG-CCAGTGCACATCAATGAGTTTGCAACTCACTATGAACTTCACTACAAAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTATGACATTCATCAACCGATGACTATTCTCAGCCAATCACAAAGACATCGGCACCTTATACCTAATCTTTGGTGCATGAGCCGGAATAGTAGGCACTGCCCTCAGCCTTCTCATTCGAGCGGAGCTAGGCCAACCCGGCGCCCTCTTGGGAGACGACCAGGTGTACAACGTGGTCGTCACAGCCCATGCATTTGTGATAATCTTCTTTATAGTTATGCCAATCATGATCGGAGGATTCGGAAACTGACTGGTGCCTCTAATAATTGGAGCCCCAGACATGGCATTCCCCCGAATAAACAACATGAGCTTCTGACTCCTACCACCCTCCTTCCTGCTACTGCTAGCCTCATCAACAGTCGAGGCGGGGGCAGGAACAGGCTGAACCGTATACCCTCCCCTGGCTGGCAACCTAGCCCACGCTGGAGCCTCAGTCGACCTAGCTATCTTCTCCCTCCACCTAGCGGGGATCTCATCAATCCTAGGGGCAATTAACTTCATCACAACAGCCATCAACATAAAACCACCTGCCCTGTCCCAATACCAAACCCCCCTATTTGTGTGATCAGTCTTAATCACCGCAGTACTACTCCTGCTATCTCTCCCAGTACTAGCTGCCGGCATCACAATGCTACTCACCGACCGAAACCTCAACACCACTTTCTTCGACCCTGCAGGAGGAGGGGACCCCGTACTCTACCAACACCTCTTCTGATTCTTCGGTCACCCAGAAGTATACATCCTAATCCTGCCCGGATTCGGAATCATCTCCCACGTAGTAGCCTACTACGCAGGAAAAAAAGAACCATTCGGCTATATAGGAATAGTATGGGCCATACTATCCATCGGATTCCTTGGGTTCATTGTATGAGCACATCACATGTTTACAGTAGGAATAGACGTGGACACCCGAGCATACTTCACATCCGCTACTATGATCATTGCCATCCCAACCGGAATCAAAGTATTTAGCTGACTAGCAACACTACACGGAGGAACAATCAAATGAGACCCGCCTATACTATGAGCCCTAGGGTTCATCTTCCTATTTACTATCGGAGGCCTAACAGGCATCGTACTAGCAAACTCTTCACTGGACATTGCCCTACACGACACCTATTACGTAGTAGCCCACTTCCACTACGTCCTGTCAATAGGAGCAGTCTTTGCGATCCTAGCAGGCTTCACCCACTGATTCCCACTATTCACAGGATATACCCTCCACTCCACATGGGCCAAAGCCCACTTTGGAGTAATATTCGTGGGCGTAAACCTCACTTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGATGCCTACACCCTGTGAAATACTGTCTCCTCAATCGGCTCATTAATCTCCATGGTGGCTGTAATCATGCTAATGTTCATAATCTGAGAAGCTTTCGCAGCCAAACGTAAAGCCCTACAACCAGAACTAACAAGCACTAACATCGAATGAATCCACGGCTGCCCACCACCATTCCACACCTTCGAGGAACCAGCCTTTGTTCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACCTATGCTTCTTTCTC---ATC-AAGGGGTGTTAGT-AAAACA-ATTACCTAG-CCTTGTCAAGACTAAATTACAGGTGAGAGCCCTGTACACCCC------------AACCATGGCCAACCACACACAACTAGGCTTCCAAGACGCTTCATCACCCATTATAGAAGAACTCACACAATTCCACGACCATGCCCTAATGGTCGCCCTAGCTATCTGTAGCTTGGTCCTATACCTCCTGGCCCTCATACTCACAGAAAAGCTATCATCCAACACAGTCGACGCACAAGCAATCGAGCTTGTCTGAACAATCCTCCCAGCCATCGTACTAATCACACTAGCCCTGCCATCCCTACGAATCCTCTACATAATGGACGAAATTAACGAACCAGACATCACCCTAAAAGCCATCGGCCATCAGTGATACTGAACCTACGAATACACTGACTTTAAAAACCTCACATTCGACTCATACATAACACCAACAACCGACCTACCACTAGGACACTTCCGACTGCTAGAAGTCGACCACCGTGTCATCGTACCAACAGAATCCACTATTCGAGTTATCGTTACTGCCGACGACGTCCTCCACTCATGAGCCGTGCCCAGCCTAGGCGTAAAAACTGACGCAATCCCAGGACGCCTCAACCAGACCTCATTCTTGGCCAACCGACCTGGGATCTTCTACGGACAATGCTCAGAAATTTGCGGAGCAAATCACAGTTTCATGCCTATCGTAGTGGAAGCAGCCCCGCTTGCTAACTTCGAGAACTGATCCTCCCTGT---TATCATCCT----------AACCGTTAAGAAGCTATGGAACAGCGCTAGCCTTTTAAGCTAGAGAAAGAGGACT--TCCCCCCTCCTTAATGGTATGCCCCAACTAAACCCAAATCCCTGATTTTTTATCATGCTCACTTCATGACTAACATTTTCCATAATCATCCAACCCAAACTCTTGACATTCGTATCAATAAACCCCCCATCCAACAAAATATCAACAACAACCCCAGACACCACCCCCTGAACTTGACCATGAACCTAAGCTTTTTCGACCAATTCTCAAGCCCCTCCATCCTAGGAATCCCCCTAATTTTAATTGCAACCACCTTCCCAGCCCTGCTACTGCCCTCCCTGGACAACCGATGAATTACCAATCGGCTGTCAACCTTACAACTATGATCCATCAACCTCATCACAAAACAACTAATAATCCCCCTAAACAAAAAAGGACACAAATGGGCCCTAATCCTAACCTCACTAATAATATTCCTGCTGCTCATCAACCTCCTAGGCTTACTGCCCTACACTTTCACACCAACCACCCAACTATCCATAAACCTAGCCCTCGCATTCCCACTATGACTAGCCACACTACTCACAGGCCTACGCAACCAACCCTCAGCCTCCCTGGGCCACCTCTTACCAGAAGGGACACCAACACCCCTAATCCCAGCCCTCATCCTCATCGAAACAACAAGCCTCCTCATCCGCCCACTAGCGCTAGGGGTGCGCCTCACGGCAAACCTGACAGCAGGACATCTTCTAATCCAACTCATCTCCACAGCCACCGTGGTCCTGTTCTCAACAATGCCAATAGTCCCCATTCTAACGCTACTAGTTCTTTTCTTACTAACTATTCTAGAAGTAGCTGTAGCCATAATCCAAGCTTACGTCTTCGTATTACTATTAAGCTTGTACCTTCAAGAAAACATCTAACCC------ACAATGGCTCACCAAGCACACTCTTATCATATAGTAGATCCAAGCCCATGACCTATTTTCGGAGCAGCCGCCGCCCTCCTCACTGCCTCCGGCCTAACCATATGATTCCACCTTAACACCCCATACCTATTAATGATAGGGCTACTGTCTACCGCCCTGGTTATGTTCCAATGATGACGTGATGTCATCCGAGAAAGCACCTTCCAGGGCCACCACACCCCCGCTGTTCAAAAAGGCCTACGATACGGCATGGTCCTGTTCATCACCTCAGAAGCCTTTTTCTTCCTAGGGTTCTTCTGAGCGTTCTTCCACTCAAGCCTAGCCCCCACTCCAGAGCTAGGGGGACAATGACCGCCCGTGGGAATTAAACCCTTAAACCCAATAGAGGTGCCCCTACTAAACACCGCCATCCTACTAGCCTCAGGAGTTACCGTCACATGAGCCCACCACAGCATCACAGAAGCCCACCGAAAACAGGCAATCCATGCTCTCACCCTAACCGTACTATTAGGGTTCTACTTCACCGCCCTCCAAGCTATAGAATACTACGAGGCCCCATTCTCCATTGCGGACGGAGTCTATGGCTCCACTTTCTTCGTAGCCACAGGATTCCACGGCCTCCACGTCATCATTGGCTCCACCTTCCTATTAGTATGCCTCGCGCGCCTAATCAAATACCACTTCACATCAAACCACCACTTCGGCTTCGAGGCAGCAGCCTGATACTGACACTTCGTAGACGTCGTCTGACTATTCCTCTACATTTCTATCTACTGATGAGGATCCTACTCTTCTAGTATATCA-ATTACAATCGACTTCCAATCCTTAAAGTCCGGTTTAAATCCGGAGAAGAGTAATA---AACATAGTCACATTCATAATCACCCTATCATTAGCCCTGAGCGTCGCCTTAACTGCACTAAACTTCTGACTGGCACAAATAACACCAGACCCAGAAAAGCTATCACCATACGAGTGCGGATTCGACCCCCTAGGATCCGCCCGATTGCCTTTCTCAATCCGATTCTTCCTAGTAGCCATCCTCTTCCTACTATTCGATCTAGAAATTGCCCTCCTGCTCCCCCTCCCATGAGCCATCCAACTACAAAGCCCCACCACCACACTAACATGAACCTTCATTCTCATCACACTACTAACCCTGGGACTCGTGTATGAATGAATCCAAGGCGGACTAGAATGGGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAAATTATAGTACTCACCCTATAACTTTCTTTATGACCCCCCTCCACTTAAGCTTCTACTCGGCCTTCACCCTAAGCGCACTAGGCCTAGCCTGCCACCGGACCCACCTAATCTCAGCCCTACTATGTTTGGAAAGCATAATACTATCCATATACGTCGCCCTATCAATATGACCCATCCAAACACAAGCACCATCCTCCACCCTCCTACCAATCCTCATACTCACATTCTCCGCCTGCGAAGCAGGAACAGGGCTAGCACTGCTAGTAGCCTCCACCCGCACTCACGGCTCTGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATTCCAACCATCATACTACTGCCCCTCACATTCCTATCCCCACGCAAACACCTGTGAACTAACATCACCGCACACAGCCTACTAATTGCCACCGCCAGCCTTCAATGACTAACACCAACATACTACCCCCACAAAGGACTGACCCCCTGAACTTCCATTGATCAAATCTCCGCTCCCCTATTAGTCCTGTCATGCTGGCTCCTCCCCCTCATGGTAATAGCAAGCCAGAACCACCTAGAACAAGAACCCACCATCCGCAAACGAATCTTCATCACAACGATAGTTCTAGCCCAGCCATTCATCCTGCTGGCCTTTTCAGCGTCCGAGCTGATGCTCTTTTATATCGCATTTGAAGCCACCCTAATCCCAACCCTAATCCTCATCACCCGATGAGGAAACCAACCAGAACGACTAAACGCAGGCATTTACCTCCTATTTTATACCCTTGCCAGCTCACTGCCCCTGCTAGTCGCCATCCTATACCTTCACAACCAAATTGGCACCTTATACCTCCCTATGCTCAAACTCTCTCACTCAACAATAACCACCTCATGAGCAGGTCTGATATCCAGCCTAGCCCTACTCGTGGCATTCATGGTCAAAGCACCCCTGTACGGCCTACATCTATGACTGCCTAAAGCCCACGTAGAAGCCCCAATCGCCGGATCTATACTACTAGCCGCCCTACTACTAAAACTAGGGGGGTACGGAATCATGCGAGTCACCATTTTAGTGAACCCATCACTAACTAACCTACACTACCCCTTCATTATCCTGGCATTATGAGGGGCACTAATAACTAGCGCCATTTGCCTACGACAAATCGACCTAAAATCCCTGATCGCCTACTCATCCGTCAGCCACATAGGCCTAGTCATTGCCGCCACCATAATCCAAACCCACTGAGCATTCTCAGGGGCAATAATCCTAATAATCTCACACGGCCTGACTTCCTCAATACTGTTCTGCCTAGCAAACACCAACTATGAACGCACCCACAGCCGAATTCTAATCCTCACACGTGGTATCCAACCCCTCCTACCGCTAATAGCTACCTGATGACTACTAGCAAACCTAACAAACATAGCACTACCACCGACAACCAACCTCATAGCAGAACTAACAATCATAATCGCCCTATTCAACTGATCTTCTCTGACAATCCTCCTAACAGGGACAGCAATCCTATTAACCGCTTCATACACCTTATACATACTAATAATAACACAACGAGGAGCCCTACCACCACACATTACATCAATCCAAAACTCCTCCACACGAGAACACCTGCTCATGTCCCTGCATATAATCCCTATAATCCTCCTCATCTTTAAGCCCGAACTAATCTCCGGCATCCCCCTAT-GCAAGCATAGTTT-CAA-CCCAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAAACCTTCTTGCCTGCCGAGGGAGAGGTT-AATCCGGCAAGAACTGCTAACTCTCGCACCTGAGTCTAA-AACCTCAGCTCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGTCCTAACCACCCTCATACTACTTACCCTAACAACCCTCACCACCCCCATCATTTTCCCCCTCCTATCGGATAACCTCAAAAACACCCCAACCACCATCACGGACACAGTAAAAATCTCTTTCCTGATTAGCCTAATTCCAATAGCTATCCACATCTACTCAGGAACAGAAAACCTGGTCTCCTTCTGAGAATGAAAATTCATTATAAACTTCAAAATCCCCTTGAGCCTAAAAATAGACTTCTACTCGCTTACATTCTTCCCAATCGCACTGTTCGTGTCATGATCAATCTTACAATTCGCAACATGATACATAGCCTCCGACCCTTACATTACAAAATTCTTCACCTACCTCCTACTATTCTTAATTGCAATACTAATCCTAATCGTCGCCAACAACCTATTCGTCCTATTCATCGGCTGAGAAGGAGTAGGAATCATATCCTTCTTGCTAATCAGCTGATGGCACGGACGAGCAGAAGCTAACACTGCCGCCCTTCAAGCCGTACTCTACAACCGAGTCGGAGACATTGGCTTAATCCTCTGCATAGCATGACTGGCCTACACCACAAACTCCTGAGAAATCCAACAACTCCCCTCCCCCCACCAAACCCCAACTCTCCCACTACTAGGCCTGATCCTAGCTGCAACAGGCAAATCGGCCCAATTCGGCCTACACCCCTGACTTCCCGCAGCTATAGAAGGCCCAACCCCAGTATCCGCCCTCCTGCACTCTAGCACAATAGTGGTCGCCGAAATCTTCCTATTAATCCGAACCCACCCACTCTTCAACAACAATCAAACTGCCCTGACCCTATGCCTCTGCCTCGGAGCCCTGTCCACACTATTTGCAGCTACGTGCGCCCTCACCCAAAACGACATCAAAAAAATTATTGCTTTCTCCACTTCAAGCCAGCTAGGCTTAATAATAGTTACTATTGGACTAAACCTACCACAACTAGCCTTCTTACACATCTCAACCCACGCATTCTTTAAAGCTATATTATTCCTATGTTCGGGATCCATTATCCACAGCCTAAACGGCGAACAAGACATTCGAAAAATAGGCGGACTCCAAAAAATACTGCCAACTACCACCTCATGCCTAACCATTGGAAACCTCGCCCTAATAGGAACACCATTCCTAGCCGGCTTCTATTCAAAAGACCAAATCATTGAAAGCCTAAACACCTCATACCTAAATACATGGGCCCTCATCCTCACCCTCCTAGCTACGTCCTTTACTGCAGTGTACACAATACGCATAACCACGCTAGTACAAACGGGCTTCACCCGAATCCCACCCCTCACCCCCATGAACGAAAACAACCCTGCAGTGACCTCCCCAATCACCCGACTAGCACTAGGAAGTATCACAGCAGGCTTTCTCATCACCTCTTATATCCCAC---CCTCAAAAACACCCCCAATAACCATGCCTCTCTCAATCAAACTCACAGCCCTAGTAGTGACAGCCCTGGGCATTGTGCTAGCACTAGAACTCTCAAAGATGGCCCAAACCCTGATTCTCACAAAGCAAGCCCCACTCTACAACTTCTCCGTCTCTCTAGGGTATTTCAACCCACTAGCACACCGTTTCAGCACAACAAACATGATAACCAAGAGCCAAAATATTGCCTCCCACCTCGTAGACCTGTCCTGACTCAAGCTCCTCGGACCAGAAGGACTGGCAAGCCTACAGCTGATAGCAGCCAAAGCTGCCACCACCATGCACTCCGGCCTAATCAAAGCCTACCTGGGATCCTTTGCCCTATCTATCCTCATTATCCTCA---TATCCGCACACAGAACA-CAACC-C---AATGGCCCTCAATCTTCGTAAAAACCACCCGCTAATAAAAATCGTCAACGACTCTCTAATCGACCTCCCCACCCCATCAAACATCTCAACTTGATGAAATTTTGGCTCACTACTAGGTATTTGCCTGATCACCCAAATCGTCACAGGACTTCTGCTAGCCATGCACTACACAGCAGACACCTCCCTAGCATTTGCCTCCGTCGCCCACGTATGCCGAGACGTACAATTTGGATGACTGATCCGCAACCTCCACGCAAACGGAGCCTCTTTCTTCTTCATTTGCATTTACTTCCACATCGGCCGAGGGTTTTACTACGGATCATACTTGAACAAAGAAACCTGAAACATCGGCGTCATCCTCCTACTAACCCTCATAGCAACTGCCTTCGTAGGATACGTCCTACCCTGAGGGCAGATATCATTCTGAGGAGCAACAGTAATCACAAACCTCTTCTCCGCCATCCCATACATCGGCCAAACACTAGTAGAATGAGCATGAGGAGGCTTTTCAGTAGACAACCCAACCCTAACCCGATTCTTTGCCATTCACTTCCTACTACCGTTCATTATCGCAGGCCTGACCCTAGTACACCTAACCCTACTACACGAAACAGGGTCAAACAACCCACTAGGAATCCCATCAGACTGCGACAAAATTCCATTCCACCCCTACTACTCCGTAAAAGACATTCTAGGGTTTGCACTCATATTCATCCTTCTTGCCTCCCTAGCCCTATTCTCACCCAACCTGCTAGGAGACCCAGAAAACTTCACGCCCGCCAACCCCCTAGCCACTCCCCCGCACATCAAACCCGAATGATACTTCCTATTTGCATATGCTATCCTACGATCCATCCCAAACAAACTAGGGGGAGTACTAGCACTTGCCGCCTCCGTTTTAGTTCTATTCCTCATGCCCCTCCTACACACATCCAAGCTGCGCTCAATGACATTCCGCCCTCTCTCCCAAATCCTATTCTGAGCCCTAGTAGCCAACCTCCTCGTACTCACCTGAGTAGGCAGCCAACCAGTCGAACATCCATTCATCATCATCGGACAACTGGCCTCACTCAGCTATTTCACAATCATCCTGGTCCTCTTCCCCCTGGCATCCATCTTTGAAAATAAACTCCTCAAACT----------ATA-ACT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Agelaius_phoeniceus GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--TAAA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCC-T-AA-TAT-----GGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ATCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T----TAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAGCAACTAAGCTGTCACAAGCCCAAGATGC-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-CACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCC--CTGAAAGCCCAACAGTGGGCGCAATAG-CCCCA-CCACGCTAACAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAAATTAGAACA-T-----ACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG----CCCCCTCCACCCATAAACTAATAAACTAT-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGCTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ATACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-T-A-AACTC----AACTAAAGCATT---C--ACCAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCC--GAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGGAAAAC-CCCCA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--ACTAA-CCC-CTTAAC-TGAATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATGTAAA-AACCTCATGACTCCCT-CCCCATTAACAGGCCAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-CTCCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATTA-AATACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CT-CACCCA--C-C-GGGTTTACTGAC-ACA-TAA-GA-C-TCTGGTT-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACTTCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TT-----CTCCCC--A----ATGAC----------CAACTACCCCCTCCTAATCAACCTCATTATAGCCCTCTCCTATATCCTGCCAATCCTAATTGCAGTAGCCTTCCTCACATTAGTAGAACGCAAAATCTTAAGCTACATACAAGGCCGAAAAGGCCCAAACATCGTTGGCCCATATGGACTGCTCCAACCCCTGGCAGACGGTGTCAAGCTATTCATCAAAGAACCCATCCGCC---------CATCAACATCTTCCCCAGTCTTATTCATTGCGACCCCAATCCTAGCTCTACTCCTAGCTCTCTCAATCTGAACCCCACTACCCCTCCCATTCTCTTTAGCAGACCTTAATCTAGGGTTACTTTTCTTATTAGCCATATCAAGCCTAGCCGTATACTCCATCCTATGATCAGGATGAGCCTCCAACTCCAAGTACGCCCTAATCGGAGCACTACGAGCGGTAGCCCAAACAATCTCCTATGAAGTGACCCTAGCTATCATTCTTCTCTCTGTAGTCCTCCTTAGCGGAAACTACACCCTGAACACTCTTGCAATTACCCAGGAACCCTTATACCTTATCTTCTCCTGCTGACCCCTTGCTATAATGTGATACGTCTCTACTCTGGCTGAGACCAACCGTGCCCCCTTTGATCTTACAGAAGGGGAGTCCGAACTGGTATCCGGATTCAACGTGGAATACGCAGCAGGTCCCTTTGCACTTTTCTTTCTAGCCGAATACGCCAATATTATACTCATAAATACATTAACCACAATCCTATTCTTTAACCCAAGCCTATTTAACCCCCCTCAAGAGCTATTCCCTGTCATTCTAGCCACAAAAGTCCTGCTTTTATCCGCAGGATTCCTATGAATTCGTGCCTCCTATCCACGATTCCGATACGACCAATTAATACACTTGCTATGAAAAAATTTCTTACCACTCACACTAGCCCTATGTCTTTGACACACCAGCATACCAATCTGCTACGCGGGCCTACCC-----CCTTACCTA-A--GG-CC-----------TTACTGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-T--TCAG-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTCCCTTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTTATCTTCGCCGCTAGTCTACTTCTAGGGACAACCATCACCATCTCAAGCAACCACTGGGAT?CATTAGCTTGAACCGGCCTTGAAATTAACACACTTGCCATCCTCCCATTAATCTCTAAATCACACCACCCACGAGCCATTGAAGCTGCCACTAAATACTTCTTAACCCAGGCAGCTGCCTCCGCCCTAGTTCTATTCGCCAGCATAACCAATGCATGACATACAGGACAATGAGACATCACTCAACTTACCCACCCAACATCCTGCCTGATCCTCACTTCAGCAATCGCAATAAAACTTGGACTAGTGCCATTCCACTTCTGATTCCCAGAAGTACTACAAGGCTCTCCCCTTACCACCGGTCTACTCCTATCTACTATCATAAAACTCCCCCCAATCACACTACTATACATAACCTCCCCTTCACTAAACCCTACGCTCTTAACCATCCTAGCCATCCTATCCGCAGCTCTCGGAGGCTGAATAGGCCTTAACCAAACACAGATCCGAAAAATCTTAGCCTTTTCCTCCATCTCTCACCTGGGCTGAATAGCAATCATTATCATCTACAACCCCAAACTCACACTTCTCAACT?CTACCTATACGCCATAATAACTGCAACCGTCTTCCTCACTCTAAATACAATTAAAGTACTAAAACTATCCACTCTAATAACCGCATGAACTAAA?T?CCATCTCTAAATGCAATACTGCTCCTGACCCTGCTCTCTCTTGCAGGACTGCCACCTCTAACAGGCTTCCTGCCCAAGTGACTCATCATCCAAGAACTAACTAAACA?GAAATGGCTCCAGCAGCCACACTCATCTCCCTTCTCTCCCTACTAAGCTTATTCTTCTACCTCCGACTAGCATATTGTACAACCATCACCCTCCCTCCACATACTACGAACCACATAAAACAGTGACGCACTAACAAACCAACTAACATCACAATCGCCATCCTAACCACTGTGTCCATCATACTCCTCCCCATCTCCCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCACTACCCTGCATCCCCTGAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-C--TAA-TCTTCTAGGCAGATGGGCTTTGATCCCATGATTC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGGCCCCGGCGCATGA-TCAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGGGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACTAATCACAAAGACATTGGTACCCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAAGTTTATAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATTATAATCGGAGGATTCGGAAACTGACTAGTTCCTCTAATAATCGGAGCCCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCACCATCATTTCTCCTCCTACTAGCATCCTCCACAGTTGAAGCAGGTGTAGGCACAGGCTGAACAGTGTACCCTCCACTAGCAGGCAACCTAGCTCACGCCGGAGCCTCAGTCGACCTTGCAATCTTCTCCCTACATCTAGCCGGTATCTCTTCAATCCTAGGGGCAATCAATTTTATTACAACAGCAATCAACATGAAACCCCCTGCCCTCTCACAATACCAAAC?CCCCTATTCGTTTGATCCGTACTGATCACTGCAGTCCTATTACTTCTATCTCTCCCAGTCCTCGCTGCAGGAATCACAATACTTCTCACAGACCGCAACCTTAACACCACATTCTTTGATCCTGCCGGAGGAGGAGACCCCGTACTATACCAACACTTGTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATCATCTCCCACGTTGTAGCCTACTATGCGGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTAGGCTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACTGGAATCAAAGTATTCAGCTGACTAGCTACACTCCACGGAGGCACAATCAAATGAGACCCACCAATATTATGAGCCCTAGGATTTATCTTCCTATTTACCATCGGAGGACTAACAGGAATCGTTTTAGCAAACTCCTCACTAGACATCGCCCTGCACGACACTTACTACGTAGTAGCCCACTTCCACTACGTACTATCCATAGGAGCAGTATTTGCAATCCTAGCAGGCTTCACCCACTGATTCCCCCTATTCACTGGATACACGCTACATTCAACATGAGCTAAAGCACATTTCGGCGTAATGTTTGTAGGTGTAAATCTAACCTTCTTCCCTCAACATTTCCTAGGCCTAGCTGGTATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAATACCATCTCCTCAGTAGGCTCACTAATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCTTACAACCAGAACTAACAAGCACTAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAGCCTGCCTTCGTTCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACCT--AAATATGGCCAACCACTCACAACTCAACTTCCAAGACGCCGCCTCACCTATTATAGAAGAACTAATAGGATTCCACGACCACGCCCTAATAATCGCACTAGCAATCTGCAGTCTCGTCCTTTACCTGCTAACCCACACTCTAACAGAAAAACTGTCATCAAGCACAGTCAACGCACAAGTAATCGAGCTGGTATGAACAATTCTCCCTGCCCTAGTCCTAGTCACACTAGCCCTACCATCTCTACGAATCCTTTACATGATGGATGAAATCAACGAACCCGACCTAACCTTAAAAGCCATCGGCCACCAATGATATTGAACCTACGAATACACCGACCTTAAAGACCTAACATTCGACTCCTACATAATCCCAACAGCAGACCTACCTCTAGGCCACTTCCGCCTACTAGAAGTCGACCATCGCGTTGTCGTCCCTATAAGCTCAACCATCCGAGTCATCGTCACTGCCGATGACGTCCTCCACTCATGAGCCGTCCCTAGCCTAGGTGTAAAAACCGATGCAATCCCAGGACGTCTCAACCAAACCTCCTTCTTCGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCAATCGTGGTAGAATCCACCCCACTCGCCAATTTCGAAAACTGATCCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCGTTAGCCTTTTAAGCTAAAGAAAGAGGGAC-CCTCCCCCTCCTTAATGATATGCCCCAACTAAACCCCAGCCCCTGATTTTTTATCATGCTTACTTCATGACTCACTTTCTCTCTAATTATTCAACCCAAACTTCTATCATTCGTATCAATAAATCCCCCATCTAACAAAC---CACCTGTCGCCCCAACCACTACTCCCTGAGCCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCCTTTCTAGGAATCCCACTAATCCTTATCTCTATAACATTCCCAGCCCTTCTCCTACCATCCCTTGACAACCGATGAATCACTAACCGGCTATCGACCCTTCAACTTTGATTCATCAATCTAGTTACAAAACAACTAATAATACCCTTAGACAAAAAAGGGCACAAATGAGCCCTAATCTTAACATCCCTTATAATCTTCCTCCTCCTCATTAACCTCCTAGGACTACTACCATATACATTCACCCCAACCACCCAACTGTCTATAAACTTGGCCCTAGCCTTCCCCCTATGACTAGCCACACTCCTGACAGGACTGCGAAACCAACCTTCTGCCTCACTAGGCCATCTCCTGCCAGAAGGCACACCCACCCCACTAATCCCAGCCCTAATTTTGATCGAAACAACAAGCCTTCTCATCCGCCCATTAGCACTAGGCGTGCGCTTAACAGCCAACCTGACAGCAGGTCACCTCCTCATTCAGCTCATCTCCACAGCCACAACAGCCCTATTCTCCACAATACCAGTAGTCTCACTCCTAACCTTCGTAGTCCTCTTCCTATTAACAATTCTAGAAGTAGCAGTAGCAATAATCCAGGCCTACGTCTTCGTCCTCCTACTAAGCCTTTACCTCCAAGAAAACATCTAATTC--CA----AATGGCACACCAAGCACATTCCTACCACATAGTCGATCCCAGCCCATGACCCATCCTAGGAGCAGCTGCCGCTCTCCTTACCACCTCAGGACTAACAATATGATTCCACTACAACTCCCCTCGACTCCTTATTCTAGGCCTACTATCAACCATTCTCGTCATATTCCAATGATGACGCGACATCGTACGAGAAAGCACATTCCAAGGCCACCACACCCCGACCGTACAAAAAGGATTACGATACGGAATAGCCCTATTTATCACATCAGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCTACACCAGAATTAGGGGGACAATGACCGCCCGTCGGAATTAAACCCCTCAACCCTATAGAAGTACCACTCCTAAACACTGCCATCCTCCTAGCCTCAGGAGTCACCGTCACATGAGCCCATCACAGCATCACAGAAGCCAACCGAAAACAGGCAATTCAAGCCCTATCCCTAACAGTTCTCCTAGGCTTCTACTTCACCGCCCTACAAGCCATAGAATACTATGAAGCCCCCTTTTCCATCGCTGACGGAGTTTACGGCTCAACATTCTTTGTTGCCACTGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCTTAATCAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCAGCCGCTTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAGTCCTATTCATACTAATCCTATCACTAACCCTAAGCATCCTACTAACCATACTGAACTTCTGACTTGCCCAAATAACCCCAGACCCAGAAAAACTATCCCCGTACGAATGCGGATTCGACCCCCTAGGATCTGCTCGACTCCCTTTCTCGATCCGCTTCTTCCTAGTAGCTATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTCCCACTACCATGAGCTATCCAACTACAATCCCCCACCACTACCCTAACCTGAACTGCCACACTCATCCTCCTACTCACCTTAGGTCTAGTGTACGAATGAATTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACGGTTGATTTCGACTCAACAAATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCAGCCTTCGCCCTAAGCAGCCTAGGCTTAGCCTTCCACCGAACCCATCTAATCTCTGCCCTGCTATGTTTAGAAAGCATGATACTATCCATATACGTCGCCCTAGCCATATGACCCATCCAAACCCAATCATCAGTATCCACTATCCTACCTATCCTCATACTAACTTTTTCCGCCTGCGAAGCAGGCACAGGCCTAGCACTACTAGTAGCCTCAACTCGCACCCACGGATCTGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCGCAACACTTCTCCCCCTAGCCCTACTATCCCCACGCAAACACCTATGAACCAACGTTACGCTATATAGCCTACTAATCGCCGCTGCCAGCCTCCAATGACTCACACCCACATACTACCCAAACAAAAGCCTAACCCCATGAACATCAATCGACCAAATCTCCTCTCCCCTACTAGTCCTCTCATGCTGGCTCCTTCCTCTAATGATCATAGCAAGCCAAAATCACCTAGAACAAGAACCCATCAATCGTAAACGAGTCTTCGCCTCAACATTAATCCTAGCCCAACTATCCATCCTCCTAGCCTTCTCAGCCTCCGAACTAATGCTCTTCTACATCGCATTCGAAGCCACCCTCATTCCCACGCTCATCCTCATCACACGATGAGGAAGCCAACCAGAACGCCTAAACGCTGGCATCTACCTCCTATTCTACACCCTCGCCAGCTCACTCCCACTATTAATTGCCATCCTACACCTACAAAACCAAATCGGCTCACTATACCTCCCAATACTCAAACTATCACACCCAACATTAAACTCCTCTTGATCCAGCCTAACTGCAAGCCTAGCCCTCCTACTAGCCTTCATGGTTAAAGCCCCCTTATACGGCTTACACCTATGACTGCCCAAAGCTCACGTAGAGGCCCCAATCGCCGGCTCCATGCTTCTAGCAGCTTTACTCTTAAAACTTGGAGGATACGGCATTATACGAATCACAATCCTAGTAAACCCATCATCAAACAACCTCCACTACCCCTTCATTACCCTCGCCCTATGAGGAGCAGTAATAACCAGCGCCATTTGCTTACGCCAAATTGACCTGAAATCACTAATTGCCTACTCATCTGTCAGCCACATAGGACTTGTCATTGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCTTAATAATCTCACATGGCTTAACCTCCTCAATACTATTCTGCTTAGCCAACACCAACTATGAACGAACCCACAGTCGAATCCTCCTACTCACACGAGGACTCCAACCCCTCCTACCACTTATAGCCACTTGATGATTATTAGCTAACCTAACAAACATGGCTCTTCCCCCAACAACAAACCTCATAGCAGAACTAACCATTGTAGTAGCGCTTTTCAACTGATCCGCTCTGACAATCATCCTAACAGGAGCTGCTATCCTACTTACCGCCTCATACACCCTATACATACTAATAATGACACAACGAGGCCCCATCCCATCCCACATCACATCAATCCAAAACTCCTCCACACGAGAACACCTCCTAATAGCCCTACACATAATTCCAATAATCCTCCTAATCTCCAAACCCGAACTGATCTCCGGTATCCCTATAT-GCAAGTATAGTTT-TAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTT-AAACCAGCGAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTAATACTCTTAACCCTAGCAACCCTTTCTACCCCTATCCTACTCCCACTACTATCCAACAACCTCAAAAACACCCCTGACACAATCACAAACACAGTCAAAACCTCATTCCTAATCAGCCTAATTCCCATAACAATTTTCATCTACTCCGGAACAGAAAACCTCACCTCCCTCTGAGAATGAAAATTCATCATAACCTTCAAAATCCCAATCAGCCTAAAAATAGACTTCTACACACTCACTTTCTTCCCCATCGCACTATTCGTATCATGATCCATTCTACAATTCGCAACATGATACATAGCCTCAGACCCTTACATCACAAAATTCTTCACCTACCTTCTATTCTTCCTAATTGCTATACTAATCCTAATTATCGCCAACAACCTATTTGTACTATTCATCGGCTGAGAAGGGGTCGGAATTATGTCTTTCCTACTAATCAGCTGATGACACGGCCGAGCAGAAGCTAACACCGCCGCCCTACAAGCCGTCCTGTACAACCGAATCGGTGACATTGGCCTTATCCTCTGCATAGCATGACTAGCCTCTACCACAAACACCTGAGAAATCCAACAACTTTCCA-CCCCTCCCAAACCCCCACACTACCATTACTAGGACTTATCCTAGCTGCAACCGGAAAATCCGCCCAATTCGGCCTCCACCCATGACTCCCCGCTGCAATGGAAGGACCGACCCCCGTATCCGCCCTACTCCATTCCAGCACAATAGTAGTAGCAGGAATCTTCCTACTCATCCGAACCCACCCTCTATTCAACAACAACCAAACTGCCCTAACCCTATGCCTCTGCCTGGGAGCCCTCTCCACCCTATTCGCAGCCACATGCGCTCTAACTCAAAACGACATTAAAAAAATCATTGCCTTCTCCACCTCCAGCCAACTAGGCCTAATAATAGTAACAATCGGACTAAACCTGCCCGAACTTGCCTTCCTCCACATCTCCACCCACGCATTCTTTAAAGCCATACTCTTCCTATGTTCAGGCTCCATCATCCACAACCTAAATGGAGAACAAGACATCCGAAAAATAGGAGGACTACAAAAAATACTCCCCACAACAACCACATGCCTCACAATCGGCAACCTAGCCCTAATAGGAACACCATTCCTAGCAGGATTTTACTCAAAAGACCAAATCATTGAAAGCTTAAACACATCCTACCTAAACACCTGAGCCCTAGTACTAACCCTCCTAGCTACATCATTCACCGCAGTGTACACAATTCGTATAACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCCCCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAACTTCCCCCATCACCCGCCTTGCACTAGGAAGCATCCTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACGAAAACTCCCCCAATAACTATACCACTGCACATCAAAATAACCGCCCTGATCGTAACAGCCCTAGGAATTGCCTTAGCCCTAGAAATCTCAAAAATAGCCCAAACACTCATCCTAACAAAACAAACCCCTCTCTCTAACTTCTCAACCTCCCTAGGATACTTCAACCCACTAACCCACCGCCTAAGCATAACTAATTTCCTTAAAGGGGGACAAAACATCGCCTCCCACCTAATCGACCTGTCCTGATATAAAATACTAGGCCCAGAAGGACTAGCCAGCCTACAACTGACAGCAACCAAAACTGCCACTACCCTTCACTCAGGCCTAATCAAAGCTTACCTAGGGTCATTCGCCCTATCAATCCTTATCATCCTCA---CATCCACACTCAGAAA--TAA-T-C---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTCAAAATCATTAACGACGCCCTAATTGACCTCCCAGCTCCATCAAACATTTCAACATGATGAAACTTCGGGTCCCTACTAGGCGTTTGCTTAATTACTCAAATTGTCACAGGTCTCCTACTAGCTATACACTATACAGCAGACACCAACCTAGCTTTTGCCTCTGTAGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTCCATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATTTATCTTCACATCGGCCGAGGCCTCTACTACGGCTCTTACCTAAACAAAGAAACCTGAAATGTTGGAGTTATCCTCCTTCTAACCCTAATAGCAACTGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATTACAAACCTATTCTCAGCCATCCCATACATCGGACAAACACTAGTAGAATGAGCCTGAGGAGGATTTTCCGTCGACAACCCCACGCTGACCCGATTCTTCGCCCTCCACTTCCTTCTCCCTTTCGTCATCGTTGGACTTACCCTCGTCCACCTAACATTCCTCCACGAAACGGGCTCAAACAACCCACTAGGCATCCCATCAGACTGCGACAAAATTCCCTTCCATCCATACTACACCATCAAAGACATCCTAGGATTTGTCCTAATACTTTCACTGCTTGTCTCACTAGCCCTATTCTCCCCTAACCTCCTGGGAGACCCAGAAAATTTCACCCCAGCCAATCCACTAGTCACTCCACCCCACATTAAACCAGAGTGATACTTCCTATTTGCCTACGCCATTCTCCGATCCATCCCAAATAAACTAGGAGGAGTACTAGCCCTAGCCGCCTCAATCCTAGTCCTTTTCCTCACTCCACTACTACACACATCAAAACTTCGATCAATAACTTTCCGTCCCCTATCACAAATCCTATTCTGAGCCCTAGTCGCCAACGTCCTAATCCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCACTCTCATACTTCACAATCATCCTAATTCTATTCCCCCTCGCGGCCGCCTTAGAGAATAAACTACTCAAACT----------TTA-ACA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Agelaius_phoeniceus_JX516062 GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--TAAA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCC-T-AA-TAT-----GGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ATCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T----TAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAGCAACTAAGCTGTCACAAGCCCAAGATGC-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-CACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCC--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAACAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAAATTAGAACA-T-----ACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG----CCCCCTCCACCCATAAACTAATAAACTAT-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGCTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ATACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-T-A-AACCC----AACTAAAGCATT---C--ACCAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGGAAAAC-CCCCA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--ACTAA-CCC-CTTAAC-TGAATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATGTAAA-AACCTCATGACTCCCT-CCCCATTAACAGGCCAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-CTCCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATTA-AATACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CT-CACCCA--C-T-GGGTTTACTGAC-ACA-TAA-GA-C-TCTGGTT-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACTTCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TT-----CTCCCC--A----ATGAC----------CAACTACCCCCTCCTAATCAACCTCATTATAGCCCTCTCCTATATCCTGCCAATCCTAATTGCAGTAGCCTTCCTCACATTAGTAGAACGCAAAATCTTAAGCTACATACAAGGCCGAAAAGGCCCAAACATCGTTGGCCCATATGGACTGCTCCAACCCCTGGCAGACGGTGTCAAGCTATTCATCAAAGAACCCATCCGCC---------CATCAACATCTTCCCCAGTCTTATTCATTGCGACCCCAATCCTAGCTCTACTCCTAGCTCTCTCAATCTGAACCCCACTACCCCTCCCATTCTCTTTAGCAGACCTTAATCTAGGGTTACTTTTCTTATTAGCCATATCAAGCCTAGCCGTATACTCCATCCTATGATCAGGATGAGCCTCCAACTCCAAGTACGCCCTAATCGGAGCACTACGAGCGGTAGCCCAAACAATCTCCTATGAAGTGACCCTAGCCATCATTCTTCTCTCTGTAGTCCTCCTTAGCGGAAACTACACCCTGAACACTCTTGCAATTACCCAGGAACCCTTATACCTTATCTTCTCCTGCTGACCCCTTGCTATAATGTGATACGTCTCTACTCTGGCTGAGACCAACCGTGCCCCCTTTGATCTTACAGAAGGGGAGTCCGAACTGGTATCCGGATTCAACGTGGAATACGCAGCAGGTCCCTTTGCACTTTTCTTTCTAGCCGAATACGCCAATATTATACTCATAAATACATTAACCACAATCCTATTCTTTAACCCAAGCCTCTTTAACCCCCCTCAAGAGCTATTTCCTGTCATTCTAGCCACAAAAGTCCTGCTTTTATCCGCAGGATTCCTATGAATTCGTGCCTCCTATCCACGATTCCGATACGACCAATTAATACACTTGCTATGAAAAAATTTCTTACCACTCACACTAGCCCTATGTCTTTGACACACCAGCATACCAATCTGCTACGCGGGCCTACCC-----CCTTACCTA-A--GG-CC-----------TTACTGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-T--TCAG-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTCCCTTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTTATCTTCGCCGCTAGTCTACTTCTAGGGACAACCATCACCATCTCAAGTAACCACTGGATCA---TAGCTTGAACCGGCCTTGAAATTAACACACTTGCCATCCTCCCATTAATCTCTAAATCACACCACCCACGAGCCATTGAAGCTGCCACTAAATACTTCTTAACCCAGGCAGCTGCCTCCGCCCTAGTTCTATTCGCCAGCATAACCAATGCATGACACACAGGACAATGAGACATCACTCAACTTACCCACCCAACATCCTGCCTGATCCTCACTTCAGCAATCGCAATAAAACTTGGACTAGTGCCATTCCACTTCTGATTCCCAGAAGTACTACAAGGCTCTCCCCTTACCACCGGTCTACTCCTATCTACTATCATAAAACTCCCCCCAATCACACTACTATACATAACCTCCCCTTCACTAAACCCTACGCTCTTAACCATCCTAGCCATCCTATCCGCAGCTCTCGGAGGCTGAATAGGCCTTAACCAAACACAGATCCGAAAAATCTTAGCCTTTTCCTCCATCTCTCACCTGGGCTGAATAGCAATCATTATCATCTACAACCCCAAACTCACACTCCTCAACTTCTACCTATACGCCATAATAACTGCAACCGTCTTCCTCACTCTAAATACAATTAAAGTACTAAAACTATCCACTCTAATAACCGCATGAACTAAAATCCCATCTCTAAATGCAATACTGCTCCTGACCCTGCTCTCTCTTGCAGGACTGCCACCTCTAACAGGCTTCCTGCCCAAGTGACTCATCATCCAAGAACTAACTAAACAAGAAATGGCTCCAGCAGCCACACTCATCTCCCTTCTCTCCCTACTAAGCTTATTCTTCTACCTCCGACTAGCATATTGTACAACCATCACCCTCCCTCCACATACTACGAACCACATAAAACAGTGACGCACTAACAAACCAACTAACATCACAATCGCCATCCTAACCACTGTGTCCATCATACTCCTCCCCATCTCCCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCATTACCCTGCATCCCCTGAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-C--TAA-TCTTCTAGGCAGATGGGCTTTGATCCCATGATTC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGGCCCCGGCGCATGA-TCAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGGGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACTAATCACAAAGATATTGGTACCCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAAGTTTATAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATTATAATCGGAGGATTCGGAAACTGACTAGTTCCTCTAATAATCGGAGCCCCTGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCACCATCATTTCTCCTCCTACTAGCATCCTCCACAGTTGAAGCAGGCGTAGGCACAGGCTGAACAGTGTACCCTCCACTAGCAGGCAACCTAGCTCACGCCGGAGCCTCAGTCGACCTTGCAATCTTCTCCCTACATCTAGCCGGTATCTCTTCAATCCTAGGGGCAATCAACTTTATTACAACAGCAATCAACATGAAACCCCCTGCCCTCTCACAATACCAAACCCCCCTATTCGTTTGATCCGTACTGATCACTGCAGTCCTACTACTTCTATCTCTCCCAGTCCTCGCTGCAGGAATCACAATACTTCTCACAGACCGCAACCTTAACACCACATTCTTTGATCCTGCCGGAGGAGGAGACCCCGTACTATACCAACACTTGTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATCATCTCCCACGTTGTAGCCTACTATGCGGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTAGGCTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACTGGAATCAAAGTATTCAGCTGACTAGCTACACTCCACGGAGGCACAATCAAATGAGACCCACCAATATTATGAGCCCTAGGATTTATCTTCCTATTTACCATCGGAGGACTAACAGGAATCGTTTTAGCAAACTCCTCACTAGACATCGCCCTGCACGACACTTACTACGTAGTAGCCCACTTCCACTACGTACTATCCATAGGAGCAGTATTTGCAATCCTAGCAGGCTTCACCCACTGATTCCCCCTATTCACTGGATACACGCTACATTCAACATGAGCTAAAGCACATTTCGGCGTAATGTTTGTAGGTGTAAATCTAACCTTCTTCCCTCAACATTTCCTAGGCCTAGCTGGTATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAATACCATCTCCTCAGTAGGCTCACTAATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCTTACAACCAGAACTAACAAGCACTAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAGCCTGCCTTCGTTCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACCT--AAATATGGCCAACCACTCACAACTCAACTTCCAAGACGCCGCCTCACCTATTATAGAAGAACTAATAGGATTCCACGACCACGCCCTAATAATCGCACTAGCAATCTGCAGTCTCGTCCTTTACCTGCTAACCCACACTCTAACAGAAAAACTGTCATCAAGCACAGTCAACGCACAAGTAATCGAGCTGGTATGAACAATTCTCCCTGCCCTAGTCCTAGTCACACTAGCCCTACCATCTCTACGAATCCTTTACATGATGGATGAAATCAACGAACCCGACCTAACCTTAAAAGCCATCGGCCACCAATGATATTGAACCTACGAATACACCGACCTTAAAGACCTAACATTCGACTCCTACATAATCCCAACAGCAGACCTACCTCTAGGCCACTTCCGCCTACTAGAAGTCGACCATCGCGTTGTCGTCCCTATAAGCTCAACCATCCGAGTCATCGTCACTGCCGATGACGTCCTCCACTCATGAGCCGTCCCTAGCCTAGGTGTAAAAACCGATGCAATCCCAGGACGTCTCAACCAAACCTCCTTCTTCGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCAATCGTGGTAGAATCCACCCCACTCGCCAATTTCGAAAACTGATCCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCGTTAGCCTTTTAAGCTAAAGAAAGAGGGAC-CCTCCCCCTCCTTAATGATATGCCCCAACTAAACCCCAGCCCCTGATTTTTTATCATGCTTACCTCATGACTCACTTTCTCTCTAATTATTCAGCCCAAACTTCTATCATTCGTATCGATAAATCCCCCATCTAACAAAC---CACCTGTCGCCCCAACCACTACTCCCTGAGCCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCCTTTCTAGGAATCCCACTAATCCTTATTTCTATAACATTCCCAGCCCTTCTCCTACCATCCCTTGACAACCGATGAATCACTAACCGGCTATCGACCCTTCAACTTTGATTCATCAATCTAGTTACAAAACAACTAATAATACCCTTAGACAAAAAAGGGCACAAATGAGCCCTAATCTTAACATCCCTTATAATCTTCCTCCTCCTCATTAACCTCCTAGGACTACTACCATATACATTCACCCCAACCACCCAACTGTCTATAAACTTGGCCCTAGCCTTCCCCCTATGACTAGCCACACTCCTGACAGGACTGCGAAACCAACCTTCTGCCTCACTAGGCCATCTCCTGCCAGAAGGCACACCCACCCCACTAATCCCAGCCCTAATTTTGATCGAAACAACAAGCCTTCTCATCCGCCCATTAGCACTAGGCGTGCGCTTAACAGCCAACCTGACAGCAGGTCACCTCCTCATTCAGCTCATCTCCACAGCCACAACAGCCCTATTCTCCACAATACCAGTAGTCTCACTCCTAACCTTCGTAGTCCTCTTCCTATTAACAATTCTAGAAGTAGCAGTAGCAATAATCCAGGCCTACGTCTTCGTCCTCCTACTAAGCCTTTACCTCCAAGAAAACATCTAATTC--CA----AATGGCACACCAAGCACATTCCTACCACATAGTCGATCCCAGCCCATGACCCATCCTAGGAGCAGCTGCCGCTCTCCTTACCACCTCAGGACTAACAATATGATTCCACTACAACTCCCCTCGACTCCTTATTCTAGGCCTACTATCAACCATTCTCGTCATATTCCAATGATGACGCGACATCGTACGAGAGAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGATTACGATACGGAATAGCCCTATTTATCACATCAGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCTACACCAGAATTAGGGGGACAATGACCGCCCGTCGGAATTAAACCCCTCAACCCTATAGAAGTACCACTCCTAAACACTGCCATCCTCCTAGCCTCAGGAGTCACCGTCACATGAGCCCATCACAGCATCACAGAAGCCAACCGAAAACAGGCAATTCAAGCCCTATCCCTAACAGTTCTCCTAGGCTTCTACTTCACCGCCCTACAAGCCATAGAATACTATGAAGCCCCCTTTTCCATCGCTGACGGAGTTTACGGCTCAACATTCTTTGTTGCCACTGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCTTAATCAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCAGCCGCTTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAGTTCTATTCATACTAATCCTATCACTAACCCTAAGCATCCTACTAACCATACTGAACTTCTGACTTGCCCAAATAACCCCAGACCCAGAAAAACTATCCCCGTACGAATGCGGGTTCGACCCCCTAGGATCTGCTCGACTCCCCTTCTCGATCCGCTTCTTCCTAGTAGCTATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTCCCACTACCATGAGCTATCCAACTACAATCCCCCACCACTACCCTAACCTGAACTGCCACACTCATCCTCCTACTCACCCTAGGTCTAGTGTACGAATGAATTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACGGTTGATTTCGACTCAACAAATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCAGCCTTCGCCCTAAGCAGCCTAGGCTTAGCCTTCCACCGAACCCATCTAATCTCTGCCCTACTATGTTTAGAAAGCATGATACTATCCATATACGTCGCCCTAGCCATATGACCCATCCAAACCCAATCATCAGTATCCACTATCCTACCTATCCTCATACTAACTTTTTCCGCCTGCGAAGCAGGCACAGGCCTAGCACTACTAGTAGCCTCAACTCGCACCCACGGATCTGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCGCAACACTTCTCCCCCTAGCCCTACTATCCCCACGCAAACACCTATGAACCAACGTTACGCTATATAGCCTACTAATCGCCACTGCCAGCCTCCAATGACTCACACCCACATACTACCCAAACAAAAGCCTAACCCCATGAACATCAATCGACCAAATCTCCTCTCCCCTACTAGTCCTCTCATGCTGGCTCCTTCCTCTAATGATCATAGCAAGCCAAAATCACCTAGAACAAGAACCCATCAATCGTAAACGAGTCTTCGCCTCAACATTAATCCTAGCCCAACTATCCATCCTCCTAGCCTTCTCAGCCTCCGAACTAATGCTCTTCTACATCGCATTCGAAGCCACCCTCATTCCCACGCTCATCCTCATCACACGATGAGGAAGCCAACCAGAACGCCTAAACGCTGGCATCTACCTCCTATTCTACACCCTCGCCAGCTCACTCCCACTATTAATTGCCATCCTACACCTACAAAACCAAATCGGCTCACTATACCTCCCAATACTCAAACTATCACACCCAACACTAAACTCCTCTTGATCCAGCCTAACTGCAAGCCTAGCCCTCCTACTAGCCTTCATGGTTAAAGCCCCCTTATACGGCTTACACCTATGACTTCCCAAAGCTCACGTAGAGGCCCCAATCGCCGGCTCCATGCTTCTAGCAGCTTTACTCTTAAAACTTGGAGGATACGGCATTATACGAATCACAATCCTAGTAAACCCATCATCAAACAACCTCCACTACCCCTTCATCACCCTCGCCCTATGAGGAGCAGTAATAACCAGCGCCATTTGCTTACGCCAAATTGACCTGAAATCACTAATTGCCTACTCATCTGTCAGCCACATAGGACTTGTCATTGCCGCAACCATAATCCAGACCCAATGAGCATTCTCAGGAGCAATAATCTTAATAATCTCACATGGCTTAACCTCCTCAATACTATTCTGCTTAGCCAACACCAACTATGAACGAACCCACAGTCGAATCCTCCTACTCACACGAGGACTCCAACCCCTCCTACCACTTATAGCCACTTGATGATTATTAGCTAACCTAACAAACATGGCTCTTCCCCCAACAACAAACCTCATAGCAGAACTAACCATTGTAGTAGCGCTTTTCAACTGATCCGCTCTGACAATCATCCTAACAGGAGCTGCTATCCTACTTACCGCCTCATACACCCTATACATACTAATAATGACACAACGAGGCCCCATCCCATCCCACATCACATCAATCCAAAACTCCTCCACACGAGAACACCTCCTAATAGCCCTACACATAATTCCAATAATCCTCCTAATCTCCAAACCCGAACTGATCTCCGGTATCCCTATAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTT-AAACCAGCGAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTAATACTCTTAACCCTAGCAACCCTTTCTACCCCTATCCTACTCCCACTACTATCCAACAACCTCAAAAACACCCCTGACACAATCACAAACACAGTCAAAACCTCATTCCTAATCAGCCTAATTCCCATAACAATTTTCATCTACTCCGGAACAGAAAACCTCACCTCCCTCTGAGAATGAAAATTCATCATAACCTTCAAAATCCCAATCAGCCTAAAAATAGACTTCTACACACTCACCTTCTTCCCCATCGCACTATTTGTATCATGATCCATTCTACAATTCGCGACATGATACATAGCCTCAGACCCTTACATCACAAAATTCTTCACCTACCTTCTATTCTTCCTAATTGCTATACTCATCCTAATTATCGCCAACAACCTATTTGTACTGTTCATCGGCTGAGAAGGGGTCGGAATTATGTCTTTCCTACTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTACAAGCCGTCCTGTACAACCGAATCGGTGACATTGGCCTTATCCTCTGCATAGCATGACTAGCCTCTACCACAAACACCTGAGAAATCCAACAACTTTCCACCCCCTCCCAAACCCCCACACTACCATTACTAGGACTTATCCTAGCTGCAACCGGAAAATCCGCCCAATTCGGCCTCCACCCATGACTCCCCGCTGCAATAGAAGGACCGACCCCCGTATCCGCCCTACTCCATTCCAGCACAATAGTAGTAGCAGGAATCTTCCTACTCATCCGAACCCACCCTCTATTCAACAACAACCAAACTGCCCTAACCCTATGCCTCTGCCTGGGAGCCCTCTCCACCCTATTCGCAGCCACATGCGCTCTAACTCAAAACGACATTAAAAAAATCATTGCCTTCTCCACCTCCAGCCAACTAGGCCTAATAATAGTAACAATCGGACTAAACCTGCCCGAACTTGCCTTCCTCCACATCTCCACCCACGCATTCTTTAAAGCCATACTCTTCCTATGTTCAGGCTCCATCATCCACAACCTAAATGGAGAACAAGACATCCGAAAAATAGGAGGACTACAAAAAATACTCCCCACAACAACCACATGCCTCACAATCGGCAACCTAGCCCTAATAGGAACACCATTCCTAGCAGGATTTTACTCAAAAGACCAAATCATTGAAAGCTTAAACACATCCTACCTAAACACCTGAGCCCTAGTACTAACCCTCCTAGCTACATCATTCACCGCAGTGTACACAATTCGTATAACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCCCCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAACTTCCCCCATCACCCGCCTTGCACTAGGAAGCATCCTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACGAAAACTCCCCCAATAACTATACCACTGCACATCAAAATAACCGCCCTGATCGTAACAGCCCTAGGAATTGCCTTAGCCCTAGAAATCTCAAAAATAGCCCAAACACTCATCCTAACAAAACAAACCCCTCTCTCTAACTTCTCAACCTCCCTAGGATACTTCAACCCACTAACCCACCGCCTAAGCATAACTAATTTCCTTAAAGGAGGACAAAACATCGCCTCCCACCTAATCGACCTGTCCTGATATAAAATACTAGGCCCAGAAGGACTAGCCAGCCTACAACTGACAGCAACCAAAACTGCCACTACCCTTCACTCAGGCCTAATCAAAGCTTACTTAGGGTCATTCGCCCTATCAATCCTTATCATCCTCA---CATCCACACTCAGAAA--TAA-T-C---AATGGCCCTCAATCTTCGTAAAAACCATCAAATCCTCAAAATCATTAACGACGCCCTAATTGACCTCCCAGCTCCATCAAACATTTCAACATGATGAAACTTCGGGTCCCTACTAGGCGTTTGCTTAATTACTCAAATTGTCACAGGTCTCCTACTAGCTATACACTATACAGCAGACACCAACCTAGCTTTTGCCTCTGTAGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTCCATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATTTATCTTCACATCGGCCGAGGCCTCTACTACGGCTCTTACCTAAACAAAGAAACCTGAAATGTTGGAGTTATCCTCCTTCTAACCCTAATAGCAACTGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATTACAAACCTATTCTCAGCCATCCCATACATCGGACAAACACTAGTAGAATGAGCCTGAGGAGGATTTTCCGTCGACAACCCCACGCTGACCCGATTCTTCGCCCTCCACTTCCTTCTCCCTTTCGTCATCGTTGGACTTACCCTCGTCCACCTAACATTCCTCCACGAAACGGGCTCAAACAACCCACTAGGCATCCCATCAGACTGCGACAAAATTCCTTTCCATCCATACTACACCATCAAAGACATCCTAGGATTTGTCCTAATACTTTCACTGCTTGTCTCACTAGCCCTATTCTCCCCTAACCTCCTGGGAGACCCAGAAAATTTCACCCCAGCCAACCCACTAGTCACTCCACCCCACATTAAACCAGAGTGATACTTCCTATTTGCCTACGCCATTCTCCGATCCATCCCAAATAAACTAGGAGGAGTACTAGCCCTAGCCGCCTCAATCCTAGTCCTTTTCCTCACTCCACTACTACACACATCAAAACTACGATCAATAACTTTCCGTCCCCTATCACAAATCCTATTCTGAGCCCTAGTCGCCAACGTCCTAATCCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCACTCTCATACTTCACAATCATCCTAATTCTATTCCCCCTCGCGGCCGCCTTAGAGAATAAACTACTCAAACT----------TTA-ACA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Alauda_arvensis_NC_020425 GTCCCTGTAGCTTATTC-AAAGCATGACGCTGAAGACGTCAAGAAGGTCGC--TGCA-CGCACCC-AAGGAC--AAGAGACTTAGTCCCAACCTTACAGTTGGTTGTTGCTAGAGATATACATGCAAGTATCCGCGCGCCAGTG-TAGACGCCCTAGGTACCCT---ACCC-------AGGTCGATAGGAGCAGGCATCAGGCACA-CC------CAC----ATCGTAGCCCAAGACGTCTAGCATTTGCCACACCCCCACGGGTATCCAGCAGTAGTTAACATTAAGCAATGAGTGTAAACTTGACTTAGTCATGGCAAC-----TTAGGGGCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATCAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAGCTAAGATAAAAAAGCAACTGAGCTGTCATAAGCCAAAGATGC-CCATAATACCTCC---AACAAAGAAGATCTTAGACT--AACGATTGATTGAACTCCACGAAAGCCAGGACCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-CGA--TCTTACCGGAGCGTCCGCCCGAGAACTACGAGCCCAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCTAAACCCACCTAGAGGAGCCTGTTCTACAATCGATGATCCACGATA-TACCTTACCATTCCTAGC-CAA---ATTCAGCCTATATACCGCCGTCGCCAGCCCACCCAAC--CTGAAGGCCCAACAGTGGACGCAATAG-CC----CCCCGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAAGATAGAACA-T----TACGGCAAAGGGGTGTGAAATCGCCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTAGGGCACGTACATACCGCCCGTCACCCTCCTCAAAAG-CG-ACCCCCCCCCCCCCCATAAATTAATAAGTTTC-CC--AGCCAAAGAGGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCGAGACGTAGC-TTTAACA-AAAGCACTCAGCTTACACCTGAAAGATATCCGACC-ACACCGGATCGTCTCGA-TGCCAAACCCTAGCCC--------AATCT-ACC-TG------ACCTGGA-ATAAC--AAAGCTACC--CC-CAA-AACCC----AACTAAAGCATT---C--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGGTGAAATAGAAGTG-AAA---AC--TAAGCTA-AAAACAGCAAAGATCAGCCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTGAAGTTTGCCTCCCCGAAACCTAAGCGAGCTACTCGTGAGCAGCTAA-C-TTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGCTAGTAGCGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAGACGAATCTAAGTTCACTCTTAATCCTTCTCCAAGG-AAAC--CCCG-AACCCTA--ATGAAGC---GGATTAAGGGCAATTTAAAGGAGGGACAGCTCCTTTAAAAAAGAAAACAATCTCCA-CCAGCGGATA----AGT--AACTACTCC-GATAAC---TAATGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCAAC-ACCTCAAAAATATATA-ATCAACATGAATCCCT-CACCACTAACAGGCCAACCTATCAC--AATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--TAAAC-CCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAG-CACCCA-ATATACGA--CTAAT---------CCA---ACAAGCA-GAG-TATTA-AACACC-TTGTTAACCCGACAGA-GGAGCGTCCGTT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCC---AAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCAGAGAACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACAT--A----GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCGTAAATCGGGACACGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAACCCCATAAGACGAGAAGACCCTGTGGAACTTCAAAAACAGCGACCACC--CCAATA-TACATC----CA-CACCC-------GGGCGCACTTAT-TCC-TAAAGC---ACTGGTT-CGCATTTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAG-AAATTGGACCATCCCTCCAGACTA-AGAGCAACTCCTCAACGTGCCAACAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCGATCTCCCCCGAGAGTCCATATCGAAGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGGGGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCTCGTACGAAAGGATCGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTCAATTACAAAAGGCTATCAC-ACCCC-----CCC-CATCCTAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GTAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TACCCC------------------C----ATGAC----------CAACCACCCCCTCCTAATTAACCTAATCATAGCCCTCTCCTACGCCCTCCCTATCCTAATCGCAGTCGCCTTTCTAACACTAGTAGAACGCAAAATCCTTAGCTACATGCAAGGCCGAAAGGGCCCAAACATTGTTGGCCCTTACGGACTCCTCCAACCCCTGGCAGACGGAGTAAAACTGTTCATTAAAGAACCCATCCGTC---------CCTCCACATCCTCCCCAATTCTCTTCATCGCAACCCCCATCCTGGCCCTACTCCTAGCCATCTCAATCTGAACCCCACTACCCCTTCCTTTTTCCCTAGCAGACCTCAACCTAGGAGTACTGTTTCTGCTAGCCATGTCAAGCCTAGCAGTGTACTCCATCCTATGATCAGGCTGAGCCTCCAACTCAAAATACGCCCTAATCGGTGCACTACGAGCAGTAGCACAAACCATCTCCTACGAGGTCACACTAGCAATCATCCTTCTATCCGTCATCCTCCTCAGCGGAAACTACACCCTTAGCACTCTTGCAATTACCCAAGAACCCCTATACCTCATCTTTCCCTGCTGACCCCTGGCCATGATATGATATGTCTCCACACTGGCCGAAACAAACCGTGCCCCCTTTGACCTAACAGAAGGAGAGTCCGAACTAGTCTCCGGCTTCAATGTAGAGTATGCAGCAGGGCCTTTTGCTCTATTCTTCCTAGCCGAATACGCCAACATCATACTCATAAACACACTAACCGCAATTCTGTTCTTTAACCCAAGTCTCCTCAACCCACCCCAAGAACTGTTCCCAGTACTACTGGCTACAAAAGTCCTACTCCTATCAGCGGGCTTCCTGTGAGTCCGTGCCTCCTACCCGCGTTTTCGATATGACCAACTGATGCACCTACTATGAAAAAACTTCCTCCCTCTAACATTAGCCCTATGTCTGTGGCACATCAGCATGCCCATCTGCTACGCAGGCCTTCCA-----CCGTACCTAAG--GAGC------------CGGACGGAAATGTGCCTGAATACTC--AAGGGCCACTGTGATAAAGTGGACATAGGGGTATACTAGTCCCCTCATTTCCATA--AAAC-------TTAGAAAAGCAGGGATCGAACCTGCACTAAAGGGATCAAAGCCCTCCATACTCCCATTATATTATTTTCT----------------AGTAGGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACCCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTTACCTCCAGTCTCATCCTAGGAACAACTATTACAATCTCAAGCAACCACTGAGTTA---CGGCCTGAGCCGGGCTCGAAATCAACACACTTGCCATCCTCCCCCTAATCTCGAAATCCCACCACCCCCGAGCCATCGAAGCAGCCACCAAATATTTCCTCACACAAGCGGCTGCCTCCGCTCTCCTATTATTCTCCAGCATAACAAATGCCTGACACACAGGACAATGAGACATTACCCAAATAACTCACCCAACATCATGCCTCATCCTAACCTCCGCCCTTGCAATAAAACCAGGACTAGTTCCATTCCACTTTTGATTTCCCGAAGTACTCCAAGGATCCCCACTCATTACCGGCTTATTACTCTCCACTGCCATAAAACTCCCACCAATCGCCCTACTTTACATGACAGCCCAGTCCCTAAACCCAACAATACTAACCGGTATAGCCATTCTCTCTGCAGCCCTAGGAGGCTGAATGGGACTCAACCAGACACAGATCCGAAAAATCCTTGCCTTCTCTTCCATTTCCCACCTAGGCTGAATAACTGTCATCCTCGTCTACAACCCAAAACTCACCCTACTAAATTTTTACCTATACACCCTAATAACCGCGGCCGTCTTCCTCACCCTAAACTCAACTAATACTACAAAACTACCCACCCTAATAACTGCATGAACCAAAGCCCCTGCACTAAATACAATACTGATACTAACCCTACTCTCACTCGCAGGCCTCCCCCCTCTGACAGGCTTCCTGCCCAAATGACTTATTATCCAGGAACTAACCAAACAAGACATGGCACCCGCAGCAACAATCATCTCACTTCTTTCCCTTTTAGGGCTGTTCTTCTACCTGCGGCTTGCATACTGCGCAACAATCACCCTCCCCCCACACACCACAAACCACATGAAACTGTGGCACACCAACAAACCCATCCCCTCCTCAATTGCTATCTTAACCGTCTTATCCACAACACTTCTCCCTCTATCCCCTATAATCTCTGCCACTAT------CT----AAGAAACTTAG----GATTACGC--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAGACCCGCAGGATTCTACCCCGCATCCTCTGAATGCAACCCAGATACTTTAA-TTAAGCTAGGGCCTCTC--AAGTTCAACTAGACAGATGGGCCTCGATCCCATAATCC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTGCCT-A-------------AGACCCCGGCACACAA-TTAATGCGCATCAATGAGTTTGCAACTCACCATGAATTTCACTACAGGGCC---GATAAGAAGAGGAATTAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTATGACATTCATCAACCGATGACTATTTTCAACCAACCACAAAGACATTGGCACACTCTACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGCACTGCCCTAAGCCTCCTAATCCGAGCAGAACTGGGTCAACCCGGCGCTCTGCTAGGAGATGACCAAATCTACAACGTAGTAGTTACAGCCCATGCCTTCGTAATAATTTTCTTTATAGTCATGCCAATTATGATCGGAGGCTTCGGAAACTGACTAGTCCCCCTAATAATCGGTGCACCAGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTCCTACCCCCATCCTTCCTTCTCCTACTAGCCTCCTCCACAGTCGAAACAGGTGTAGGAACAGGCTGAACAGTCTACCCCCCACTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTGCATCTGGCAGGCATCTCATCAATCCTAGGCGCCATCAATTTCATCACCACAGCCATCAACATAAAACCACCCGCCCTCTCCCAATACCAAACGCCCCTGTTCGTATGATCAGTCCTAATCACTGCCGTACTCCTACTCCTTTCCCTCCCAGTCCTAGCCGCCGGCATCACCATGCTCCTCACTGACCGCAATCTTAACACCACCTTCTTCGACCCTGCAGGTGGAGGAGACCCGGTACTCTACCAACACCTATTCTGATTCTTCGGTCACCCGGAGGTCTACATCCTAATCCTCCCAGGATTCGGCATCATCTCCCACGTTGTAGCCTACTACGCAGGCAAAAAAGAGCCATTCGGATACATAGGAATAGTATGAGCAATACTATCCATCGGATTCCTAGGCTTTATCGTATGAGCCCACCACATATTCACTGTAGGCATAGACGTAGACACCCGAGCATACTTCACATCAGCCACCATAATCATCGCCATCCCAACCGGTATCAAAGTGTTCAGCTGACTAGCCACACTGCACGGAGGAACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACCATCGGAGGCTTAACAGGGATTGTACTTGCAAACTCCTCACTGGACATCGCCCTCCACGATACATACTACGTAGTTGCTCACTTCCACTACGTACTATCCATAGGGGCCGTATTTGCAATCCTAGCAGGGTTTACCCACTGATTCCCCCTATTCACAGGATATACCCTCCACTCCACATGAGCTAAAGCTCACTTTGGCGTAATATTCGTAGGGGTGAACCTCACCTTCTTCCCTCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACCATCTCCTCAGTAGGCTCCCTAATCTCAATAACAGCCGTAATCATGCTAGTGTTTATCATCTGAGAAGCTTTCGCATCCAAACGTAAAGCCCTCCAACCAGAATTAACAAACACCAACATCGAATGAATACACGGCTGCCCACCTCCATTCCACACCTTTGAAGAACCAGCTTTCGTTCAAGTC------CAAGAAAGGGAGGAGTTGAACCCCCATATGCTGGTTTCAAGCCAGCCGC--AT--ATACTGCTTATGCTTCTTTCTC---ATC--AGGGGCGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCTATATTGCAGGTGAAACCCCTGCACACCCCACC---------AAACATGGCCAACCACATACAATTCGGTTTTCAAGACGCATCCTCTCCCATTATAGAAGAACTAACACAATTCCACGACCACGCCCTCATAGTCGCCCTAGCCATTTGCAGCCTAGTCCTCTACCTCTTAACTGTCATGCTAACAGAAAATCTCACATCAAACACAGTCGACGCCCAAGCAATCGAGCTCGTCTGAACAATCCTCCCAGCTGCCGTCCTAATCATACTTGCACTACCTTCCCTACGCATTCTTTATATAATAGACGAAGTTAATGAGCCCAACCTCACACTAAAAGCCATCGGCCACCAGTGATACTGAACCTACGAATACACGGACTTCAAAGACCTAACATTCGACTCCTACATAACACCTACAACCGATCTCCCACTAGGCCACTTCCGTCTGCTAGAAGTCGACCATCGCGTTATTGTCCCAACAAGCTCTACAGTGCGAGTCATTGTCACCGCTGATGACGTACTACACTCATGAGCCGTCCCCAGCCTAGGCGTAAAAACTGACGCCATCCCAGGACGACTCAATCAAACCTCATTCCTTGCTTCCCGACCCGGCATTTACTACGGACAATGCTCAGAAATCTGCGGGGCAAATCACAGCTTCATGCCCATTGTAGTAGAAGCCGCCCCGCTCGCCAATTTCGAAAGCTGATCCACTCTAA---TATCATCTT----------AACCATTAAGAAGCTATGCACCAGCGCTAGCCTTTTAAGCTAGAGAAAGAGGAC--ACACCCCCTCCTTAATGATATGCCACAACTCAACCCAAACCCCTGATTCTTCACCATACTCGCCACATGATTAACATTCTCACTAATCATTCAACCCAAACTCCTAACATTCCTATCTACCAACCCCCCTACCAGCAAAG---CCCCCACAATCCCCAAAACCACTCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCCTCACTCCTAGGAATCCCCCTAATCCTAATCTCCCTCACATTCCCCGCCCTCTTACTCCCCTCCCCCGGCAACCGATGAATGACCAGCCGCCTCTCAACCCTACAACTATGATTCATCAACCTAATCACCAAACAACTAATAACCCCACTAAACGAAAAGGGACACAAATGAGCTCTAATCCTAACCTCCCTAATAATCTTCCTCCTGCTCATCAACCTACTAGGCCTATTACCATACACCTTTACCCCAACCACCCAACTATCAATAAACCTAGCCCTGGCCTTCCCACTATGACTGGCTACCCTTCTCACAGGCCTACGCAACCAACCCTCCACCTCCCTAGCACACCTCCTCCCAGAAGGAACCCCAACACCCCTAATCCCAGCCCTCATTCTAATCGAAACAACAAGCCTACTAATCCGCCCCCTGGCCCTTGGAGTTCGCCTAACAGCCAACTTAACAGCCGGCCACCTCCTGATCCAACTAATTTCCACGGCCACAATAGCACTCGCCTCAACAATGCCAGCTATCTCCCTTCTAACCCTACTCATTCTACTCCTACTAACCATTCTAGAAGTAGCTGTAGCCATAATCCAAGCCTACGTATTTGTCCTGCTACTAAGCCTATACCTACAAGAAAACATCTAGCCC-------CAATGGCACACCAAGCACATTCTTATCACATAGTAGACCCAAGCCCATGACCCATCTTCGGAGCAGCCGCCGCCCTCCTAACCACTTCCGGCCTAACCATATGATTCCACTACAACTCCCCTCAACTTCTCATTGCAGGCCTTATCTCAACCCTCCTAGTCATATTCCAATGATGACGCGACATCGTACGAGAAAGCACATTCCAAGGCCACCACACCCCCACCGTACAAAAAGGACTACGCTACGGCATAATCCTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGCTTCTTCTGAGCATTCTTCCACTCAAGCCTAGCCCCCACCCCTGAACTAGGAGGCCAATGACCCCCCGTCGGCATTAAACCCCTAAACCCAATAGAAGTCCCCCTTCTAAACACCGCCATCCTCCTAGCCTCAGGGGTAACCGTCACATGAGCCCACCACAGCATCACGGAAGCTAGCCGAAAACAAGCCATCCATGCCCTCACCCTCACAGTCATCCTGGGCTTCTACTTTACAGGCCTCCAAGCCATAGAATACTACGAAGCCCCCTTCTCTATCGCCGACGGAGTTTATGGCTCCACCTTCTTTGTAGCCACCGGATTCCATGGACTCCACGTAATCATCGGCTCCACATTCCTCCTAGTTTGCCTCCTCCGCCTAATCAAATACCACTTCACATCAAACCACCACTTTGGATTTGAAGCGGCCGCTTGATACTGACACTTCGTAGACGTAGTTTGACTATTCCTCTACGTCTCCATCTACTGATGAGGATCCTGCTCTTCTAGTATACTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAACCCCAGAGAAGAGCAATG---AACATAATCCTATTCATATTCACCCTATCCCTCTCCCTAAGCATCGCCCTAACCGCCCTAAACTTCTGACTCGCCCAAATAACCCCCGACTCCGAAAAACTATCCCCCTACGAATGTGGCTTCGACCCCCTAGGGTCCGCTCGACTCCCGTTCTCTATTCGATTCTTCCTGGTAGCAATCTTATTTTTACTATTCGACCTAGAAATCGCCCTACTACTCCCCCTTCCCTGAGCTACTCAACTCCAAAACCCCATTACCACACTAACCTGAGCCTCCACCCTCATTGCCCTACTCACCCTGGGCCTTGTCTACGAATGAATCCAAGGGGGCCTAGAATGAGCCGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAGATTATAGCACCCACCCTATAACTTTCTTTATGACCACACTTCACCTAAGCTTCTACTCCGCATTCGTCCTAAGCAGCCTCGGCCTAGCCTTCCACCGAACCCACTTAATCTCTGCCCTTCTATGTTTAGAGAGCATAATACTATCAATGTATGTCGCCCTAGCCATATGACCTATCCAAATACAGGCCCCATCCTCCACCCTACTCCCCATGCTCATACTTACGTTCTCCGCCTGCGAAGCGGGTACAGGACTAGCCCTACTAGTCGCCTCCACCCGTACCCACGGCTCAGACCACCTTCACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCATCATACTCCTCCCCATAACCATCCTATCTCCGTGCAAACACCTATGAACCAACATCACAACTCACAGCCTACTAATTGCTGCCCTCAGCCTCCAATGACTGACCCCCACATACTTCCCCAACAAAGGCCTAACCTTTTGAACCTCAATCGACCAAATCTCCTCCCCCCTACTAGTCCTATCATGCTGACTCCTGCCTCTGATAATTTTAGCGAGCCAAAACCACCTAGAATCCGAGCCCCCAATCCGAAAACGAATCTTCATCTCAACAATAATCCTAGCACAGCCCTTCATTCTCCTAGCCTTCTCAGCCTCAGAGCTCATGCTCTTCTACATCGCATTCGAAGCCACACTAATCCCCACCCTAATTCTCATTACCCGCTGAGGAAACCAGCCAGAACGACTAAACGCCGGCATCTACCTGCTATTCTACACACTCGCCAGCTCGCTACCCCTACTCATTGCCATCCTCCACCTACACAACCAAATCGGAACACTCTATTTCCCCATACTAAAACTCTCCCACCCCCCAATAACTGCCTCATGAACAAACCTAATGTGCGGCCTAGCCCTCCTCCTAGCCTTCATAGTTAAAGCCCCCCTATATGGCCTACACCTATGACTACCCAAAGCCCATGTAGAAGCCCCAATCGCCGGCTCTATGCTCCTAGCTGCCCTACTACTAAAACTAGGCGGCTACGGCATTATACGAATCACAATCCTGGTAGACCCATCACAGAGCAACCTACACTACCCCTTCATCACCCTAGCCCTATGAGGAGCCCTAATAACCAGCGCCATCTGCCTGCGACAAATCGACCTAAAATCTCTAATCGCCTACTCATCCGTCAGCCACATGGGCCTAGTTGTTGCTGCAACTATAATCCAAACCCAATGAGCATTCTCAGGTGCAATAATTCTAATAGTAGCCCATGGCCTAACCTCATCCATACTATTCTGCCTAGCCAACACAAACTACGAACGCACCCACAGCCGCATCCTTCTACTCACACGAGGACTCCAACCCCTCCTACCACTTATGGCCACCTGATGACTTCTAGCCAATCTAACAAACATAGCCCTACCCCCCACAATCAACCTCATAGCAGAACTAACCATCATAATCGCACTATTCAACTGATCCTCCCTCACCCTCCTCCTAACAGGAACTGCAATCCTACTTACCGCCTCATACACCCTATACATGCTACTTATAACACAACGAGGGCCCCTACCATCCCACATCACATCACTTCAAAACTCCTCCACACGAGAGCATTTACTCATGGCACTACACATGATCCCCATGCTTCTCCTCATCCTCAAACCAGAACTCATCTCCGGCATCCCCGCAT-GCAGGTATAGTTT-CAA-CCAAAACATTAGACTGTGATCCTAAAAATAGAAGTTAGACCCTTCTTACCTGCCGAGGGGGAGGAT-CACCCAGCAAGAGCTGCTAACTCTCGCTTCTGAGACTAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACTCCTCACCCTCAACACACTAATATTAGTCACCCTAGCAACCCTAACCACCCCCATCATCTTCCCCATACTCTCAAACAACCTCAAAAGTACACCCACAATCATCACAAATACCGTCAAAACCTCCTTCCTAATCAGCCTCATCCCAATAACCATCTTCATTCACTCAGGGTCAGAAAGCCTAATCTCCCTCTGAGAATGAAAATACATCATAAACTTCAAAATCCCCGTCAGCCTGAAAATAGACTTCTACTCCCTCACCTTCTTCCCAATCGCCCTCTTTGTATCCTGATCAATCCTCCAATTCGCGACATGATATATGGCCTCCGACCCCTACATTACAAAATTCTTTGTCTACCTCCTGTTTTTCCTAATCGCCATACTCATCCTAATCCTCGCCAACAACCTATTCGTCCTATTTATCGGTTGGGAGGGAGTGGGAATCATATCTTTCCTTCTAATCAGCTGATGACACGGACGAGCAGAAGCCAATACTGCCGCCCTCCAGGCAGTTCTCTACAACCGAGTGGGAGACGTAGGACTCATCCTATGCATGGCCTGACTAGCCTCCTCCACAAACACCTGAGAAATTAATCAACTCCCCTCCCCCCACCAAGCTCCCACCCTCCCACTCCTAGGCCTCATCCTAGCCGCAACAGGCAAATCCGCCCAATTCGGCCTACATCCATGACTCCCAGCTGCCATAGAAGGACCAACCCCCGTATCCGCCCTACTCCACTCCAGCACCATAGTGGTCGCCGGAATCTTCCTACTCATCCGAACCCACCCACTATTCGACACCAATCAGACCGCCCTCACTCTGTGCCTATGTCTCGGTGCACTATCAACGCTATTCGCAGCCACGTGCGCCCTAACCCAAAACGACATCAAAAAAATTATCGCCTTCTCTACTTCAAGCCAACTAGGCCTGATAATAGTCACCATCGGACTCAACCTGCCCCAACTAGCCTTCCTACATATCTCGACCCACGCCTTCTTCAAAGCTATACTATTCCTATGCTCAGGTTCCATCATCCACAGCCTCAATGGGGAACAAGACATCCGAAAAATGGGCGGATTACAAAAATTACTACCAACAACCACCTCATGCTTAACCATCGGCAACCTTGCCCTAATAGGAACCCCTTTCCTCGCAGGTTTTTACTCAAAAGACCAAATCATTGAAAGCTTAAGCACCTCCTACTTAAACACCTGAGCCCTAGTACTAACCCTCCTAGCAACCTCCTTTACCGCAGTATACACAATCCGCATAACTGTACTAGTACAAACCGGCTTCGTCCGAATTCCTCCACTAGTCCCAATAAATGAAAACAACCCCGCAGTCACATCCCCAATCACCCGCCTAGCACTAGGAAGCATCACAGCCGGGTTTCTCATCACCTCATACATCCCTC---CCATAAAAACCCCTCCTACAACCATACCAACCTCCATCAAAATCACCGCCCTAATCGTAACCGCCCTGGGCATTGTCCTCGCACTAGAACTATCAAAACTAGCCCAAACTTTAATCCTAACAAAACAAACTAACTTCTCCAACTTCTCCACCTCACTAGGATATTTCAACCCCCTCGCACACCGTCTCGCTACAACCAACCTACTGTCCGGAGGACAAGACATTGCCTCCCACCTCATCGACCTTTCCTGATACAAACTAATCGGACCAGAAGGACTAGCAACCTCACAAATAGCTGCCTCCAAATTTGTCACCACCCTACACTCCGGACTGATCAAAGCCTACCTAGGCTCTTTCGCACTATCCATCCTCATCATACTCA---TATCCTCATACAGAAC--CCCCT-----AATGGCACTCAACCTACGTAAAAATCACCCACTCCTAAAAATCGTAAATGACTCCCTAATTGACCTCCCAACACCATCCAACATCTCATCCTGATGAAATTTTGGATCCCTCCTAGGCATCTGCCTAATCACGCAAATCGTCACAGGCCTCTTACTAGCCATACACTACACAGCAGACACTTCCCTGGCTTTCGCCTCTGTCACACACATTTGCCGAAACGTCCAATTCGGCTGACTAATCCGAAACCTCCACGCAAACGGGGCCTCCTTCTTCTTCATCTGCATCTACTTCCATATCGGCCGAGGAATCTACTACGGCTCATACCTAAATAAAGAAACTTGAAACATTGGAGTCCTCCTCCTTCTGGCTCTAATAGCAACTGCCTTTGTAGGATATGTCTTACCTTGAGGACAAATATCATTCTGAGGCGCTACAGTAATCACAAACCTATTTTCAGCAATCCCATACATCGGCCAAACCCTGGTAGAATGAGCATGAGGCGGATTCTCAGTAGACAACCCCACTTTAACCCGATTCTTCGCCCTTCATTTCCTCCTCCCATTCTTCATCGCAGGACTTACTCTAGTCCACCTCACCTTCCTCCACGAAACAGGATCAAACAACCCCCTAGGCATCCCATCAGATTGCGACAAAATCCCCTTCCACCCATACTACTCCACAAAAGACATCCTAGGGTTCGCCCTCCTACTCATCCTCCTTGCCACCCTCGCCCTTTTCTCCCCCAACCTCCTGGGAGACCCAGAAAACTTTACACCAGCCAACCCACTAGCCACACCCCCACACATCAAACCAGAATGATACTTCCTCTTTGCATATGCCATTCTTCGATCCATCCCCAACAAACTAGGCGGCGTACTAGCCCTCGCCGCGTCAGTCCTAGTCCTATTCCTCATCCCACTCTTGCACACCTCCAAACTACGCTCAATAACCTTCCGTCCCCTATCACAAATTCTATTTTGAGCACTAGTTGCCAACCTCCTAGTCCTAACTTGAGTAGGAAGCCAGCCCGTCGAACACCCATTCATCATCATTGGACAACTCGCTTCCCTCAGCTACTTCACAATCATTCTAGTCCTATTCCCTCTTGTCTCCATCCTAGAAAATAAAATGCTAAAACT----------TTA-GCC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGACTACACCTCTTCTTAGAGTT Amblyramphus_holosericeus_JX516063 GTCCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTGGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGGGTGGTCGC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTAAGCTGTCGCAAGCCCAAGATGT-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACCTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTACAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTACA--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAAATAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG----TCCCC-CCTCCCATAAACTAATAAGCCAT-CC--AGCCGGAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACCCCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTATTACCC-C-A-AACCT----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AT--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTA--TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGGAAAAC-TTACG-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAACCTCCA-CGAGCGGATA----AAT--ATCGACCCC-T-TAAC-TGAATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAA-ACCACAAAAATATAAG-AACTTCATGACTCCCT-CCTCATTAACAGGCCAACCTATATTCAGATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAA-CCCCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-TAG-TATTA-AATGTA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAA-CCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTT--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCGACCACC--TTAAAA-CACATA----CT-CACCCA--C-C-GGGTTCACTGAC-ACA-TAA-GA-C-TCTGGTC-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCATACCTCTAGACTG-AGAGCAACCTCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATA-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--T-TAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TA-----CC---C--C----ATGAC----------CAACTACCCCATCCTAATTAACCTTATCATAGCCCTCTCCTATGCCCTACCAATCCTAATTGCAGTAGCTTTTCTCACACTAGTAGAACGTAAAATCCTGAGTTACATGCAAGGCCGAAAAGGCCCAAACATCGTCGGCCCCTTCGGGCTCCTCCAACCCCTAGCAGACGGTGTCAAACTGTTCATCAAAGAGCCTATCCGGC---------CTTCAACATCCTCCCCAGTCTTATTCATTGCGACTCCGGTCCTAGCTCTTCTCCTGGCCATCTCAATTTGAACCCCATTACCCCTCCCATTCTCTCTAGCAGATCTCAATCTGGGACTTCTTTTTCTACTAGCCATATCAAGCCTAATAGTATATTCCATTCTATGATCAGGCTGGGCCTCCAATTCCAAATACGCCCTAATTGGGGCACTACGAGCAGTAGCCCAAACAATCTCCTACGAAGTAACCCTAGCTATCATTCTTCTCTCCGTTGTCCTCCTTAGCGGTAACTATACTCTAAGCACCCTCGCAGTCACTCAAGAACCCTTATACCTTATCTTCTCTTGCTGACCCCTTGCTATAATATGATACGTCTCCACATTAGCTGAAACCAACCGAGCCCCTTTCGATCTGACAGAAGGAGAATCTGAGCTGGTATCCGGATTCAACGTAGAATATGCAGCAGGTCCTTTCGCACTCTTCTTTCTAGCCGAATACGCCAACATTATGCTAATAAACACACTAACCACAATCCTATTCTTCAACCCAAGCTTTTTTAACCCACCTCAAGAGCTATTTCCCGTCATCCTAGCCACAAAGGTCCTGCTTTTATCAGCAGGATTCCTATGAATTCGTGCCTCCTATCCGCGATTCCGATACGACCAACTAATGCACTTACTGTGAAAAAACTTCTTACCACTCACACTAGCCCTATGTCTGTGACACACCAGCATACCAATTTGCTACGCGGGCCTACCT-----CCTTACCTA-A--GG-CC-----------TTGTTGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-T--GTAG-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGAAATCAAAATCCTCCATACTCCCTTTATATTACTTTCT----------------AGTAGGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCGAGCAAGCCTGATTTTCACCACTAGCCTACTTTTAGGGACAACTATCACCATCTCAAGCAACCACTGGGTTA---TAGCCTGGACCGGCCTCGAAATTAACACACTTGCCATCCTCCCACTAATTTCCAAATCCCACCACCCACGAGCTATTGAAGCTGCTACTAAATACTTCCTAACCCAAGCAGCTGCCTCCGCCCTAGTCTTATTCTCCAGCATGACCAATGCATGACACACCGGACAATGAGACATCACTCAACTTACCCATCCAACATCCTGCCTGATTCTTACCTCAGCAATCGCAATAAAACTAGGACTAGTGCCATTCCACTTCTGATTTCCGGAGGTACTCCAAGGCTCTCCCCTCACCACTGGTCTACTCCTATCTACCATTATAAAGCTCCCTCCAATCACATTACTCTACATAACTTCCCCCTCACTGAACCCCACACTATTAACCACCTTAGCCATCCTCTCTACAGCCCTCGGAGGTTGAATGGGCCTCAACCAAACACAAATCCGAAAAATCCTAGCCTTTTCATCCATCTCCCACCTAGGATGGATAGCAATCATTATCATCTACAACCCAAAACTCACCATCCTCAACTTCTATCTATACGCTATAATAACCGCAACCATCTTCCTCACCCTAAACACAATCAAAGTACTAAAACTATCCACCCTAATGACCGCATGAACTAAAAGCCCATCTTTAAATGCAATACTACTTCTAACTCTGCTTTCCCTGGCAGGACTCCCTCCCCTGACAGGATTCCTGCCCAAATGACTTATCATCCAAGAACTAACTAAACAAGAAATAGCTCCTGCAGCTACACTTATCGCTTTACTCTCCCTACTAAGCCTATTCTTCTACCTCCGACTAGCATATTGCGCAACTATCACACTCCCCCCACACACCACAAACCATATGAAACAATGACGCACTAACAAGCCAACCAACATCACAATCGCCATCCTGATCACTGTGTCCATCGCACTCCTCCCTATCTCTCCTATAATCCTCACTATTTT------CT----AAGAAGCTTAG----GATTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGTTAAGATCCGCAGGCCATTACCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT-G--CAAT-CTTCTAGGCAGATGGGCTTTGATCCCACGATAC-TATAGTTAACAGCTATATGCCTCAACC-AACGGGCTTCTGCCT-A-------------AGGCCCCGGCGCAGGG-TTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACTAACCATAAAGACATTGGGACCCTATACTTAATTTTCGGCGCATGAGCCGGAATGGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCTCTCCTGGGAGACGATCAAGTCTACAACGTAGTCGTCACGGCCCATGCTTTCGTAATAATCTTTTTCATAGTCATGCCAATCATAATCGGAGGGTTCGGGAACTGACTAGTTCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATGAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTTCTTCTCCTAGCATCTTCCACAGTTGAAGCAGGCGCAGGGACAGGCTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGGGCCTCAGTCGACCTAGCAATTTTCTCCCTACATCTAGCCGGTATCTCTTCAATCCTAGGGGCGATCAACTTTATTACAACAGCAACCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCTCTATTTGTTTGATCCGTGCTAATCACTGCAGTACTACTGCTCTTATCTCTTCCAGTTCTAGCCGCAGGAATCACAATACTCCTAACAGATCGCAACCTTAACACCACATTCTTCGACCCCGCCGGAGGGGGAGACCCCGTACTGTACCAGCACCTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCTTAATCCTCCCAGGATTCGGGATCATCTCCCATGTTGTAACCTACTACTCAGGCAAAAAAGAACCATTCGGGTACATGGGAATAGTATGGGCCATACTATCCATCGGATTCCTAGGTTTTATCGTATGAGCCCACCACATATTCACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACATCTGCCACTATAATCATTGCTATCCCAACCGGAATCAAAGTGTTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCTCTAGGATTTATCTTCCTGTTCACTATTGGAGGACTAACAGGAATTGTCCTAGCAAACTCCTCACTAGACATCGCCCTACACGACACTTACTACGTAGTAGCCCACTTCCACTACGTACTATCCATAGGAGCGGTATTCGCAATTCTAGCAGGCTTCACCCACTGATTCCCTCTTTTCACCGGATATACACTCCACTCAACATGAGCTAAAACACATTTCGGCGTAATGTTCGTAGGTGTAAACCTAACCTTCTTCCCTCAACACTTCTTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTGTGAAACACCATTTCCTCAGTGGGCTCACTCATCTCTCTGACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAGCTAACAAGCACCAACGTCGAATGAATCTACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCTGCTTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATT-ATTACATAG-CCTTGTCGAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACCT---AACATGGCCAACCACTCACAACTTAACTTCCAAGACGCTGCCTCACCTATTATAGAAGAACTGATAGGATTCCACGACCACGCCCTAATAATTGCACTAGCCATCTGTAGCCTCGTCCTCTACCTGCTAACCCACACTCTCACAGAAAAACTGACATCAAACACAGTCAACGCACAAGTAATCGAACTAGTCTGAACAATTCTCCCTGCCCTAGTTCTAGTCACACTCGCCCTACCATCCCTACGAATTCTCTACATAATAGATGAAATCAATGAACCAGACCTAACCCTAAAAGCCATTGGCCACCAATGATACTGAACCTACGAATACACTGACACCAAAGACCTAACATTCGACTCCTACATGATTCAAACAGCAGACCTACCTCTAGGCCACTTCCGCCTACTAGAAGTCGACCATCGTGTTATCGTCCCCATAAACTCAACCATTCGAGTCATCGTTACCGCCGATGATGTCCTCCACTCATGAGCTGTCCCTAGCCTAGGTGTAAAAACCGACGCAATCCCAGGACGCCTTAACCAAACTTCCTTCCTCGCCTCCCGACCAGGTGTGTTTTACGGACAATGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATACCAATCGTTGTAGAATCAACCCCACTCGCCAACTTCGAAAGCTGATTCTCTCTAA---TAACATCCT----------AATCATTAAGAAGCTATGGACCAGCGTTAGCCTTTTAAGCTAAAGAAAGAGGGAC-CCCCCCCCTCCTTAATGATATGCCTCAACTAAACCCCAACCCATGATTTTTTATCATGCTCACTTCATGGCTCACCTTCTCTCTGATTATCCAACCCAAGCTCTTAACCTTCGTATCAATAAATCCCCCATCTAACAAGC---CGCCCGCCGCCCCAAGCACTACTCCCTGAGCCTGACCATGAACTTAAACTTCTTCGACCAATTCTCAAGCCCGTCATTCCTAGGAATCCCGCTAATCCTCATCTCAATAACATTCCCAGCCCTTCTTCTACCATCCCTCGACAACCGATGAATCACTAACCGACTATCCACCCTTCAATTGTGATTCGTCAACCTAGTCACAAAACAACTAATAATACCCCTAGACAAAAAAGGACATAAATGGGCTCTAATTCTGACTTCCCTCATAATCTTCCTCCTCCTCATTAATCTCCTAGGCCTGCTACCATACACATTCACCCCAACCACCCAACTATCTATGAACCTAGCCCTAGCCTTTCCCCTATGACTGGCCACACTCCTAACAGGACTGCGAAACCAACCATCTGTCTCACTAGGCCATCTCCTGCCAGAAGGCACACCCACTCCACTAATCCCAGCCCTCATCCTAATCGAAACAACAAGCCTTCTCATCCGCCCATTAGCACTGGGTGTGCGCCTAACAGCCAACCTAACAGCAGGCCATCTCCTAATCCAACTTATCTCCACTGCCACAACAACCCTATTCTCCACAATACCAGTAGTCTCACTCCTAACTTTCGTAGTCCTCTTCCTACTAACGATTCTAGAAGTAGCAGTAGCAATGATCCAAGCCTACGTCTTTGTACTCCTACTAAGCCTCTATCTCCAAGAAAACATCTAACCT--TA----AATGGCACACCAAGCACATTCTTACCACATAGTTGACCCCAGCCCATGACCTATCCTAGGAGCAGCTGCTGCCTTCCTTACTACCTCGGGACTAACAATATGATTCCACTGAAACTCCCCACAACTCCTTATCTTAGGCCTACTATCAACCGCCCTCGTCATATTCCAATGATGACGCGACATTGTACGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGGCTACGATACGGCATAGCCCTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGATTTTTCTGAGCTTTCTTCCACTCAAGCCTAGCCCCCACACCAGAACTGGGAGGCCAGTGACCACCCGTAGGAATTAAACCCCTTAACCCCATAGAAGTCCCACTTCTAAACACTGCCATCCTCCTAGCCTCAGGAGTTACCGTCACATGAGCCCACCACAGCATCACAGAAGCTAATCGAAAACAAGCAATCCAAGCCCTATCCCTGACAGTTCTCCTAGGCTTCTACTTCACCGCCCTACAAGCCATAGAGTACTACGAAGCACCCTTCTCCATTGCCGACGGAATCTACGGCTCAACGTTCTTCGTCGCCACTGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACATTTTGTAGACGTTGTATGACTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAGCCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTGACCCTATCACTAACCCTAAGCATCCTCCTAACCATACTAAACTTCTGACTCGCCCAAACAGTTCCGGACTCGGAAAAACTGTCCCCATATGAATGTGGATTCGACCCATTAGGATCCGCCCGACTTCCCTTCTCAATCCGCTTCTTCCTAGTAGCCATCCTATTCCTCCTATTCGACCTAGAAATCGCCCTACTCCTCCCACTACCCTGAGCCACTCAACTACAATCCCCCACCACTACCCTGACCTGAACTACCGCACTCATCCTCCTACTCACCCTAGGCCTAGTGTACGAATGAATCCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCTACCCTATAACTTTCTTTATGTCCTACCTTCACCTAAGCTTCTACGCAGCCTTTGCTCTAAGCAGCCTTGGCCTAGCCTTCCACCGAACCCACCTAATCTCCGCTCTACTATGTTTAGAGAGCATAATACTATCTATATACGTCGCCCTAGCCATATGACCCATCCAAATCCAATCATCAGTATCCACTATCCTACCTATCCTCATACTAACATTCTCCGCCTGCGAGGCAGGCACAGGCCTAGCATTACTAGTAGCCTCAACCCGCACCCACGGATCCGACCATCTACATAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACTACAGCACTCCTCCCCCTAGCCCTCCTCTCCCCACGTAAACACCTATGAACTAACATCACACTGTATAGCCTACTAATCGCCACTCTCAGCCTCCAATGACTTTCACCCACATACTACCCAAATAAAAGCCTAACCCCATGAACATCAATCGACCAAATCTCTTCTCCTCTACTAGTTCTCTCCTGCTGACTCCTCCCCCTAATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCGTCAGTCGCAAACAAATCTTTGCCTCAACACTAATCTTAGCCCAACTATCCATCCTCCTAGCATTCTCAGCCTCAGAACTAATACTCTTCTACATCGCATTTGAGGCCACCCTCATCCCCACCCTAATCCTCATCACACGATGAGGAAGCCAGCCAGAACGCCTGAACGCCGGCATCTACCTCCTATTCTACACTCTCGCTAGCTCACTCCCATTATTAATTGCCATCCTCCACCTACAAAACCAAATCGGCTCACTCTACCTGCCAATGCTCAAACTTTCACATCCAACATTAGGCTCTTCCTGATCCAACTTAGCTGCAAGCCTAGCTCTTCTACTAGCCTTCATAGTCAAAGCCCCCCTATATGGCCTACACCTATGACTACCCAAAGCCCATGTAGAAGCCCCAATTGCCGGGTCCATACTACTAGCAGCCCTACTACTAAAACTCGGAGGCTACGGCATTATACGAATCACAATCCTAGTAAACCCAACATCAAACAACCTACACTACCCATTCATCACCCTAGCCTTATGAGGAGCAGTAATAACCAGCGCCATCTGCTTACGCCAAATTGACCTAAAATCACTAATCGCTTACTCATCCGTCAGTCACATAGGTCTAGTCGTAGCCGCAACTATAATTCAAACCCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCACACGGATTAACTTCCTCAATACTATTCTGCCTAGCCAACACCAACTACGAACGAACCCACAGCCGAATCCTCCTGCTCACGCGAGGACTCCAACCCCTCTTACCACTTATAGCCACCTGATGACTATTAGCCAACTTAACAAACATAGCCCTTCCCCCAACAACAAACCTCATAGCAGAACTAACGATTGTAGTAGCACTTTTCAACTGATCCGCCCTAACAATCATCCTAACAGGAACTGCCATCCTACTCACCGCCTCATACACCCTATACATATTAATTATAACGCAACGAGGCACCCTCCCATCTCACATCACATCAATCCAAAACTCTTCCACACGAGAACACCTTCTCATGGCCCTTCACATAATCCCAATAGCCCTACTAATCTTCAAACCTGAACTGATCTCCGGCATCCCCGCAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAGACCCTTCTTACCTGCCGAGGAG-AGGTG-TAACCAGCGAGAACTGCTAACTCTTGCATCTGAGTGTAA-AGCCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTAACCCTAACAACCCTCTCCACCCCCATCCTACTTCCACTTCTATCTAATAACCTCAAAAACACCCCCGACACAATCACAAACACAGTCAAAACCTCATTTCTAATCAGCCTAATCCCCATAACAATTTTCATTTACTCAGGAACAGAAAACCTCATCTCCCTATGAGAATGAAAATTCATCATAACCTTTAAAATCCCAATTAGCTTAAAAATGGACTTCTACACACTCACCTTCTTCCCTATCGCACTATTCGTATCATGATCCATCCTACAATTCGCAACATGATACATAGCATCAGACCCTTACATCACAAAATTCTTCACCTATCTCCTATATTTCCTAATTGCCATGCTCATCCTAATCATCGCCAACAACCTATTTGTCCTATTCATTGGCTGAGAGGGGGTCGGAATTATATCTTTCCTCCTAATCAGCTGATGATACGGCCGGGCGGAAGCTAATACTGCTGCCCTGCAGGCCATTCTCTACAACCGGATCGGTGACATCGGCCTCATCCTATGTATAGCATGACTTGCCTCCACCATAAACACCTGAGAAATCCAACAACTTCCTACCCCTTCCCAAACCCCCACATTGCCCCTACTAGGCCTCATCCTAGCCGCAACCGGAAAATCCGCCCAATTTGGCTTACACCCATGACTCCCAGCTGCAATAGAAGGGCCAACCCCCGTATCTGCCCTACTCCATTCCAGCACAATAGTAGTCGCAGGGATCTTCCTACTCATCCGAACCCATCCACTATTCAACAACAACCAAACCGCTCTAACCCTGTGCCTCTGCCTAGGAGCCATCTCCACCCTATTCGCAGCCACATGTGCTCTAACCCAGAACGACATTAAAAAAATCATTGCCTTCTCCACCTCCAGCCAACTAGGCCTAATAATAGTTACAATCGGATTAAACTTACCCGAATTAGCCTTCCTCCATATCTCTACCCACGCATTCTTCAAAGCCATGCTCTTCCTGTGCTCAGGCTCTATCATCCACAGCCTAAACGGTGAACAAGACATCCGAAAAATAGGAGGACTCCAAAAAATACTCCCCACAACAACCGCATGCTTTACAATCGGTAACCTCGCCCTAATAGGAACTCCATTCCTAGCAGGATTTTACTCAAAAGACCAAATCATCGAAAGCCTCAACACATCCTACCTAAACACCTGAGCCCTGGTCCTAACCCTCCTAGCCACATCATTCACCGCAGTATACACAATCCGCATAACCATACTAGTACAGACCGGCTTCGTTCGAATCTCACCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAATTTCCCCCATCACCCGCCTTGCGCTAGGAAGCATCCTAGCAGGCTTCCTCATTACCTCATTTATCATCC---CAACAAAAACTCCCCCGATAACTATACCACTCCATATTAAAATAACTGCCCTAATCGTAACAGCTCTAGGAATCGCCCTAGCCCTAGAAATTACAAAAATAGCCCAAACACTCATCCTCACAAAACAAACCCCCTTCTCGAACTTCTCTACCTCCTTAGGATATTTCAACCCCCTAACCCACCGCCTAAGCATGACTAACTTCCTCAAAGGAGGACAAAACATCGCCTCCCATTTAATTGACTTATCCTGATACAAAATACTAGGCCCAGAAGGATTAGCCAGCCTACAACTAGCAGCAACCAAAACCGCCACTACCCTTCACTCAGGCCTAACCAAAGCCTACCTAGGATCATTCGCCCTATCCATTCTCATCATCCTCA---TATCCACACTCAGAAA--CAA-C-C---AATGGCCCCCAACATTCGTAAAAACCACCAAATCCTCAAAATCATCAACGACGCCTTAATCGACCTCCCAGCTCCATCAAACATCTCAACATGATGAAACTTCGGATCTCTTCTAGGCGTTTGCTTAATTACACAAATTGTCACAGGCCTCCTGCTAGCCATACACTATACGGCAGACACCAACCTGGCCTTCTCCTCCGTAGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAATCTACATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGCCTCTATTACGGTTCATACCTAAACAAAGAGACCTGAAACGTCGGAGTCGTCCTTCTCCTAACCCTAATAGCAACTGCGTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACCTACTCTCCGCCATTCCCTACATCGGACATACACTAGTCGAATGAGCTTGAGGAGGATTCTCCGTCGACAACCCAACACTAACCCGATTCTTCGCCCTTCACTTCCTCCTCCCTTTCGTCATCGTAGGACTCACCGTCGTCCATCTAACCCTCCTCCACGAAACAGGATCAAACAACCCACTAGGCATCCCATCAGACTGCGACAAAATCCCCTTCCACCCTTACTACACCATCAAAGACATCCTAGGATTTGTCCTAATACTTTCCCTGCTCGTCTCACTAGCCCTATTCTCCCCCAATCTCCTAGGAGACCCAGAAAATTTCACCCCAGCCAACCCGCTAGTCACCCCTCCACACATCAAACCCGAATGATACTTCCTATTTGCCTACGCCATCCTTCGATCTATCCCAAACAAATTAGGAGGCGTACTAGCCCTAGCCGCCTCGATCCTAGTTCTATTCCTCATCCCACTCCTACACACATCAAAACTACGATCAATAACCTTCCGCCCCCTATCACAAATCCTATTCTGAGCCCTAGTCGCCAACGTCCTAATCCTAACTTGAGTAGGCAGCCAGCCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCACTCTCATACTTCACAATCATCCTAGTCCTATTCCCCCTCGCAGCTGCCCTGGAGAATAAAATACTCAAACT----------CTA-ATA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Bombycilla_cedrorum GTCTCTGTAGCTTATAACAAAGCATGACACTGAAGATGTCAAGATGGATGC--CACA-CGCACCC-AAAGAC--AAAAGACTTAGTCCCAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCCCCAGTGAAGTAAGCCCTGGACA-CCCTT-AACA-------CGGTAGATAGGAGCAGGCATCAGGCACA--C------CTT-A--ACCGTAGCCCAAGACGCCTTGCAATTGCCACACCCCCACGGGTCATCAGCAGTAGTTAACATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---TTAGGGGTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAAACCCAAATTAACATTA--T----AACGGCGTAAAGCGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAGGTAACTGAGCCGTCACAAGCCCAAGATAC-CCATAAGGCCACTACCATCAAAGAAAATCTTAGAAC--AACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TCA--TATTACCCAAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCTCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATATTACCTGACCACTTCTTGC-TCA-AAA--CAGCCTATATACCGCCGTCGCCAGCCCACCTACT--ATGAAAGATCAACAGTGGACGCAATAG-CCTAA-CCACGCTAATAAGACAGGTCAAGGTATAGCCCATGGAGTG----------------------GA-AGCAATGGGCTACATTTTCTAGATTAGAACA-T----AACGGCAAAGGGATCTGAAATAATCCCTGGAAGGAGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGAGGCACGTACATACCGCCCGTCACCCTCCTCAAAGG-CG----ACCCACACACCCATTAACTAATAAGCCAT-TA--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGATTA-CCAAGACGTAGC-TTTAACC-AAAGCATTCAGCTTACACCTGAAAGATATCTGATA-ATATCAGATCGTCTTGA-TGCCAAATTCTAGCCC--------AAAAT-ACA-TG------ACCTGGA-ATAAC--AAAGTCACT--AT-ATA-AACCT----AACTAAAGCATT---T--ATCAGT-CCCAGTATAGGCGATAGAAAAGACA-CCT-TTGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATAGAAATG-AAATAAGC--AAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCGAAATGA--ATTGAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTATGAGCAGCTAT-C-TTGAGCGAACCCGTCTCTGTAGCAAAAGAGTGGGATGACTTATTAGTAGTGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCTCTCTTAATTCTTCTCCAAGG-AAAT---TCAAAACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--AACCT--TCACTAAAA-TTTACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCAGT-GTCTCAAAAATATAAG-AACCTTATGACTCCCT-CTCCACTAACAGGCCAACCTATATTTCAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--AC-TCCCTCT----ACGACGCAAGCTTACATCTACA-CATTATTAACAAA-TCACCA-AGATACGA--TTAAT---------CAA---ACAAGCA-GAG-TATCAATATATA-TTGTTAACCCAACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAAC---AATACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACCC-GAT---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCCCCCTGTGCAAAAGCAGGGATAAATCCATAAGACGAGAAGACCCTGTGGAACTTTAAAAACAGCAGCCACC--TTAAAA-CACATA----AA-CACCCA--C-T-GGGTTCACTCAA-ATA-CAA-GT---ACTGGCC-TGCATTTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAATTAGATCATCCATCTAGACTG-AGAGAGACATCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGACCAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCAAGAGTCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCAGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATC-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTAGGGCCAATACCACAA-GCAAGCCCTC-GCTTTAAGTAGTGAAAACAACTGAACTACGAAAGGCTATCAC-TCCAC-----CCA-CGTCCTAGAAAAGGA--C-CAGCTAGCGTGGCAGAGTTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGCTTC--TCAACC----------AAACCC--A----ATGAT----------CAACCACCCATTTCTAATCAGCCTTATTATAGCACTTTCCTATATTATCCCAATCCTAATTGCAGTAGCCTTTCTAACACTAGTAGAACGCAAAATTTTAAGCTACATACAAGGCCGAAAAGGCCCAAATATCGTTGGCCCATTCGGACTTCTACAACCATTAGCAGACGGAGTAAAACTATTCATTAAAGAACCTATTCGCC---------CCTCAACATCATCACCAATCCTCTTCATCGCAACCCCAATTCTAGCTCTCCTCCTAGCTATTTCAATCTGAACACCACTTCCACTTCCATTTCCCCTAGCTGACCTTAACCTAGGCATGCTATTTCTTTTGGCCATATCAAGCCTAGCAGTCTATTCTATTTTGTGATCTGGTTGAGCCTCAAACTCAAAATATGCTCTAATTGGAGCCCTGCGAGCTGTAGCCCAAACTATCTCTTATGAAGTGACCCTAGCAATTATCCTGCTATCTATTATTCTCCTCAGTGGTAACTATACTCTAAGCACTCTTGCAGTAACTCAGGAACCCTTATATTTAATCTTCTCATGCTGACCTTTAGCTATAATATGATATGTTTCTACACTTGCCGAAACCAACCGCGCCCCCTTCGATCTAACAGAAGGAGAATCAGAGCTAGTCTCAGGCTTCAATGTAGAATACGCAGCGGGACCATTTGCTCTATTCTTTCTAGCCGAATACGCCAATATTATGCTTATAAATACCTTAACCGCTCTGCTCTTCTTTAACCCAAGTCTCCTCAATCTCCCCCAAGAGCTATTTCCTGTAGTACTAGCAACAAAAGTTTTACTGCTCTCAGCAGGATTCCTGTGAATCCGTGCCTCATACCCACGATTCCGATATGATCAACTAATGCACCTGTTATGAAAAAACTTCCTACCATTAACACTAGCCCTATGTCTATGACATATTAGTTTACCAATCTGCTATGCAGGCTTACCC-----CCATACCTAAG--GATA------------ATCCAGGAAATGTGCCTGAACACCT--AAGGGCCACTATGATAAAGTGGATATAGAGGTACACCAGCCCTCTCATTTCCTTT--ACTT-------TTAGAAAAACAGGAATCGAACCTGTACTAAAGGGATCAAAACCCTTCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACTCCTTCCCCTACTA-ATGAATCCGCAGGCAAAACTAATCTTCATTACCAGCTTACTAATAGGGACAACAATCACAATTTCAAGTAACCACTGAATCA---TAGCCTGAACAGGACTTGAAATTAACACCTTAGCTATCCTCCCATTAATTTCAAAATCACACCACCCCCGAGCCATTGAGGCCGCAACCAAATATTTTTTAGTCCAAGCGGTTGCCTCTACTCTAGTTCTATTTTCTAGCATAACTAATGCATGACATACCGGACAATGAGACATTACCCAACTAACCCATCCACTATCTTGCTTAATCTTGACATCAGCTATCGCAATAAAATTAGGCCTTGTCCCATTCCATTTTTGATTCCCAGAAGTACTTCAAGGATCACCTCTAGTCACCGGGCTTATCCTATCCACAGCAATAAAACTCCCCCAAAAAAAATTACTATATATAACCTCTCATTCACTTAATCCAATAGTACTAACAAGCTTAGCCATCCTTTCTGTAGCCCTGGGAGGATGAATAGGACTAAACCAAACCCAAGTGCGAAAAATCATAGCATTCTCTTCCATTTCACACCTGGGCTGAATAGCAATTATCATTGTCTACAACCCTAAACTTGCCCTACTAAACTTCTACCTATACACCCTAATAACTGCAGCTGTATTTTTAACCCTAAATTCAATTAAAGTACTAAAACTATCAACCTTGATAACTACATGAACAAAAACCCCAGCACTAAGTGCAATACTACTCCTGGCACTACTTTCCCTTGCAGGTTTACCTCCATTAACAGGATTCCTTCCAAAATGACTCATTATCCAAGAACTAACTAAGCAAGACATGGCTTCAGCAGCAATTATTATCTCCCTCCTATCATTACTAGGACTCTTCTTCTACCTACGTCTTGCCTACTGCGCAACAATCACACTCCCTCCACATACCACAAATCACATTAAACTGTGATATACTAACAAACCAACAAGCACTTGAATTGCTATTTTGATCACCACATCTATCATGCTTCTACCCATTTCACCCATAATCGCTACTATTAT------CT----AAGAAACTTAG----GATTACTA--AAACCGAGGGCCTTCAAAGCCCTAAACAAGAGTTAAACTCTCTTAGTTTCTGTTAAGACCCGCAAGATACTACCTTGCATCTCCTAAATGCAACTCAGGCGCTTTAA-TTAAGCTAGGGCCTT-ACTCAG--CCACTAGACAGATGGGCCTCGATCCCATAACAC-TATAGTTAACAGCTATATGCCTCAACC-AACTGGCTTCTGTCT-A---------T---AGGCCCTGGCACACAC-TTAATGTACATCAATGAGCTTGCAACTCACCATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGAACTCTGTACCTAATCTTTGGTGCATGAGCCGGTATAGTAGGCACAGCCTTAAGCCTTCTCATCCGAGCTGAATTAGGACAACCAGGTGCACTACTAGGAGATGACCAAATCTACAATGTTGTAGTTACAGCCCATGCTTTCGTAATAATTTTCTTCATAGTTATACCAATTATAATCGGTGGATTCGGAAACTGACTAGTCCCATTAATAATTGGAGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCTCCATCTTTCCTCCTACTTCTAGCCTCCTCTACAGTAGAAGCTGGTGCAGGAACAGGATGAACTGTATACCCACCACTAGCAGGTAATCTAGCCCACGCTGGAGCCTCAGTAGACCTAGCTATTTTCTCATTACACTTAGCAGGTATTTCCTCTATCCTAGGAGCCATCAACTTTATTACAACAGCCATCAACATAAAACCCCCAGCCTTATCACAATATCAAACACCACTGTTCGTATGATCAGTTTTAATTACTGCAGTCCTGCTACTCCTATCTTTACCAGTACTAGCCGCTGGTATCACAATACTACTTACCGATCGCAACCTTAATACTACTTTCTTTGATCCAGCGGGTGGAGGTGACCCAGTACTATACCAACACCTATTCTGATTCTTTGGACACCCAGAAGTTTACATCTTAATTCTACCAGGATTCGGAATCATTTCCCATGTTGTAGCCTACTACGCAGGAAAAAAAGAACCATTCGGCTATATAGGAATAGTATGAGCTATACTATCCATCGGTTTCCTAGGATTTATTGTATGAGCCCACCACATGTTCACAGTAGGAATAGACGTAGACACCCGAGCTTACTTTACATCTGCCACCATAATCATTGCTATCCCAACAGGAATTAAAGTCTTTAGCTGACTAGCAACCCTGCATGGAGGAACAATCAAATGGGATCCCCCAATATTATGAGCCTTAGGTTTCATCTTCCTGTTCACCATTGGCGGATTAACAGGGATTGTCTTAGCAAATTCTTCACTGGACATTGCCCTGCACGACACATACTATGTAGTTGCCCACTTCCATTATGTTCTATCCATAGGAGCAGTATTTGCAATCCTAGCAGGATTCACCCACTGATTCCCCCTATTCACTGGATACACCCTACACTCCACATGAGCTAAAACCCACTTCGGAGTTATGTTCGTAGGAGTAAACCTAACTTTCTTCCCTCAACATTTCCTAGGCCTAGCAGGTATACCACGACGATACTCAGATTATCCGGATGCATATACATTATGAAACACTATTTCCTCAGTAGGATCCCTAATCTCCCTAACAGCCGTAATTATACTAGTTTTCATAATCTGAGAAGCCTTCGCATCAAAACGTAAAGCTTTCCAACCCGAACTAACAACTACAAATGTGGAATGGATCCATGGCTGCCCACCTCCATTCCACACATTCGAAGAACCAGCCTTTGTACAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGCATAT--AAACCACTTATGCTTCTTTCTC---ATTAAAGGGGTGTTAGT-AAAACA-ATTACATAG-TCTTGTCAAGACTAAATTACAGGTGAAAACCCAGTACACCTCA----TACCC--AAACATGGCCAACCACTCACAACTCGGTTTCCAAGACGCATCATCCCCTATTATAGAAGAACTAACACAATTCCACGATCATGCTTTAATAGTTGCTTTAGCTATCTGTAGCCTAGTATTATATCTAATAACTTTAATACTAACAGAAAAACTCTCATCTAGCACAGTAGACGCACAAGAAATCGAACTTGTGTGAACAATCCTTCCAGCCATAGTACTAGTCATACTAGCCCTACCATCCCTTCGAATCCTCTACATGATGGATGAAATCAACGAACCAGATCTAACTCTAAAAGCCATCGGACATCAATGATACTGAACCTACGAATATACTGACCTTAAAGATTTATCATTTGACTCCTACATAATCCCCACAACAGAATTACCACTAGGACATTTCCGCCTACTAGAAGTTGACCATCGTGTTATTGTCCCAACAGAATCCACAGTACGAGTCATTGTCACCGCTGATGACGTACTCCATTCATGAGCCGTCCCAAGCCTAGGAGTGAAAACTGATGCAATTCCAGGACGACTTAACCAAACTTCATTCCTTGCTCCACGACCCGGGGTATTCTTTGGGCAGTGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATACCTATTGTCGTTGAATCTACCCCTCTAGCCAACTTCGAAAGCTGATCTGCTTCTC---ATCCGTCCT----------AATCATTAAGAAGCTATGAAACAGCACTAGCCTTTTAAGCTAGAGAAAGAGGG---TGTACCCCTCCTTAATGATATGCCTCAACTGAATCCGAACCCTTGATTTTTTATCATGCTCATTTCATGAGTGACCTTCTCCATAATTATTCAACCAAAAATACTCTCATTCATTACCATAAACCCACCATCCAGCAAAAAACCA---ACAATCCCAAATACCACTCCCTGAACCTGACCATGAACTTAAGCTTTTTCGACCAATTCTCAAGCCCATCATTCATAGGAATTCCCTTAATCCTCATTTCAATAACATTCCCAGCACTACTCTTACCTTCCCTAGATAATCGGTGAATCACCAATCGACTCTCAACCCTACAACTATGATTCATCAACATAGTTACAAAACAACTAATAACCCCCCTAAATAAAAAAGGACACAAATGAGCCCTAATCCTCACATCCTTAATAATCTTTCTTTTACTGATTAACCTACTAGGACTCCTACCCTACACATTCACACCCACCACCCAACTATCTATAAACCTAGCCTTAGCATTCCCGCTATGGTTAGCCACCCTCCTAGTAGGTTTACGAAACCAACCATCTGCCTCCCTAGGACATCTACTGCCCGAAGGTACTCCAACACCACTAATTCCAGCCCTAATTCTAATTGAAACAACAAGCCTTCTAATTCGACCCGTAGCACTAGGTGTACGCCTAACTGCAAATCTTACAGCAGGACACTTACTTATTCAGCTCATTTCAACAGCTACAATAGCCTTATTCTCAACAATACCAGCAGTCTCTCTGTTAACACTAATCGTACTATTCCTACTAACCATCTTGGAAGTAGCAGTAGCCATAATCCAAGCTTACGTATTCGTACTCCTATTAAGCCTATACCTACAAGAAAATATCTAACTT-------CAATGGCACACCAAGCTCACTCTTATCATATAGTAGACCCAAGCCCCTGACCAATTCTCGGAGCAACCGCCGCCCTCCTGACTACTTCCGGACTAACCATGTGATTCCATTACAATTCCCCGCAACTATTAATCCTAGGTCTTATCTCCACAGCTCTTGTTATATTCCAATGATGACGAGATATTGTCCGAGAAAGCACATTCCAAGGACATCATACTCCCACCGTCCAAAAAGGCCTACGATACGGAATAGTACTATTCATTACCTCAGAAGCATTCTTCTTCCTAGGATTTTTCTGAGCCTTCTTTCACTCAAGCCTAGCCCCAACACCAGAACTAGGAGGACAATGACCTCCCGTAGGAATCAAACCTCTAGACCCAATAGACGTACCCCTATTAAACACTGCTATCCTATTAGCTTCAGGAGTTACTGTTACATGAGCCCATCACAGCATTACAGAAGCCAACCGAAAACAAGCAATTCATGCCTTAACCCTAACAGTCCTACTAGGTTTCTACTTCACAGCACTTCAAGCTATAGAGTACTATGAAGCCCCATTCTCCATCGCAGACGGAGTATACGGATCAACCTTCTTTGTAACTACAGGGTTCCATGGCCTGCACGTAATCATCGGATCCACATTCCTACTAGTTTGTCTCCTACGCCTAATCAAATACCATTTCACCTCAAACCACCACTTTGGTTTCGAAGCAGCGGCCTGATACTGACATTTCGTAGACGTAGTTTGACTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCTTATTTATAATAGCCTCATCTCTAACCCTAAGCATCATCCTAACCGCACTGAACTTTTGACTAGCACAAATAAACCCAGACTCAGAAAAACTATCCCCATATGAATGCGGCTTCGACCCCCTAGGATCTGCCCGACTACCTTTCTCTATCCGATTCTTCCTAGTAGCTATCCTATTCCTACTATTCGATCTAGAAATCGCCCTTCTCCTACCCCTTCCATGAGCCACCCAACTCAACTCACCCGACACCACCATAATATGAGCCTCAGTATTAGTCCTCCTCCTCACCCTAGGACTAATCCATGAATGAATTCAAGGAGGCCTAGAATGAGCAGAGTA---------AGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAGATTATAGTTCACACCCTATAACTTTCTTTATGACATACCTACACCTAAGCTTCTACTCAGCTTTCGCCCTAAGCAGCCTGGGCCTAGCTTTCCATCGAACACACCTGATCTCAGCCCTACTATGTTTAGAAAGCATAATGCTTTCAATATACGTAGCCCTAGCCATATGACCTATCCAAACACAAACTTCATCCCCAACCCTACTATCCATTCTCATACTAACCTTCTCTGCCTGCGAAGCAGGCACCGGCCTAGCACTCCTAGTTGCCTCCACCCGAACTCACGGCACTGACCACCTACACAACTTTAATTTATTACAATGCTAAAAATCATCATCCCTACTATTATACTACTGCCCTTAGCCCTCCTATCTCCATGTAAACACTTATGAACTAATACTACAACACACAGCCTATTAATTGCCACCATTAGCCTACAATGACTAGTACCAACATACTACCCAAGCAAAGGATTAACCCCTTGGACCTCTATTGACCAGATTTCCTCCCCATTACTAGTCCTCTCATGCTGACTTCTTCCACTCATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCTATTATCCGTAAACGAATCTTCATTATAACCTTAACCCTAGCTCAACCATTCCTTCTATTAGCCTTCTCAGCATCAGAACTAATACTATTTTACATTGCATTCGAAGCTACCCTAATCCCCACTTTAATCTTAATTACACGATGAGGCAATCAACCAGAACGCTTAAACGCTGGCATCTACTTACTATTTTACACGCTTGCCAGCTCACTCCCCCTACTAATTGCTATCCTACATCTCCACAACCAAGTAGGCACACTATACTATCCAATACTTAAACTCCATCACCCTACAATAAACACTTCCTGAACAGGACTAATCTCCAGCCTAGCCCTTCTCCTTGCCTTTATGGTCAAAGCCCCCCTATACGGCTTACATCTATGACTTCCAAAAGCTCACGTAGAAGCCCCAATCGCCGGATCCATGCTTTTAGCTGCCCTCTTACTAAAACTAGGAGGCTACGGCATCATCCGAATTACTATCTTAGTAGACCCCTCATCAAATAATCTACACTACCCATTCATCACACTAGCATTATGAGGAGCTCTCATAACCAGCGCCATCTGTTTACGACAAATCGACCTAAAATCATTAATCGCCTACTCATCTGTCAGCCACATGGGCCTAGTTGTAGCCGCAACCATAATCCAAACCCAATGAGCTATCTCAGGAGCTATAATCCTAATAATTTCACATGGCCTGACCTCCTCAATACTATTCTGCTTAGCCAACACTAACTATGAACGAACTCACAGCCGAATTCTCCTACTCACACGTGGATTACAACCCCTCCTACCACTGATAGCAACCTGATGATTATTAGCCAACTTAACAAACATAGCCCTCCCTCCAACCACCAACCTCATAGCAGAACTCACCATTATAATTGCGCTCTTCAATTGATCCTCTTTAACAATTATCCTAACAGGAACCGCAATTCTACTAACCGCCTCATACACCCTATATATACTCACAATAACACAACGAGGAATAATCCCATC{AC}CACATCACATCCATCCAAAACTCTACGACACGAGAACACCTACTAATAGCCCTGCACATAATTCCTATACTTCTACTTATCCTCAAGCCCGAACTGATCTCCGGCATCCCAATAT-GCAAGTATAGTTT-TAA-TTAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAAATCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAGCAAGAACTGCTAACTCCTGCATCTGAGTATAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCATAAATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTTGTCCTAAACGTATCTATACTACTAACCCTCGCAACCCTCTTAACCCCAATCATCCTCCCCCTCCTATCGGACAACCTAAAAAACTCCCCAACCATCATTACAAACACAGTCAAAACCTCCTTCTTAATCAGCTTAATCCCAATAACAATCTACATATATTCAGGATCAGAAAGCCTTACCACCCTCTGAGAATGAAAATATATCATAAACTTTAAAATCCCAGTCAGCTTAAAACTGGACTTCTACTCCCTTACATTCTTCCCAATCGCCCTATTCGTATCATGATCCATCCTGCAATTCGCAACATGATATATGGCCTCAGACCCATTCATCACAAAATTCTTCACCTACTTACTATTTTTCCTAATTGCAATACTCATCCTAATTATTGCCAACAATTTATTCATCTTGTTCATTGGCTGAGAAGGAGTCGGAATCATATCATTCTTACTTATCAGCTGATGACATGGCCGAGCAGAAGCAAACACTGCAGCCCTCCAAGCCGTACTTTATAACCGAGTCGGAGATGTAGGCCTTATCTTCTGCATAGCATGATTAGCTTCTACCACAAACTCATGAGAAATCCAACAACTAACCTCACCTAACCAAACCCCCACCCTACCTCTCCTAGGGCTAATTCTAGCTGCAACTGGCAAGTCCGCTCAATTTGGACTCCACCCATGACTTCCAGCTGCCATGGAAGGCCCAACCCCTGTATCCGCCCTACTACACTCTAGCACAATAGTAGTAGCCGGCATCTTCCTATTAATCCGAACCCACCCACTATTTAACAACAACCAAACTGCCCTAACTCTATGCTTATGTCTTGGAGCCATTTCCACCCTATTCGCAGCAACATGCGCTCTAACCCAAAACGACATTAAAAAAATCATTGCTTTCTCCACCTCAAGCCAACTAGGACTTATAATAGTTACAATTGGTCTAAACCTACCCCAACTAGCCTTCCTACACATTTCAACACACGCATTCTTCAAAGCCATACTATTCCTATGTTCCGGCTCTATCATTCACAACCTAAACGGTGAACAGGACATTCGAAAAATAGGAGGCTTACAAAAAATATTACCCATAACCACTTCGTGTCTAACTATTGGAAACCTAGCCCTAATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCATATCTAAACACCTGAGCTCTCTTACTAACCCTATTAGCCACATCCTTCACTGCAGTTTATACTATCCGCATAACCATGCTAGTTCAAGCAGGAC?????????????????????????AATAAACGAAAACAACCCAGCAGTAATCTCTCCAATTACCCGCCTCGCCCTAGGAAGCATTACCGCCGGATTCATCATTACTTCGTTTATTCTAC---CTACAAAAACCCCACCCATAACCATACCACTATACATCAAAATTACAGCGCTAGCAGTGACTGCCCTAGGAGTCGCCCTAGCCCTAGAAATCTCAAAAATAACTCAAACCCTTATTCTAACAAAACAAGGCCCATTCTACAACTTCTCCACATCCTTAGGCTATTTCAACCCACTAATACACCGCTTCAACACAACTAATCTATTAAACAACAGCCAAAACATTGCCTCTCACCTAACCGACCTCTCATGATATAAACTACTAGGACCAGAAGGACTAGCTCAATTGCAACTCATAGCCACCAAAGCCATAACCCCTATACACTCAGGATTAATCAAAGCCTACCTAGGCTCCTTCGCCCTATCCATATTCATTATCTTC---TTATACACATACAGAACA-CAA-C-C---AATGGCCCCTAACTTACGTAAAAACCACCCACTACTAAAAATCATCAACGACTCACTAATCGACCTCCCTACACCATCAAACATCTCTGCTTGATGAAACTTCGGATCCCTACTAGGCCTATGCTTAATCACACAAATCATCACCGGCCTACTACTAGCTACACACTATACAGCAGATACTTCCCTAGCCTTTACCTCCGTTGCCCACACCTGCCGAAACGTCCAATTCGGCTGACTAATCCGTAATCTACATGCAAACGGAGCTTCATTCTTCTTCATCTGCATTTACCTTCACATCGGACGAGGATTCTACTACGGATCATACCTAAACAAAGAAACCTGAAACGTCGGAGTAATTCTACTCCTCACCCTCATAGCAACTGCTTTCGTAGGATACGTCCTACCTTGAGGACAAATATCCTTCTGAGGAGCCACTGTCATCACAAACCTATTCTCAGCCATCCCCTACATCGGACAAACATTAGTAGAATGAGCCTGAGGTGGATTCTCAGTAGACAACCCAACATTAACCCGATTCTTTGCCCTCCACTTCCTCCTACCATTTTTCATCGCAGGCCTCACACTAGTCCACCTAACATTCCTCCATGAAACAGGATCAAACAACCCACTAGGTATCCCTTCGGACTGTGACAAAATCCCATTCCACCCATACTACTCTATTAAAGACATCTTAGGATTTGCATTAATAATCATCCTTCTAGTCACTCTAGCCCTATTCTCCCCTAACCTACTAGGAGACCCAGAAAACTTTACACCAGCTAACCCACTAGCCACACCCCCACACATCAAACCAGAATGATATTTCCTATTCGCATACGCCATCCTACGATCAATCCCAAACAAACTAGGAGGTGTACTAGCCCTAGCTGCCTCCGTCCTAGTACTCTTCCTCATCCCACTTCTACATGTATCCAAACAGCGCTCAATAACTTTCCGCCCTCTCTCACAAATCCTATTCTGAATCCTAGTAGCCAACCTGCTTATCCTAACCTGAGTAGGCAGCCAACCAGTCGAACACCCATTCATCATTATCGGACAACTAGCCTCCTTCACTTACTTCGCAATCATCCTTATCCTATTCCCTCTAGTAGCTAGCTTAGAAAATAAACTACTAAAGCT----------CTA-AAC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGATTATACCCCTTCTTAGAGTT Bucanetes_mongolicus GTTCTTGTAGCTTATAG-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAAATGCCCTGGACA-CCT-C-AA-G-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTATCCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTCGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCATAAGCCCAAGATGC-TAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--CCCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCCACC--CTGAAGGACAAACAGTGAGCGCAATAG-CCCCA-CCACGCTAGTACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAACATAGAACA-T-----ACGGCAAAGGGGTGTGAAATAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCACAAG-CGCCCCCCCCCCCCCCCCATAAATTAATAAGCCAT-CC--AGCCGAAGAGGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAGATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--CC-ACA-CACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATTTTAGTTCACTCTTAATTCTTCTCCAAGG-AACT-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AATAGT-TT-CTAAAC-AATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-CCTACAAAAATATAAG-AACAACATGACTCCCT-CCCCATTAACAGGCTAACCTATACTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-CCACCA-ATATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATTA-GACATA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAGCACGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCATAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CT-CACCCA--C-T-GGGTTCACTGTT-ACA-TAA-GA-C-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AGACTAGACCATACCTCTAGACTG-AGAGCAACTTCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTCC-GCTTTAAGTAATGAAACCAACTAAATTACGAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT---CA-----ACAACC--C----ATGGC----------CAACTACCCCCTACTAATCAACCTTATCATAGCCCTCTCCTACGCCCTACCAATCCTGATTGCGGTGGCCTTCCTCACACTAGTAGAACGCAAAATCTTAAGCTACATACAAAGCCGAAAAGGCCCAAATATTGTAGGGCCATACGGCCTTCTACAGCCCCTGGCAGATGGCGTAAAACTATTCATTAAAGAACCCATTCGAC---------CATCAACATCCTCTCCAATCCTATTCATTGCAACCCCAATACTAGCCCTACTCCTGGCAATCTCTATCTGAACCCCCCTACCACTACCATTCTCACTAGCAGACCTAAATCTAGGACTACTATTTCTGCTAGCCATATCAAGCCTAGCAGTATACTCCATCCTATGATCTGGCTGAGCCTCCAACTCAAAATATGCCCTAATCGGTGCACTACGAGCAGTAGCCCAGACAATCTCATACGAAGTGACCCTAGCAATTATCCTCCTATCTGTCGTCCTCCTCAGCGGTAACTACACCCTAAACACCCTCGCAGTCACCCAAGAACCCCTATACCTTATTTTCTCGTGTTGACCCCTTGCCATGATATGATATGTCTCTACACTTGCCGAGACCAACCGTGCCCCTTTCGACCTGACAGAAGGAGAGTCAGAGCTAGTATCTGGATTCAACGTAGAATACGCAGCAGGCCCTTTCGCACTATTCTTCCTAGCCGAATATGCCAATATTATACTAATAAACACAATTACAACCATCATGTTCTTCAACCCAAGCCTATTTAACCCCCCTCAAGAACTATTTCCTGTAATTTTAGCCACAAAAGTACTGCTACTGTCAGCAGGGTTCCTATGAATTCGTGCTTCCTACCCACGATTCCGATACGATCAACTAATGCATCTACTATGAAAAAACTTCCTTCCTCTTACACTAGCCCTATGTCTATGACACACCAGCATACCAATCTGCTATGCTGGACTGCCT-----CCTTATATA-A--GA--------------CCCCAGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-A--CAAC-------CTAGAAAAACAGGAATCGAACCTGCACTAGAGGAATCAAAATCCTCCATACTCCCCTTATATTACTTTCT----------------AGTAGGGTAAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTACTA-ATGAACCCCCAAGCAAAATTAATTTTTGTAGCCAGCCTACTCCTAGGAACCACTATCACAATCTCAAGCAACCACTGAATCA---TAGCCTGAGCCGGCCTCGAAATCAACACACTTGCCATCCTGCCACTAATCTCAAAGTCCCACCATCCTCGATCCATCGAAGCAGCCACTAAATACTTCCTAACTCAATCAGCTGCCTCAGCCCTAGTCTTATTCTCCAGCATGACTAATGCATGACACACCGGACAATGAGACATTACTCAATTATCTCACCCAACATCCAGCCTAATCCTAACCTCAGCAATTGCAATAAAACTAGGCCTAGTCCCATTCCACTTCTGATTTCCAGAAGTACTACAAGGCTCTCCCCTCTCCACTGGACTCCTCCTATCCACCATCATAAAACTTCCTCCAATCACCCTCTTATATATAACCTCCCAATCACTAAACCCCACACTACTAACCACCCTAGCCATCCTCTCAGCAGCTATTGGCGGATGAATAGGACTCAACCAAACACAAATCCGAAAAATCCTAGCTTTCTCGTCCATCTCACACCTTGGATGAATAGCAGCTGTCATCGTCTACAACCCCAAACTCACCCTACTAAACTTCTACTTATACACTATAATAACTGCAACTATCTTCCTAGCCCTAAACTCAATCAAAGTAGTAAAGCTATCCTCCCTAATAACCGCATGGACTAAGATCCCCTCACTAAACGCAATACTACTCCTAACCCTCCTTTCTCTCGCTGGGCTCCCCCCTCTAACAGGATTCCTGCCCAAATGACTCATTATCCAAGAGCTAACCAAACAGGAGATAATCCCCACAGCCACACTCATATCTCTCCTATCCCTATTAAGCCTGTTCTTCTACCTACGCCTTGCATACTGCACTACAATCACACTCCCACCGCACACCACCAACCACATAAAACAATGACGTACTGGCAAACCAACCAACATCCTAATTGCCATCTTAGCCACAATGTCCGTCATTCTCCTCCCCATTTCACCTATAATTATTTCCATTGT------CT----AAGAAACTTAG----GATTAATTTTAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACTCTCTTAGTTTCTGCTAAAGTCCGCAGGTTATTACCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT-A--AAA-C--ACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTATATGCCCCAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGCACACAA-TTAATGTACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTATGACATTCATTGACCGATGATTATTCTCTACCAACCACAAAGATATCGGAACTCTATACCTAATTTTCGGAGCATGAGCCGGGATAGTGGGTACCGCCCTAAGCCTACTCATCCGAGCAGAACTAGGACAACCCGGAGCACTTTTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCCTTCGTAATAATTTTCTTCATAGTTATACCCATTATGATCGGCGGATTCGGTAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTACTCCCCCCGTCCTTTCTTCTTCTACTAGCTTCCTCTACAGTAGAAGCAGGAGTTGGTACAGGATGAACAGTATACCCCCCACTAGCCGGCAACCTAGCACACGCCGGAGCTTCAGTAGACCTCGCAATCTTCTCCCTACACTTAGCCGGCATTTCCTCAATCCTAGGGGCAATCAACTTCATCACAACAGCAATCAACATAAAACCTCCCGCTCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTACTAATCACCGCAGTACTCCTACTCCTCTCCCTCCCAGTCCTCGCTGCAGGAATCACAATGCTCCTCACAGACCGCAACCTCAACACCACATTCTTTGACCCTGCAGGAGGAGGAGACCCAGTCCTATACCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTATACATCTTAATCCTACCAGGATTTGGAATCATCTCCCATGTTGTAACCTACTATGCAGGAAAAAAAGAACCATTCGGGTACATAGGAATAGTCTGAGCTATACTGTCCATCGGATTCCTAGGGTTCATTGTATGAGCTCACCACATATTCACAGTCGGGATAGACGTTGACACCCGAGCCTACTTCACATCTGCTACCATAATCATTGCCATCCCAACCGGCATTAAAGTATTCAGCTGACTAGCCACTCTTCACGGAGGCGTAATCAAATGAGATCCACCAATGCTATGAGCCTTAGGGTTCATCTTCCTATTTACCATCGGAGGACTAACAGGAATCGTTCTAGCAAACTCTTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCTCACTTCCACTACGTCCTTTCTATAGGAGCAGTATTCGCAATCTTAGCGGGCTTCACACACTGATTCCCTCTATTCACTGGATACACTCTCCACTCAACATGAGCTAAAACCCACTTCGGAGTAATGTTCGTAGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTAGGCCTAGCTGGCATGCCACGTCGATACTCAGACTACCCTGATGCTTACACCCTATGAAACACTATCTCCTCAGTAGGTTCACTAATTTCCCTAACAGCCGTAATCATGCTAGTCTTCATCATTTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCCTTCCACACCTTCGAAGAACCTGCTTTCGTCCAAGTT------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---AT---AGAGACGTTAGT-AAAACA-ATTACATGG-CCTTGTCAAGACCAAATTGCAGGTGAAACCCCCGCACGTCTCTT---CACCC--AAACATGGCTAACCACTCACAATTTAACTTCCAAGACGCCTCCTCCCCCATCATAGAAGAACTAATAGGGTTCCACGACCACGCTCTAATGGTCGCATTAGCAATCTGCAGCTTAGTACTTTACCTGCTAACCCATATACTTACAGAAAAGCTTTCATCCAGCACAGTAAATGCACAAGAAATCGAACTCGTCTGAACAATTCTCCCAGCCATAGTCCTAGTTACACTCGCCCTACCGTCACTACGGATTCTATACATAATAGACGAAATCAACGAACCTGACCTAACCCTGAAAGCCATCGGCCACCAATGATACTGATCATACGAATACACTGACCTTAAAGACCTCACATTCGACTCCTACATAATCCCAACATCAGACCTACCCCTAGGACACTTCCGACTGCTAGAAGTGGACCACCGCGTTGTAGTCCCAATAAGCTCCACAATTCGAGTGATCGTCACCGCCGACGACGTACTGCACTCATGAGCCGTCCCAAGCTTAGGCGTAAAAACCGACGCAATCCCAGGCCGCCTCAACCAAACTTCCTTCCTTGCCTCCCGACCAGGAGTTTTCTACGGACAGTGCTCAGAAATCTGCGGGGCTAACCACAGCTTCATACCTATCGTGGTAGAATCCACCCCTCTCGCTAATTTCGAAAACTGATCCTCCCTAA---TGACCTCTT----------AATCATTAAGAAGCTATGAACCAGCGTTAGCCTTTTAAGCTAAAGAAAGAGGACT-ACA-CCCCTCCTTAATGATATGCCTCAACTAAACCCAGCACCATGATTTTTTATCATGACCATTTCATGACTCACCTTTTCCCTTATTATTCAACCTAAAATCCTATCCTTCGTGTCAATAAACCCCCCATCCAACAAAC---CATCCACAACTACAGCCACTACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGTCCATCCCTCCTAGGCATTCCCCTAATCCTAATCTCAATGACATTCCCCGCCCTCCTAATCCCCTCCATGGACAACCGATGAATCACTAACCGACTCTCAACCCTCCAACTATGATTCATTAACCTAATTACAAAACAACTAATAATACCCCTAGACAAAAAAGGACACAAATGAGCACTAATCTTAACATCACTAATAGTATTCCTTCTACTCATTAACCTGCTAGGCCTACTACCATATACATTTACCCCAACCACCCAACTATCTATAAACCTAGCCTTAGCCTTCCCCCTGTGACTCGCAACCCTACTAACAGGACTACGAAATCAGCCCTCTGCCTCACTAGGCCACCTACTCCCAGAAGGAACTCCAACCCCCCTAATCCCAGCCCTAATCTTAATCGAAACAACAAGCCTACTCATCCGCCCACTAGCTCTGGGAGTGCGCCTCACAGCCAACCTCACAGCAGGGCACTTACTAATCCAACTTATTTCCACAGCCACAGCAGCCCTATTCACCACAATACCGGCAGTCTCACTCCTGGCCCTACTGGTCCTCCTACTACTGACCATCCTAGAAGTAGCAGTAGCAATGATCCAAGCCTACGTCTTCGTACTCCTATTAAGCCTATACCTACAAGAGAACATCTAACCA--CC--ATAATGGCACACCAAGCACACTCTTACCATATAGTCGACCCCAGCCCATGACCCATCCTAGGAGCCGCCGCCGCCCTTCTAACTACCTCAGGTCTAACAATATGATTCCACCATAACTCACCCCAACTACTCATCCTCGGGCTACTATCCACCTCACTAGTGATACTCCAATGATGACGAGATATCGTTCGAGAAAGTACTTTCCAAGGTCACCACACCCCCACCGTACAAAAAGGGTTACGATACGGCATGGCCCTATTCATTACATCCGAAGCTTTCTTCTTCCTAGGATTCTTCTGAGCCTTCTTCCACTCAAGCTTAGCCCCCACCCCAGAACTAGGAGGACAATGACCACCCGTAGGAATTAAACCCCTAAACCCCATAGAGGTGCCACTTCTAAACACTGCTATCCTTCTAGCCTCCGGAGTTACTGTAACATGAGCTCACCATAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTAACCCTGACAGTCCTCCTAGGATTCTACTTCACCGCACTACAAGCCATGGAGTACTACGAAGCACCATTCTCCATCGCAGACGGAGTATATGGCTCTACCTTCTTCGTAGCTACCGGATTCCACGGACTACACGTAATCATTGGCTCAACATTCCTACTAGTATGTCTACTACGACTAATCAAATACCACTTCACATCAGGCCACCACTTCGGATTTGAGGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTTTACATCTCTATCTACTGATGAGGATCCTACTCTTCTAGTATATCC-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATT---AACATAATCCTATTCATACTAACCCTATCATTTACCCTAAGCATCCTGCTAACCGCACTAAACTTCTGACTAGCCCAATCAAACCCAGACTCAGAAAAACTATCCCCATACGAATGCGGATTTGACCCCCTAGGCTCAGCCCGACTTCCCTTCTCAATCCGATTCTTCCTAGTAGCTATCCTATTCCTACTATTCGACCTGGAAATCGCTCTACTACTCCCACTCCCATGAGCCACCCAATTAGAATCCCCCACCACCACCCTGATCTGAACCTCCTTCCTCCTACTTCTACTAACACTAGGACTAGTATACGAATGAATTCAAGGAGGATTAGAATGAGCGGAATA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGGCTCAACAAATTATAGCTCACACCCTATAACTTTCTTTATGTCCTACCTCCACCTCAGCTTCTACTCAGCCTTCACCCTAAGCAGCCTAGGCCTAGCTTTTCACCGAACCCACCTAATTTCTGCCCTACTATGCTTAGAAAGCATAATACTATCCATATACGTAGCACTTGCCATATGACCCATCCAAATACAATCCCCATCCTCCACCATCCTACCAATTATCATACTAACATTCTCCGCTTGCGAAGCGGGTACAGGCCTAGCCCTACTAGTAGCCTCCACCCGAACCCACGGTTCCGACCACCTCCACAACTTCAACCTCCTACAATGCTAAAAATCATTATTCCAACCGCAACCCTCCTCCCCTTAGCCCTTTCGTCTCCACTCAAACACCTATGAACCAACCTCACACTATACAGCCTACTCATCGCCACTGCCAGCCTACAATGACTAACCCCCACCTACTACCCAAACAAAGGCCTAACCCCCTGAACATCAATCGACCAGATCTCCTCCCCTCTCCTAGTACTATCATGCTGACTGCTCCCCCTCATGATTATAGCAAGCCAAAACCACCTAGAGCAAGAACCCCCTATCCGCAAACGAATTTTCGCTACAACAGTAATCCTAGCTCAACTATCCATCCTCCTAGCCTTCTCAGCCTCCGAACTAATACTATTCTACATCGCATTCGAAGCAACCCTAATCCCCACCCTCATCCTTATTACACGATGAGGAAACCAACCAGAACGACTAAACGCAGGAATTTACCTATTATTCTACACTCTAGCCAGCTCGCTCCCCCTACTAATCGCCATCCTACACCTACAAAACCAAATCGGCACACTCTACCTCCCCATACTAAAATTATCACACCCCACACTAAACTCCTCCTGATCCGGACTCATTGCGAGCCTCGCCCTACTCCTGGCCTTCATAGTTAAAGCCCCCCTGTATGGCTTACACTTATGACTCCCCAAAGCACATGTAGAAGCCCCAATCGCCGGCTCCATACTACTAGCCGCCCTCCTTCTAAAACTAGGAGGATATGGTATCATACGAGTCACAATCCTAGTCAACCCAGCATCAAACAACCTACACTACCCATTCATCACCCTAGCCCTATGAGGAGCCCTAATAACTAGTGCTATCTGCCTACGACAAATCGATCTAAAATCACTAATCGCCTACTCATCCGTAAGCCACATAGGCCTAGTCGTAGCCGCAACCATAATCCAAACCCAGTGAGCAATCTCAGGAGCAATAATCCTAATAATCTCACACGGCCTCACTTCATCAATACTATTCTGCCTAGCCAACACCAATTACGAACGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCCCTCCTACCACTAATGGCCATCTGATGACTCCTGGCCAATCTCACAAACATAGCCCTCCCCCCAACAACAAACCTTATAGCAGAACTAACCATTATCATCGCACTATTCAACTGATCATCCCTCACAATCATCCTAACCGGAACAGCAATCCTACTCACCGCCTCATACACCTTATACATACTCACAATGACACAACGAGGCACTCTCCCATCCCACATTACCTCAATCCAAAACTCCTCCACCCGAGAGCACCTCCTCATGTCCCTCCACATAATCCCCATACTACTTCTAATCCTTAAACCTGAGTTAATTTCTGGCATTCCCATAT-GCAAGTATAGTTT-TAA-CCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTA-AAGCCAACAAGAACTGCTAACTCTTGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGCCCTAAACACATTCATACTCCTGACCCTAATAACCCTCTCTACCCCAATTCTATTCCCACTCCTATCCTCCAAATTCAAAAACACCCCC-ACATCATCACTAACACAGTCAAAACATCCTTCCTAATTAGCCTAATCCCCATAACAATTCACATCTACTCAGGAACAGAAGGCCTAATCTCCCTGTGACAATGAAAATTTATCATAAACTTCAAAATCCCAATCAGCCTAAAAATAGATTTCTACTCACTCACCTTCTTCCCAATCGCACTATTCGTGTCTTGATCTATCCTACAATTTGCAACATGGTATATAGCCTCAGACCCCCACATCACAAAATTCTTCACCTACCTCTTACTCTTCCTAATAGCAATACTCCTCCTAATCGTAGCCAACAACCTCTTCGTCCTATTCATCGGCTGAGAAGGAGTAGGAATCATATCCTTCCTACTAATCAGCTGATGACACGGCCGAGCAGAAGCTAACACCGCCGCCCTCCAAGCCGTATTATACAACCGAGTCGGAGACGTTGGCCTCATCCTCTGCATGGCATGACTAGCCTCAGCCATAAACACCTGAGAAATCCACCAACTCCCCTCTCAATCCCAAACCCCAACACTGCCCCTACTAGGCCTAATCCTAGCTGCAACTGGCAAATCCGCTCAATTCGGCCTACACCCATGACTCCCAGCCGCTATAGAAGGACCTACTCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTGCTCATCCGCACTCACCCCCTATTTAACAACAACCAGACCGCCCTTACCCTATGTCTCTGCCTGGGAGCCCTCTCCACCCTATTCGCAGCTACATGTGCTCTTACCCAAAACGATATTAAAAAAATCATTGCCTTCTCCACTTCAAGTCAACTAGGATTAATAATAGTTACAATCGGACTAAACCTCCCAGAACTAGCCTTCCTCCATATTTCAACCCACGCATTCTTCAAAGCCATACTTTTCCTATGCTCAGGATCCATCATCCACTGCCTAAACGGTGAACAAGACATTCGAAAAATGGGAGGACTCCAAAAGATACTACCCACAACCACTTCATGCCTTACTATCGGCAACCTGGCCTTAATAGGAACACCATTCTTAGCAGGATTCTACTCAAAAGACCAAATCATTGAAAGCCTTAACACATCCTACCTAAATACTTGAGCCTTACTACTAACCCTACTAGCCACATCCTTCACTGCAGTTTATACAATCCGTATAACCGTACTAGTACAGACCGGCTTCGTCCGAATCTCCCCCCTAACCCCAATAAATGAAAACGACCCCGCAATTACATCACCCATCACTCGACTTGCGCTAGGAAGCATCCTAGCAGGATTCCTCATCACCTCATTCATCATCC---CAACAAAAACCCCCACAATAACCATACCTCTCTCAATCAAAATAACAGCCCTGATCGTCACCGCCCTAGGAATTGCCCTAGCACTAGAAATCTCAAAAATAACCCAAACCCTCATCCTAACAAAACAAACTACCCTATCAAACTTCTCTACATCATTAGGATACTTCAACCCCCTAACTCACCGCCTAAGCACATCCAACCTCCTTAGCGGAGGACAAAACATCGCCTCACACCTAATTGACTTATCCTGATACAAAATACTAGGCCCAGAAGGCCTAGCCAACCTACAACTAACAGCAACCAAGGCCATCACCTCACTCCATTCCGGCCTAATCAAAGCCTACCTAGGCACATTCGCCCTATCCATCATCATCATCCTCA---TATCCACATACAGAAC--AAA-T-T---AATGGCCCTCAACCTTCGTAAAAATCACCAAATCCTAAAAGTCATCAATAACGCCCTAATTGACCTTCCTACCCCACCAAACATCTCTGCATGATGAAACTTCGGGTCTCTCCTGGGCATTTGCTTAATTACCCAAATCGTCACCGGTCTTCTACTAGCCATACACTATACGGCAGACACCAACCTAGCCTTCTCCTCCGTAGCCCACATATGCCGCGACGTGCAGTTCGGCTGACTAATCCGAAACCTCCACGCAAACGGAGCCTCCTTCTTCTTTATTTGCATCTACTTACACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTCATTCTACTACTAACCCTTATAGCAACAGCTTTCGTCGGATATGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACAGTCATCACAAACCTATTCTCAGCAATCCCATACATCGGACAAACACTAGTAGAATGAGCCTGAGGAGGATTCTCTGTCGACAACCCCACACTGACCCGATTCTTCGCTCTACACTTCCTCCTCCCATTCGTCATCGTAGGCCTCACACTAGTCCACCTAACCTTCCTACACGAAACAGGATCAAACAACCCAACAGGAGTCCCCTCAGACTGCGACAAAATCCCATTCCACCCATACTACACCGTAAAAGACGTCCTAGGATTCGCACTAATAATCTCCCTACTCGTCTCCCTAGCTCTATTCTCACCCAACATGCTAGGAGACCCAGAAAACTTCACACCAGCCAACCCCCTAGTAACCCCTCCCCATATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTA?GATCCATCCCAAATAAACTGGGAGGCGTACTAGCCCTAGCCGCCTCAATCCTTGTTCTATTCCTAATGCCACTACTACATACATCAAAACTACGATCAATGACTTTCCGCCCTATCTCCCAAATCCTATTCTGAGCCCTAGTAGCAAACGTCCTCATTCTAACATGAGTGGGAAGCCAACCAGTAGAACACCCATTCATCATCATTGGACAACTAGCCTCACTCTCCTACTTCACAATCATTCTAGTCCTATTCCCCCTCGCGGCCGCACTAGAAAACAAACTATTAAAACT----------CTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Campylorhynchus_zonatus_KF509924 GTCCTCGTAGCTTACAAAAAAGCATGCCACTGAAGATGACAAGACGGTTGC--CATA-CGCACCC-GAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTGTTGCTAGGATTACACATGCGAGTATCCGCGTTCCAGTG-TAGATGCCCTGGGCA-CCC-T-GATTCCCCATCAGGTAGATAGGAGCGGGTATCAGGCACA--C------CTTCA--ACTGTAGCCCAAGACGCCTTGCAATTGCCACACCCCCACGGGTATTCAGCAGTGGTTAACATTAAGCAATGAGTGAAAACTTGACTTAGCCATAGCAA--C---CCAGGGCCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGGCCCAAATTAACAGTA--T----AACGGCGTAAAGCGTGGTAGC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCCGTCACAAGCCCATGTAGC-CCGTAAGGCCACT-TACCTAAAGAAAATCTTAGACT--AACGACTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAA--TATAACCCAAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCATCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCATTTCTCGC-TAG-TT---CAGCCTGTATACCGCCGTCGCCAGCCCACCTCCT--CTGAAAGCCCAACAGTGAGCGCAATAG-CCTAA--CCCGCTAGTAAGACAGGTCAAGGTACAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAGTTTAGAACA-T----TACGGCAAAGGGACCTGAAACGATCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCAAAAG-CG-AACCAAACCCCCCCCATAAA-TAATAAGCTAT-TC--AGCCGAAGATGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGAATA-CCAAGACGTAGC-TTTAAAT-AAAGCATTCAGCTTACGCCTGAAAGATACTTGCTC-ACACCAAGTCGTCTTGA-TGCCAAACTCTAGCCC--------AAAAG-ACATTG------ACCTGGA-ATAAC--AAAGCCACT---CACTA-CACCC----AACCAAAGCATT---T--GTTAGT-CTTAGTATAGGCGATAGAAAAGACA-CCA-CTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAGTG-AAATAAC---TAAGCTA-AAAACAGCAAAGATCAGCCCTTGTACCTCTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTGTAGTTTGCCTCCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAC-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAACAC----CTGAACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAGTACAATCTCCA-CGAGCGGATAAGCAAAT--ATTTCCACC---------ATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTACTACC--AAAAATATATG-AACACTGCGACTCCCT-CCTCATTAACAGGCTAACCTATAGTC-AATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----TCGACGCAAGCTTACATCTTTA-CATTATTAACAAA-CCACCC-ATATACGA--CCAAT---------CCA---ACAAGCA-CAG-TATTA-GGCATT-TTGTTAACCCGACAAA-GGAGCGTCCGCT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCCCA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACCT-GAG---GTTTAACGGCCGCGGTATCCTGACCGTGCAAAGGTAGCGCAATCAATTGTCCCGTAAATCGGGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCGATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAACCCCATAAGACGAGAAGACCCTGTGGAACTTCAAAACCAACAGCCACC--CTAGGT-TATCTA----CA-CCCCCA--C-T-GGGCTCACACCT-ACCCTGG----CTCCTGGCT-GGTG-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAATTAGACCATCCCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCAACCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCATATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AACCCTTCCCAGTACGAAAGGATAGGAA-GAGTGGGGCCAATGCCACAA-GTAAGCCCCC-GCCCCAAGTGGTGAAACCAACTAAACTGCGAAAGGCTATCAC-ACCAC---A-CCA-CGTCCTAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTTTAC----------CTCACGAACCA--ATGGC----------AAACCACCCCCTCCTAGTCAACCTAACCATAGCCCTATCCTATATCCTCCCCATCTTAATTGCGGTGGCCTTCCTCACCCTAATTGAACGCAAAGTCCTAAGCTACATACAAGGCCGAAAAGGCCCAAACATCGTTGGCCCATTCGGCCTGCTCCAGCCCGTGGCAGACGGCGTCAAACTATTTATCAAAGAACCCATCCGCC---------CCTCCACATCCTCTCCTATCCTCTTCACTGTGACTCCCATCCTCGCCCTGCTCCTTGCAATATCCATCTGGGTCCCACTCCCCCTCCCATTTGCTCTGGCGGACCTAAACCTGGGCATCCTTTTCCTACTGGCTATGTCAAGCCTAGCGGTCTACTCTATCCTGTGATCAGGGTGAGCCTCCAACTCAAAATACGCCTTAATTGGAGCTCTCCGCGCAGTAGCACAAACCATCTCCTACGAAGTAACCCTGGCAATTATCCTGCTCTCTGTTGTCCTCCTAAGCGGCAACTACACCCTCAGCACTCTCGCAGTCACCCAAGAAGCCACCTACCTGATCTTTCCCTGCTGACCCCTCGCTATGATATGATACGTATCCACACTAGCTGAAACTAACCGCGCCCCATTCGACCTCACCGAGGGCGAGTCAGAACTGGTCTCAGGGTTCAATGTAGAATACGCAGCAGGCCCCTTCGCCTTATTCTTCCTCGCAGAATACGCCAATATCATCCTGATAAACACACTAACAGTCATCATCTTCCTAAATCCCAGCTTCCTAAACCCCCCTCAAGAACTATATCCTGTCCTTCTAGCTACAAAAGCCCTCCTTCTCTCCGCAGGCTTCCTGTGAATCCGAGCCTCCTACCCTCGATTCCGCTACGACCAACTAATACACCTACTATGAAAAAACTTCCTCCCGCTCACACTAGCTCTATGCCTGTGACACATCAGCATGCCAATCTCTTACGCCGGTCTACCA-----CCCTACCTATA--ACCCCTTC--------CCCGCGGAAATGTGCCTGAACGCCC--AAGGGTCACTATGATAAAGTGAACATAGAGGTATACCAGCCCTCTCATTTCCT-ATTAGGC-------CTAGAAAAACAGGACTTGAACCTGTACTAGAGAGATCAAAACCCTCCATACTTCCTTTATATTATTTCCT----------------AGTAGGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGATGGATCAACCCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATCTTCATTGCCAGCTTACTTCTGGGAACGACCATCACCATCTCAAGTAACCACTGAATCC---TAGCCTGAGCGGGCCTTGAAATCAACACTCTCGCCATCCTACCGCTGATTTCAAAATCCCACCACCCCCGAGCCGTCGAAGCCGCAACTAAGTACTTCCTGGTCCAAGCCGCTGCCTCCGCCCTGGTCCTGTTCTCCAGCATGACCAACGCATGGCACACCGGGCAGTGAGACATCGGCCAGCTGACAGACCCCACCTCTTGCCTCATCTTAACCACAGCCCTCGCAATAAAACTGGGCCTAGTCCCATTCCACTTCTGATTTCCAGAAGTCCTTCAAGGCTCCTCTCTCTCCACGGGCCTACTCCTGTCAACAGTCATAAAATTCCCGCCCATCACCCTACTACTCATAACCTCCCCCTCGCTAGACCCGACCCTGCTAGTCACCATAGCCCTGCTCTCTGCAACCCTGGGGGGATGAATGGGCCTAAACCAGACCCAAACCCGGAAAATCCTAGCCTTCTCCTCAATCTCCCACCTAGGATGAATAGCCATCATTGTCTCCTACAGCCCCAAACTTGCCCTACTAAACTTCTACCTATACGCCTTAATAACTACTACAGTGTTCCTGTCATTAAACTCAATAAAAGCCCTTAAGCTATCGACCCTAATAACCGCCTGAACAAAAGCCCCCGCACTAAGCACAATGTTAATACTGACCCTCCTATCCCTAGCGGGCCTCCCTCCCCTAACAGGGTTCCTCCCAAAATGACTCATCATCCAAGAACTAACCAAACAAGAGATAGCCCCAGCAGCAACCATCATCTCCCTCCTCTCTTTACTTGGCCTATTCTTCTACCTCCGCCTCGCATATTGCGCAACAATCACTCTTCCCCCACACACCACAAACCACATTAAACAATGACGCATTAATGAGCCAATCAGCCCTATAATAGGCATCCTGACCACCATGTCCCTCGTACTCCTCCCAACCTCCCCCCTCATCCTCTCCATTGT------CT----AAGAAACTTAG----GATTACCC--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGTTAAGACCCGCAGGCTATTACCCTGCATCTCCTGATTGCAACTCAGATGCTTTAA-CTAAACTAGGGCCTT----CCACAAAACTAGACAGATGGGCCTCGATCCCATGACTC-TACAGTTAACAGCTGCATGCCCAAACC-ACCAGGCTTCTGCCT-A-------------AGACTCCGGCACACAA-TTAGTGCGCATCAATGGACTTGCAATCCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATCAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGACTATTCTCCACCAACCACAAGGATATCGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTAGGCACTGCCCTAAGCCTCCTCATCCGAGCGGAGCTAGGTCAACCTGGCGCCCTGCTAGGAGACGATCAAATCTACAATGTAATCGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCCTGCTCCTCCTAGCCTCCTCCACTGTTGAAGCAGGCGCCGGAACAGGCTGAACAGTATACCCCCCCCTAGCAGGAAACCTAGCCCATGCCGGAGCATCAGTCGACCTTGCCATTTTTTCCCTACACCTAGCAGGCATCTCCTCCATCCTAGGCGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTGTCCCAATACCAAACACCTCTGTTCGTCTGATCCGTCCTAATCACCGCAGTCCTCCTGCTCCTCTCCCTCCCCGTCCTCGCCGCAGGCATCACCATGCTACTAACAGATCGAAACCTCAACACCACATTCTTCGACCCCGCAGGAGGTGGGGACCCTGTACTCTACCAACACCTGTTCTGATTTTTCGGACACCCCGAGGTCTATATCCTAATCCTCCCAGGGTTTGGAATCATCTCCCACGTCGTAGCCTACTACTCCGGGAAAAAAGAACCCTTCGGCTACATAGGAATAGTGTGAGCAATGCTGTCCATTGGATTCCTAGGCTTCATTGTATGAGCCCACCACATATTCACGGTAGGAATAGACGTAGACACCCGAGCCTACTTTACCTCCGCCACTATAATCATTGCTATCCCAACCGGCATTAAAGTCTTCAGCTGACTAGCCACCCTGCATGGAGGGACAATCAAATGAGACCCCCCCCTGCTATGAGCCCTTGGATTCATCTTCCTATTCACCATTGGAGGTCTAACAGGAATCGTACTGGCAAACTCTTCACTAGATATTGCCCTACACGATACCTACTACGTAGTAGCCCACTTCCACTACGTCCTGTCCATAGGCGCAGTCTTTGCAATCCTAGCGGGCTTTACGCACTGATTCCCACTATTCACAGGATACACCCTCCATTCCACATGAGCCAAAATCCACTTCGGAGTGATATTCGTAGGCGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGTCTAGCCGGAATGCCCCGACGATATTCAGATTACCCAGACGCCTACACACTCTGAAACACCATCTCCTCAGTAGGCTCCCTCATCTCCCTCACAGCCGTAATCCTGCTAGTCTTCATCATTTGAGAAGCCTTCGCATCAAAACGCAAAGCATCTCAACTAGAGCTAACAAGCACAAACATCGAGTGAATTCACGGCTGCCCTCCACCATTCCACACATTCGAAGAACCAGCCTTCGTCCAAGTC------CGAGAAAGGAAGGAATCGAACCCCCTTATGTTGGTTTCAAGCCAACCGC--AC--AGACCACTTATGCTTCTCTCTC---AT---AGAGGCGTTAGT-AAAATA-ATTACATGG-CCTTGTCAAGACCAAATCACAGGTGAAACCCCTGTACGCCCCAA---CTACC--AAACATGGCCAACCACTCACAACTAGGTTTCCAAGACGCATCATCCCCAATCATAGAGGAACTCACTCGGTTCCACGACCATGCCCTGATGGTCGCCCTAGCTATTTGCACCCTAGTCTTGTACCTCTTAGCTCACATACTCACAGGGAAACTGTCATCAAGCACAGTCAACGCACAAGAAATCGAGCTAGTTTGAACCATTCTCCCCGCTATAGTCCTAGTCATGCTAGCCCTCCCATCACTACGAATCCTCTACATAATGGATGAAATCAACCAGCCAGATCTGACCCTAAAAGCCATCGGCCACCAATGATACTGAACCTACGAATATACCGACCTAAAAGACCTCACATTTGACTCCTACATAATCCCCACCGCCGACCTTCCACTAGGTCACTTCCGCCTGCTAGAAGTAGACCACCGTGTCATCGTCCCCACAGGATCCACCATCCGAGTCATTGTCACCGCCGACGACGTCCTTCACTCATGAGCCGTCCCAAGCCTAGGCGTAAAAACTGACGCAATCCCAGGACGCCTCAACCAAACCTCATTCCTAGCCAACCGACCCGGAGTCTACTACGGACAGTGCTCAGAAATCTGCGGGGCCAACCACAGCTTCATGCCCATCGTAGTAGAAGCCGTCCCTCTCGCTAACTTTGAAGACTGATCCTCTCTGT---CATCCTCCT----------AATCGCTAAGAAGCTATGAAACAGCACTAGCCTTTTAAGCTAGAGACAGAGG----ACATACCCTCCTTAGCGATATGCCTCAACTAAACCCAAACCCATGATTTTTTATCATGATCATCTCATGACTCACCCTCTCCCTAATCATCCAACCCAAACTACTCAAATTCGTATCCATAAACCCCCCGGCCAGCAAAA---CACCAACAAACCCAGACACCACTCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCCTCCCTCCTAGGCGTCCCCCTCGTTCTAGTAGCAACAATATTCCCAGCCCTCCTACTACCCTCCCCAGGCAACCGATGAATCACCGGCCGACTCTCAGCACTCCAACTATGACTCATCAACCTGATCACCAAACAACTAATAATCCCCCTAAACGAAAAAGGACACAAATGAGCCCTAATCTTGACATCCCTCATGCTGTTCCTCCTATCCATCAACCTACTAGGACTCCTACCCTATACATTCACCCCAACCACCCAACTATCAATAAACCTCGCCCTGGCATTCCCCCTCTGACTAGCCACACTGCTCATCGGATTACGAAACCAACCCTCAATTTCACTAGGCCACCTCCTACCAGAGGGCACTCCAACACCCCTAATCCCAGCCCTAGTCCTAATCGAAACAACAAGCCTACTCATCCGACCACTAGCCCTAGGCGTACGCCTAACCGCAAACCTCACAGCAGGCCACCTCCTAATCCAACTCATCTCTACCGCCACAACAGCTCTATCCTCCACAATACCGGCAGTCTCCCTCCTAACCCTAACAATCCTACTCCTACTAACCCTCCTGGAGGTAGCCGTAGCCATAATCCAGGCCTATGTCTTCGTCCTCCTGCTAAGCCTGTATCTACAAGAAAACATCTAAACC-----CCCAATGGCCCACCAAGCACACTCCTACCACATAGTAGACCCCAGCCCATGACCTATTCTCGGAGCAGCCGCCGCCCTCCTCACTACTTCAGGCCTAACGGTGTGATTCCACGACAACACCCCATATCTCCTAACCATCGGCCTGCTTTCCACCCTCCTCGTCATATTCCAATGATGACGTGATATCATCCGAGAGAGCACATTCCAAGGACACCACACCCCCACCGTTCAGAAAGGCCTACGATACGGCATGGCACTATTCATCACATCCGAAGCCTTTTTCTTCCTAGGATTCTTCTGAGCATTCTTCCACTCAAGCCTAGCCCCAACCCCAGAATTAGGTGGACAATGACCTCCTGTTGGCATTCAACCGCTAGACCCAATAGACGTCCCCCTACTAAACACCGCCATCCTCCTGGCCTCCGGCGTTACTGTCACATGAGCCCACCACAGCATCACAGAGGCAAACCGCAAACAAGCCATCCAAGCACTAACCCTAACAGTCCTCTTAGGCTTCTACTTCACTGGCCTTCAAGCCATAGAATATTACGAAGCCCCCTTCTCCATCGCCGACGGGGTGTACGGATCGACTTTCTTTGTTGCCACCGGATTCCACGGCCTACATGTTATCATCGGCTCAATCTTCCTCCTGGTGTGCCTCCTACGACTCATCAAATACCACTTCACATCAAACCACCACTTCGGCTTTGAGGCAGCCGCTTGATACTGACACTTCGTAGACGTCGTATGACTGTTCCTCTACATCTCTATCTACTGATGAGGTTCCTGCTCTTCTAGTATACTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTGTAAACCCAGAGAAGAGCAATG---AATATAATCTTATTCATAATCACCCTGTCCCTAACCCTAAGCATCACCCTGACAGCCCTGAACTTCTGACTCGCCCAAATAAACCCAGACTCAGAAAAACTCTCTCCATACGAATGCGGTTTCGACCCCCTGGGATCAGCCCGACTACCCTTCTCAATCCGATTCTTCCTCGTAGCAATCCTATTCCTCCTGTTCGACCTAGAAATCGCCCTACTCCTTCCCCTCCCGTGAGCCACCCAACTCGAACACCCCACTACCACCCTGATCTGAGCCTCCACTATCATCTCTCTCCTCACCCTGGGACTGGTCTACGAATGAACCCAAGGGGGACTAGAATGGGCCGAATA-G------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTC-CACCCTATAACTTTCTTTATGACCTACCTCCACCTAAGTTTCTACTCAGCCTTCACCCTAAGCGGACTAGGACTGGCCTTCCACCGAACCCACCTAGTCTCCGCCCTGCTATGCCTAGAAAGCATGATACTGTCCCTATACGTCGCCCTAACCATGTGACCCATCCAAATACAAGCACCAACTTTCGCCCTACTCCCGATCCTAGTACTAACATTCTCTGCCTGTGAAGCAAGCACAGGTCTCGCACTCCTGGTCGCCTCCACCCGAACCCACGGCTCTGACCGCCTCCACAACTTCAACCTCCTAAAATGCTAAAAATCATCATCCCAACCATTATACTACTACCCCTAACCGCCCTCTCCCCATGCAAGCACTTATGAACCAACATTACAACACACAGCCTCCTAATTGCCGCCATCAGCCTCCAATGACTCACTCCAACCTACTACCCCAACAAAACCTCGACCCCCTGAGCCTCTGTCGACCAAATCTCCTCACCCCTACTTGTCCTATCATGCTGACTTCTCCCCCTGATAATCATAGCAAGCCAAAACCACCTAGAGCGAGAGCCAACCGCCCGCAAGCGAATTTTTGCCTCCACAATCCTGCTAGCTCAACTATTCCTACTCCTAGCCTTCTCAGCCTCCGAGCTAATGCTATTCTACATCACATTTGAAGCTACCCTGATTCCAACCCTAATCCTCATCACACGATGAGGAAACCAACCAGAACGACTGACTGCTGGCATCTATCTACTATTCTACACCTTAGTCAGCTCTTTACCCCTGCTAATCATCATCCTACATCTCCACAACCAAATCGGCACGCTATACCTACCAATCCTCAAACTCACACAACCCGCAACATCAAACTCATGAACCAGCCTCGCCTCTAGTCTCGCCCTCCTTCTAGCCTTCATGGTCAAAGCCCCCCTCTACGGCCTGCACCTCTGACTCCCCAAGGCACACGTAGAAGCCCCAATCGCTGGCTCCATACTACTAGCCGCCCTTCTCTTAAAACTAGGAGGATACGGCATCATCCGAGTCACAATCCTAGTAAACCCCTCATCAAGCGGCCTCCACTACCCCTTCATTACCCTAGCCCTATGAGGCGCGCTCATAACCAGCGCTATCTGCCTGCGACAAACCGACCTAAAATCCCTAATCGCCTACTCATCTGTCAGCCACATGGGCCTGGTAGTCGCCGCAACCATAATCCAAACCCAATGAGCAATCTCAGGAGCAATAATCCTAATAATCGCACACGGCCTAACTTCCTCAATACTATTCTGCCTAGCTAACACCAACTACGAACGCACCCACAGCCGAATCCTCCTCCTTACCCGAGGCCTTCAACCCCTTCTGCCACTAATAGCCACCTGATGACTCCTGGCTAACCTGACAAACATAGCACTCCCCCCTACAATCAACCTCATAGCAGAACTTACTATCATAGTCGCCCTTTTCAACTGATCCTCCCTCACAATCATCCTCACAGGGACTGCAATCATTCTCACCGCCTCCTACACCCTGTACATACTCATAATAACGCAACGAGGGACACTCCCATCACACATCACCTCCATCCAAAACTCCTCCACACGAGAACACCTCCTTATAGCCCTACACATAATCCCCATGATCCTCCTCATCCTCAAACCCGAGCTCATCTCTGGCATCCCCTCAT-GCAAACATAGTTT-CAA-CCCAAACGTTAGACTGTGATCCTAAAAATAGGAGTTAAAACCTCCTTGTTTGCCGAGGGA-GGGTT-CAACCAGCAGGAACTGCTAACTCTTGCATCTGAGCATAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAATAGCAATCCAATGGTCTTAGGAACCACCCATCTTGGTGCAAATCCAAGTGAAAGT--AGTGGACCTACCCCTAATCCTAAACACATTCATACTCCTCGCCCTAGCAACCATCTCTACCCCAATCATCTTCCCCCTCCTATCAAACCACCTAAAAAACACCCCCGCCACCATCACTAACACAGTTAAGGCCTCTTTCCTAATTAGCCTAGTCCCCATAACAATCTACATCCACTCAGGAATGGAAAGCCTGACCACCCTATGGGAATGAAAATTCATCATACACTTCAAAATCCCTATCAGCCTAAAAATGGACTTCTACTCCCTCACATTCTTCCCAATCGCCCTGTTCGTCTCCTGATCCATCCTACAATTCGCATCCTGATACATGGCATCAGACCCCTACATCACAAAATTCTTCGTCTACCTCCTATTCTTCCTAATTGCCATACTAACCCTAATCATCGCCAACAACCTATTTGTCCTGTTCATCGGCTGAGAGGGGGTAGGCATCATATCCTTCTTACTAATCAGCTGATGACACGGCCGAGCAGAAGCTAATACCGCCGCCCTCCAAGCCGTACTCTACAACCGAGTAGGGGATGTTGGCCTCATTCTCTGCATAGCATGACTAGCCTCCACCCTAAACACCTGAGAAATCCAACAACTCCACTACCCATCCCAAGCCCCCACACTCCCCCTCCTAGGCCTCATCCTAGCCGCAGCAGGAAAGTCAGCCCAATTTGGACTCCATCCGTGGCTGCCTGCCGCCATAGAAGGCCCCACTCCAGTATCCGCACTCCTTCACTCCAGCACGATAGTTGTTGCAGGAATTTTCCTACTCATCCGAACCCACCCCCTATTTCACAACAACCAGACCGCCCTAACCCTATGTCTCTGCCTGGGGGCTGTCTCTACCCTATTCGCAGCAACCTGCGCCCTCACCCAGAACGACATTAAAAAGATCATTGCCTTCTCTACATCCAGCCAACTAGGCCTAATAATAGTCACAATCGGCCTAAACCTCCCCCAACTAGCGTTTCTACACATCTCAACACACGCCTTCTTCAAAGCCATGCTCTTCCTCTGCTCAGGCTCCATCATCCACAATCTAAACGGGGAACAAGACATCCGCAAAATAGGAGGCCTGCAAAAAATACTACCAGCAACAACCTCATGCCTCACCATCGGAAACCTTGCCCTAATAGGAACCCCCTTTTTAGCGGGATTCTACTCAAAAGACCAAATCATCGAAAGCTTAAGCACCTCCTACCTAAACACCTGAGCCCTCCTACTAACCCTACTAGCCACCTCTTTCACCGCAATCTACACAATACGCATGACTGTATTAGTCCAAAGCGGCTTCGTCCGAATCCCCCCTCTAACCCCGATAAACGAGAACAACCCAGCGGTGACTTCCTCCATCACCCGCCTCGCCCTAGGGAGCATCACAGCAGGCTTCCTCATTACCTCCTACATCCCCC---CAACAAACATTCCCCCCACAACCATACCCCTCTCCATCAAAATAACCGCCTTAGCAGTCACTATCCTAGGAATAGCCCTAGCCCTAGAAATTTCAAAAATAGCTCAAACCCTAATTCTAACAAAACAAACCACCTTCTCGAACTTCTCTCTCTCTCTCGGCTACTTCAACCCCCTTACACACCGCTCTATCTCAACAGGTCTCCTGGGTGGAGGGTATAAAATCGCCTCCAACCTCATAGACCTCTCCTGATACAAAATGCTAGGGCCAGAGGGACTCGCTAGCCTACAAGTTGCTGCAGCCAAAGCCTCTACCGCCCTACACCACGGCTCAACTAAAGCCTACCTAGGCTCCTTCGCCCTATCCATCCTTATCATCCTCG---CATCCCTACACAGAAC--CAA-CCT---AATGGCACTCAACCTTCGTAAAACCCACCCACTAATGAAAGTCGTCAACGACGCCCTAATTGACCTCCCAACACCATCAAATATTTCCGGATGATGAAACTTTGGATCACTCCTAGGTGTCTGCCTAGTCACACAAATCATCACCGGCCTACTCCTAGCCGCACACTACACAGCAGACACATCCTTAGCCTTCAACTCTGTAGCCCACATATGCCGAAACGTCCAATTTGGCTGACTAATTCGCAACCTCCACGCAAACGGAGCATCCTTCTTTTTCATCTGCATCTACCTCCACATCGGCCGAGGAATCTACTACGGCTCCTACCTCAACAAAGCAACCTGAAACATTGGTGTCCTCCTCCTACTAGCCCTCATAGCAACCGCTTTCGTCGGGTACGTCCTGCCCTGAGGCCAAATATCATTCTGAGGGGCTACAGTCATCACAAACCTGTTCTCAGCAATTCCCTACATCGGCCAAACTCTAGTAGAGTGAGCGTGAGGGGGATTCTCGGTAGACAACCCAACCCTAACCCGCTTCTTTGCACTCCACTTCCTCCTACCCTTCCTCATCGCAGGACTCACACTAGTCCACCTCACCCTACTTCACGAAACAGGCTCAAACAACCCCCTAGGAATCCCCTCAGACTGCGACAAAATCCCATTCCATCCTTACTACACAATCAAGGATATCTTAGGATTCGCCCTAATACTCATCCTGCTCGTTTCCCTAGCCCTATTTTCGCCTAACCTACTAGGGGACCCAGAAAATTTCACACCAGCCAACCCCCTAGCCACGCCCCCGCACATCAAACCAGAATGATACTTCCTATTCGCATACGCCATCCTGCGATCCATCCCAAACAAACTAGGAGGAGTACTGGCCCTGGCCGCCTCTGTTCTCGTCCTATTCCTAATACCCCTGCTTCACACATCCAAACTACGCTCAATAACTTTCCGCCCCATCTCTCAAATCCTATTCTGAGCCCTAGTAGCCAACCTCCTAGTCCTCACCTGAGTTGGCAGCCAGCCAGTCGAGCACCCATTCATCATCATCGGACAGCTAGCCTCTCTCTCCTACTTCACAATCATCCTAATCCTATTCCCCTTGGCAGCTATCCTAGAAAATAAACTACTCAAATT----------ATA-GCC-----------CACTCTAATAGTTTATA-AAAACATTGGCCTTGTAAGCCAAAGATTGAAGACTACACATCTTCTTAGAGTT Cardinalis_cardinalis GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CATA-AACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--CCCGTAGCCCAAAACGCCTTGCAATTGCCACGCCCCCACGGGTATTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T----TAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCACC--TATCAAAGGAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCTCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTTCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCC--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GT-AGTAATGGGCTACATTTTCTAGATTAGAACA-T----CACGGCAAAGGGGTATGAAACAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGAGCACGTACATACCGCCCGTCACCCTCCTCGCAGG-CC-GCCCCCCCCCCCCCCAT-AACTAATAAGCTAT-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAACCT-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACATCGGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTGCAC-A-C-AACCC----AACTAAAGCATT---C--ATTAGT-CTTAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAGCCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTCCTCCAAGG-AAAA-TCACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AGT--ATTTAAACC-CCTAAC-CATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACTACAAAAATATAAG-AACTTCACGACTCCCT-CCCCATTAACAGGCTAACCTATACTCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGCA-CATTATTAACAAG-CCCCCC-ATATACGA--TAAAT---------CAA---ACAAGCA-CAG-TATTA-AATGAA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTAAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CT-CACCTA--C-T-GGGTTCACTGTC-ACA-CAA-GC-C-GCTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAGC-AAAACCTCCAA-AAATTAGACCATACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAAACAACTAAATTACAAAAGGCTATCAC-ACCAC---A-TCA-CATCCAAGAAAAGGA--T-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TAGATCACC---C--T----ATGAC----------TAACTACCCTCTTCTAGTTAACTTTATCATAGCCCTCTCCTATGCCCTGCCAATTCTAATCGCAGTAGCCTTCCTCACACTAGTAGAGCGTAAAATCCTAAGCTACATGCAAGGTCGAAAGGGCCCAAACGTTGTTGGCCCTTACGGACTGTTACAACCCCTGGCAGATGGTGTAAAACTATTTATTAAAGAGCCAATCCGTC---------CATCGACATCCTCTCCAATCTTATTTATCGCAACACCAATACTCGCTCTACTCCTAGCAATCTCAATCTGGACCCCACTGCCTCTTCCATTCTCCCTAGCAGACCTTAACCTGGGCTTACTCTTTCTACTAGCTATGTCAAGCCTAGCAGTATACTCTATTTTATGATCCGGCTGGGCCTCTAACTCAAAGTACGCTCTAATCGGGGCATTACGAGCAGTAGCCCAGACAATTTCATATGAGGTCACCCTGGCCATTATTCTCCTATCAGTTGTCTTACTAAGCGGCAACTACACCCTCAGCACTCTCGCAGTAACTCAAGAACCCCTGTACCTGATCTTCTCCTGCTGGCCTCTCGCCATAATGTGGTATGTCTCTACACTAGCAGAAACTAATCGTGCCCCCTTTGACCTAACAGAAGGGGAATCAGAACTAGTATCTGGTTTCAATGTAGAGTATGCAGCAGGTCCTTTTGCATTATTCTTCCTAGCTGAATACGCTAACATTATACTCATGAACACATTAACCACAATCCTCTTCTTCAACCCAAGCTTTTTAGACCCACCTCAAGAACTGTTCCCTGTTATTCTAGCCACAAAAGTCCTGCTCCTATCAGCAGGGTTCCTATGAATTCGAGCCTCCTACCCACGATTCCGATACGACCAACTAATGCACTTGCTGTGAAAAAACTTCCTACCGCTCACATTAGCCCTATGTCTCTGACACATCAGCATACTAATTTGCTACGCGGGCCTGCCT-----CCTTATCTA-A--GG-CC-----------TTAGTGGAAATGTGCCTGAACTC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTGCACCAGTCCTCTCATTTCCT-A--CCGA-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTCCCTTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAATCCCCAAGCAACCCTAATTTTCATCACCAGCCTTATACTAGGGACAACCATCACTATCTCAAGCAACCATTGAATTA---TAGCCTGAACTGGCCTAGAAATTAATACACTCGCCATTCTCCCACTGATCTCAAAGTCTCACCACCCACGAGCCATCGAAGCCGCTACTAAGTACTTCTTAACCCAGGCAGCCGCTTCTGCCCTGGTCCTATTCTCTAGCATAACTAATGCATGGCACACCGGACAGTGAGATATCACTCAACTAACTCACCCCACATCCTGCCTGATCCTTACTTCAGCAATCGCAATAAAACTAGGACTGGTCCCATTCCACTTCTGATTCCCAGAAGTACTTCAAGGCTCTCCTCTTACTACCGGTCTTATCCTATCTACCATTATAAAACTCCCCCCAATCGCACTACTCTACATAACTTCCCCCTCACTTAATCCAGCCCTCTTAACTACCTTAGCTATCCTCTCAACAGCCCTAGGCGGATGAATGGGCCTTAACCAAACACAAATCCGAAAAATCCTAGCATTCTCTTCTATCTCCCACCTAGGCTGAATGGCAATCATCATCGTCTACAACCCCAAACTTACCCTGCTCAACTTCTACCTTTACGCTGTAATAACTGCAACCATCTTCCTTACTCTAAACACAACCAAAGTACTCAAACTGTCTACCCTAATAACTGCATGAACTAAAGCTCCATCCCTAAACACAATGCTACTCCTAGCCCTACTCTCCCTTGCAGGACTCCCTCCTCTAACAGGATTCCTACCCAAATGACTTATTATTCAAGAACTAACTAAACAAGACATAGCCCTAGCAGCCACCCTCATCTCCCTTCTCTCTCTGCTAAGCCTGTTCTTCTACCTCCGCTTAGCATACTGCACAGCAATCACACTCCCCCCACACACCACAAATCACATAAAACAATGACGTACTAACAAGCCGACTAACGTCACAATCGCTATCCTGACCACCATTACTATCATACTCCTCCCCATCGCCCCTATGATCCTCACCATCGT------CT----AAGAAACTTAG----GATTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACTCTCTTAGTTTCTGCTAAAATCCGCAGGACACTACCCTGCATCCTCTGAATGCAACTCAGATACTTTAA-TTAAGCTAGGACTTT----CAA-TTCACTAGGCAGATGGGCTTTGATCCCATGACTC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTGCCT-A-------------AGACTCCGGTACATGT-CTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCAGTGACATTCATTACCCGATGACTATTCTCAACCAACCACAAAGATATTGGGACTCTGTACTTAATCTTCGGCGCATGAGCCGGGATGGTAGGTACAGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCTCTTCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCTCATGCTTTTGTAATAATTTTCTTCATAGTTATGCCAATTATAATCGGAGGGTTTGGTAACTGACTAGTTCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTCCTACCTCCATCTTTCCTTCTCCTCCTAGCATCTTCTACAGTCGAAGCGGGTGTCGGCACAGGATGAACAGTATATCCCCCACTTGCTGGCAACTTAGCCCATGCTGGAGCTTCAGTCGACCTTGCTATCTTCTCCTTACACCTAGCTGGTATCTCCTCAATCCTAGGGGCTATCAACTTTATCACAACAGCAATCAATATAAAACCCCCTGCCCTCTCACAATACCAAACCCCACTATTCGTCTGATCCGTACTAATCACTGCAGTCCTACTACTCCTATCTCTACCAGTACTAGCTGCAGGAATTACAATGCTCCTTACAGACCGTAACCTCAATACTACATTCTTCGACCCTGCTGGAGGAGGAGACCCTATTCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCTTAATCCTACCAGGATTCGGAATCATCTCCCACGTCGTAACCTACTACGCAGGTAAAAAAGAACCATTTGGTTACATAGGAATAGTATGAGCTATACTATCTATTGGATTCCTAGGATTTATTGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTCGACACCCGAGCATACTTTACATCTGCCACTATAATCATTGCCATCCCAACTGGAATCAAAGTATTCAGCTGACTAGCCACACTACATGGAGGTACAATCAAATGAGACCCTCCAATACTATGAGCCCTAGGATTCATTTTCCTATTCACCATTGGAGGACTAACAGGGATTGTACTAGCAAACTCCTCACTAGACATTGCCCTGCATGACACTTACTACGTAGTAGCCCACTTCCACTACGTGCTATCTATAGGAGCAGTATTCGCAATCCTAGCAGGCTTCACCCACTGATTCCCCCTATTCACTGGCTATACTCTACACTCAACATGAGCAAAAGTACACTTCGGTGTAATATTTGTAGGTGTCAACCTAACTTTCTTCCCACAGCACTTCCTAGGTTTAGCTGGCATGCCTCGACGATACTCAGACTACCCAGACGCCTACACGCTATGAAACGCTATTTCTTCAGTAGGATCACTCATCTCTCTAACAGCCGTAATTATGCTAATTTTCATTATCTGAGAGGCCTTTGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACAAATGTTGAATGAATCCACGGCTGCCCACCTCCATTCCACACCTTCGAAGAACCTGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---ATA---GAGATGTTAGT-AAAACT-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAACCCCAGCACATCTCT-----CCAC--AAACATGGCCAACCACTCACAACTTAACTTCCAAGATGCTTCCTCACCCATCATAGAAGAACTAATAGGGTTCCACGACCATGCCCTAATAGTCGCACTAGCAATTTGCAGCCTAGTCCTCTACCTACTAACCCACACACTCACAGAAAAACTAACATCAAACACAGTCAATGCGCAAGTAATCGAGCTTGTTTGAACAATCCTCCCAGCCATAGTCCTAGTCATGCTCGCCCTACCATCCTTACGAATCCTCTACATAATAGACGAAATCAATGAACCTGATTTAACCCTAAAAGCTATTGGTCACCAATGATATTGAACCTACGAATATACTGACCTTAAAGACCTATCATTTGACTCTTACATAATCCCGACAGCAGACTTACCTTTAGGCCACTTCCGCCTGCTAGAAGTAGACCACCGAGTTGTTGTCCCTATAAGCTCCACTATCCGAGTTATCGTCACTGCTGACGACGTCCTCCACTCATGAGCAGTCCCCAGCCTAGGTGTAAAAACGGACGCAGTGCCAGGCCGCCTTAACCAAACTTCTTTCTTTGCTTCCCGACCGGGCGTTTTCTACGGACAATGCTCAGAAATCTGCGGAGCTAACCATAGCTTCATGCCGATCGTTGTAGAATCTACTCCACTTGCCGACTTCGAAAACTGATCATCTCTAA---TCCCATCCT----------AATCATTAAGAAGCTATGGACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGAT-TCCTCCCCTCCTTAATGGTATGCCTCAACTAAACCCCAACCCTTGATTTTTTATCATGCTCACTTCATGACTTACCTTCTCCCTTATCATCCAGCCTAAACTACTATCATTTATCTCAATGAACCCGCCTTCTAACAAAC---CCCCCATTGCCCCTAACACCACTCCCTGAACCTGACCATGAACTTAAGCTTCTTTGATCAATTCTCTAGCCCATCTTTTCTAGGAATCCCTCTAATCCTCATCTCAATAACATTCCCAGCCCTCCTACTGCCATCCCTAGACAACCGATGAATCACTAACCGCCTTTCAACACTCCAACTATGATTCATCAACCTAGTTACAAAACAACTAATAATACCCCTAGATAAAAAAGGACACAAATGAGCCCTAATCCTAACATCCCTCTTAATCTTCCTCCTGCTCATCAACCTCCTAGGATTGCTACCCTACACATTCACCCCAACTACCCAGCTATCTATAAACTTAGCCCTAGCTTTCCCCCTGTGACTAGCCACCCTTCTAACAGGCCTACGAAACCAACCTTCTGCCTCCCTAGGCCACCTCCTGCCAGAAGGCACTCCAACTCCGCTGATCCCTGCTCTAATCCTGATTGAAACAACAAGCCTACTCATCCGCCCACTAGCGCTAGGAGTGCGCCTAACAGCCAACCTCACAGCAGGCCACCTACTCATCCAACTCATCTCTACAGCTACAGTAGCCCTATTCTCTACAATGCCCGTAGTCTCACTTCTCACCCTACTAGTTCTATTCCTACTAACCATCTTAGAAGTAGCAGTAGCGATAATCCAAGCCTATGTCTTCGTACTCCTACTGAGCCTCTACCTACAAGAAAATATTTAACCC--TC----AATGGCACACCAAGCACACTCTTATCACATAGTCGACCCCAGCCCTTGACCTATCCTAGGAGCAGCCGCTGCTCTAATGACTACTTCTGGCCTAACAATATGATTCCACTACAACTCCCCTCGATTACTCATCCTAGGCCTAATCTCAACCATTCTAGTCATGTTCCAATGATGACGTGACGTTATCCGAGAAAGCACATTCCAAGGCCACCACACCCCTACCGTACAAAAAGGGCTACGCTACGGAATAGTCCTATTTATTACATCAGAAGCTTTCTTCTTCCTAGGATTCTTCTGAGCTTTCTTCCACTCAAGCCTAGCCCCTAC-CCCGAACTAGGAGGGCAATGACC-CCCGTTGGAATTAAACCCCTAAACCCCATGGAAGTCCCACTCCTAAACACCGCTATCCTCCTAGCCTCCGGAGTCACCGTTACATGAGCCCACCATAGCATTACAGAGGCCAATCGAAAACAAGCAATCCAAGCCCTACTTCTAACAGTCCTCCTAGGATTCTACTTCACTGCCCTACAGGCCATAGAATACTACGAAGCCCCCTTCTCTATCGCTGACGGAGTCTACGGCTCCACATTCTTTGTCGCCACAGGATTCCACGGATTACATGTCATCATTGGTTCTACATTCCTACTAGTATGCCTTCTGCGCCTAATCAAGTACCACTTCACATCTAACCACCACTTTGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGACTTCTCCTCTATATTTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCTCATTCATACTAACTCTATCACTGGCCCTAAGCATCCTTTTAACCGCACTAAACTTTTGACTCGCCCAAATAACCCCAGACTCTGAAAAACTATCTCCATACGAGTGCGGATTCGACCCCCTAGGATCTGCCCGACTTCCTTTCTCAATTCGCTTCTTCCTAGTAGCCATCCTCTTCCTCCTCTTCGACCTAGAAATTGCCCTACTCCTTCCACTCCCATGAGCCACCCAACTACAATCCCCTACTACAACCCTAATCTGAGCCTTTATACTTATCCTCCTCCTTACTCTAGGATTAGTGTACGAATGAATTCAAGGAGGACTAGAATGAGCAGAGTA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGGCTCAACAAATTATAG-TACTACCCTATAACTTTCTTTATGTCTTACCTTCACTTAAGCTTCTACTCAGCCTTCACCCTAAGTAGCCTAGGCCTAGCCTTTCACCGAACCCATCTGATTTCAGCCCTACTGTGCCTAGAGAGTATAATATTATCCATATACGTCGCCCTGGCCATATGACCCATCCAGATACAATCCTCAATCTCCACCATCCTGCCCATTATCATACTAACATTTTCTGCCTGCGAAGCGGGCACAGGACTAGCCCTACTAGTGGCTTCAACCCGAACTCACGGGTCTGACCACCTACACAACTTTAACCTCCTACAATGCTAAAAATCATCATTCCAACTTCAATACTTCTCCCCCTAGCCCTCCTCTCCCCACGCAAACACCTATGAACCAACACTACACTATATAGCCTACTAATTGCTACCATTAGCCTCCAATGACTAACTCCCACATACTACCCAAGTAAAAGCCTAACTCCTTGAACATCCATCGATCAAATCTCCTCCCCTCTATTAGTACTCTCATGCTGATTACTTCCCCTCATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCTATCACCCGCAAACGAATCTTCGCCACAACCGTAATCTTAGCCCAACTATTTATCCTCCTAGCCTTCTCAGCCTCAGAACTAATACTCTTTTACATCGCATTTGAAGCCACCCTCATCCCCACCTTAATCCTTATCACACGATGAGGAAATCAACCAGAACGACTAAACGCCGGTATCTACCTACTATTCTACACCCTCGCCAGCTCGCTCCCATTACTAATTGCCATCCTCCACTTGCACAATCAAATCGGCACATTATACCTCCCCATGCTCAAACTCTCACACCCTACACTAAATTCTTCCTGATCGAGCCTATTCGCAAGCCTAGCCCTTTTAATAGCCTTCATGGTAAAAGCCCCTTTATATGGCTTACACCTATGACTCCCCAAAGCCCACGTAGAAGCTCCTATCGCAGGCTCCATACTACTAGCAGCCCTACTCCTAAAACTCGGCGGCTACGGAATCATACGAATCACGATCCTAGTAAACCCCACATCAAACAACCTCCACTACCCCTTCATCACCCTAGCCTTATGAGGAGCCCTAATAACCAGTGCCATCTGCCTACGCCAAATCGACCTAAAATCTTTAATTGCCTACTCTTCTGTCAGCCACATAGGACTAGTTGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCTATAATTCTGATAATTTCCCATGGCCTAACCTCCTCAATACTATTCTGCTTAGCCAACACTAACTATGAACGAACCCACAGTCGAATCCTCTTGCTCACACGAGGACTTCAACCCCTTCTGCCCCTCATGGCCACCTGATGACTCCTAGCCAACCTAACAAACATAGCCCTCCCTCCAACTACAAACCTCATAGCAGAACTTACCATTGTAATCGCCCTTTTCAACTGATCTGCCTTCACAATTATCCTAACAGGAGCCGCAATCCTACTTACCGCCTCATATACCCTATACATACTGATAATAACACAACGAGGCACCCTCCCATCTCACATCACATCAATTCAAAACTCTTCTACACGAGAGCACCTCCTCATAGCCCTTCACATAATCCCCATGATGCTCCTAATTCTCAAACCTGAGTTAATTTCAGGCATCCCTATAT-GCAAGTATAGTTT-TAA-CCAAAACATTAGACCGTGACTCTAAA-ATAGAAGTTAGACCCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAACGAGAGCTGCTAACTCTTGTATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTCACCCTAGCAACCCTCTCCACCCCCATCCTATTCCCCCTTTTATCCGACAATTTCAAAAATAACCCTAACACAATTACTAACACGGTTAAAACTTCCTTCCTAATCAGCCTCATCCCAATAATAACCTACATTTACTCCGGAACAGAAAGTCTTACTTCTCTCTGAGAGTGAAAATTCATTACAAATTTCAAAATCCCCATCAGCCTGAAAATAGACTTCTACTCCCTCACTTTCTTCCCCATCGCACTATTCGTATCATGATCCATCTTACAATTCGCAACATGATATATAGCTTCAGACCCTTACATCACAAAATTTTTCACTTATCTACTATTCTTCCTAATCGCCATGCTCATTTTAATTATCGCCAACAACCTATTCATTCTCTTCATCGGCTGAGAAGGGGTAGGAATCATATCCTTCTTACTAATCAGTTGATGATACGGCCGAGCAGAAGCTAATACTGCTGCCCTCCAGGCTGTGCTTTACAACCGAGTCGGGGACATCGGACTCATCCTCTGCATAGCATGACTAGCTTCTACCACAAACACCTGAGAAATCCAACAACTCCCCCTCTCCCCCCAAACCCC-ACACTTCCTCTACTAGGCCTCATCCTAGCTGCAACCGGAAAATCTGCCCAATTCGGCCTCCACCCATGACTACCAGCTGCAATAGAAGGACCAACCCCCGTATCTGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCTTACTCATCCGAACTCACCCTCTATTCAGCAACAATCAAACTGCTCTAACTTTATGCCTATGCCTAGGAGCCCTTTCTACATTATTTGCAGCCACATGTGCTCTCACCCAAAATGATATT?AAAAAATCATTGCCTTCTCCACCTCAAGCCAACTAGGACTTATAATAGTTACCATCGGACTAAACCTCCCAGAACTAGCTTTCCTCCACATCTCAACTCATGCATTTTTCAAAGCCATACTCTTCCTATGTTCAGGCTCTATCATCCACAGCCTAAATGGTGAACAAGACATTCGAAAAATAGGAGGACTCCAAAAAATACTTCCTACAACCACCGCATGCCTCACCATTGGAAACCTTGCCCTAATAGGAACACCATTCCTAGCAGGCTTCTACTCAAAAGATCAAATCATTGAAAGCCTTAGCACTTCCTACCTAAACACCTGAGCTTTAGTTCTCACTCTCCTGGCCACATCATTCACCGCAGTCTACACAATCCGAATAACCACATTAGTTCAGACCGGCTTCGTTCGGATTTCACCCTTAACCCCTATAAATGAAAACAACCCCGCAGTAACTTCTCCCATCACCCGTCTCGCATTAGGAAGTATCCTGGCAGGATTCTTCATCACCTCATTTATTATTC---CCACAAAAACCCCTCCAATAACTATACCTCTATCCATCAAAATAACCGCCCTAGTCGTGACAGCCCTAGGAATCGCTTTAGCACTAGAAATTTCAAAAATAACTCAAACACTCATCCTTACAAAACAGACTCCTTTCTCAAACTTCTCCACTTCCCTAGGATACTTCAATCCCCTAACCCACCGCCTAAGTATGACTAATCTCCTCAGCAGTGGACAAAACATTGCCTCCCACCTAATCGACCTCTCCTGATACAAAATACTAGGACCAGAAGGACTAGCTAACTTACAACTAATAGCAGCCAAAACTGCCACCACCCTCCACTCCGGCCTAATCAAGTCCTACTTAGGAGCATTCGCCCTATCCATCCTCATCATCCTGA---TATCCACATATAGAAA--CAA-T-C---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAACAATGCCCTAATTGACCTCCCAGCTCCATCAAATATCTCATCCTGATGAAACTTCGGATCCCTATTAGGTATTTGCCTCATCACTCAGATCGTCACAGGCCTCCTGCTAGCCATACACTACACAGCAGACACCAACCTAGCTTTCTCCTCCGTCGCTCACATTTGCCGAGACGTGCAATTCGGCTGACTTATTCGTAACCTCCATGCAAACGGAGCTTCTTTCTTCTTTATCTGCATCTACTTCCACATCGGCCGAGGAATTTACTACGGCTCATACCTAAATAAAGAAACCTGAAATATTGGAGTTATTTTACTCCTAGCCCTCATAGCAACCGCCTTCGTAGGATACGTCCTACCATGAGGCCAAATATCATTCTGAGGGGCTACCGTAATCACAAAC?TATTTTCAGCCATTCCCTACATCGGACAAACACTAGTCGAATGAGCCTGAGGTGGATTCTCCGTAGACAACCCCACACTAACCCGATTCTTCGCCCTACACTTCCTGCTCCCATTCCTCATCGTAGGGCTCACACTTGTCCATCTAACCTTCCTCCATGAAACAGGCTCAAACAACCCACTAGGCATTCCTTCAGACTGCGACAAAATTCCCTTCCACCCATACTACACTATCAAAGACATCCTAGGATTCGTATTAATAATCTCTCTGCTCGTCTCACTAGCCCTATTTGCCCCCAACCTCCTAGGAGACCCAGAAAACTTTACACCAGCCAACCCACTAGTCACTCCTCCCCACATTAAACCAGAATGATACTTCCTATTTGCCTACGCCATCCTACGATCCATCCCAAACAAACTGGGAGGCGTATTAGCTCTAGCCGCATCCATTCTAGTACTGTTCCTCATACCACTACTCCATACATCTAAACTACGCTCAATAACCTTCCGCCCTATCTCCCAAATCCTATTCTGAACCCTAGTTGCTAACATCCTTATCCTCACATGAGTAGGCAGCCAACCAGTAGAACACCCATTCATTATCATTGGACAGCTAGCCTCATTCACATACTTTGCAATCATTCTAGTTTTATTCCCCCTCGCGGCCGCTTTTGAAAATAAACTACTCAAACT----------CTA-GCT-----------AACTCTAATAGTTTATG-AAAACATTGGTCTTGTAAACCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Carduelis_pinus GTTCTTGTAGCTTATAG-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-AACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGACGCCCTGGACA-CCT-T-AA-C-C-----AAGTAGATAGGAGCAGGCATCAGGCACA--C------CAT-T--ACCGTAGCCCAAGACGTCTTGCATTTGCCACGCCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-TGATAAGGCCTCC-TCGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAG--AA--CAGCCTACATACCGCCGTCTCCAGTTCACCTACC--CTGAAAGCCCAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GT-AGTAATGGGCTACATTTTCTAAATTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCATAGG-CG-----CCCCCCCCCCCATAAATTAATAAGCTAT-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCCTACACCTGAAAAATGTCTGTTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--GC-ATA-CACCC----AACTAAAGCATT---T--ACTAGT-CTTAGTATAGGCGATAGAAAGGACA-CCA-TTGGC-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--CTTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AATATA-CC-CCAATC--ATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCCATAAAAATATAAG-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--TTAAT---------CAA---ACAAGCA-GAG-TATTA-GGTACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTATAA-CACATA----CA-CACCCA--C-C-GGGTTCACTGTC-ACA-TAA-GA-T-ATTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAACCTCCAA-AAATTAGACCAAACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCGAGAGTCCATATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAATT---TA-----ATAACC--C----ATGAC----------CAACTACCCCCTACTAATCAACCTCATCATAGCCCTATCCTACGCCCTCCCAATCTTAATCGCAGTAGCTTTCCTCACACTAGTAGAGCGCAAAATCTTAAGCTACATACAAGGTCGAAAAGGGCCAAACATTGTTGGTCCATATGGCCTCCTTCAACCCCTAGCAGACGGAGTAAAATTATTCATCAAAGAACCCATCCGAC---------CCTCAACATCCTCGCCAATCCTATTTATTGCAACCCCAATACTAGCCCTACTCCTAGCAATCTCTATCTGAACTCCCCTACCACTACCATTCTCTCTAGCAGATCTCAACCTAGGCCTTTTATTCCTACTAGCTATATCAAGCCTGGCAGTATACTCCATTCTATGATCTGGCTGAGCATCCAACTCAAAATACGCTCTAATTGGGGCATTACGAGCAGTAGCCCAAACAATTTCATACGAAGTAACTTTAGCAATTATCCTCCTATCTGTAATTCTCCTCAGCGGCAACTACACCCTCAGCACCCTCGCAGTTACCCAAGAACCCCTCTATCTTATCTTCTCATGCTGACCCCTCGCTATAATATGATATGTCTCTACACTTGCTGAAACCAACCGTGCCCCCTTTGATTTAACAGAAGGAGAATCTGAACTAGTATCCGGATTCAACGTAGAGTACGCAGCAGGCCCATTCGCACTATTCTTCCTAGCAGAATATGCTAATATTATACTCATGAACACCATTACCACCATCCTATTCTTTAATCCAAGCCTACTAAACCCACCACAAGAACTATTCCCCGTAGTACTAGCCACTAAAGTCCTGCTACTCTCAGCAGGATTCCTATGAATTCGTGCTTCCTACCCCCGATTCCGATATGATCAACTAATGCACCTACTATGAAAAAACTTCCTACCCCTTACACTCGCTCTATGCCTTTGACATACCAGCATACCAATTTGCTATGCAGGACTACCC-----CCCTATCTA-A--GA--CCCCCCCC----CCATCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAATCCTCTCATTTCCT-A--CGAC-------TTAGAAAAGCAGGAGTCGAACCTACACTAGAGAAATCAAAATTCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAATCCACAGGCAAAACTAATCTTCACAATCAGCCTGCTCCTAGGAACCACTATCACGATCTCAAGCAACCATTGAATTA---TGGCCTGAACTGGCCTAGAAATCAATACACTTGCCATTCTACCCCTAATCTCAAAATCTCACCACCCACGATCCATTGAGGCAGCCACCAAATACTTCCTAACCCAAGCAGCTGCCTCAACCCTCGTACTATTCTCTAGTATAACTAACGCATGATGTACTGGACAATGAGACATCACCCAACTCTCCCATCCCACATCAAGCCTGATTCTAACCTCAGCAATTGCCATAAAACTAGGATTAGTCCCATTCCACTTCTGATTTCCAGAAGTACTACAAGGTTCCCCTCTCTCCACCGGCCTCATCCTATCTACTATCATAAAACTCCCTCCAATCACCCTCCTATACATAACTTCCTCATCACTAAACCCTACACTCCTAACCACCCTGGCCATTCTGTCAGTAGCTATCGGCGGATGAATGGGACTAAACCAAACACAAATCCGAAAAATCCTAGCCTTTTCCTCCATCTCCCACCTAGGATGAATGACAATCGTCATCATCTACAACCCTAAACTCACCCTCCTCAACTTCTATCTATACACCATAATAACTGCAGCCGTCTTTCTAACCCTAAACTCAATTAAAGTGCTGAAACTATCCACCTTAATAACAGCATGGACTAAAGTCCCATCACTAAATGCAATACTACTTCTAACCCTACTATCCCTCGCAGGTCTACCTCCCCTAACAGGATTCCTACCCAAATGACTCATCATTCAAGAACTAACTAAACAAGAAATAATCCCTGCAGCTACACTTATTTCTCTCCTCTCCCTACTAAGCCTATTCTTCTACCTCCGCCTTGCATATTGTACAACAATCACACTCCCACCACACACCACAAACCACATAAAACAATGACGCACCGGCAAATCAACTCATGTCCTGATTGCCATCCTAACCACAATATCTGTCATCCTCCTTCCCATCTCACCTATAATCCTCACCATTAT------CT----AAGAAACTTAG----GATTAA-T-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTGAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGTTATTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-G--CAA-CTTACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACACGA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AGCCACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGAACCCTATACCTAATTTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTAAGCCTTCTCATCCGAGCAGAATTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCCCATGCTTTCGTTATAATCTTTTTCATAGTTATACCCATCATAATCGGAGGGTTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTCCCCCCATCATTCCTCCTCCTACTAGCATCCTCCACCGTAGAAGCAGGTGTTGGTACAGGTTGAACAGTGTATCCCCCACTAGCTGGTAACCTAGCCCATGCCGGAGCTTCAGTTGACCTAGCAATCTTCTCCCTACACCTAGCCGGTATTTCTTCAATTCTAGGTGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTCTGATCAGTCCTAATTACTGCAGTACTCCTACTCCTTTCCCTCCCAGTTCTCGCTGCAGGAATTACAATACTTCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTCCTATACCAACACCTTTTCTGATTCTTTGGTCACCCAGAAGTATACATCCTCATCCTCCCAGGATTTGGAATTATTTCCCACGTTGTAACCTACTACGCAGG?AAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATGCTATCCATTGGATTCCTAGGATTCATCGTATGAGCTCACCACATATTCACAGTCGGAATGGACGTTGACACTCGAGCATACTTCACATCAGCCACTATAATCATTGCCATCCCAACCGGAATCAAAGTGTTCAGCTGATTAGCTACACTTCACGGAGGCATTATCAAATGAGATCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACCATCGGAGGACTAACAGGAATTGTCCTAGCAAACTCTTCACTAGACATTGCTCTACACGACACTTACTATGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTATTCGCAATCCTAGCAGGCTTCACACACTGATTCCCACTATTCACCGGATATACTCTCCACTCAACATGAGCCAAAATCCACTTTGGTGTAATATTCGTAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCAGGCATACCACGCCGATACTCAGACTACCCTGACGCCTATACCCTATGAAACACCATCTCCTCCGTAGGTTCCTTAATCTCTCTTACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCTTTCGCATCTAAACGTAAAGTTCTACAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCCTTCCACACCTTCGAAGAACCTGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGACGTTAGT-AAAACC-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGCGGAACCCCTGCACGTCTCTC---TACCC--AAACATGGCTAACCACTCACAATTCAACTTTCAAGACGCCTCCTCTCCCATCATAGAAGAACTAATAGGATTCCACGACCATGCTCTAATAGTTGCATTAGCAATCTGCAGCCTAGTACTATACCTACTAACCCACATACTCACAGAAAAACTCTCATCAAGCACAGTAGACGCACAAGAAATCGAACTAGTTTGAACAATCCTCCCAGCCATAGTATTAATTATACTTGCACTACCATCCCTACGAATCCTGTACATAATAGACGAAATTAATGAACCCGACCTCACCCTAAAAGCCATCGGCCACCAATGATACTGAACGTACGAATACACTGACCTCAAAGACCTAACATTCGACTCCTACATGATCCCAACATCAGATCTACCTCTAGGACACTTCCGTCTACTAGAAGTAGACCATCGCGTTGTAGTCCCTATAAGCTCTACAATCCGAGTCATTGTCACTGCCGATGACGTACTCCACTCATGAGCTGTCCCAAGCTTAGGTGTAAAAACTGACGCAATCCCAGGCCGCCTCAACCAAACTTCCTTCCTCGCCTCTCGGCCCGGAGTATTCTACGGACAATGCTCAGAAATTTGCGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACTCCTCTCGCTAACTTCGAAAACTGATCTTCTACAA---CAGCCCCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-CCA-CCCCTCCTTAATGATATGCCTCAACTAAACCCCGCACCATGATTTTTTATCATGATCATTTCATGACTCACTTTTTCCCTCATTATTCAGCCCAAAATCCTTACATTCGTAACAATAAACCCTCCATCCAATAAAC---CTCCCATCGCCCCAAGTACCACCCCCTGAACCTGACCATGAACCTAACTTTCTTCGACCAATTCTCAAGTCCATCCCTACTAGGAATCCCACTCATCCTCATTTCAATAACATTCCCCGCCCTCCTAATTCCTTCCCTGGACAACCGATGAATCACCAACCGACTTTCAACCCTCCAATTATGATTCATCAACCTAGTCACAAAACAACTAATAATACCCTTAGACAAAAAAGGACACAAATGAGCCCTAATCCTGACATCCCTAATAATCTTCCTCCTACTTATCAACCTTCTAGGCCTACTACCATACACATTTACCCCAACTACCCAGCTATCTATAAACCTAGCACTGGCTTTCCCCCTATGACTTGCCACCCTATTAACAGGCTTACGGAACCAACCCTCTGCCTCACTAGGCCACCTCCTGCCAGAAGGTACCCCAACCCCACTAATCCCTGCCCTAATCCTAATTGAAACAACAAGCCTACTCATCCGCCCACTAGCCCTAGGCGTACGCCTAACAGCCAACCTCACAGCAGGTCACCTACTCATCCAACTCATCTCCACTGCCACAACAGCCTTATTCACTACAATACCAGTAGTGTCACTCCTAACCCTCCTAGTCCTTTTCCTACTAACTATTCTAGAAGTAGCTGTAGCAATAATCCAAGCCTATGTTTTCGTACTCTTACTAAGCCTATACCTACAAGAAAACATCT-AACC--CT--ACAATGGCACACCAAGCACATTCCTATCACATAGTAGACCCCAGCCCATGACCTATCCTAGGAGCCGCTGCCGCCCTCCTAACTACATCAGGACTAACAATATGATTCCACCACAACTCCCCTCAACTCCTCATCCTAGGCCTACTATCCACCGCCCTAGTTATATTCCAATGATGACGAGATATTATCCGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAGAAAGGACTACGATATGGTATAGCCCTATTCATCACATCCGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCTACCCCAGAACTAGGAGGACAATGACCACCTGTCGGAATCACACCCCTAAACCCGATAGAAGTACCACTACTAAACACTGCCATCCTACTAGCCTCTGGAGTTACCGTAACATGAGCCCACCACAGCATCACAGAAGCCAGCCGAAAACAAGCAATCCACGCCCTAACCCTAACCGTTCTCCTAGGATTCTACTTCACTGCACTACAAGCCATAGAATACTACGAAGCACCATTTTCAATCGCAGACGGAATCTACGGCTCTACATTCTTCGTTGCCACAGGATTCCACGGCCTACACGTAATCATTGGCTCAACATTCCTATTAGTATGCCTACTTCGCCTGATCAAATACCACTTCACACCAAGCCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTATATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTTATACTGACCCTATCATTCACCCTAAGCATCCTACTAACCGCACTAAACTTTTGATTGGCCCAAATAAACCCAGACTCAGAAAAATTATCTCCCTACGAATGCGGATTCGACCCCCTAGGCTCCGCCCGACTGCCCTTCTCAATCCGATTCTTCCTGGTAGCTATCCTGTTCCTCCTCTTCGACCTAGAAATTGCCCTCCTGCTTCCACTGCCATGAGCTACCCAACTAGAATCTCCTATAACCACCCTAACCTGAACCTCCATCCTCCTCCTCCTCCTAACACTAGGGCTTATCTACGAATGAATCCAAGGCGGATTAGAATGAGCAGAATA-A------TAGAAAGTTAGTCTAACTAAGACGGTTGATTTCGGCTCAACAAATTATAGCTCACACCCTATAACTTTCTTTATGTCCTATCTCCACCTCAGCTTTTACTCAGCCTTCACCCTAAGCAGCCTAGGCCTAGCTTTCCACCGAACTCATCTAATCTCCGCTCTCCTCTGCCTAGAAAGCATAATACTATCCATATACGTAGCACTCGCCATATGACCTATCCAAATACAATCACCAACCTCCACCATCCTACCAATCATCATACTAACATTCTCCGCCTGCGAAGCAGGAACAGGCCTAGCCCTGCTAGTCGCCTCTACCCGAACCCACGGTTCAGACCACCTACACAACTTCAACCTTCTACAATGCTAAAAATCTTAATTCCAACTGCAACACTCCTACCCCTAGCCCTAATATCCCCACTTAAACACCTATGAACTAATATCACACTGCACAGCCTAATCATTGCTACCATCAGCCTACAATGATTAACACCAACATACTACCCAAGCAAAAGCTTAACTCCCTGAACATCAATCGATCAAATCTCCTCCCCCCTCCTAGTTCTCTCATGCTGACTCCTTCCCCTCATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCATTATCCGCAAACGAATCTTCGCTACAACAGTAATTCTAGCCCAACTATTCATCCTCTTAGCCTTCTCAGCCTCCGAACTAATACTCTTCTACATCGCATTTGAAGCAACCCTCATCCCCACCCTTATCCTCATTACACGATGAGGAAATCAACCAGAACGACTAAACGCTGGAATTTACCTCCTATTCTACACCCTAGCCAGCTCACTCCCCCTACTAATTGCTATCCTTCACCTACAAAACCAAATCGGCACACTCTATCTCCCCATACTAAAACTATCACACCCTACAATAAACTCCTCCTGATCCGGATTAATCGCAAGCCTCGCCCTTCTCCTTGCCTTCATAGTTAAAGCCCCCCTATACGGCCTACACCTATGACTCCCCAAAGCACATGTAGAAGCTCCAATCGCCGGTTCCATACTACTAGCCGCCCTTCTCCTAAAACTAGGAGGCTACGGCATCATACGAATCACAATCCTAGTAAACCCAGCATCAAACAACCTACACTACCCATTCATCACCCTGGCCCTATGAGGAGCATTAATAACCAGCGCCATCTGCTTACGACAAATCGACCTAAAATCACTAATCGCCTACTCATCCGTCAGCCACATAGGACTAGTCGTAGCTGCAACCATAATTCAAACCCAATGAGCATTCTCAGGAGCAATAATCTTAATAATCTCACACGGCCTAACCTCATCAATACTATTCTGCCTAGCCAATACCAACTACGAACGAACCCACAGCCGAATCCTCCTCCTCACACGAGGGCTCCAACCCCTCCTACCACTGATAGCCATCTGATGACTTCTAGCAAACCTAACAAACATAGCTCTTCCTCCAACAACCAACCTCATAGCAGAGTTAACCATCGTCATCGCACTATTCAACTGATCTGCCTTTACAATCATCCTAACAGGAGCGGCAATCCTACTCACCGCTTCTTACACCCTCTACATACTCATAATAACACAACGAGGCGCACTTCCATCCCACATCACCTCAATCCAAAACTCCACCACCCGAGAACATCTCCTCATAGCCCTCCACATAATCCCAATACTGCTCCTCATCCTTAAGCCCGAACTAATCTCTGGTATCCCTATAT-GCAAGTATAGTTT-TAA-CCAAAACATTAGACTGTGATCCTAAAAATAGAAGTTAAAATCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACAAGAACTGCTAACTCTTGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGCAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGTCCTAAACACATTCATACTCCTAACCCTAGCAACCCTCTCCACACCCATCCTATTTCCCCTCCTATCCCCCAACTCCAAAAGCACCCCTAACACCATCACAAACACAGTTAAAGCCTCCTTCCTAATCAGCTTAGTCCCCATGACAATTCACATCTACTCAGGGACAGAAAGCCTCACTTCCCTATGAGAATGAAAATTCATCATAAACTTCAAAATCCCTATCAGCCTAAAAATAGACTTCTACTCACTCACCTTCTTCCCTATTGCACTATTCGTCTCATGATCCATCTTACAATTTGCAACATGATACATAGCTTCAGACCCCTACATCACAAAATTCTTCATCTACCTACTACTCTTCCTAATAGCAATACTCATCCTAATTCTCGCCAACAATTTATTCGTCCTGTTCATCGGCTGAGAAGGGGTCGGAATCATATCCTTCCTACTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTACAAGCCGTTCTATACAATCGAGTAGGAGACATCGGCCTCATCCTTTGCATAGCATGACTAGCCTCAACCATAAACACCTGAGAAATCCACCAACTCCCCTCCCCATCACAAACCCCAACACTACCTCTACTAGGCCTCATCCTAGCTGCAACTGGCAAATCAGCCCAATTCGGCCTTCACCCTTGACTGCCCGCCGCCATAGAAGGACCTACCCCTGTTTCTGCCCTACTTCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTGCTCATCCGAACTCACCCCCTACTCAGCAATAACCAAACCGCTCTAACCCTCTGCCTATGCCTGGGGGCCCTCTCCACCCTATTCGCAGCTACATGTGCCCTCACCCAAAACGATATCAAAAAAATCATCGCCTTCTCTACCTCAAGCCAACTAGGCCTAATAATAGTTACAATCGGACTCAACCTCCCCGAACTAGCCTTCCTTCACATCTCAACTCACGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGATCTATTATCCACAGCCTAAACGGCGAACAGGACATCCGAAAAATAGGAGGACTCCAAAAAATAATACCTACAACCACCTCATGCTTTACTATCGGCAACTTAGCACTAATAGGAACTCCATTCCTAGCAGGATTTTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCATACCTAAACACCTGAGCCCTACTACTAACCCTCCTAGCTACATCATTCACCGCAGTATACACAATTCGCATAACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCTCCTCTAACCCCAATAAATGAAAACGACCCCGCAGTGACTTCGCCCATCACCCGACTTGCACTAGGAAGCATCCTAACAGGATTCCTCATCACCTCATTCATCATTC---CCACAAAAACTCCTACAATAACTATACCCCTATCTATCAAAATAACAGCCCTAATAGTAACCGCCCTAGGAATTGCTTTAGCCCTAGAAATTACAAAAATAGCCCAAACCCTTCTCCTTACAAAACAAACCACCTTCTCAAACTTCTCCACATCCCTAGGATACTTTAACCCCTTAACCCACCGCTTAGCCATAACCAACCTCCTCAACGGAGGACAAAACATCGCTTCACACCTAATTGACCTATCCTGATACAAAATCCTAGGCCCAGAAGGACTAGCCAACCTACAGCTAATAGCAACCAAAACCGCTACTTCCCTCCACTCAGGCCTAATCAAGGCCTACCTAGGAGCATTCGCCCTATCCATCATCATTATTCTCA---TATCCATACACAGAAC--CAA-T-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTCAAAGTCATCAACAACGCCCTAATTGACCTTCCTACACCACCGAACATCTCTACATGATGAAACTTCGGGTCTCTACTGGGCATTTGCCTAATTACCCAAATTGTTACAGGCCTCCTGCTAGCCACCCACTACACAGCAGACACCAACCTAGCTTTCTCCTCCGTAGCTCACATATGCCGCGACGTCCAATTCGGCTGACTAATCCGCAACCTTCACGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTTCACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTTATCCTACTACTAACCCTCATAGCAACCGCCTTCGTAGGTTATGTCCTACCATGAGGCCAAATATCATTCTGAGGTGCTACAGTAATTACAAACCTATTTTCAGCAATCCCCTACATTGGACAGACATTAGTAGAATGAGCCTGAGGAGGATTCTCCGTAGACAACCCTACACTAACCCGCTTCTTTGCCCTCCACTTCCTACTCCCATTTGTTATCGTAGGTCTCACACTAGTTCACCTCACCTTCCTACACGAAACAGGATCAAACAACCCAACAGGAGTCCCCTCAGACTGCGACAAAATTCCATTCCACCCATACTACACCGTAAAAGACATTCTAGGTTTCGCACTAATAATCTCCCTACTCGTTTCTCTAGCCCTATTCTCCCCAAACCTCTTAGGAGATCCAGAAAACTTCACACCAGCCAACCCTCTAGTAACTCCCCCCCACATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCCATCCCAAACAAACTAGGAGGTGTACTAGCCCTAGCCGCCTCAATCCTCGTACTATTCCTAATACCCCTACTCCACACATCTAAACTACGATCAATGACCTTCCGTCCTATCTCACAAATCCTATTCTGAGCCCTAGTCGCAAACGTCCTTATTCTCACATGAGTAGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCATTCTCGTACTTTACAATCATTCTAGTCCTATTCCCCATCGCAGCTGCACTAGAAAACAAACTCCTAAAACT----------CTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Carduelis_psaltria GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--TATA-AACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGAAGCCCTGGACA-CCT-T-AA-C-T-----AGGTAGATAGGAGCGGGCATCAGGCACA--C------CAT-T--ACCGTAGCCCAAAACGTCTAGCACTTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-TGATAAGGCCTCC-TCATTAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACGTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAG--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGACCAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GT-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCATAGG-CG-----CCCCCCCCCCCATAAACTAATAAGCTAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAATA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGTTA-ACACCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--GC-ATA-CACCC----AACTAAAGCATT---T--ACTAGT-CTTAGTATAGGCGATAGAAAGGACA-CCA-TTGGC-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--CTTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--AATACT-CC-CAAATC-AATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--TAAAT---------CAA---ACAAGCA-GAG-TATTA-GGTACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTTCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CA-CACCCA--C-C-GGGTTCACTGTT-ATA-CAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAACCTCCAA-AGATTAGACCAAACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCGAGAGTCCATATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT---TA-----ATAGCC--C----ATGAC----------CAACCACCCCCTACTAATCAACCTCATTATAGCCCTCTCCTACGCCCTCCCAATCTTAATCGCAGTAGCTTTTCTCACACTAGTAGAACGTAAAATCCTAAGCTACATACAAGGCCGAAAAGGCCCAAACATTGTCGGTCCATACGGCCTCCTACAACCCCTAGCAGACGGAGTGAAACTATTCATTAAAGAACCCATCCGAC---------CATCAACATCCTCACCAATTCTATTTATTGCAACCCCAATACTAGCCCTACTCCTAGCAATCTCTACCTGAACTCCCCTACCATTACCATTCTCCCTAGCAGACCTCAACCTGGGCCTTTTATTCTTACTAGCTATATCAAGCCTGGCAGTATACTCCATTCTATGATCTGGCTGAGCATCCAACTCAAAATATGCCCTAATTGGGGCATTACGAGCAGTGGCCCAAACAATTTCATATGAAGTAACCCTGGCAATTATCCTCCTATCTGTTATTCTCCTTAGTGGTAACTACACTCTCAACACTCTCGCAATTACCCAAGAACCCCTATATCTTATCTTCTCATGCTGACCCCTTGCTTTAATATGATATGTCTCTACACTTGCTGAAACCAACCGCGCCCCCTTTGATTTAACAGAAGGGGAATCTGAACTAGTATCCGGATTCAACGTAGAATACGCAGCAGGCCCATTCGCACTATTCTTCCTAGCAGAATACGCTAATATTATGCTCATGAACACCATCACCGTTATTCTGTTCTTTAACCCAAGTCTACTAAACCCACCACAAGAATTATTCCCTGTAGTACTAGCCACTAAAGTCCTACTACTCTCAGCAGGATTTCTATGAATTCGTGCCTCCTACCCTCGATTTCGATATGATCAACTAATGCACTTACTATGAAAAAACTTTCTACCCCTCACACTTGCCCTATGCCTTTGACATACCAGCATACCAATTTGCTATGCGGGACTACCT-----CCCTATCTA-A--GA--CTACTCTAAGATCTACCGGAAATGTGCCTGAATAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAACCCTCTCATTTCCT-A--CAAC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGAAATCAAAATTCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAATCCACAGGCAAAACTAATTTTCACAATTAGCCTGCTCCTAGGAACCACTATCACAATCTCAAGCAACCATTGAGTCA---TAGCCTGAACCGGCCTAGAAATTAATACACTTGCTATTCTACCCCTAATCTCAAAATCCCACCACCCACGATCCATTGAAGCAGCCACTAAATACTTCCTAACCCAAGCAGCTGCTTCAACCCTAGTATTATTCTCTAGTATAACCAACGCATGACATACCGGACAATGAGACATCACCCAACTCTCTCACCCTACATCAAGCCTAATTCTAACCTCAGCTATTGCCATAAAACTAGGCCTAGTTCCATTCCACTTCTGATTTCCAGAAGTATTACAAGGCTCCCCTCTCTCCACCGGTCTTATCCTATCCACTATTATAAAACTTCCTCCAATCGCTCTTCTCTACATAACCTCCTCATCACTTAACCCCACACTCCTAACTACTCTAGCCATTCTATCAGTAGCTATTGGTGGATGAATAGGACTAAACCAAACACAAATCCGAAAAATCCTAGCCTTCTCCTCCATCTCCCACCTAGGATGGATAACAATTGTTATCATCTACAACCCTAAACTCACCCTCCTCAACTTCTACCTATACACCATAATAACTGCAGCCGTCTTTCTAACCCTAAACTCAATTAAAGTGTTAAAATTATCCACCCTAATAACAGCCTGAACTAAAGTCCCATCACTAAACGCAATACTACTTCTAACCCTACTATCCCTTGCAGGTCTACCTCCACTAACAGGATTCCTACCCAAATGACTCATCATTCAAGAACTAACCAAACAAGAAATAATCCCTGCAGCCACACTCATTTCTCTCCTCTCTCTACTAAGCTTATTCTTTTATCTCCGTCTTGCATACTGCACAACAATCACACTCCCACCACATACCACAAACCACATAAAACAATGACGCACCGGCAAATCAACTAACATCCTGATTGCCATCCTAACCACAATGTCAGTCATCCTCCTCCCCATTTCACCTATAATTCTCACCATTAT------CT----AAGAAACTTAG----GATTAA-T-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTGAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-A--AAA-TTTACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACACGA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATTCACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGAACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGCACTGCCCTAAGCCTTCTCATCCGAGCAGAATTAGGTCAACCCGGGGCCCTCCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCCCATGCTTTCGTCATAATCTTCTTCATAGTTATACCCATCATAATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTTCCCCCATCATTCCTCCTCCTTCTAGCATCCTCCACCGTAGAAGCAGGTGTCGGTACAGGCTGAACAGTATACCCTCCACTAGCTGGTAACCTAGCCCATGCCGGAGCTTCAGTTGACTTAGCAATCTTCTCCCTACACTTAGCCGGTATCTCTTCAATCCTAGGCGCAATCAACTTCATCACAACAGCAATCAACATAAAACCTCCCGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCAGTCCTAATTACTGCAGTACTCCTACTCCTCTCCCTCCCAGTTCTTGCTGCAGGAATTACAATACTTCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGCGACCCAGTCCTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTATACATCCTTATTCTTCCAGGATTTGGAATTATCTCCCATGTTGTAACCTACTACGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTAGGATTTATCGTATGAGCTCACCACATATTCACAGTCGGAATGGACGTTGACACTCGAGCATACTTTACATCAGCCACTATAATCATTGCCATCCCAACTGGAATTAAAGTGTTCAGCTGATTAGCAACGCTTCACGGAGGCATTATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACTATCGGAGGTCTGACAGGAATTGTCCTAGCAAACTCTTCACTAGATATTGCCCTACATGACACCTACTATGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCTGTATTTGCAATCCTAGCAGGCTTTACACACTGATTCCCACTATTCACTGGATACACCCTCCACTCAACATGAGCCAAAACCCACTTTGGCGTAATGTTCGTAGGAGTAAACCTAACCTTCTTCCCTCAACACTTCCTAGGTCTAGCAGGTATACCACGCCGATACTCAGACTACCCTGACGCCTACACCCTATGAAATACCATCTCCTCCGTAGGTTCCCTAATCTCTCTTACAGCCGTAATTATACTAGTATTTATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACTAACGTCGAATGAATCCACGGCTGCCCACCCCCCTTCCACACCTTCGAAGAACCTGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAAACGTTAGT-AAAACC-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGCGAAACCCCTGCACG--TCTC---CACCC--AAACATGGCCAACCACTCACAACTCAACTTTCAAGACGCCTCCTCTCCCATTATAGAAGAACTAATAGGATTCCACGACCACGCTCTAATAGTTGCATTAGCAATCTGCAGCCTAGTACTTTACCTTCTAACCCACATACTCACAGAAAAACTTTCATCAAGCACGGTAGACGCACAAGCAATCGAAATAGTTTGAACAATCCTCCCAGCCATAGTATTAGTTATACTCGCACTACCATCCCTACGAATCCTGTACATAATAGACGAAATCAACGAACCTGACCTTACCCTAAAAGCCATCGGCCACCAATGATACTGAACATACGAATATACCGACCTCAAAGACCTAACATTCGACTCCTACATAATCCCAACATCAGACTTACCTTTAGGACACTTCCGCCTGCTAGAAGTAGACCACCGCGTTGTAGTCCCTATAAGCTCTACAATCCGAGTCATTGTCACTGCCGATGATGTACTCCACTCATGAGCTGTCCCAAGCCTGGGTGTAAAAACTGACGCGATTCCAGGACGCCTTAACCAAACCTCCTTCCTCGCCTCTCGACCCGGAGTATTCTACGGACAATGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATACCAATCGTAGTAGAATCCACTCCTCTCGCTAACTTCGAAAACTGATCTTCTACAA---TAGCACCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-CCA-CTCCTCCTTAATGGTATGCCTCAACTAAACCCCGCACCATGATTTTTTATCATGATCATTTCATGAATCACTTTTTCCCTCATTATTCAACCCAAAATTCTTACATTTGTAACAATAAATCCCCCATCCAATAAAC---CCCCCATCGCCCCAAGCACCACCCCCTGAACCTGACCATGAACCTAAACTTCTTCGACCAATTTTCAAGCCCATCCCTACTGGGAATCCCACTTATCCTCATTTCAATAACATTCCCCGCCCTCCTAATTCCCTCCCTAGACAACCGATGAATCACCAACCGACTTTCCACTCTCCAATTATGATTCATTAACCTAGTCACAAAACAACTAATAATACCCCTAGACAAAAAAGGACACAAATGAGCCCTAATCCTAACATCCCTAATAATCTTCCTCCTACTTATTAACCTTTTAGGCCTACTACCATACACATTCACCCCAACTACTCAACTATCTATAAACCTAGCACTAGCCTTCCCCCTATGACTCGCCACTCTACTAACAGGTTTACGAAACCAACCCTCCGCCTCACTAGGCCACCTTCTGCCAGAAGGCACCCCAACCCCACTAATCCCCGCTCTAATCCTAATTGAAACAACAAGCCTGCTCATTCGCCCACTAGCCCTAGGTGTACGCTTAACAGCCAACCTCACAGCAGGTCACCTACTCATTCAACTCATCTCCACTGCCACAACAACTCTATTCACTACAATACCAATAGTATCACTCCTAACCCTCCTAGTCCTTTTCCTGCTAACTATTCTAGAAGTAGCTGTAGCAATAATCCAAGCCTATGTTTTCGTACTCCTACTAAGCCTATACCTACAAGAAAACATCT-AACC--CT--ACAATGGCACACCAAGCACATTCCTACCACATAGTAGACCCCAGCCCATGACCTATCCTAGGAGCTGCTGCCGCTCTCCTAACTACATCAGGACTAACAATATGATTCCACTATAACTCCCCCCAACTCCTTATCCTAGGCCTACTATCCACCGCCCTAGTTATATTCCAATGATGACGAGATGTTATCCGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAGAAAGGACTACGATATGGTATAGCCCTATTCATCACATCCGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCCTTCTTCCACTCAAGCCTAGCTCCTACCCCAGAACTAGGAGGACAATGACCACCCGTCGGAATCAAACCCCTTAACCCGATAGAAGTTCCACTACTAAACACTGCTATCTTACTAGCCTCTGGAGTTACCGTTACATGAGCCCACCACAGCATCACAGAAGCTAGCCGAAAACAGGCAATCCACGCCTTAACTCTAACCGTCCTTCTAGGATTCTACTTCACTGCACTACAAGCCATAGAATACTACGAAGCACCATTCTCAATCGCAGACGGAATTTACGGCTCTACATTCTTCGTTGCCACAGGATTCCACGGCCTACACGTAATCATTGGCTCAACATTCCTGTTAGTCTGCTTACTTCGCCTAATCAAATACCATTTCACACCAAACCACCACTTCGGGTTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTTATACTAACCCTATCATTCACCCTGAGCATCCTACTAACCGCACTAAACTTTTGACTAGCCCAAATAAACCCAGACTCAGAAAAACTATCCCCCTACGAATGCGGGTTCGATCCTCTAGGCTCCGCCCGACTGCCCTTCTCAATCCGATTTTTCCTAGTAGCTATCCTATTCCTCCTCTTTGACCTAGAAATCGCCCTCCTACTCCCACTACCATGAGCCACTCAACTAGAATCCCCCATAACCACCCTAACCTGAACCTCTGTCCTCCTCCTTCTCCTTACACTAGGACTTATCTACGAATGAATCCAAGGCGGATTAGAATGAGCAGAGTA-A------CAGAAAGTTAGTCTAACCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCGCACCCTATAACTTTCTTCATGACCTACCTCCACCTCAGCTTCTACTCAGCTTTCACCCTAAGCAGCCTAGGCCTAGCTTTCCACCGAACCCATCTAATCTCAGCCCTTCTCTGTCTAGAGAGCATAATACTATCCATATACGTGGCACTCGCCATATGACCCATCCAAATACAATCACCATCCTCCACCATCCTACCAATCATCATACTAACATTCTCCGCCTGCGAAGCAGGAACAGGCCTAGCCCTGCTAGTTGCCTCCACCCGAACTCACGGTTCAGACCATCTACACAACTTCAACCTTCTACAATGCTAAAAATCTTAATTCCAACCGCAACACTCCTACCCCTAACCCTCATGTCTCCACTTAAACACCTATGAACTAATATCACACTGCACAGCCTAATCATTGCTACCATCAGCCTACAATGATTAACACCAACATACTACCCAAGCAAAAGCTTAACCCCCTGAACATCAATTGATCAAATCTCTTCCCCCCTTCTAGTCCTCTCATGCTGACTCCTTCCTCTTATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCATTATCCGTAAACGAATCTTTGCTACAACAGTAATTCTAGCCCAACTATTTATCCTCCTAGCTTTCTCAGCCTCCGAACTAATACTCTTCTACATCGCATTTGAAGCTACCCTCATCCCCACCCTTATCCTTATTACACGATGAGGAAATCAACCAGAACGACTAAACGCCGGAATCTACCTCCTATTCTACACCCTAGCCAGCTCACTCCCCCTACTAATCGCCATCCTACACCTACAAAACCAAATCGGCACACTCTACCTCCCCATACTAAAACTACACCACCCTACAATAAACTCCTCCTGATCCGGATTAATCGCAAGCCTCGCCCTACTCCTTGCCTTCATAGTTAAAGCCCCCCTATATGGACTGCACCTATGACTTCCCAAAGCACACGTAGAAGCCCCAATCGCCGGTTCCATACTACTAGCCGCCCTTCTCCTAAAACTAGGAGGCTACGGCATCATACGAATCACAATCCTAGTAAACCCAGCATCAAACAACCTACACTACCCATTCATCACCCTAGCCTTATGAGGTGCACTAATAACCAGCGCCATCTGCCTACGACAAATTGACCTAAAATCGCTAATCGCCTATTCATCTGTTAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCACACGGCTTAACCTCATCAATACTATTCTGCCTAGCCAACACCAACTACGAACGAACCCACAGCCGAATCCTCCTCCTCACACGAGGACTCCAACCCCTCCTACCACTGATAGCCATCTGATGACTTCTAGCGAACCTAACAAACATAGCTCTTCCCCCAACAACGAACCTTATAGCAGAATTAACCATCGTCATCGCACTATTCAACTGATCTGCCTTTACAATCATCCTAACAGGAGCGGCAATCCTACTTACTGCTTCTTACACCCTCTACATACTCATAATAACACAACGAGGCACACTTCCATCCCACATTACCTCAATCCAAAACTCCACCACTCGAGAACACCTCCTCATAGCCCTCCACATAATCCCAATACTACTCCTCATCCTTAAACCTGAACTAATCTCTGGCATCCCCGTAT-GCAAGTATAGTTT-TAA-TCAAAACATTAGACTGTGATCCTAAAAATAGAAGTTAAAATCTTCTTACCTGCCGAGGGG-AGGTC-AAACCAACAAGAACTGCTAACTCTTGAGTCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTAAACACATTCATATTACTAACCCTAGCAACCCTCTCCACACCCATCCTATTCCCCCTCCTATCTCCCAACTCCAAAAGTACCCCTAACATCATCACAAACACAGTCAAAACCTCCTTCTTAATCAGCTTAATCCCCATAACTATCCACATCTACTCAGGGACAGAAAGCCTTACTTCCCTATGAGAATGAAAATTCATCATAAACTTCAAAATCCCTATCAGCCTAAAAATAGACTTCTACTCACTTACCTTCTTCCCTATCGCACTATTCGTCTCATGATCCATCCTACAATTTGCAACATGATACATAGCCTCAGATCCCCACATTACAAAATTCTTCATCTACCTCCTACTATTCCTAATAGCAATACTCATCCTAATCCTTGCTAACAATCTATTCGTCCTATTTATCGGCTGAGAGGGAGTCGGAATTATATCCTTCCTACTAATCAGCTGATGACACGGCCGAGCAGAGGCCAATACCGCTGCCTTACAAGCCGTCTTATACAACCGAGTTGGAGACATCGGCCTCATCCTCTGCATAGCATGACTAGCCTCAACTATAAACACCTGAGAAATCCACCAACTCCCCTCCCCATCACAAACCCCAACATTACCCCTATTAGGTCTCATTCTAGCCGCAACCGGTAAGTCAGCCCAATTCGGCCTCCATCCTTGACTGCCCGCCGCCATAGAAGGACCCACTCCTGTCTCCGCCCTACTTCATTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCTCTACTTAGCAATAACCAAACCGCCCTAACCCTCTGCCTATGCCTAGGAGCCCTATCTACCCTATTCGCAGCTACATGTGCCCTCACCCAAAACGATATCAAAAAAATCATCGCCTTTTCTACCTCAAGCCAATTAGGCCTAATAATAGTTACAATCGGACTCAACCTCCCCGAACTTGCCTTCCTTCACATCTCAACACACGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGATCCATTATCCACAACCTAAACGGCGAACAGGACATCCGAAAAATAGGAGGACTCCAAAAAATAATACCCACAACCACCTCATGCTTCACTATTGGCAACTTAGCCCTAATAGGAACTCCATTCCTAGCAGGATTTTACTCAAAAGACCAAATCATCGAAAGCCTTAACACATCCTACCTAAACACCTGAGCCTTACTACTAACCCTACTAGCTACGTCATTCACCGCAGTATACACAATTCGCATGACCGTACTAGTACAGACCGGCTTCGTTCGGATTCCTCCTCTAACCCCAATAAATGAAAACAACCCCGCAGTGACTTCACCCATCACTCGACTCGCACTAGGAAGCATCCTAACAGGATTCCTCATCACCTCATTCATCATCC---CCACAAAAACTCCCACAATAACCATACCCCCATCCATCAAAATAATAGCCTTAGTAGTAACTGCCCTAGGAATTGCTTTTGCTCTAGAAATCTCAAAAATAGCCCAAACCCTCATCCTCACAAAACAAACCGTCTTCTCAAACTTCTCTACGTCCCTAGGATACTTTAACCCCCTAGCTCACCGCTTAACCATATCTAATCTCCTCAACGGAGGACAAAACATCGCCTCACACCTAATCGACCTATCCTGATACAAAATCCTAGGCCCAGAAGGACTAGCCAATCTACAACTAATAGCAACCAAAACCGCCACCTCCCTCCACTCAGGCCTAATCAAGGCCTACCTAGGAGCATTTGCCCTATCCATCATTATCATCCTCA---TATCCATACACAGAAC--CAA-C-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTCAAAGTCATCAACAACGCCCTAATTGACCTCCCCACACCACCAAACATCTCCACATGATGAAACTTCGGGTCTTTACTGGGCATTTGCCTAATCGTCCAAATCGTTACAGGTCTCCTGCTAGCCACTCATTACACAGCAGACACCAACCTAGCTTTCTCCTCTGTAGCTCACATATGCCGTGACGTCCAATTCGGCTGACTAATCCGCAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTTCACATCGGCCGAGGAATCTACTATGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTTATCCTACTACTAACCCTCATAGCAACCGCCTTCGTAGGCTACGTCCTACCATGAGGCCAAATATCATTCTGAGGCGCTACAGTAATTACAAATCTATTCTCAGCAATCCCCTACATTGGACAAACATTAGTAGAATGAGCCTGAGGAGGATTCTCCGTAGACAACCCTACACTAACCCGCTTCTTCGCTCTTCACTTCCTTCTCCCATTTGTTATCGTAGGCCTCACACTAGTTCATCTCACCTTCCTACACGAAACAGGATCAAACAACCCAACCGGAGTACCCTCAGACTGTGACAAAATTCCATTCCACCCATACTACACCGTAAAGGACATTCTAGGCTTCGCACTAATAATCTCCCTACTCGTCTCCCTAGCCCTATTCTCCCCAAACCTCCTAGGAGACCCAGAAAACTTCACACCAGCTAACCCTCTAGTAACTCCCCCTCATATTAAACCCGAATGATACTTCCTATTCGCCTACGCCATTCTACGATCCATCCCAAATAAATTAGGAGGTGTTCTAGCCCTAGCTGCTTCAATCCTCGTACTATTCCTAATACCCCTACTCCACACATCCAAACTACGATCAATAACCTTCCGCCCTATCTCACAAATCCTATTCTGAGCCCTAGTTGCAAACGTCCTCATCCTCACATGAGTAGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCACTCTCGTACTTCACAATCATTCTAGTCCTATTCCCCATCGCAGCCGCACTAGAAAACAAACTCCTAAAACT----------CTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Carduelis_sinica GTTCTTGTAGCTTATGA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-AACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTCATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGTTGTCACAAGCCCAAGATGC-TAATAAGGCCTCC-TTGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAG--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCATAGGCCG---CCCCCCCCCCCCCATAAATTAATAAGCCAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACATCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--GC-ATA-CACCC----AACTAAAGCATT---T--ACTAGT-CTTAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAT-ACACG-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AGT--AATATT-CC-CTAATC-TTTACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCCACAAAAATATAAG-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-TCACCA-ATATACGA--TAAAT---------CAA---ACAAGCA-GAG-TATTA-GGTACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CT-CACCCA--C-C-GGGTTCACTGAC-ACA-TAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAACCTCCAA-AAATTAGACCAAACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCGAGAGTCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT---TA-----ACAACC--C----ATGCT----------CAACTACCCCCTACTGATTAATCTCATTATAGCCCTCTCCTACGCCCTTCCGATCCTAATTGCAGTAGCCTTTCTCACACTAGTAGAGCGCAAAATCTTAAGCTACATACAAGGCCGAAAAGGTCCAAATATTGTAGGCCCATATGGCCTCCTACAACCCCTGGCAGACGGAGTAAAACTATTTATTAAGGAACCTATTCGAC---------CATCAACGTCCTCACCTATCCTATTTATTGCAACTCCAATACTAGCCCTACTCCTAGCTATTTCCATCTGAACCCCCTTACCTCTACCATTTTCTTTGGCAGACCTCAACCTAGGCCTACTATTTCTATTAGCTATATCAAGCCTGGCAGTGTACTCCATTTTATGATCCGGCTGAGCATCCAACTCAAAATACGCCCTAATTGGAGCACTACGAGCAGTAGCCCAAACAATTTCATATGAAGTAACTCTAGCAATTATTCTACTATCTGTCATTCTACTCAGTGGTAATTACACTCTCAACACTCTCGCAATCACCCAAGAACCCCTCTACCTCATTTTCTCATGCTGACCCCTTGCTATAATATGATATGTCTCAACACTTGCTGAGACCAACCGTGCCCCATTCGACTTAACAGAAGGAGAATCCGAACTAGTCTCTGGATTCAACGTAGAATACGCAGCAGGCCCATTCGCACTATTCTTCCTAGCAGAGTATGCTAACATCATGCTCATAAACACTATCACTACTATCCTATTCTTTAACCCAAGCTCACTGAACCCACCACAAGAGCTATTCCCCGTAGTACTAGCTACTAAAGTCCTACTGTTATCGGCAGGGTTCCTATGAATTCGTGCCTCATACCCTCGATTCCGATATGATCAACTAATACACTTACTATGAAAAAACTTCCTACCCCTCACACTTGCCCTATGTCTCTGACACACCAGCATACCAATCTGCTACGCAGGACTACCC-----CCCTACATA-A--GG--------------TTACCGGAAATGTGCCTGAATGT-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTGCACCAACCCTCTCATTTCCT-A--TAGT-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGAAATCAAAATTCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAATCCCCAAGCTAAACTAATCTTTGCAATTAGCCTACTCTTAGGAACCACTATCACAATCTCAAGCCACCATTGAATTA---TGGCTTGAGCCGGCCTGGAAATCAATACACTCGCTGTCCTACCCCTAATCTCAAAATCCCACCACCCACGATCCATTGAAGCAGCCACTAAATACTTCTTAACCCAAGCAGCTGCCTCAACCTTAGTCCTATTCTCCAGCATAACCAACGCATGATATACTGGACAATGAGACATTACTCAACTCTCTCACCCCACATCAGGCCTAATCCTAACTTCAGCAATTGCCATAAAACTAGGTCTAGTCCCATTTCATTTCTGATTCCCAGAAGTACTACAAGGCTCCCCCCTCTCCACTGGTCTCATCCTATCTACTATCATAAAACTCCCTCCAATCACTCTCCTCTACATAACTTCCCCATCACTAAACCCCACACTCCTAACTATCCTAGCCATTCTCTCAACAGCTGTTGGCGGATGAATAGGACTAAACCAAACACAAATCCGAAAAATCCTAGCCTTTTCCTCCATCTCCCACCTAGGATGAATAACGGCGGTTATCATCTACAACCCCAAACTCACCCTCCTCAACTTCTATCTATATACCATAATAACTGCAGCCGTCTTCCTAACTCTAAACTCAATCAAAGTACTGAAACTATCCACCTTAATGACCGCATGAACTAAAGTCCCATCACTAAATGCAATACTACTTCTAACCTTACTATCCCTCGCAGGTCTACCCCCTCTAACAGGATTCTTACCTAAATGACTCATTATTCAAGAACTAACTAAGCAAGAAATAATCCTTGCAGCCACACTCATTTCTCTTCTTTCTCTACTAAGCTTATTCTTCTATCTCCGCCTTGCATACTGCACAACAATCACACTCCCACCACACACTACAAACCACATAAAACAGTGGCGAACTAGCAAACCAACTCCTGTCCTGATCGCCATCTTAACCACAATGTCTATCATTCTCCTCCCCA?TTCCCCTATATTCCTCACCATCAT------TT----AAGAAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGATATTACCCTGCATCCCCTGGATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-G--AAA-CTTACTAGACAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACACAA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGTACCCTATATTTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACTGCCCTAAGTCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTAGGCGACGATCAAGTCTATAACGTAGTCGTCACAGCCCATGCCTTCGTAATAATTTTCTTCATAGTTATACCTATCATAATTGGAGGATTCGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTGCTCCCTCCATCTTTCCTACTGCTACTAGCATCTTCCACTGTAGAAGCAGGCGTTGGCACAGGTTGAACAGTATACCCTCCACTAGCTGGCAACCTAGCCCACGCTGGAGCTTCAGTTGACTTAGCAATCTTCTCCCTACATCTAGCCGGTATTTCCTCAATCCTTGGAGCAATCAACTTCATTACAACAGCAATTAACATAAAACCTCCTGCCCTATCACAGTACCAAACCCCCCTATTCGTCTGATCAGTCCTAATCACTGCAGTACTCCTACTTCTCTCCCTACCAGTCCTTGCTGCAGGAATCACAATGCTTCTTACAGACCGCAACCTAAACACCACATTCTTCGACCCCGCAGGAGGAGGCGACCCAGTTCTATACCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTGTATATCCTTATCCTCCCAGGATTCGGAATTATCTCACACGTCGTAACCTACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGAATGGTATGAGCTATACTATCTATCGGATTCCTAGGATTCATCGTATGAGCCCACCACATATTCACAGTTGGAATAGACGTTGACACCCGAGCATACTTCACATCAGCCACTATAATTATTGCCATCCCTACTGGGATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCGTAATCAAATGAGATCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTTACCATTGGAGGACTAACAGGGATTGTTCTAGCAAACTCCTCACTAGACATTGCCCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTATTCGCAATCCTAGCAGGCTTTACTCATTGATTCCCACTATTCACCGGATACACTCTCCACTCAACATGAGCCAAAACCCACTTTGGCGTAATGTTTGTAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCAGGCATGCCACGCCGATATTCAGACTACCCAGACGCCTACACCCTATGAAACACCATCTCCTCTGTAGGCTCTCTAATCTCCCTAACAGCCGTAATTATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTTGAATGAATCCACGGCTGCCCTCCTCCCTTCCACACCTTCGAAGAACCTGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAAACGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGTGAAACCCCTGCACGTCTCTC----ACTT--AAACATGGCAAACCACTCACAATTTAACTTCCAAGACGCCTCCTCCCCCATCATAGAAGAACTAATAGGATTTCACGATCATGCCCTAATAGTCGCACTAGCAATCTGTAGTCTAGTACTTTATCTACTAACCCACATACTCACAGAAAAACTTTCATCAAGCACCGTTGATGCTCAAGAAATCGAACTAGTTTGAACAATCCTTCCAGCCATAGTCCTAGTCATACTTGCCCTACCATCCCTACGAATCCTATACATAATAGACGAAATCAACGAACCCGACCTCACCCTAAAAGCTATCGGCCACCAATGATACTGAACATACGAATATACTGACCTCAAAGATCTAACATTCGACTCCTACATAATCCCAACATCAGACCTACCTCTAGGACACTTCCGTCTACTAGAAGTAGACCATCGCGTTGTAGTCCCAATAAGCTCTACGATTCGAGTCATCGTCACTGCTGATGATGTACTCCACTCATGAGCCGTCCCTAGCCTAGGAGTAAAAACTGACGCAATTCCAGGCCGCCTTAACCAGACTTCCTTCCTCGCCTCCCGGCCTGGAGTGTTTTACGGACAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACTCCTCTTGCTAATTTCGAAAGCTGATCCTCTACAA---TAGCCTCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGCT-ACA-CCCCTCCTTAATGATATGCCTCAACTAAACCCTGCACCATGATTTTTTATTATGATCATTACATGACTCACTTTTTCCCTTATTATTCAACCCAAAATCCTCACATTTGTAACAATAAACCCCCCATCCAATAAAC---CTCGCATCGCCCCAACCACCACTCCCTGAACCTGACCATGAACCTAAGCTTCTTTGACCAATTTTCAAGCCCATCCCTACTAGGAATCCCACTTATCCTCATCTCAATAACATTTCCCGCCCTCCTCATTCCCTCCCTGGATAACCGATGGATTACTAACCGACTCTCAACCCTTCAATTATGATTCATCAACCTAGTCACAAAACAACTAATAATGCCCTTAGACAAAAAAGGACACAAATGAGCCCTAATCCTAACATCCCTGATAATCTTCCTACTACTTATCAACCTTCTGGGCCTACTACCATACACATTCACTCCAACTACCCAACTATCCATAAACCTAGCACTAGCCTTCCCCCTATGACTCGCCACCCTACTAACAGGTCTACGAAACCAACCATCCGCCACACTAGGTCACCTCCTGCCAGAAGGTACCCCAACCCCACTAATCCCCGCCCTAATCCTAATCGAAACAACAAGCCTACTCATCCGCCCATTAGCCCTAGGCGTACGCCTAACAGCCAACCTTACAGCAGGCCACCTACTCATCCAACTCATTTCCACGGCCACAATAGCCCTTTTCACTACAATACCAGTAGTCTCACTCCTAACTCTTCTTATCCTTCTCCTCCTAACTATCCTAGAAGTAGCTGTAGCAATAATCCAAGCCTACGTTTTCGTACTTCTACTGAGCCTATATCTACAAGAGAACATTT-AGCT--CC--ACAATGGCACACCAAGCACATTCCTATCACATAGTAGACCCCAGCCCATGACCCATCCTAGGAGCTGCTGCTGCACTCTTAACCACATCAGGACTAACAATATGATTTCACTATAACTCCCCCCAACTCCTCATCCTAGGCCTACTATCCACTGCCCTAGTCATATTCCAATGATGACGAGACATTATCCGAGAAAGCACATTCCAAGGCCATCATACCCCCACAGTACAAAAAGGACTACGATATGGTATAGCCCTATTCATCACCTCCGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCTTTCTTCCATTCAAGCCTGGCCCCTACCCCAGAACTAGGAGGTCAATGACCACCCGTAGGAATCAAACCCCTAAACCCAATAGAAGTACCATTACTAAATACCGCCATCCTACTAGCCTCCGGAGTTACCGTAACATGAGCCCACCATAGCATCACAGAAGCTAGCCGAAAACAAGCAATCCATGCCCTATCTCTAACTGTTCTCCTAGGATTCTACTTCACCGCACTACAGGCCATAGAATACTACGAAGCACCATTCTCAATCGCAGACGGAGTCTACGGCTCCACATTCTTCGTTGCTACCGGATTCCATGGCCTACATGTAATTATTGGTTCAACATTCCTTCTAGTATGCCTACTTCGCCTAATCAAGTACCATTTCACACCAAACCACCACTTCGGATTTGAAGCAGCTGCTTGATACTGACACTTTGTAGACGTCGTATGACTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTTATACTAATCCTATCATTAACCCTAAGCATCCTACTAACCACACTAAACTTTTGACTAGCCCAAATAAACCCAGACTCAGAGAAACTGTCCCCCTACGAATGCGGATTCGACCCCCTT?GGTCCGCCCGGCTGCCTTTCTCCATCCGATTCTTCCTAGTAGCTATCCTATTCCTCCTTTTCGACTTAGAAATCGCCCTCCTACTACCACTACCATGAGCTATCCAACTAGAATCACCCACCACTACCCTAATCTGAACTTCCATCCTCCTCTCCCTCCTAACCCTAGGACTCATCTACGAATGAATCCAAGGTGGATTAGAATGAGCTGAGTA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGACTCAACAAATTATAGCTTACACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTTTACTCAGCTTTCACTCTAAGCAGCCTAGGCCTAGCTTTCCACCGAACTCACCTAATCTCAGCCCTACTCTGCCTAGAAAGCATAATATTATCCATATACGTGGCACTCGCCATATGGCCTATCCAAATACAATCACCATCCTCTACCATCCTGCCAATTATCATACTAACATTTTCCGCCTGCGAGGCAGGAACAGGCCTAGCCCTGCTAGTAGCCTCTACCCGAACTCACGGCTCAGATCACCTACATAACTTCAACCTCCTACAATGCTAAAAGTCCTAATTCCAACTGCAATACTCCTACCCCTAACCCTCACATCCCCTCTCAAACACCTATGAGCTAATATTACCCTACATAGCCTAATCATTGCTACCATCAGCCTACAATGATTAGCACCAACATACTACCCAAACAAAAGCTTAACCTTCTGAACATCAATTGATCAAATTTCCTCTCCTCTCCTAGTCCTCTCATGCTGACTTCTCCCCCTCATAATCATAGCAAGCCAAAATCACCTAGAACAAGAACCCGCCATTCGTAAACGAATCTTCGCCCTAACAGTAGTCCTAGCCCAGTTATTCATCCTCCTAGCTTTCTCAGCCTCTGAACTAATACTCTTCTACATCGCATTTGAAGCAACCCTCATCCCCACGCTTATCCTCATTACCCGATGAGGCAACCAACCAGAACGACTAAATGCCGGGATCTACCTTCTATTCTATACCCTAGCCAGCTCACTCCCCCTACTAATCGCTATTCTACACCTACAAAACCAAATTGGTACACTCTACCTCCCTATACTAAAACTATCACACCCTACATTAAACTCCTCCTGATCCGGACTAATCGCAAGCCTCGCCCTACTTATCGCCTTTATAGTCAAAGCCCCCCTATATGGCCTACACTTATGACTACCCAAAGCCCACGTAGAAGCTCCAATCGCCGGCTCTATACTTCTAGCTGCCCTACTCCTGAAACTAGGAGGCTACGGCATCATACGAATCACAATTCTAGTAAACCCAGCATCAAACAACTTACACTACCCCTTCATCACCCTAGCCCTATGAGGAGCACTAATAACTAGCGCAATCTGCCTACGACAAATCGACCTAAAATCTCTAATCGCCTACTCATCCGTTAGCCACATAGGCCTAGTTGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACACGGTTTAACCTCATCAATACTGTTCTGCTTAGCCAATACCAACTATGAACGAACTCACAGCCGAATCCTCCTCCTAACACGAGGACTCCAACCCCTTCTACCACTAATAGCCATCTGATGACTCCTAGCCAACCTAACAAACATAGCACTCCCTCCAACAACAAACCTCATAGCCGAATTAACCATTGTCATCGCACTATTCAACTGATCCTCCTTTACAATTATTCTAACAGGGTCAGCAATCCTACTAACTGCCTCTTACACCCTCTACATACTCATAATAACACAACGAGGCACACTTCCATCTCACATTACCTCAATTCAAAACTCCACAACCCGAGAACACCTCCTCATAGCCCTTCACATAATTCCAATGCTACTCCTCATCCTTAAACCTGAACTAATCTCTGGTATCCCCATAT-GCAAGTATAGTTT-CAA-TTAAAACATTAGACTGTGTACCTAAAAATAGAAGTTAAACTCTTCTTACTTGCCGAGGGG-AGGTT-AAACCAACAAGAACTGCTAATTCTTGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTAAATACATTCATACTCCTCACCCTAGCAACCCTCTCCACACCTATCCTATTCCCTCTTCTATCCCCCAACCTTAAAAACACCCCTAGCATCATCACAAATACAGTTAAAACATCCTTCCTAATCAGCCTAATTCCCATAACTATCCACATCTACTCAGGGACAGAAAGCCTCACTTCCCTATGGGAATGAAAATTCATCATAAACTTCAAAATTCCTATTAGCCTAAAAATAGACTTCTACTCACTCACTTTCTTCCCCATCGCACTATTTGTTTCATGGTCCATCCTACAATTTGCAACATGATACATAGCCTCGGATCCCTACATTACAAAATTCTTTACCTACCTACTATTCTTCCTAATAGCAATACTCATCCTAATCATCGCTAACAACCTATTCGTCCTATTTATTGGCTGAGAAGGAGTCGGGATCATATCCTTCCTACTAATTAGCTGATGACATGGCCGAGCAGAAGCCAATACCGCTGCCCTACAAGCCATCCTCTACAATCGAGTCGGAGATATCGGCCTCATCCTCTGCATAGCATGACTAGCCTCAGCTATAAACACCTGAGAAATTCAACAACTCCCCTCCCCATCACAAACCCCAACACTACCTCTACTAGGTCTCATTCTAGCTGCGACCGGAAAATCAGCCCAATTCGGCCTACACCCATGATTACCCGCTGCCATAGAAGGACCAACCCCCGTTTCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCCCTATTCAGCAACAACCAAACCGCCCTAACCCTCTGCCTATGCCTGGGAGCCCTATCTACCCTATTTGCAGCCACATGCGCCCTTACTCAAAACGATATTAAAAAAATCATTGCCTTCTCCACTTCAAGTCAACTAGGCCTAATGATAGTCACAATCGGACTTAACCTCCCTGAACTAGCCTTCCTTCACATCTCAACTCACGCATTCTTCAAAGCCATGCTCTTCCTATGCTCAGGATCCATCATCCACAGCCTAAACGGCGAACAGGACATCCGAAAAATAGGAGGGCTCCAAAAAATAATACCCACAACCACCTCATGTCTCACCATTGGCAACCTAGCCCTAATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCCCTACTACTAACCTTACTAGCCACGTCATTCACCGCAGTGTACACAATCCGCATGACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCTCCTCTAACCCCAATAAATGAAAACGACCCCGCAGTGACCTCCCCCATCACTCGACTCGCTCTAGGAAGCATTCTAGCAGGATTCCTCATCACCTCATTCATCATCC---CTACAAAAACTCCTACAATAACTATACCTACATCCATCAAAATAACAGCTCTAGTAGTCACCGCCCTAGGAATTGCTCTAGCCCTAGAAATCTCAAAAATAGCCCAAACCCTCATCCTCACAAAACAAACCACCTTCTCTAACTTTTCTACATCTTTAGGCTACTTTAACCCCCTAATCCATCGTCTAACCATAACCAACCTCCTTAACGGAGGCCAAAATATCGCCTCACACCTAATTGATCTGTCCTGATACAAAACCCTAGGCCCAGAGGGACTAGCCAACCTACAGCTAATAGCAACCAAAGCCGCTACCTCCTTCCATTCAGGTCTAATCAAGGCCTACCTAGGAGCATTCGCCCTATCCATCATCATTATTCTCA---TATCCATACACAGAAT--CAA-T-T---AATGGCCCTCAATCTCCGTAAAAACCACCAAATCCTCAAAGTCATCAACAATGCCCTAATTGACCTACCCACACCACCAAACATCTCAACATGATGAAACTTCGGGTCTTTACTGGGTATTTGCCTAATTACTCAAATCGTTACAGGTCTCCTGCTAGCAACCCACTACACAGCAGACACCAACCTAGCTTTCTCCTCTGTAGCCCACATATGCCGCGACGTCCAATTCGGCTGACTAATTCGTAACCTCCATGCAAACGGAGCTTCCTTCTTCTTCATCTGCATCTATCTTCACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAAAAACCTGAAACATTGGAGTCATTCTACTACTAACCCTCATAGCAACCGCCTTCGTAGGATACGTCCTACCATGAGGCCAAATATCATTCTGAGGAGCTACAGTAATCACAAACCTATTCTCAGCAATCCCCTACATTGGACAAACACTAGTAGAATGAGCCTGAGGGGGATTCTCCGTAGACAACCCCACATTAACTCGATTTTTCGCTCTCCACTTCTTACTACCATTCGTTATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTACACGAAACTGGGTCAAACAATCCAACAGGAGTCCCCTCAGACTGCGACAAAATCCCATTCCACCCATACTACACCGTAAAAGACATTCTAGGCTTCGCACTAATAATCTCCCTACTCGTTTCCCTGGCCCTATTCTCCCCAAACCTACTAGGAGACCCAGAAAACTTCACGCCAGCCAACCCCCTAGTAACTCCCCCCCACATCAAACCCGAATGATACTTCCTATTCGCCTACGCTATTCTACGATCTATTCCAAATAAACTAGGAGGCGTACTAGCCCTAGCTGCCTCAATCCTCGTACTATTCCTAATACCCCTACTACACACATCAAAACTACGATCAATAACCTTCCGCCCTATCTCACAAATCCTATTCTGAGCCCTCGTCGCAAACGTCCTCATCCTAACATGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATTATCGGCCAACTAGCCTCACTCTCATACTTCACAATTATTCTAGTCCTATTCCCCATTGCAGCTGTACTAGAAAACAAACTGCTAAAACT----------CTA-ACC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Carduelis_sinica_NC_015196 GTTCTTGTAGCTTATGA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-AACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTCATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGTTGTCACAAGCCCAAGATGC-TAATAAGGCCTCC-TTGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAG--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCATAG---G---CGCCCCCCCCCCTATAAATTAATAAGCTAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACATCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--GC-ATA-CACCC----AACTAAAGCATT---T--ACTAGC-CTTAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAT-ACACG-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AGT--AATATT-CC-CTAATC-TTTACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCCACAAAAATATAAG-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-TCACCA-ATATACGA--TAAAT---------CAA---ACAAGCA-GAG-TATTA-GGTACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CT-CACCCA--C-C-GGGTTCACTGAC-ACA-TAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAACCTCCAA-AAATTAGACCAAACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCGAGAGTCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT---TA-----ACAACC--C----ATGCT----------CAACTACCCCCTACTGATTAATCTCATTATAGCCCTCTCCTACGCCCTTCCGATCCTAATTGCAGTAGCCTTTCTCACACTAGTAGAGCGCAAAATCTTAAGCTACATACAAGGCCGAAAAGGTCCAAATATTGTAGGCCCATATGGCCTCCTACAACCCCTGGCAGACGGAGTAAAACTATTTATTAAGGAACCTATTCGAC---------CATCAACGTCCTCACCTATCCTATTTATTGCAACTCCAATACTAGCCCTACTCCTAGCTATTTCCATCTGAACCCCCTTACCTCTACCATTTTCTTTGGCAGACCTCAACCTAGGCCTACTATTTCTATTAGCTATATCAAGCCTGGCAGTGTACTCCATTTTATGATCCGGCTGAGCATCCAACTCAAAATACGCCCTAATTGGAGCACTACGAGCAGTAGCCCAAACAATTTCATATGAAGTAACTCTAGCAATTATTCTACTATCTGTCATTCTACTCAGTGGTAATTACACTCTCAACACTCTCGCAATCACCCAAGAACCCCTCTACCTCATTTTCTCATGCTGACCCCTTGCTATAATATGATATGTCTCAACACTTGCTGAGACCAACCGTGCCCCATTCGACTTAACAGAAGGAGAATCCGAACTAGTCTCTGGATTCAACGTAGAATACGCAGCAGGCCCATTCGCACTATTCTTCCTAGCGGAGTATGCTAACATCATGCTCATAAACACTATCACTACTATCCTATTCTTTAACCCAAGCTCACTGAACCCACCACAAGAGCTATTCCCCGTAGTACTAGCTACTAAAGTCCTACTGTTATCGGCAGGGTTCCTATGAATTCGTGCCTCATACCCTCGATTCCGATATGATCAACTAATACACTTACTATGAAAAAACTTCCTACCCCTCACACTTGCCCTATGTCTCTGACACACCAGCATACCAATCTGCTACGCAGGACTACCC-----CCCTACATA-A--GG--------------TTACCGGAAATGTGCCTGAATGT-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTGCACCAACCCTCTCATTTCCT-A--TAGT-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGAAATCAAAATTCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAATCCTCAAGCTAAACTAATCTTTGCAATTAGCCTACTCTTAGGAACCACTATCACAATCTCAAGCCACCATTGAATTA---TGGCTTGAGCCGGCCTGGAAATCAATACACTCGCTGTCCTACCCCTAATCTCAAAATCCCACCACCCACGATCCATTGAAGCAGCCACTAAATACTTCTTAACCCAAGCAGCTGCCTCAACCTTAGTCCTATTCTCCAGCATAACCAACGCATGATATACTGGACAATGAGACATTACTCAACTCTCTCACCCCACATCAGGCCTAATCCTAACTTCAGCAATTGCCATAAAACTAGGTCTAGTCCCATTTCATTTCTGATTCCCAGAAGTACTACAAGGCTCCCCCCTCTCCACTGGTCTCATCCTATCTACTATCATAAAACTCCCTCCAATCACTCTCCTCTACATAACTTCCCCATCACTAAACCCCACACTCCTAACTATCCTAGCCATTCTCTCAACAGCTGTTGGCGGATGAATAGGACTAAACCAAACACAAATCCGAAAAATCCTAGCCTTTTCCTCCATCTCCCACCTAGGATGAATAACGGCGGTTATCATCTACAACCCCAAACTCACCCTCCTCAACTTCTATCTATATACCATAATAACTGCAGCCGTCTTCCTAACTCTAAACTCAATCAAAGTACTGAAACTATCCACCTTAATGACCGCATGAACTAAAGTCCCATCACTAAATGCAATACTACTTCTAACCTTACTATCCCTCGCAGGTCTACCCCCCCTAACAGGATTCTTACCTAAATGACTCATTATTCAAGAACTAACTAAGCAAGAAATAATCCTTGCAGCCACACTCATTTCTCTTCTTTCTCTACTAAGCTTATTCTTCTATCTCCGCCTTGCATACTGCACAACAATCACACTCCCACCACACACTACAAACCACATAAAACAGTGGCGAACTAGCAAACCAACTCCTGTCCTGATCGCCATCTTAACCACAATGTCTATCATTCTCCTCCCCATTTCCCCTATAATCCTCACCATCAT------TT----AAGAAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGATATTACCCTGCATCCCCTGGATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-G--AAA-CTTACTAGACAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACACAA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGTACCCTATATTTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACTGCCCTAAGTCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTAGGCGACGATCAAGTCTATAACGTAGTCGTCACAGCCCATGCCTTCGTAATAATTTTCTTCATAGTTATACCTATCATAATTGGAGGATTCGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTGCTCCCTCCATCTTTCCTACTGCTACTAGCATCTTCCACTGTAGAAGCAGGCGTTGGCACAGGTTGAACAGTATACCCTCCACTAGCTGGCAACCTAGCCCACGCTGGAGCTTCAGTTGACTTAGCAATCTTCTCCCTACATCTAGCCGGTATTTCCTCAATCCTTGGAGCAATCAACTTCATTACAACAGCAATTAACATAAAACCTCCTGCCCTATCACAGTACCAAACCCCCCTATTCGTCTGATCAGTCCTAATCACTGCAGTACTCCTACTTCTCTCCCTACCAGTCCTTGCTGCAGGAATCACAATGCTTCTTACAGACCGCAACCTAAACACCACATTCTTCGACCCCGCAGGAGGAGGCGACCCAGTTCTATACCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTGTATATCCTTATCCTCCCAGGATTCGGAATTATCTCACACGTCGTAACCTACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGAATGGTATGAGCCATACTATCTATCGGATTCCTAGGATTCATCGTATGAGCCCACCACATATTCACAGTTGGAATAGACGTTGACACCCGAGCATACTTCACATCAGCCACTATAATTATTGCCATCCCTACTGGGATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCGTAATCAAATGAGATCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTTACCATTGGAGGACTAACAGGGATTGTTCTAGCAAACTCCTCACTAGACATTGCCCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTATTCGCAATCCTAGCAGGCTTTACTCATTGATTCCCACTATTCACCGGATACACTCTCCACTCAACATGAGCCAAAACCCACTTTGGCGTAATGTTTGTAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCAGGCATGCCACGCCGATATTCAGACTACCCAGACGCCTACACCCTATGAAACACCATCTCCTCTGTAGGCTCTCTAATCTCCCTAACAGCCGTAATTATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTTGAATGAATCCACGGCTGCCCTCCTCCCTTCCACACCTTCGAAGAACCTGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAAACGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCTAAATTGCATGTGAAACCCCTGCACGTCTCTC----ACTT--AAACATGGCAAACCACTCACAATTTAACTTCCAAGACGCCTCCTCCCCCATCATAGAAGAACTAATAGGATTTCACGATCATGCCCTAATAGTCGCACTAGCAATCTGTAGTCTAGTACTTTATCTACTAACCCACATACTCACAGAAAAACTTTCATCAAGCACCGTTGATGCTCAAGAAATCGAACTAGTTTGAACAATCCTTCCAGCCATAGTCCTAGTCATACTTGCCCTACCATCCCTACGAATCCTATACATAATAGACGAAATCAACGAACCCGACCTCACCCTAAAAGCTATCGGCCACCAATGATACTGAACATACGAATATACTGACCTCAAAGATCTAACATTCGACTCCTACATAATCCCAACATCAGACCTACCTCTAGGACACTTCCGTCTACTAGAAGTAGACCATCGCGTTGTAGTCCCAATAAGCTCTACGATTCGAGTCATCGTCACTGCTGATGATGTACTCCACTCATGAGCCGTCCCTAGCCTAGGAGTAAAAACTGACGCAATTCCAGGCCGCCTTAACCAGACTTCCTTCCTCGCCTCCCGGCCTGGAGTGTTTTACGGACAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACTCCTCTTGCTAATTTCGAAAGCTGATCCTCTACAA---TAGCCTCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGCT-ACA-CCCCTCCTTAATGATATGCCTCAACTAAACCCTGCACCATGATTTTTTATTATGATCATTACATGAGTCACTTTTTCCCTTATTATTCAACCCAAAATCCTCACATTTGTAACAATAAACCCCCCATCCAATAAAC---CTCGCATCGCCCCAACCACCACTCCCTGAACCTGACCATGAACCTAAGCTTCTTTGACCAATTTTCAAGCCCATCCCTACTAGGAATCCCACTTATCCTCATCTCAATAACATTTCCCGCCCTCCTCATTCCCTCCCTGGATAACCGATGGATTACTAACCGACTCTCAACCCTTCAATTATGATTCATCAACCTAGTCACAAAACAACTAATAATGCCCTTAGACAAAAAAGGACACAAATGAGCCCTAATCCTAACATCCCTGATAATCTTCCTACTACTTATCAACCTTCTGGGCCTACTACCATACACATTCACTCCAACTACCCAACTATCCATAAACCTAGCACTAGCCTTCCCCCTATGACTCGCCACCCTACTAACAGGTCTACGAAACCAACCATCCGCCACACTAGGTCACCTCCTGCCAGAAGGTACCCCAACCCCACTAATCCCCGCCCTAATCCTAATCGAAACAACAAGCCTACTCATCCGCCCATTAGCCCTAGGCGTACGCCTAACAGCCAACCTTACAGCAGGCCACCTACTCATCCAACTCATTTCCACGGCCACAATAGCCCTTTTCACTACAATACCAGTAGTCTCACTCCTAACTCTTCTTATCCTTCTCCTCCTAACTATCCTAGAAGTAGCTGTAGCAATAATCCAAGCCTACGTTTTCGTACTTCTACTGAGCCTATATCTACAAGAGAACATTT-AGCT--CC--ACAATGGCACACCAAGCACATTCCTATCACATAGTAGACCCCAGCCCATGACCCATCCTAGGAGCTGCTGCTGCACTCTTAACCACATCAGGACTAACAATATGATTTCACTATAACTCCCCCCAACTCCTCATCCTAGGCCTACTATCCACTGCCCTAGTCATATTCCAATGATGACGAGACATTATCCGAGAAAGCACATTCCAAGGCCATCATACCCCCACAGTACAAAAAGGACTACGATATGGTATAGCCCTATTCATCACCTCCGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCTTTCTTCCATTCAAGCCTGGCCCCTACCCCAGAACTAGGAGGTCAATGACCACCCGTAGGAATCAAACCCCTAAACCCAATAGAAGTACCATTACTAAATACCGCCATCCTACTAGCCTCCGGAGTTACCGTAACATGAGCCCACCATAGCATCACAGAAGCTAGCCGAAAACAAGCAATCCATGCCCTATCTCTAACTGTTCTCCTAGGATTCTACTTCACCGCACTACAGGCCATAGAATACTACGAAGCACCATTCTCAATCGCAGACGGAGTCTACGGCTCCACATTCTTCGTTGCTACCGGATTCCATGGCCTACATGTAATTATTGGTTCAACATTCCTTCTAGTATGCCTACTTCGCCTAATCAAGTACCATTTCACACCAAACCACCACTTCGGATTTGAAGCAGCTGCTTGATACTGACACTTCGTAGACGTCGTATGACTACTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTTATACTAATCCTATCATTAACCCTAAGCATCCTACTAACCACACTAAACTTTTGACTAGCCCAAATAAACCCAGACTCAGAGAAACTGTCCCCCTACGAATGCGGATTCGACCCCCTTGGGTCCGCCCGGCTGCCTTTCTCCATCCGATTCTTCCTAGTAGCTATCCTATTCCTCCTTTTCGACTTAGAAATCGCCCTCCTACTACCACTACCATGAGCTATCCAACTAGAATCACCCACCACTACCCTAATCTGAACTTCCATCCTCCTCTCCCTCCTAACCCTAGGACTCATCTACGAATGAATCCAAGGTGGATTAGAATGAGCTGAGTA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGACTCAACAAATTATAGCTTACACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTTTACTCAGCTTTCACTCTAAGCAGCCTAGGCCTAGCTTTCCACCGAACTCACCTAATCTCAGCCCTACTCTGCCTAGAAAGCATAATATTATCCATATACGTGGCACTCGCCATATGGCCTATCCAAATACAATCACCATCCTCTACCATCCTGCCAATTATCATACTAACATTTTCCGCCTGCGAGGCAGGAACAGGCCTAGCCCTGCTAGTAGCCTCTACCCGAACTCACGGCTCAGATCACCTACATAACTTCAACCTCCTACAATGCTAAAAGTCCTAATTCCAACTGCAATACTCCTACCCCTAACCCTCACATCCCCTCTCAAACACCTATGAGCTAATATTACCCTACATAGCCTAATCATTGCTACCATCAGCCTACAATGATTAGCACCAACATACTACCCAAACAAAAGCTTAACCTTCTGAACATCAATTGATCAAATTTCCTCTCCTCTCCTAGTCCTCTCATGCTGACTTCTCCCCCTCATAATCATAGCAAGCCAAAATCACCTAGAACAAGAACCCGCCATTCGTAAACGAATCTTCGCTCTAACAGTAGTCCTAGCCCAGTTATTCATCCTCCTAGCTTTCTCAGCCTCTGAACTAATACTCTTCTACATCGCATTTGAAGCAACCCTCATCCCCACGCTTATCCTCATTACCCGATGAGGCAACCAACCAGAACGACTAAATGCCGGGATCTACCTTCTATTCTATACCCTAGCCAGCTCACTCCCCCTACTAATCGCTATTCTACACCTACAAAACCAAATTGGTACACTCTACCTCCCTATACTAAAACTATCACACCCTACATTAAACTCCTCCTGATCCGGACTAATCGCAAGCCTCGCCCTACTTATTGCCTTTATAGTCAAAGCCCCCCTATATGGCCCACACTTATGACTACCCAAAGCCCACGTAGAAGCTCCAATCGCCGGCTCTATACTTCTAGCTGCCCTACTCCTGAAACTAGGAGGCTACGGCATCATACGAATCACAATTCTAGTAAACCCAGCATCAAACAACTTACACTACCCCTTCATCACCCTAGCCCTATGAGGAGCACTAATAACTAGCGCAATCTGCCTACGACAAATCGACCTAAAATCTCTAATCGCCTACTCATCCGTTAGCCACATAGGCCTAGTTGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACACGGTTTAACCTCATCAATACTGTTCTGCTTAGCCAATACCAACTATGAACGAACTCACAGCCGAATCCTCCTCCTAACACGAGGACTCCAACCCCTTCTACCGCTAATAGCCATCTGATGACTCCTAGCCAACCTAACAAACATAGCACTCCCTCCAACAACAAACCTCATAGCCGAATTAACCATTGTCATCGCACTATTCAACTGATCCTCCTTTACAATTATTCTAACAGGGTCAGCAATCCTACTAACTGCCTCTTACACCCTCTACATACTCATAATAACACAACGAGGCACACTTCCATCTCACATTACCTCAATTCAAAACTCCACAACCCGAGAACACCTCCTCATAGCCCTTCACATAATTCCAATGCTACTCCTCATCCTTAAACCTGAACTAATCTCTGGTATCCCCATAT-GCAAGTATAGTTT-CAA-TTAAAACATTAGACTGTGATCCTAAAAATAGAAGTTAAACTCTTCTTACTTGCCGAGGGG-AGGTT-AAACCAACAAGAACTGCTAATTCTTGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTAAATACATTCATACTCCTCACCCTAGCAACCCTCTCCACACCTATCCTATTCCCTCTTCTATCCCCCAACCTTAAAAACACCCCTAACATCATCACAAATACAGTTAAAACATCCTTCCTAATCAGCCTAATTCCCATAACTATCCACATCTACTCAGGGACAGAAAGCCTCACTTCCCTATGGGAATGAAAATTCATCATAAACTTCAAAATTCCTATTAGTCTAAAAATAGACTTCTACTCACTCACTTTCTTCCCCATCGCACTATTTGTTTCATGGTCCATCCTACAATTTGCAACATGATACATAGCCTCGGATCCCTACATTACAAAATTCTTTACCTACCTACTATTCTTCCTAATAGCAATACTCATCCTAATCATCGCTAACAACCTATTCGTCCTATTTATTGGCTGAGAAGGAGTCGGGATCATATCCTTCCTACTAATTAGCTGATGACATGGCCGAGCAGAAGCCAATACCGCTGCCCTACAAGCCATCCTCTACAATCGAGTCGGAGATATCGGCCTCATCCTCTGCATAGCATGACTAGCCTCAGCTATAAACACCTGAGAAATTCAACAACTCCCCTCCCCATCACAAACCCCAACACTACCTCTACTAGGTCTCATTCTAGCTGCAACCGGAAAATCAGCCCAATTCGGCCTACACCCATGATTACCCGCTGCCATAGAAGGACCAACCCCCGTTTCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCCCTATTCAGCAACAACCAAACCGCCCTAACCCTCTGCCTATGCCTGGGAGCCCTATCTACCCTATTTGCAGCCACATGCGCCCTTACTCAAAACGATATTAAAAAAATCATTGCCTTCTCCACTTCAAGTCAACTAGGCCTAATGATAGTCACAATCGGACTTAACCTCCCTGAACTAGCCTTCCTTCACATCTCAACTCACGCATTCTTCAAAGCCATGCTCTTCCTATGCTCAGGATCCATCATCCACAGCCTAAACGGCGAACAGGACATCCGAAAAATAGGAGGGCTCCAAAAAATAATACCCACAACCACCTCATGTCTCACCATTGGCAACCTAGCCCTAATAGGAACACCATTCCTAGCGGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCCCTACTACTAACCTTACTAGCCACGTCATTCACCGCAGTGTACACAATCCGCATGACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCTCCTCTAACCCCAATAAATGAAAACGACCCCGCAGTGACCTCCCCCATCACTCGACTCGCTCTAGGAAGCATTCTAGCAGGATTCCTCATCACCTCATTCATCATCC---CTACAAAAACTCCTACAATAACTATACCTACATCCATCAAAATAACAGCTCTAGTAGTCACCGCCCTAGGAATTGCTCTAGCCCTAGAAATCTCAAAAATAGCCCAAACCCTCATCCTCACAAAACAAACCACCTTCTCTAACTTTTCTACATCTTTAGGCTACTTTAACCCCCTAATCCATCGTCTAACCATAACCAACCTCCTTAACGGAGGCCAAAATATCGCCTCACACCTAATTGATCTGTCCTGATACAAAACCCTAGGCCCAGAGGGACTAGCCAACCTACAGCTAATAGCAACCAAAACCGCTACCTCCTTCCATTCAGGTCTAATCAAGGCCTACCTAGGAGCATTCGCCCTATCCATCATCATTATTCTCA---TATCCATACACAGAAT--CAA-T-T---AATGGCCCTCAATCTCCGTAAAAATCACCAAATCCTCAAAGTCATCAACAATGCCCTAATTGACCTACCCACACCACCAAACATCTCAACATGATGAAACTTCGGGTCTTTACTGGGTATTTGCCTAATTACTCAAATCATTACAGGTCTCCTGCTAGCAACCCACTACACAGCAGACACCAACCTAGCTTTCTCCTCTGTAGCCCACATATGCCGCGACGTCCAATTCGGCTGACTAATTCGTAACCTCCATGCAAACGGAGCTTCCTTCTTCTTCATCTGCATCTATCTTCACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTCATTCTACTACTAACCCTCATAGCAACCGCCTTCGTAGGATACGTCCTACCATGAGGCCAAATATCATTCTGAGGAGCTACAGTAATCACAAACCTATTCTCAGCAATCCCCTACATTGGACAAACACTAGTAGAATGAGCCTGAGGGGGATTCTCCGTAGACAACCCCACATTAACTCGATTTTTCGCTCTCCACTTCTTACTACCATTCGTTATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTACACGAAACTGGGTCAAACAATCCAACAGGAGTCCCCTCAGACTGCGACAAAATCCCATTCCACCCATACTACACCGTAAAAGACATTCTAGGCTTCGCACTAATAATCTCCCTACTCGTTTCCCTGGCCCTATTCTCCCCAAACCTACTAGGAGACCCAGAAAACTTCACGCCAGCCAACCCCCTAGTAACTCCCCCCCACATCAAACCCGAATGATACTTCCTATTCGCCTACGCTATTCTACGATCTATTCCAAATAAACTAGGAGGCGTACTAGCCCTAGCTGCCTCAATCCTCGTACTATTCCTAATACCCCTACTACACACATCAAAACTACGATCAATAACCTTCCGCCCTATCTCACAAATCCTATTCTGAGCCCTCGTCGCAAACGTCCTCATCCTAACATGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATTATCGGCCAACTAGCCTCACTCTCATACTTCACAATTATTCTAGTCCTATTCCCCATTGCAGCTGTACTAGAAAACAAACTGCTAAAACT----------CTA-ACC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Carduelis_spinus_NC_015198 GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-AACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGACGCCCTGGACA-CCT-T-AA-C-C-----AAGTAGATAGGAGCAGGCATCAGGCACA--C------CAT-T--ACCGTAGCCCAAGACGCCTTGCATTTGCCACGCCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-TGATAAGGCCTCC-TCGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCCGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAG--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACATACATACCGCCCGTCACCCTCCTCATAGG-CG---CCCCCCCCCCCCCATAAATTAATAAGCTAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAGCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGTTA-ACACCAGATCATCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACG-TG------ACCTGGA-ATAAC--AAAGCTACT--GC-ATA-CACCC----AACTAAAGCATT---T--ACTAGT-CTTAGTATAGGCGATAGAAAGGACA-CCA-TTGGC-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--CTTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--AATATA-CC-CTAATC--ATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCCATAAAAATATAAG-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--TAAAT---------CAA---ACAAGCA-GAG-TATTA-GGTACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CA-CACCCA--C-C-GGGTTCACTGTC-ACA-TAA-GA-T-ATTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAACCTCCAA-AAATTAGACCAAACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCGAGAGTCCGTATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAATT---TA-----ATAACC--C----ATGAC----------CAACTACCCCCTACTAATTAACCTCATCATAGCCCTCTCCTATGCCCTCCCAATCTTAATCGCAGTAGCTTTCCTCACACTAGTAGAACGCAAAATCTTAAGCTACATACAAGGCCGAAAAGGACCAAACATTGTTGGCCCATATGGCCTCCTACAACCCCTAGCAGACGGAGTAAAACTATTCATCAAAGAACCCATCCGAC---------CGTCAACATCCTCACCAATTCTATTTATTGCAACCCCAATACTAGCACTACTCCTAGCAATCTCTATCTGAACTCCCCTACCACTCCCATTCTCTCTAGCAGATCTCAACCTAGGCCTTTTATTCCTACTAGCTATATCAAGCCTGGCAGTATACTCCATTCTATGATCTGGCTGAGCATCTAACTCAAAATATGCTCTAATTGGGGCATTACGAGCAGTAGCCCAAACAATTTCATACGAAGTAACCTTAGCAATTATCCTCCTATCTGTAATTCTCCTCAGCGGCAACTACACTCTCAGCACCCTCGCAGTTACCCAAGAACCCCTCTATCTTATCTTCTCATGCTGACCCCTCGCTATAATATGATATGTCTCTACACTTGCTGAAACCAACCGTGCCCCCTTTGACTTAACAGAAGGAGAATCTGAACTAGTATCCGGATTCAACGTAGAATATGCAGCAGGCCCATTCGCACTATTCTTCCTAGCAGAATATGCTAATATTATGCTCATGAACACCATTACCACCATCCTATTCTTTAATCCAAGCCTACTAAACCCACCACAAGAACTATTCCCCGTAGTACTAGCCACTAAAGTCCTGCTACTTTCAGCAGGATTCCTATGAATTCGTGCTTCCTACCCTCGATTCCGATATGACCAACTAATACACCTACTATGAAAAAACTTCCTACCCCTTACGCTCGCTCTATGCCTTTGACACACCAGCATACCAATTTGCTATGCAGGACTACCC-----CCCTATCTA-A--GGACCCCCCCCA----CTATCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAATCCTCTCATTTCCT-A--CAAC-------TTAGAAAAGCAGGAGTCGAACCTACACTAGAGAAATCAAAATTCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAATCCACAGGCAAAACTAATCTTCACAATCAGCCTGCTCCTAGGAACCACTATCACAATCTCAAGCAATCATTGAATCA---TGGCCTGAACCGGCCTAGAAATTAATACACTTGCCATTCTACCCCTAATCTCAAAATCTCACCACCCACGATCCATTGAAGCAGCTACCAAATACTTCCTAACCCAAGCAGCTGCCTCAACCCTAGTACTATTCTCTAGTATAACTAACGCATGAAGTACCGGACAATGAGACATCACCCAACTCTCCCACCCCACATCAAGCCTAATTCTAACCTCAGCAATTGCCATAAAACTAGGATTAGTCCCATTCCACTTCTGATTTCCAGAAGTATTACAAGGCTCCCCTCTCTCCACCGGCCTCATCCTATCCACTATCATAAAACTCCCTCCAATCACTCTCCTATACATAACCTCCTCATCACTAAACCCTACACTCCTAACCACCCTAGCCATTCTATCAGTAGCTATCGGCGGATGAATGGGACTAAACCAAACACAAATCCGAAAAATCCTAGCCTTCTCCTCTATCTCCCACCTAGGATGAATGACAATCGTTATCATCTACAACCCTAAACTCACCCTCCTCAACTTCTATCTATACACCATAATAACTGCAGCCGTCTTTCTAACCTTAAACTCAATTAAAGTACTGAAACTATCCACCTTAATAACAGCATGAACTAAAGTCCCATCGCTAAACGCAATACTACTTCTAACCCTACTATCCCTTGCAGGTCTACCTCCCCTAACAGGATTCCTACCCAAATGACTCATTATTCAGGAACTAACCAAACAAGAAATAATCCCTGCAGCTACGCTTATCTCTCTCCTCTCCCTACTGAGCCTGTTCTTCTACCTCCGCCTTGCATACTGTACAACAATCACACTCCCACCACACACCACAAATCACATAAAACAATGACGCACCGGCAAATCAACTCATGCCCTGGTTGCCATCCTAACCACAATATCTGTCATCCTCCTTCCCATTTCACCTATAATCCTCACCATTAT------TT----AAGAAACTTAG----GATTAA-T-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTGAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAA-CTTACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGCTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACACAA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATTCGCTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGAACCCTATACCTAATTTTTGGCGCATGAGCCGGAATAGTAGGCACCGCCCTAAGCCTTCTCATCCGAGCAGAATTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCCCATGCTTTCGTCATAATCTTTTTCATAGTTATACCCATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTCCCCCCATCATTCCTCCTCCTACTAGCATCCTCCACCGTAGAAGCAGGTGTTGGTACAGGTTGAACAGTGTACCCTCCACTAGCTGGTAATCTAGCCCATGCCGGAGCTTCAGTTGACCTAGCAATCTTCTCCCTACACCTAGCCGGTATTTCTTCAATTCTAGGTGCAATCAACTTCATCACAACAGCAATCAATATAAAACCCCCTGCTCTCTCACAATACCAAACCCCCCTATTCGTCTGATCAGTCCTAATTACTGCAGTACTCCTACTCCTTTCCCTCCCAGTCCTTGCTGCAGGAATTACAATGCTTCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTCCTATATCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTCATCCCCCCAGGGTTTGGAATTATTTCCCACGTTGTAACCTACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGAATAGTGTGAGCCATACTATCCATTGGATTCCTAGGATTCATCGTATGAGCTCACCACATATTCACTGTCGGAATGGACGTTGACACCCGAGCCTACTTCACATCAGCCACTATAATCATTGCCATCCCAACCGGAATCAAAGTATTCAGCTGATTAGCCACACTTCACGGAGGCATTATCAAATGAGATCCTCCAATACTATGAGCCCTAGGATTCATCTTCCTATTTACCATCGGAGGACTAACAGGAATTGTCCTAGCAAATTCTTCACTAGATATTGCTCTACACGACACTTACTATGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTATTCGCAATCCTAGCAGGCTTCACACACTGATTCCCACTATTCACTGGATACACTCTCCACTCAACATGAGCTAAAATCCACTTTGGTGTAATATTCGTAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCAGGCATACCACGCCGATACTCAGACTACCCTGACGCCTACACCCTATGAAACACTATCTCCTCCGTAGGTTCCTTAATCTCTCTCACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCTTTCGCATCTAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCCTTCCACACCTTCGAAGAACCTGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAAACGTTAGT-AAAACC-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGCGAAACCCCTGCACGTCTCTC---TA-CC--AAACATGGCTAACCACTCACAATTTAACTTTCAAGACGCCTCCTCTCCCATCATAGAAGAATTAATAGGATTCCACGACCACGCTCTAATAGTTGCATTAGCAATCTGCAGCCTAGTGCTTTACCTACTAACCCACATACTCACAGAAAAACTCTCATCAAGCACGGTAGACGCACAAGAAATTGAACTAGTTTGAACAATCCTCCCAGCCATAGTATTAATTATACTTGCACTACCATCCCTACGAATCCTGTACATAATAGACGAAATTAATGAACCCGACCTCACCCTAAAAGCCATCGGCCACCAATGATACTGAACGTACGAATACACCGACCTCAAAGACCTAACATTCGACTCCTACATGATCCCAACATCAGACCTACCTCTAGGACACTTCCGCCTACTAGAAGTAGACCATCGCGTTGTAGTCCCTATAAGCTCTACAATCCGAGTCATTGTCACTGCTGATGACGTACTCCACTCATGAGCTGTCCCAAGCTTAGGTGTAAAAACTGACGCAATCCCAGGCCGCCTCAACCAAACTTCCTTCCTCGCCTCCCGACCAGGAGTATTTTACGGACAATGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATACCAATCGTAGTAGAATCCACTCCTCTCGCTAACTTCGAAAACTGATCTTCTACAA---CAGCCCCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-CCA-CCCCTCCTTAATGATATGCCTCAACTAAACCCCGCACCATGATTTTTTATCATGATCATTTCATGACTCACTTTCTCCCTCATCATCCAACCCAAAATCCTTACATTTGTAACAATAAATCCCCCATCCAATAAAC---CTCCCATCGCCCCAAGCACCACCCCCTGAACTTGACCATGAACCTAACTTTCTTCGACCAATTCTCAAGTCCATCCCTACTAGGAATCCCACTCATCCTCATTTCAATAACATTCCCCGCCCTCCTAATTCCTTCCCTGGACAACCGATGAATTACCAACCGACTCTCAACTCTCCAATTATGATTCATCAACCTAGTCACAAAACAACTAATAATACCCTTAGACAAAAAAGGACACAAATGAGCCCTAATCCTAACATCCCTAATAATCTTCCTCCTACTTATCAACCTTCTAGGCCTACTACCATACACATTCACCCCAACTACTCAACTATCCATAAACCTAGCACTGGCTTTCCCCCTATGACTCGCCACCCTATTAACAGGCTTACGGAACCAGCCCTCTGCCTCACTAGGCCACCTTCTACCAGAAGGTACCCCAACCCCACTAATCCCTGCCCTAATCCTAATTGAAACAACAAGCCTACTCATCCGCCCACTAGCCCTAGGCGTACGCCTAACAGCTAACCTCACAGCAGGTCACCTACTCATCCAGCTCATCTCCACTGCCACAACAGCCCTATTCACTACAATACCAGTAGTGTCGCTCCTAACCCTCCTAGTCCTCTTCCTACTAACTATTCTAGAAGTAGCTGTAGCAATAATCCAAGCCTACGTTTTCGTACTCTTACTAAGCCTATACCTACAAGAAAACATCT-AACC--CC--TCAATGGCACACCAAGCACATTCCTATCACATAGTAGACCCCAGCCCATGACCTATCCTAGGAGCTGCTGCCGCTCTCCTAACTACATCAGGACTAACAATATGATTCCACCACAACTCCCCTCAACTCCTCATCCTAGGCCTACTATCCACCGCCCTAGTTATATTCCAATGATGACGAGATATTATCCGAGAAAGCACGTTCCAAGGCCACCACACCCCAACCGTACAGAAAGGGCTACGATATGGCATGGCCCTATTCATCACATCCGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCTACCCCAGAACTAGGAGGACAATGACCACCCGTCGGAATCAAACCCCTAAACCCAATAGAAGTACCACTACTAAACACTGCTATCTTACTAGCCTCTGGAGTTACCGTAACATGAGCCCACCACAGCATCACAGAAGCCAGCCGAAAACAAGCAATCCACGCCCTAACCCTAACTGTTCTCCTAGGATTCTACTTCACCGCACTACAAGCCATAGAATACTACGAAGCACCATTTTCAATCGCAGACGGAATCTACGGCTCTACATTCTTCGTTGCCACAGGATTCCACGGCCTACACGTAATCATTGGCTCAACATTCCTGTTAGTATGCCTACTTCGCCTAATCAAATACCACTTCACACCAAGCCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTATATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTGACCCTATCATTCACCCTAAGCATCCTACTAACCGCACTAAACTTTTGATTAGCCCAAATAAACCCAGACTCAGAAAAATTATCTCCCTACGAATGCGGATTTGACCCCCTAGGCTCCGCTCGACTACCCTTCTCAATCCGATTCTTCCTAGTAGCTATCCTCTTCCTCCTCTTCGACCTAGAAATCGCCCTCCTACTTCCACTACCATGAGCTACCCAACTAGAATCCCCTATAACTACCCTAATCTGAACCTCCATCCTCCTCTTCCTCCTAACACTAGGGCTTATCTACGAATGAATCCAAGGCGGATTAGAATGAGCAGAGTA-A------TAGAAAGTTAGTCTAACTAAGACGGTTGATTTCGGCTCAACAAATTATAGCTCACACCCTATAACTTTCTTTATGTCCTATCTTCACCTCAGCTTTTACTCAGCCTTCACCCTAAGCAGCCTAGGCCTAGCTTTCCACCGAACCCATCTAATCTCCGCTCTCCTTTGCCTAGAAAGCATAATACTATCCATATACGTGGCACTCGCCATATGACCTATCCAAATACAATCACCAACCTCCACCATCCTGCCAATCATCATACTAACATTCTCCGCCTGCGAAGCAGGAACAGGCCTAGCCCTGCTAGTCGCCTCTACCCGAACCCACGGTTCAGACCACCTACACAACTTCAACCTTCTACAATGCTAAAAATCTTAATTCCAACTGCAACACTCCTACCCCTAGCTCTCATATCCCCACTTAAACATCTATGAACTAACATTACACTACACAGCTTAATCATTGCCACCATCAGCCTACAATGATTAACACCAACATACTACCCAAGCAAAAGCCTAACTCCCTGAACATCAATCGATCAAATCTCCTCCCCTCTCCTAGTCCTCTCATGCTGACTCCTTCCCCTCATAATCATAGCAAGCCAAAACCACTTAGAACAAGAACCCACTATCCGCAAACGAATCTTCGCTACAACAGTAATCCTAGCCCAACTATTCATCCTCTTAGCTTTCTCAGCCTCCGAATTAATACTCTTCTACATCGCATTTGAAGCAACCCTCATCCCCACCCTTATCCTCATTACACGATGAGGAAACCAACCAGAACGACTAAACGCTGGAATCTACCTCCTATTCTATACCCTAGCTAGCTCACTCCCCCTGTTAATTGCTATCCTTCACCTACAAAACCAAATCGGCACACTCTATTTCCCCATACTAAAACTATCACACCCTACAATAAACTCCTCCTGATCCGGATTAATTGCAAGCCTCGCCTTACTCCTCGCCTTCATAGTTAAAGCCCCCCTATACGGCCTACACCTATGACTTCCCAAAGCACACGTAGAAGCCCCAATCGCCGGTTCCATACTACTAGCTGCCCTTCTCCTAAAACTAGGAGGCTACGGCATCATACGAATCACAATCCTAGTAAACCCAGCATCAAACAACCTACACTACCCATTCATCACCCTAGCCTTATGAGGAGCATTAATAACCAGCGCCATCTGCTTACGACAAATCGACCTAAAATCATTAATCGCCTACTCATCTGTTAGCCACATAGGACTAGTCGTAGCCGCAACCATAATTCAAACCCAATGAGCATTCTCAGGAGCAATAATCTTAATAATCTCACACGGCTTAACCTCATCAATACTATTCTGCCTAGCCAATACCAACTACGAACGAACCCACAGCCGAATCCTCCTCCTCACACGAGGACTCCAACCCCTCCTACCACTAATAGCCATCTGATGACTTCTAGCAAACCTAACAAACATAGCTCTCCCTCCAACAACCAACCTCATAGCAGAATTAACCATCGTCATCGCACTATTCAACTGATCTGCCTTTACAATCATCCTAACAGGAGCGGCAATCCTACTCACCGCTTCTTACACCCTCTACATACTCATAATAACACAACGAGGCACACTTCCATCCCACATTACCTCTATCCAAAACTCCACCACCCGAGAACACCTCCTCATAGCTCTTCACATAATCCCAATACTGCTCCTCATCCTTAAGCCCGAACTAATCTCTGGTATCCCTATAT-GCAAGTATAGTTT-TAA-CCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAAATCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACAAGAACTGCTAACTCTTGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGCAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGTCCTAAATACATTCATACTCCTAACCCTAGCAACCCTATCCACACCCATCCTATTCCCCCTCCTATCCCCCAACTCCAAAAGCACCCCTAACACCATCACAAACACAGTTAAAGCCTCCTTCCTAATCAGCTTAGTCCCCATGACAATTCACATCTACTCAGGGACAGAAAGCCTCATTTCCCTATGAGAATGAAAATTCATCATAAACTTCAAAATCCCTATCAGCCTAAAAATAGACTTCTACTCACTCACCTTCTTCCCCATTGCACTATTCGTCTCATGATCCATCCTACAATTTGCAACATGATACATAGCTTCAGACCCCTACATCACAAAATTCTTCATCTACCTACTACTATTCCTAATAGCAATACTCATCCTAATTCTCGCCAACAATCTATTCGTCCTGTTCATCGGCTGAGAAGGAGTCGGAATCATATCCTTCCTACTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACTGCCGCCCTACAAGCCGTCCTATACAACCGAGTAGGAGACATCGGCCTCATCCTCTGCATAGCATGACTAGCCTCAGCCATAAACACCTGAGAAATCCACCAACTCCCCTCCCCATCACAAACCCCAACACTACCCCTACTAGGCCTCATCCTAGCTGCAACTGGCAAATCAGCCCAATTCGGCCTCCATCCTTGACTGCCCGCCGCCATAGAAGGACCCACCCCTGTTTCTGCCCTACTTCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACTCACCCCCTACTCAGCAATAACCAAACCGCCCTAACCCTCTGCCTATGCCTAGGGGCCCTCTCCACCCTATTCGCAGCTACATGTGCCCTTACCCAAAACGATATCAAAAAAATCATCGCCTTCTCCACCTCAAGCCAACTAGGCCTAATAATAGTTACAATCGGACTCAACCTCCCCGAACTAGCTTTTCTCCACATCTCAACTCACGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGATCTATTATCCACAACCTAAACGGCGAACAGGACATCCGAAAAATAGGAGGACTCCAAAAAATAATACCCACAACCACCTCATGCTTTACTATCGGCAACCTAGCACTAATAGGAACCCCATTCCTAGCAGGATTTTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCTCTACTACTAACCCTCCTAGCTACATCTTTCACCGCAGTATACACAATTCGCATGACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCTCCTCTAACCCCAATAAATGAAAACGACCCCGCAGTGACTTCACCCATCACTCGACTCGCACTAGGAAGCATCCTAACAGGATTCCTCATCACCTCATTTATCATTC---CCACAAAAACTCCTACAATAACTATACCCCTATCCATCAAAATAACAGCCCTAATAGTAACCGCCCTAGGAATTGCTTTAGCCCTAGAAATCTCAAAAATAGCCCAAACTCTCATCCTTACAAAACAAACTACCTTCTCAAACTTCTCCACATCCCTAGGATACTTTAACCCCCTAACCCACCGCTTAACCATAACCAACCTCCTCAACGGAGGACAAAATATCGCTTCACACCTAATCGATTTATCCTGATACAAAATCCTAGGCCCAGAAGGACTAGCCAACCTACAGCTAATAGCAACCAAAACCGCCACCTCCCTTCACTCAGGCCTAATCAAAGCCTACCTAGGAGCATTCGCCCTATCCATCATCATTATTCTCA---TATCCATACACAGAAC--CAA-T-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTCAAAGTCATCAACAACGCCCTAATTGACCTTCCCACACCGCCAAACATCTCTACATGATGAAACTTCGGGTCTTTACTGGGCATTTGCCTAATCACCCAAATTGTTACAGGCCTCCTGCTAGCCACCCACTACACAGCAGACACCAACTTAGCTTTCTCCTCCGTAGCTCACATATGCCGTGACGTCCAATTCGGCTGACTAATCCGCAACCTCCATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTTCACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTTATCCTCCTACTAACCCTCATAGCAACCGCCTTCGTAGGTTACGTCCTACCATGAGGCCAAATATCATTCTGAGGCGCTACAGTAATTACAAACCTATTCTCAGCAATCCCCTACATTGGACAAACACTAGTAGAATGAGCCTGAGGAGGATTCTCTGTAGACAACCCTACACTAACCCGCTTCTTCGCCCTTCACTTCCTACTCCCATTTGTTATCGTAGGCCTCACACTAGTTCACCTCACCTTCCTACACGAAACAGGATCAAATAACCCAACAGGAGTCCCCTCAGACTGCGACAAAATTCCATTCCACCCATACTACACCGTAAAAGACATTCTAGGTTTCGCACTAATAATCTCCCTACTCGTTTCTCTAGCCCTATTCTCCCCAAACCTCTTAGGAGACCCAGAAAACTTCACACCAGCCAACCCTCTAGTAACTCCCCCCCATATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCCATCCCAAACAAACTAGGAGGTGTACTAGCCCTAGCCGCCTCAATCCTCGTACTATTCCTAATACCCCTACTCCACACATCTAAACTACGATCAATAACTTTCCGTCCTATCTCACAAATCCTATTCTGAGCCCTAGTCGCAAACGTCCTTATTCTCACATGAGTAGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCACTCTCGTACTTTACAATCATTCTAGTCCTATTCCCCATCGCAGCCGCACTAGAAAACAAACTCCTAAAACT----------CTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Carpodacus_cassinii GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-T--ACTGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCATAAGCCAAAGATGC-CAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--CCCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGTAATGGGCTACATTTTCTAAGCTAGAACA-T-----ACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGCGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGACACGTACATACCGCCCGTCACCCTCCTCATAGG-CG----CCCCCCCCCCCCATAAATTAATAAGCTAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGAATA-CCAAGACGTAGC-TTAAGCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACATCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--AC-ATA-CACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTTAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAACTACATA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAAAACAATCTCCA-CGAGCGGATA----AAT--AATGACACC-TCCAAT-AATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCCAC-TTCACAAAAATATAAA-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATAT-TAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-CCACCA-ATATACGA--TAAAT---------CAA---ACAAGCA-GAG-TATTA-AGTACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCCAT-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAAACACATAAGACAAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACATA----CT-CACCCA--C-C-GGGTTCACTGAC-ACA-TAA-GA-C-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAACCTCCAA-AAATTAGACCAAACCTCTAGACCG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATTAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTAAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---CA-----AAACCC--C----ATGAC----------CATCCACCCCCTACTAATCAGCCTCATTATAGCCCTCTCCTACGCCCTTCCAATCCTAATTGCAGTAGCCTTCCTCACACTAGTAGAGCGCAAAATCTTAAGCTACATACAAAGCCGAAAAGGCCCAAACATTGTTGGGCCATACGGTCTCCTACAACCTCTAGCAGACGGTGTAAAGCTGTTTATTAAAGAACCTATCCGAC---------CATCAACGTCCTCACCAATCCTATTTATCGCAACCCCAATACTAGCCCTACTCCTGGCAATCTCAATCTGAACTCCACTACCCTTGCCTTTCTCCCTAGCAGACCTTAACCTAGGATTACTGTTTATGCTAGCTATATCAAGTCTGGCAGTATACTCCATTCTATGATCCGGCTGAGCATCAAATTCAAAGTACGCTTTGATTGGGGCATTACGAGCAGTAGCCCAAACAATTTCATACGAAGTAACCTTAGCAATCATCCTCCTGTCTGTTATTCTCTTTAGTGGTAATTACACCCTCAACACTCTTGCAATTACCCAAGAGCCCCTATATCTTATCTTCTCATGCTGACCCCTCGCCATAATATGATATGTCTCCACACTTGCTGAAACAAACCGAGCCCCGTTCGACTTGACAGAGGGGGAATCCGAGTTAGTCTCCGGATTTAACGTAGAATACGCAGCAGGCCCATTCGCACTCTTTTTCTTAGCAGAGTATGCTAACATTATACTCATGAACACCCTCACCACTATTCTATTCTTCAACCCAAGCTCATTCAACCTTCCCCAGGAATTATTTCCTGTGGTACTAGCCACAAAAGTCCTACTACTATCAGCAGGGTTTCTGTGGATTCGTGCCTCCTACCCTCGATTCCGATACGACCAGCTAATACACTTACTATGAAAAAATTTCCTACCACTTACGCTTGCCCTATGTCTCTGACATACCAGCATACCAATTTCTTACGCGGGACTACCC-----CCTTATCTA-A--GA--------------TTACCGGAAATGTGCCTGAATGT-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTGCACCAGTCCTCTCATTTCCT-A--TGTC-------TTAGAAAAGCAGGAATCGAACCTGCACTAGAGAAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTAAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAATCCTCAAGCAAAACTAATCTTTACGGCTAGTCTTCTCCTAGGAACTACCGTCACAATCTCAAGCAACCACTGAATCA---TGGCCTGAGCCGGCCTAGAAATTAATACTCTCGCCATCTTACCCTTAATTTCAAAATCCCACCACCCCCGATCCATTGAAGCAGCCACTAAATACTTCTTGACTCAATCAGCCGCCTCAGCCTTAGTATTATTCTCCAGCATAACTAACGCATGACACACCGGACAATGAGACATTACTCAGCTCTCTCACCCAACATCAAGCCTGATCCTGACCTCAGCAATTGCAATAAAACTAGGTCTAGTACCATTCCACTTCTGATTCCCAGAAGTACTACAAGGCTCCCCTCTCTCCACTGGTCTCCTCTTATCCACTATCATAAAACTTCCCCCAATTACCCTCCTATACATAACCTCTCCATCACTGAACCCCACACTCCTAACCTCCCTAGCCATCCTATCGGCAGCCGTAGGAGGATGAATGGGTCTCAACCAAACACAAATCCGAAAAATCATGGCTTTCTCATCCATCTCTCACCTAGGATGAATAGCGATCATCATCATTTACAACCCCAAACTTACCCTACTCAACTTCTACCTATACACCATAATAACTGCAACTGTCTTCATAGCCTTAAACTCAATCAAAGTACTAAAACTATCTACCCTAATAACTGCATGAACTAAAGTCCCCTCACTTAATGCAATATTACTTTTAACCCTACTTTCCCTCGCAGGACTCCCTCCCCTGACAGGATTCTTACCTAAATGACTCATTATCCAAGAACTTACCAAACAAGAAATAATCCTCGCAGCCACACTTATATCTCTCCTCTCATTGCTAAGCCTGTTCTTCTACCTCCGCCTTGCATACTGTTCAACAATTACACTTCCACCACATACTACAAACCACATAAAACAATGACGCACTGGCAAACCAACCAACATCCTAATTGCCATCTTAGCCACAATATCCGTCATTCTCCTGCCTATTTCACCCATAATCCTCACCATTAT------CT----AAGAAACTTAG----GATTAA-T-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTGAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTC-C--CAA-TTCACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCTGGTACACTG-CTAATGCACATCAATGAGCTTGCAACCCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGACTATTCTCAACCAACCACAAAGATATCGGAACCCTATACCTAATTTTCGGCGCGTGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAACCCGGAGCTCTTCTGGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCATGCCTTTGTAATAATCTTCTTCATAGTTATACCTATTATAATTGGGGGGTTTGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCTCCATCATTCCTCCTCCTATTAGCATCCTCTACCGTCGAAGCAGGAGTTGGCACAGGATGAACAGTATACCCACCATTAGCCGGCAACTTAGCCCACGCCGGAGCTTCAGTTGACTTAGCAATCTTCTCTCTACACCTAGCCGGTATCTCCTCAATCCTAGGAGCAATCAACTTTATTACAACCGCAATTAATATAAAACCTCCCGCTCTATCACAATATCAAACACCCCTATTCGTCTGATCAGTACTAATCACTGCAGTGCTCCTACTGCTTTCCCTTCCAGTCCTGGCCGCAGGAATCACAATGCTCCTCACAGACCGCAACCTCAACACTACATTCTTTGACCCTGCAGGAGGAGGAGACCCAGTCCTATACCAGCACCTCTTCTGATTTTTCGGGCACCCAGAAGTATACATCCTGATCCTGCCAGGATTTGGGATTATCTCGCACGTTGTAACCTACTACTCAGGGAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATGATATCCATCGGATTCCTAGGATTCATTGTATGAGCACACCACATATTTACAGTCGGAATGGACGTTGACACCCGAGCATACTTCACATCTGCCACCATAATCATCGCCATCCCAACCGGCATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCATAATCAAGTGAGACCCCCCAATATTATGAGCTTTAGGGTTCATCTTCCTATTCACCATCGGAGGCCTAACAGGAATTGTTCTAGCAAATTCCTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCTCACTTCCATTACGTACTATCAATAGGAGCAGTATTTGCAATCCTAGCCGGTTTCACACACTGATTCCCTCTATTCACTGGATATACCCTTCACTCAACATGAGCTAAAACTCATTTCGGCGTAATATTTGTGGGAGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGCTTAGCCGGCATACCACGTCGATACTCAGACTACCCAGACGCTTACACCCTATGAAATACCATCTCTTCTGTGGGCTCACTAATCTCCCTGACAGCCGTAATTATGCTAGTATTTATTATCTGAGAAGCCTTCGCATCAAAACGCAAAGTACTACAACCAGAACTAACAAGCACTAACGTCGAATGAATCCACGGCTGCCCGCCACCGTTCCACACCTTCGAAGAGCCAGCTTTCGTCCAAGTT------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGACGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCTAAATCGCAGGCGAAACCCCTGCACATCTCTA---CATCT--AAACATGGCCAACCACTCACAATTCAACTTCCAAGACGCTTCCTCCCCAATCATAGAAGAACTAATAGGATTTCACGACTACGCCATAATGGTCGCATTATCAATCTGCACCCTAGTGCTCTACTTACTAACCCACATACTTACAGAAAAACTCTCATCCAATACAGTAGACGCACAAGAAATCGAACTTGTCTGAACAATTCTTCCAGCTATAGTACTAGTAACACTCGCTCTACCATCACTACGAATCCTATACATGATAGACGAAGTCAACGAACCTGACCTCACCCTAAAAGCCATTGGCCACCAATGATACTGATCATACGAATACACTGACCTTAAAGACCTCACATTCGACTCCTACATAATTCCAACATCAGACCTACCCCTAGGACATTTCCGACTTCTAGAAGTAGACCACCGTGTTGTAGTTCCAATAAGCTCTACAATCCGAGTCATTGTCACTGCTGACGACGTCCTACACTCATGAGCTGTTCCAAGCCTAGGTGTAAAAACCGACGCCATCCCAGGTCGCCTCAACCAAACCTCCTTCCTTGCCTCCCGACCCGGAGTATTCTACGGACAATGTTCAGAAATCTGCGGAGCTAACCACAGCTTTATACCAATCGTAGTAGAATCTACTCCCCTCGCTAACTTCGAAAGCTGATCTTCTATAA---TAGCCTCCT----------AATCATTAAGAAGCTATGGACCAGCATTAGCCTTTTAAGCTAAAGATAGAGGGCT-ACA-CCCCTCCTTAATGATATGCCTCAACTAAACCCTGCACCATGATTTTTTATCATGATCATTTCATGACTCACCTTCGCCCTCATCATCCAACCTAAAATCCTTTCTTTCGTGTCAATAAACCCACCATCAAACAAAC---CTCCCGTCGCTCCAAGCACCACTCCTTGAACCTGACCATGAACCTAAGCTTCTTCGATCAATTCTCAAGCCCATCCCTCCTAGGCATTCCACTCATCCTTATCGCAATAATATTTCCTGCCCTTCTAATTCCCTCACTAGACAACCGATGAATTACCAATCGACTTTCAACCCTTCAATTATGATTCATCAACCTAGTAACAAAACAACTAATAATGCCATTAGACAAAAAAGGACACAAATGAGCCCTAATCTTAACATCCCTGATAATTTTCCTCCTGCTTATCAACCTTCTAGGATTACTACCATATACATTCACCCCAACCACCCAACTATCCATAAACCTAGCACTAGCCTTTCCCTTATGACTTGCTACCCTGCTAACCGGCCTACGAAATCAGCCCTCCATCTCACTAGGTCACCTCCTTCCAGAAGGCACCCCAACCCCACTAATCCCTGCCCTAATCCTAATCGAAACTACAAGCCTACTAATCCGCCCACTAGCCCTGGGCGTGCGCCTAACGGCAAACCTCACAGCAGGACACCTACTCATCCAACTCATCTCGACCGCTACAGTAGCCCTATCCACCACAATACCTGCAGTTTCACTACTAACCCTGCTGGTTCTTTTCCTACTAACAATTCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTTTTCGTACTTCTACTAAGCCTCTACCTACAAGAAAATATCTAATCC--CA--ACAATGGCACACCAAGCACATTCCTATCACATAGTAGACCCAAGCCCATGACCTATTCTAGGAGCCGCCGCCGCCCTCCTAACTACCTCAGGACTAACAATATGATTCCATTACAACTCTCCTCAACTTCTCATCCTAGGATTACTATCCACCATCCTAGTCATGTTTCAATGATGACGTGATGTTATTCGAGAAAGCACATTCCAAGGACACCACACCCCAACCGTACAAAAAGGACTACGATACGGCATAGTCCTATTCATCACATCCGAAGCCTTCTTCTTTCTAGGCTTTTTCTGAGCCTTCTTCCATTCAAGCCTAGCACCAACCCCAGAACTGGGAGGACAATGACCACCCGTAGGCATTAAACCTCTAAACCCCATAGAAGTACCCCTACTAAACACCGCCATTCTACTAGCCTCTGGAGTTACCGTAACATGAGCCCACCACAGCATTACAGAAGCTAAACGAAAACAGGCAATCCATGCCCTAACCCTAACCGTCCTCCTTGGATTCTACTTCACAGCGCTACAAGCCATAGAATACTACGAAGCACCATTCTCCATCGCAGATGGAGTCTACGGCTCTACATTCTTCGTTGCCACCGGATTCCACGGCCTACACGTAATCATTGGCTCAACATTCCTACTTGTATGCCTATTACGCCTAATTAAATATCACTTCACACCAAACCATCACTTCGGATTCGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTCTACATCTCTATTTACTGATGAGGATCCTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTCAAATCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTAGCACTATCCTTTACCCTAAGCATCCTACTAACCGCACTAAACTTTTGACTGGCCCAAATGAACCCCGATTCAGAAAAATTATCCCCCTACGAATGCGGATTCGACCCATTAGGATCTGCCCGACTTCCATTCTCAATCCGATTCTTCCTAGTGGCCATCCTATTCCTTCTATTCGACCTAGAAATTGCCCTACTACTCCCACTACCATGAGCCACCCAACTAGAATCCCCCACCACCACCTTGATCTGAACATCTTTCCTCCTCCTTCTCCTGACACTAGGACTCATCTATGAATGAGTTCAAGGCGGGTTAGAATGAGCAGAGTA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCAAACCCTATAACTTTCTTAATGTCCTATCTACACCTCAGCTTTTACTCAGCCTTCACCCTAAGCAGCCTAGGCCTAGCTTTTCACCGAACCCATTTAATCTCAGCCCTACTATGTCTAGAAAGCATAATACTGTCAATATACGTAGCACTAGCCATATGACCGATCCAAATACAATCATCATCCTCCACCATTCTACCAATCATCATACTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTCGCCCTATTAGTAGCCTCCACCCGAACCCACGGCTCTGACCACCTACACAACTTTAACCTCCTACGATGCTAAAAATTCTCATTCCAACTGCAACACTACTACCCCTAGCCATCATATCTCCACTCAAACACCTATGAACTAACATCACACTCCACAGCCTAATCATTGCCACTATTAGCCTCCAATGATTAACTGCCACATACTACCCAAGCAAAGGCTTAACCCCCTGAACCTCAATCGACCAAATTTCCTCACCCCTTTTAGTCCTATCCTGCTGACTCCTACCCCTCATAATCATAGCAAGCCAAAACCATCTAGAACAAGAACCCACTATCCGCAAACGAATCTTCGCTACAACAGTAATCCTAGCCCAACTCTTCATTCTACTAGCCTTCTCAGCCTCCGAACTAATACTTTTCTACATTGCATTCGAAGCAACTCTCATCCCAACCCTTGTCCTTATTACACGATGAGGAAACCAACCAGAACGCCTAAATGCCGGTATCTACCTCCTATTCTACACACTAGCCAGCTCACTCCCTTTACTAATCGCCATCCTCCACCTACAAAACCAAATTGGCACATTATACCTCCCAATACTAAAATTATCACACCCCACACTAAACTCTTCCTGATCAGGTCTAATTGCAAGCCTCGCCCTACTCCTTGCCTTCATGGTCAAAGCCCCTCTATACGGACTTCATCTTTGACTCCCCAAAGCCCATGTAGAAGCCCCAATCGCTGGCTCCATGCTACTAGCCGCCCTACTCCTAAAGCTAGGAGGCTACGGCATCATACGAATCACAATCCTAGTAAACCCAGCATCAAACAATCTTCACTACCCATTCATCACCCTAGCCCTATGAGGGGCATTAATAACTAGTGCCATCTGCCTACGACAAATCGACCTAAAATCGCTAATCGCCTACTCATCTGTCAGCCACATAGGCCTGGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATTCTGATAATCTCACACGGCCTAACCTCCTCAATACTATTCTGCCTAGCCAATACCAACTACGAACGAACCCACAGCCGCATCCTCCTACTCACACGAGGACTACAACCCCTACTACCCCTTATAGCCATCTGATGACTACTAGCAAACCTAACAAACATAGCTCTCCCCCCAACAACAAACCTCATAGCAGAACTAACCATCGTCATCGCACTATTCAACTGATCTGCCTTCACAATCATCCTCACAGGGGCAGCAATCCTCCTAACCGCCTCATACACACTATACATACTTACAATAACACAACGAGGCACACTTCCATCCCACATCACCTCGATCCAAAACTCCTCTACCCGAGAGCACCTTCTCATAGCCCTCCATATAATCCCAATACTACTCTTAATCCTCAAACCCGAACTAATCTCCGGCACTCCTATAT-GCAAGTATAGTTT-AAA-CTAAAACATTAGACTGTGATCCTAAAAATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTC-AAACCAACAAGAACTGCTAACTCTTGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTAGCACTAGTCCTAAACACATTCATACTCCTAACCCTAGCTACTCTCTCTACACCCATCCTACTTCCACTTCTATCCCCCAAATTCAAAAACACCCCCAATACCATTACAAACACAGTCAAAGCATCCTTCCTAATTAGCCTAATCCCAATAATTATCCACATTCACTCAGGGACAGAAAGCTTAACTACCTTATGAAAATGAAAATTCATCATAAACTTCAAGATCCCTATCAGCCTAAAAATAGACTTTTACTCCCTCACCTTCTTCCCTATCGCTCTGTTTGTCTCATGATCCATCCTACAGTTTGCAACATGATACATAGAGTCGGACCCATACATCACAAAATTCTTCACCTACCTACTATTCTTCCTAATAGCAATACTTATCTTAATCATCGCTAACAACCTATTCGTCCTATTTATTGGCTGAGAAGGGGTCGGAATTATATCCTTCCTACTAATTAGCTGATGACACGGACGAGCAGAAGCCAACACCGCCGCCCTGCAAGCTGTACTATACAACCGAGTCGGAGACGTTGGACTTATCCTCTGCATGGCATGACTTGCCTCAACTATAAACACCTGAGAAATCCAACAACTTTCCACCCAAGCACAAACCCCAACACTACCTTTACTAGGCCTCATCCTAGCTGCAACTGGCAAGTCCGCCCAATTCGGCCTCCACCCGTGATTACCAGCCGCCATAGAAGGCCCTACCCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCATCCACTATTCAACAACAACCAAACTGCCCTAACCCTTTGTCTATGCCTAGGGGCCCTATCTACCCTGTTCGCAGCAACATGCGCCCTCACCCAAAACGACATCAAAAAAATCATTGCCTTCTCTACCTCAAGCCAACTAGGCCTAATAATAGTAACAATTGGACTTAACCTCCCCGAACTAGCTTTCCTCCACATTTCAACCCACGCATTTTTCAAAGCTATACTATTCCTATGTTCAGGATCAATCATCCACAACCTAAATGGCGAACAAGATATCCGAAAAATAGGAGGGCTCCAAAAAATATTACCCACAACAACCTCATGCTTAACCATTGGAAACCTAGCCCTAATAGGAACCCCATTCCTAGCAGGATTCTACTCAAAAGACCAAATTATCGAAAGCCTAAACACATCATACCTAAACACCTGAGCCTTACTAATAACTCTACTAGCCACATCATTTACCGCAGTGTACACAATCCGCATAACCGTACTTGTACAGACCGGCTTCGTTCGAATTCCCTCCCTGACCCCTATAAATGAAAACAACCCCGCGGTAACCTCGCCAATCACCCGACTTGCATTAGGAAGTATCCTAGCAGGATTCCTCATCACCTCATTCATCATCC---CCACAAAAACCCCTACAATAACTATACCCCTATCCATTAAGATGACAGCCCTAATAGTAACCGCCCTAGGAATTGCTTTAGCTCTAGAAATCTCAAAAATAGCCCAAACCCTTCTCCTCACAAAACAAACCGCCTTCTCAAACTTTTCTACATCCTTAGGATACTTCAATCCCCTAGCCCACCGCTTAACCATGTCCAACCTACTCAACGGGGGACAAAACATTGCTTCACACCTAATCGACCTATCTTGATATAAAATAATAGGCCCAGAAGGACTAGCCAACCTACAGCTAATAGCAACCAAAACCGCCACCTCCTTCCACTCTGGTCTAATCAAAGCCTACCTAGGGGCATTCGCCCTATCCATCATTATCATTCTCA---TATCCCTATACAGAAC--CAA-T-T---AATGGCCCCTAACCTACGTAAAAACCACCAAATCCTAAAGATCATCAACAACGCCCTAATTGACCTCCCCACACCATCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGTATCTGCCTAATCACTCAAATCGTTACCGGTCTCCTGCTAGCTATACACTACACAGCAGACACCAATCTAGCCTTCGCATCCGTAGCCCACGTATGCCGAGATGTCCAATTCGGTTGACTAATCCGCAACTTACACGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTTCACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTCATCCTCTTACTAGCTCTCATAGCAACCGCCTTCGTAGGATACGTCCTACCATGAGGACAAATGTCATTCTGAGGTGCTACAGTAATCACAAACCTATTCTCAGCAATCCCGTACATCGGCCAAACACTAGTAGAATGAGCCTGAGGAGGATTCTCAGTTGACAACCCCACACTAACCCGATTCTTCGCTCTTCACTTCCTCTTACCATTTGTTATTGTAGGTCTCACACTAGTCCACCTAACCTTCCTACACGAAACAGGATCAAACAACCCAACAGGAGTCCCCTCAGATTGTGACAAAATCCCATTCCACCCCTACTACACAGTAAAAGATATCCTAGGCTTCGCACTAATAATCGCCATTCTCGTCTCTCTAGCTCTATTCTCCCCAAACCTCCTAGGAGACCCAGAAAACTTCACACCAGCCAACCCACTAGTAACCCCACCCCATATCAAACCCGAATGATACTTCCTATTTGCCTATGCTATCCTACGATCTATCCCAAACAAACTAGGAGGCGTACTAGCCCTAGCCGCCTCTATCCTAGTATTATTCCTACTACCCCTCCTCCACACATCAAAACTACGATCAATAACATTCCGCCCTATCTCCCAAATCCTATTCTGAGCTCTGGTAGCAAACGTCCTAGTCCTAACATGAGTAGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCATTCACCTACTTCACAATTATTCTAGTCCTATTCCCCATCGCTGCCGCACTAGAAAATAAACTTCTAAAACT----------TTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Carpodacus_erythrinus GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGATGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGAAGCCCTGGACA-CC--T-AA-T-A-----AGGTAGATAGGAGCGGGTATCAGGCACA--C------CAT-G--ATTGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTACTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGCGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGATTAAAAAGCAACTGAGTTGTCACAAGCCCAAGATGC-TAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCAAACAGTGAGCGCAACAG-CCCAA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGCTAGAACA-C----AACGGCAAAGGGGTATGAAATAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG-----CCCCCTCCCCTATTAACTAATAAGCTAT-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGATA-ATACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--AC-ATA-TACCC----AACTAAAGCATT---T--ATCAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACCTATGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTGGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AATAGT-CT-ACTAAT-CATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCCTCAAAAATATAAA-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAG-TTACCA-ATATACGA--AAAAT---------CAA---ACAAGCA-GAG-TATTA-AGCACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAATTCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCATAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAGTTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTATAA-CACATA----CT-CACCCA--C-T-GGGTTCACTGAC-ACA-TAA-GA-C-ATTGGCC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCATATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAG-GCAAGCCTCC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT---CA-----ACTACC--C----ATGAC----------CAACTACCCACTACTCATTAACCTCATTATATCCCTTTCCTACGCCCTCCCAATCTTAATCGCAGTAGCCTTTCTCACACTAGTAGAACGCAAAATCTTAAGCTACATACAAGGCCGAAAAGGCCCCAACATTGTAGGCCCATATGGACTCCTACAACCCCTGGCAGACGGAGTAAAATTATTCATCAAAGAACCTATTCGAC---------CATCAACATCCTCACCAATTCTATTCATTGCAACCCCAATACTAGCCCTACTCCTGGCAATCTCTATCTGAACTCCACTGCCTCTACCCTTCTCCCTAGCAGACCTAAACCTAGGCCTACTATTCCTATTAGCCATGTCAAGCCTAGCAGTATACTCCATTCTGTGATCTGGTTGAGCCTCCAACTCCAAATATGCCCTAATTGGGGCACTACGAGCAGTAGCTCAAACAATCTCATACGAAGTGACCTTAGCAATCATCCTCCTATCTGTTGTCCTTCTTAGCGGCAATTACACCCTCAGCACTCTTGCAGTCACTCAAGAGCCCCTGTATCTTATTTTTTCGTGCTGGCCTCTAGCCATAATGTGGTATGTCTCTACACTTGCCGAAACAAATCGTGCCCCATTTGATCTAACAGAAGGAGAGTCTGAACTAGTATCTGGATTTAATGTAGAATATGCAGCAGGGCCTTTCGCACTTTTCTTCTTGGCCGAATATGCTAACATCATGCTCATGAACACTATCACCACCATCCTGTTCTTCAACCCAAGCCTTCTCAACCCCCCTCAAGAACTATTCCCCGTGGTGCTAGCCACAAAAGTCCTGCTGCTATCCGCAGGGTTTTTATGGATCCGTGCCTCCTATCCCCGATTCCGATACGACCAGCTAATGCACCTATTATGAAAAAACTTCCTACCACTTACACTTGCCCTATGCCTTTGACACACCAGCATGCCAATCTCCTACGCGGGACTACCC-----CCTTATCTA-A--GA--------------TAACAGGAAATGTGCCTGAATAT-C--AAGGGTCACTATGATAAAGTGAACATAGAGGTATACCAGCCCTCTCATTTCCT-A--CAGC-------TTAGAAAAGCAGGAATCGAACCTACACTGAAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCTTCCCCTGCTA-ATGAATCCACAGGCAAAGCTAATTTTTATAACTAGCCTCCTCCTAGGAACCACCATCACAATTTCAAGCAACCACTGAATTA---TAGCCTGAGCCGGCCTTGAAATTAATACACTCGCCGTCCTACCACTAATCTCGAAATCCCATCACCCACGATCCGTTGAAGCAGCCACTAAGTACTTCTTAACCCAAGCAGCCGCTTCGGCCCTAGTACTATTCTCCAGCATAACTAATGCATGACACACCGGGCAGTGGGATATCACTCAGCTGTCCCACCCCACATCAGGTTTAATCCTAACCTCAGCAATTGCAATAAAACTAGGCTTAGTCCCATTCCACTTCTGATTCCCAGAAGTACTACAAGGTTCCCCCCTCTCCACAGGCCTCCTTCTGTCTACTATCATAAAACTCCCCCCAATTACCCTCCTATATATAACCTCCCCCTCACTAAACCCCACACTACTAACCATCCTGGCCCTCCTCTCAACAGCACTTGGAGGATGAATAGGACTCAACCAGACACAAGTCCGAAAAATCTTAGCCTTCTCCTCCATCTCCCACTTAGGATGAATAGCGATCATTATTATCTACAACCCTAAACTAACTCTCCTCAACTTCTACCTTTACACCATAATAACTGCAACCGTATTTCTAACCTTAAACTCAATAAAAGTACTAAAACTATCCACCCTAATAACCGCATGAACCAAAGTCCCATCATTGAACGCAATACTACTTTTAACCCTACTTTCCCTTGCAGGATTACCTCCCCTAACAGGATTTTTACCTAAATGACTTATTATCCAAGAACTAACTAAACAAGAAATAATCGCTACAGCCACGCTTATAGCCCTCCTCTCATTACTAAGCCTGTTCTTTTACCTTCGCCTTGCATACTGTACAACAATCACACTCCCACCACACACCACAAACCACATAAAACAATGACGAACCGGCAAACCAACTAATGTCCTAATCGCTATCCTAACCACAATATCCATCACCCTCCTCCCCATTTCACCCCTAATCCTCGCCCTCGT------CT----AAGAAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTGGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCATTATCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-T--CAA-CCCACTAGACAGATGGGCTTCGATCCCATGACTC-TGTAGTTAACAGCTACATGCCCAAACC-AACAGGCCTCTGCCT-A-------------AGGCTCCGGTACACGG-TTAGCGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTTTCAACCAACCACAAAGATATCGGAACCCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGGGCAGAACTGGGACAACCCGGGGCCCTTCTAGGAGATGACCAAGTCTACAACGTGGTCGTCACAGCCCATGCCTTCGTAATAATTTTCTTCATAGTTATACCTATCATGATCGGAGGGTTCGGAAACTGACTAGTTCCCCTGATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTACTCCCCCCATCTTTCCTTCTTCTACTAGCTTCATCTACAGTTGAAGCTGGGGTCGGGACAGGCTGAACAGTGTACCCCCCACTAGCCGGCAACCTAGCCCACGCCGGAGCATCAGTTGATCTTGCAATTTTCTCACTGCATCTGGCTGGTATTTCTTCAATCCTTGGAGCAATCAACTTCATCACAACAGCGATCAATATAAAACCCCCTGCCCTATCGCAATATCAAACCCCCCTATTCGTCTGATCAGTACTAATTACCGCAGTACTCCTACTCCTATCTCTCCCAGTACTCGCTGCGGGAATCACAATACTTCTTACAGACCGCAACCTCAACACTACATTCTTTGACCCTGCGGGAGGAGGAGACCCAGTCCTATATCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTATACATCCTAATTCTACCAGGATTCGGAATCATCTCCCACGTCGTAACCTACTACGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCTATGTTATCTATCGGATTCCTGGGGTTCATTGTGTGAGCCCATCACATATTCACAGTCGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACTGGAATTAAAGTATTCAGCTGACTAGCTACACTCCACGGAGGCACAATCAAATGAGACCCACCAATACTATGAGCCCTAGGATTTATCTTCCTGTTTACCATTGGAGGTCTAACAGGAATCGTCCTAGCAAACTCTTCACTAGATATCGCCTTACACGACACCTATTACGTAGTTGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTATTCGCAATCCTGGCAGGTTTTACACACTGATTCCCCCTGTTCACTGGATACACCCTCCACTCAACATGGGCCAAAACCCACTTCGGTGTGATATTCGTAGGAGTCAACCTAACCTTCTTCCCACAACACTTCCTAGGCCTGGCCGGCATGCCACGCCGATACTCAGACTACCCTGATGCCTATACCCTATGAAACACCATCTCCTCAGTAGGCTCCCTCATCTCCTTAACAGCCGTAATCATGCTAGTGTTCATCATCTGAGAAGCCTTTGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACTAACGTAGAATGAATCCACGGCTGCCCGCCTCCCTTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATT-AAGAGACGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAACCCCTGCACATCTCTC---CATCT--AACCATGGCCAACCACTCACAATTCAACTTCCAAGACGCCTCCTCCCCAATTATAGAAGAATTAATAGGATTCCACGACCATGCCCTAATGGTCGCACTGGCAATCTGCAGCCTAGTACTTTACCTACTAACCCACATGCTTACAGAAAAACTCTCATCCAGCACAGTAGATGCACAAAAAATTGAACTCGTATGAACAATTCTTCCAGCTATGGTGCTAGTCACACTCGCACTACCATCCCTACGAATCCTTTATATAATAGACGAAATTAATGAACCCGACTTAACCCTAAAAGCCATCGGCCACCAATGATACTGAACATACGAATATACTGACCTCAAAGACCTCACATTCGACTCCTACATAATCCCAACATCAGAACTACCTCTAGGACACTTCCGACTGCTAGAAGTCGACCACCGCGTTGTAGTCCCAATGAGCTCCACAATCCGAGTAATCGTCACCGCTGACGACGTGCTTCACTCATGAGCCGTCCCAAGCCTAGGTGTAAAAACTGACGCAATCCCAGGCCGCCTGAACCAAACCTCCTTCCTTGCCTCCCGACCCGGAGTTTTCTACGGACAGTGCTCAGAAATTTGCGGGGCTAACCACAGCTTCATACCAATCGTAGTAGAGTCTACCCCTCTTGCCAATTTCGAAAGCTGATCCTCTCTAA---TAACCTCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGCC-ATA-CCCCTCCTTAATGATATGCCTCAACTAAATCCAGCCCCATGATTTTTTATCATGCTCATTTCATGATTCACCCTTTCCCTTATCATTCAACCCAAACTCCTCTCATTCGTATCAATAAACCCCCCATCTAGCAAAC---CCCCCATCGCTCCAAGCACCACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCACTACTAGGAATCCCCCTAATCCTCATCGCAATAACATTCCCCGCCCTCCTAATCCCCTCCCTGGACAACCGATGAATCACTAACCGCCTTTCAACCCTCCAACTGTGATTCATTAACCTAGTTACAAAACAACTAATAATACCCCTAGACAAGAAAGGACACAAATGAGCCCTAATCCTGACATCTCTAATAATCTTCCTCCTCCTCATCAACCTCCTGGGCTTACTGCCATACACGTTCACTCCAACTACCCAACTATCCATAAGCCTAGCCCTAGCCTTCCCCTTATGACTAGCCACCCTACTAACAGGCCTACGAAACCAACCTTCAGCCTCATTAGCCCACCTACTGCCAGAAGGTACCCCAACCCCACTAATCCCTGCCCTAATCCTAATCGAAACGACAAGCTTACTCATCCGACCACTAGCCCTGGGCGTACGCCTAACAGCCAACCTCACAGCAGGGCACTTACTCATCCAACTCATCTCCACGGCCACAGTAGCCCTATTCTCTACAATACCAGCAGTCTCGCTCCTAACCCTGCTGGTCCTCTTCCTACTAACCATTCTAGAAGTAGCGGTAGCAATAATCCAAGCCTACGTCTTCGTGCTTCTTCTAAGCCTCTACCTACAAGAAAACATCTAACAC--CC--ACAATGGCACACCAAGCACACTCTTATCACATAGTAGACCCCAGCCCATGACCTATTTTAGGAGCCGCCGCCGCCCTCCTAACCACTTCAGGACTAACAATATGATTCCACTATAACTCCCCCCGACTCCTCATCCTAGGCCTACTCTCCACCTCCCTAGTTATATTCCAATGATGACGTGACATCATCCGGGAAAGCACGTTCCAAGGCCACCACACCCCCACCGTACAAAAAGGATTACGCTACGGCATAGCCCTGTTTATCACATCTGAAGCTTTCTTCTTCCTAGGCTTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCCACCCCAGAACTAGGAGGACAATGACCGCCCGTCGGAATCAAACCTCTAAACCCAATAGAAGTACCACTCCTAAATACTGCCATCCTCCTAGCCTCAGGAGTCACCGTGACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTAACTCTAACCGTTCTCCTAGGATTCTACTTTACAGCACTACAAGCCATAGAGTACTACGAAGCCCCATTCTCTATCGCAGACGGAGTCTACGGCTCTACATTCTTCGTCGCCACCGGATTCCACGGCCTCCACGTAATCATTGGCTCAACATTCCTATTAGTATGCCTCCTGCGTCTAATCAAATACCACTTCACATCAGGCCACCACTTCGGATTCGAAGCAGCTGCCTGATATTGACACTTCGTAGACGTCGTGTGACTATTCCTCTATATCTCTATCTACTGATGAGGATCCTACTCTTCTAGTATACTT-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTCAACCCCAGAGAAGAGTAATG---AACACAATCCTATTCATACTGACTATATCGCTCGCCTTGAGCATCCTACTAACCACACTAAACTTTTGACTAGCCCAAATAAACCCAGACTCAGAAAAACTATCCCCCTACGAATGCGGATTTGATCCCCTGGGATCTGCCCGACTTCCATTCTCAATTCGATTCTTCCTAGTAGCTATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTACTCCCGCTCCCATGAGCCATCCAACTAGAATCCCCTACCACTACCTTCATTTGAACCTCCTTCCTCATTCTACTCCTAACACTAGGGCTAATCTACGAATGAATTCAAGGCGGCCTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTTATGTCTTACCTACACCTTAGCTTTTACTCAGCCTTCACCCTAAGCAGCCTAGGCTTAGCCTTCCACCGAACTCACCTAATTTCAGCCCTACTATGTTTAGAAAGCATGATACTATCAATATATGTAGCTCTCGCCATATGACCTATCCAAATACAATCACCATCCTCTACCATCCTACCTATCATCATACTAACATTCTCTGCTTGCGAAGCAGGCACAGGCTTAGCCCTACTAGTAGCCTCCACCCGAACCCACGGTTCTGACCACCTGCACAACTTCAACCTCCTACAATGCTAAAAATCATTATCCCAACTGCAACGCTTCTTCCATTAGCCTTCATGTCTCCCCTTAAACACTTATGAACCAACATTACATTTCACAGCCTACTCATTGCCACTGCCAGCCTGCAATGACTAACGCCAACCTACTACCCAGGCAAAGGCCTAACTCCCTGAACATCAGTCGACCAAATCTCCTCTCCCCTGCTAGTCCTCTCATGCTGACTCCTGCCCCTTATGATTATAGCAAGCCAAAACCACCTAGAACAAGAGCCCAACATCCGCAAACGAATCTTCGCCACAACAGTAATCCTAGCCCAACTATTCATTCTCCTAGCCTTCTCAGCCTCCGAACTAATACTCTTCTACATTGCATTCGAAGCAACCCTCATCCCAACCCTAATCCTCATCACACGATGGGGAAGCCAACAGGAACGATTAAACGCTGGCATCTACCTCCTATTCTACACACTAGCCAGTTCACTACCCCTACTAATTGCTATCCTGCACCTACAAAACCAAATCGGCACACTCTACCTCCCCATACTAAAACTATCACACCCCACATTAAACTCCTCTTGATCTGGACTAATCGCAAGCCTCGCGCTTCTCCTAGCTTTCATAGTTAAAGCTCCCCTATACGGCCTACACCTATGACTACCCAAAGCCCACGTAGAAGCCCCAATCGCCGGCTCCATACTACTAGCCGCCCTCCTCCTAAAACTAGGGGGCTACGGCATCATACGAATCACAATCCTAGTAAACCCAGCATCAAACAACCTGCACTACCCATTCATCACCCTAGCCCTATGAGGAGCCCTAATAACTAGTGCTATCTGCCTACGACAAATCGACTTAAAATCACTAATTGCCTACTCATCTGTTAGCCACATAGGCCTAGTCGTAGCAGCTACCATAATCCAGACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACACGGGCTAACCTCCTCAATACTATTCTGCCTAGCCAACACCAACTACGAACGAACCCATAGCCGAATCCTATTACTCACACGAGGACTTCAACCCCTCCTACCACTTATGGCCATCTGATGACTCCTAGCCAACCTAACAAACATAGCCCTCCCCCCAACAACCAACCTTATAGCAGAACTAACTATCGTTATCGCACTATTCAACTGATCCGCCTTCACAATTATCCTCACAGGAACAGCAATCTTCCTCACTGCCTCATACACCCTATACATACTCATAATAACACAACGAGGCCCACTCCCATCCCACATCACCTCAATCCAAAACTCCTCAACCCGAGAACACCTCCTCATGGCTCTCCATATAATTCCAATGCTCCTACTAATCCTCAAACCAGAACTAATCTCTGGCATCCCTATAT-GCAAGTATAGTTT-TAA-CCAAAACATTGGGCTGTGACCCTAAAGATAGAAGTTAGACCCTTCTTACCTGCCGAGGGG-AGGTC-AAACCAACAAGAACTGCTAACTCTTGACTCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGATCTATCCCTCATCCTAAACACATTCATAATCCTAACCCTAGTCACCCTCTCCACCCCCATCCTATTCCCACTCCTATCGCCCAACCTCAAAAACACCCCCAACACCATCACAAACACAGTCAAAGCCTCCTTCCTAATTAGCCTAGTTCCCATGACAATTCACATCTACTCAGGAACAGAGAGCCTAGTCTCCCTATGAGAATGAAAATTTATCATAAACTTCAAAATCCCTATCAGCCTAAAAATAGACTTCTACTCACTCACCTTCTTCCCAATCGCACTATTCGTATCATGATCCATCCTACAATTCGCAACATGATACATAGCCTCAGACCCATACATTACAAAATTCTTCACCTACCTACTATTTTTCCTAATAGCAATACTCATCCTAATCATCGCCAACAACCTATTCGTCCTCTTCATCGGCTGAGAAGGAGTAGGGATCATATCCTTCCTACTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTACAAGCAGTACTGTACAACCGAATCGGAGACGTCGGACTCATTCTCTGCATGGCATGACTAGCATCTACCATAAACACCTGAGAAATCCATCAACTCCCCTCCACATCCCAAACCCCAACACTTCCCCTGCTCGGCCTTATTCTAGCTGCAACCGGCAAATCCGCCCAATTCGGTCTACACCCTTGACTGCCAGCGGCCATAGAAGGACCTACCCCTGTATCCGCCCTGCTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTTATCCGAACCCATCCCTTATTTAGTAACAACCAGACCGCCCTCACCCTCTGCCTATGCCTAGGAGCCCTATCCACTCTATTCGCCGCTACGTGCGCTCTAACCCAAAATGACATTAAAAAAATCATCGCCTTCTCCACTTCAAGCCAACTGGGCCTAATAATAGTTACAATCGGACTAAACCTCCCCGAACTAGCCTTCCTCCACATCTCAACCCACGCCTTCTTTAAAGCCATACTCTTCCTGTGCTCAGGCTCCATCATCCACAGCCTTAACGGCGAACAAGACATTCGAAAGATAGGAGGACTTCAAAAAATAATGCCTACAACTACCTCTTGCCTCACCATTGGAAACCTAGCCCTAATAGGAACCCCATTCCTAGCAGGATTCTATTCAAAAGACCAAATCATCGAAAGCCTAAACACATCATACCTAAATGCCTGAGCCCTCCTACTAACCCTACTAGCCACATCATTCACCGCAGTCTACACAATCCGTATAACCGTACTAGTACAAACCGGCTTCGTTCGAATTCCTCCCCTGACCCCAATCAATGAAAACAACCCAGCAGTAACTTCACCTATTACTCGACTTGCATTAGGAAGTATCCTAGCAGGATTCCTCATTACTTCATTTATCATTC---CAACAAAAACACCAACAATAACTATACCTCTATCCATCAAAATAACAGCCCTGGCAGTAACCGCCCTAGGAATTGCCCTAGCCCTAGAAATCACAAAAATAGCCCAAACCCTCCTCCTCACAAAACAAAACGCCTTCTCAAACTTCTCCGCCTCCCTAGGCTACTTCAACCCTCTAACCCATCGCCTAAGCACATTCAACCTCCTCAGCGGAGGACAAAACATTGCCTCACACTTAATCGACTTATCCTGATACAAAACCCTAGGCCCAGAAGGATTAGCCAACCTACAACGAATAGCAGCCAAAACTGCCACCTCAGCCCACTCCGGCCTAATCAAGGCCTACCTAGGAACATTTGCCCTGTCCATCATTATCATCCTAA---TATCCACATACAGAA---AAA-C-C---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATTGTCAACGACGCCCTGATTGACCTCCCCACACCCCCAAACATCTCAACATGATGAAACTTCGGGTCTCTCCTGGGCATTTGCCTAATCACTCAAATCGTTACCGGTCTTCTGCTAGCCACACACTACACAGCAGACACCAACCTAGCTTTCTCCTCCGTAGCTCACATATGCCGTGACGTTCAATTCGGCTGACTAATCCGCAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTTCACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTCATCCTCCTTTTAACCCTCATAGCAACCGCCTTCGTAGGCTACGTCCTACCATGAGGCCAAATGTCGTTCTGAGGTGCTACAGTAATTACAAACCTATTCTCAGCAATCCCCTACATTGGGCAAACACTAGTAGAATGAGCCTGAGGGGGATTCTCTGTTGACAACCCAACATTAACCCGATTTTTCGCTCTTCACTTCCTTCTACCATTCGTTATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTTCACGAAACTGGATCAAACAACCCAACAGGAGTCCCCTCGGACTGCGACAAAATCCCATTCCACCCATATTACACCGTAAAAGACATCCTAGGCTTCGCATTAATAATCTCCCTACTTGTCTCCCTGGCCCTATTCTCCCCTAACCTTCTAGGAGACCCAGAAAACTTCACACCAGCTAACCCCCTAGTCACCCCTCCCCACATCAAACCAGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCTATTCCAAACAAACTAGGAGGTGTACTAGCCCTAGCCGCCTCAATTCTAGTCCTATTTCTCCTACCCCTACTTCACACATCAAAACTCCGATCAATGACCTTCCGCCCTATCTCCCAAATCCTATTCTGAGCCCTAGTCGCAAATGTCCTCATCCTGACATGAGTAGGAAGCCAACCAGTAGAGCACCCATTCATCATTATCGGCCAACTAGCCTCATTCACTTACTTCACAATCATTCTAGTCCTATTCCCCCTCGCGGCCGCGCTAGAAAATAAAATACTAAAACT----------CTA-ATA-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAGCCCCTTCTTAGAGTT Carpodacus_mexicanus GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACA-CC--T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCTAAAGATGC-CAATAAGGCCTCC-TCGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCCAACAGTGAGCGCAATAG-CCTAA-CCCCGCTAGTACGACAGGTCAAGGTATAGCCCATGGAATG----------------------GG-AGCAATGGGCTACATTTTCTATAATAGAACA-T-----ACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG----ACCCCCCCCCCCATAAATTAATAAGCCAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGCTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGTTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTATT--AC-ATG-CACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-ATGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAACAACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ACTAAT-CT-TCTAAC-AGTACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TTTACAAAAATATAAG-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATATCTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--AA-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-CCACCA-ATATACGA--TCAAT---------CAA---ACAAGCA-GAG-TATTA-AGTACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCAGTG--ACTA--TT---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATGAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTATAA-CACCTA----CT-CACCCA--C-T-GGGTTCACTGAC-ACA-TAA-GA-C-ATTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAACAAAAACCTCCAA-AAATTAGACCAAACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCATATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACGAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---T------ACAACT--C----ATGAC----------TAACTTCCCCCTACTAATCAACCTTACCATAGCCCTCTCCTATGCCCTCCCAATCTTGATTGCAGTAGCCTTCCTCACACTAGTAGAGCGTAAAATCTTAAGCTACATACAAAACCGAAAAGGTCCAAACATCGTTGGCCCATATGGACTTTTACAACCATTGGCAGACGGAGTAAAACTATTCATTAAAGAACCCATCCGAC---------CATCAACATCTTCACCAATCCTATTCATCACAACCCCAATGCTAGCCTTACTTCTAGCAATCTCCATCTGAACTCCGCTGCCCCTACCGTTCTCCCTAGCAGACCTCAACCTAGGCCTGCTATTTCTATTAGCCATATCAAGCCTGGCAGTATACTCCATCCTATGGTCTGGATGAGCATCCAACTCAAAGTATGCCCTAATCGGGGCACTACGAGCAGTAGCCCAAACAATTTCATACGAAGTGACCCTGGCAATTATTCTCCTATCCGTTATCCTTCTCAGTGGGAACTACAACCTCAATACTCTTGCAGTCACTCAAGAACCCTTGTACCTTATTTTCTCGTGTTGACCCCTTGCTATAATATGATACGTCTCTACACTTGCTGAGACCAACCGAGCCCCATTTGACCTGACAGAAGGAGAATCCGAACTAGTCTCCGGATTTAACGTAGAATACGCAGCAGGTCCATTCGCATTATTCTTCCTAGCGGAATACGCTAATATCATACTCATGAACACCATCACTACCATCATATTCTTCAACCCAAGCTCACTAAACCCACCTCAAGAGCTGTTCCCTGTAGTGCTAGCCACAAAAGTTCTACTACTATCAGCAGGATTTCTATGAATTCGCGCCTCTTACCCCCGATTTCGATACGACCAACTAATACACCTGCTATGAAAAAACTTTCTCCCACTTACGTTAGCCTTATGCCTCTGACACACCAGCATGCCAATTTGCTATGCGGGACTACCC-----CCCTACCTA-A--GA--------------TCACCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-A--TAAA-------TTAGAAAAACAGGAATCGAACCTGCACTAGAGAAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTAAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCTCAGGCAAAACTAATTTTTACGATCAGCCTAATTCTAGGCACCACCATCACAATCTCAAGCAACCACTGAATTA---TGGCCTGAGCTGGCCTCGAAATCAACACACTCGCCATTCTCCCCATAATCTCAAAATCTCATCACCCTCGATCTATTGAAGCGGCTACCAAATACTTCCTAACCCAAGCAGCCGCCTCAGCCCTAGTATTATTCTCAAGCATAACTAACGCATGACATACTGGTCAATGGGACATTACACAGCTCTCCCACCCCACATCAAGCCTGATCCTGACCTCAGCAATTGCCATAAAACTAGGCCTAGTTCCATTCCACTTCTGATTCCCGGAAGTACTGCAAGGCTCCCCCCTCCTCACCGGTCTCCTATTATCCACCATCATAAAACTTCCCCCAATAACCCTACTATACATAACCTCCCCATCACTAAATCCTACTCTCCTAACCTTCCTAGCCATTCTCTCAGCAGCTATCGGCGGATGAATGGGACTCAACCAAACACAAATTCGAAAAATCATGGCTTTCTCCTCCATCTCCCACCTAGGATGGATAGCAATCATTATTGTATACAACCCCAAACTCACCCTCCTCAACTTCTACTTATATACCATAATAACCGCAACTGTATTCCTGACTTTAAACTCAATCAAAGTGCACAAACTATCCACCCTAATAACCGCATGAACCAAAATCCCCTCACTAAATGCAATACTACTTCTTACCCTACTTTCCCTTGCAGGACTTCCTCCCCTAACAGGATTCCTTCCCAAATGACTCATTATTCAAGAACTAACTAAGCAAGAAATAATTCCTGCAGCCACGCTAATAGCCCTCCTCTCACTATTAAGCCTATTCTTCTACCTCCGCCTTGCGTACTGCACAACAATTACACTCCCACCTCATACTACAAACCACATAAAACAATGACGAACCGGCAAACCAACCAACTTCCTAATTGCCGTCTTAGCCACAATATCCATCGTCCTCCTACCCATTTCCCCCATAATCCTCACTATCAT------CT----AAGAAACTTAG----GATTAA-T-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTGAACCCTCTTAGTTTCTGTTAAAGTCCGCAGGCTACTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-G--CAA-CTCACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTGCACAA-CTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTAATCGATGATTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGCACTGCCCTGAGCCTCCTCATCCGAGCAGAACTAGGACAACCCGGAGCCCTATTAGGAGACGATCAAGTTTACAACGTAGTCGTTACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATACCCATTATGATCGGGGGATTCGGTAACTGATTAGTCCCACTGATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTACTCCTAGCATCCTCTACCGTAGAAGCAGGGGTTGGCACAGGATGAACAGTATACCCCCCACTAGCTGGTAACTTAGCCCATGCCGGAGCCTCAGTTGACTTAGCAATCTTCTCCCTACACCTAGCTGGTATCTCTTCAATCCTAGGAGCAATTAACTTTATCACCACAGCAATCAATATAAAACCCCCCGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTACTAATCACCGCAGTGCTCCTACTGCTTTCACTTCCAGTACTCGCTGCAGGAATTACAATGCTCCTCACAGACCGCAACCTAAATACTACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTCCTATACCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCCTACCAGGATTCGGAATTATCTCCCACGTAGTAACCTACTACGCAGG?AAAAAAGAACCATTTGGCTACATAGGAATAGTATGAGCCATACTATCTATCGGGTTCTTAGGTTTTATTGTATGAGCCCACCACATATTTACAGTCGGAATAGACGTTGACACACGAGCATACTTCACATCTGCTACAATAATCATTGCCATCCCAACCGGAATCAAAGTATTCAGCTGACTAGCTACACTACACGGAGGAACAATCAAATGAGACCCACCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACCATCGGAGGACTTACAGGAATTGTCCTAGCAAACTCCTCACTAGACATTGCCCTACATGACACTTACTACGTAGTAGCCCACTTCCACTACGTCTTATCAATAGGAGCAGTATTCGCAATCCTAGCAGGATTCACGCACTGATTCCCCCTATTCACTGGCTACACCCTACACTCAACATGAGCCAAAACCCACTTCGGCGTAATGTTCGTAGGAGTCAACCTCACCTTCTTCCCACAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACCCTATGAAACACTATCTCCTCCGTAGGATCACTAATCTCACTAACAGCTGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTACTTCAACCAGAACTAACAAGCACTAACGTTGAATGAATCCACGGCTGCCCACCTCCCTTCCACACCTTCGAAGAACCTGCCTTTGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---AT---AGAGACGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAACCCCTGCACA--TCTC---TACCC--AA--ATGGCTAACCACTCACAATTCAACTTCCAAGACGCCTCCTCCCCAATCATAGAAGAACTAATAGGATTCCACGACCACGCCTTAATGGTCGCACTATCAATCTGCACCTTAGTGCTTTATCTACTAACCCACATACTCACAGAAAAACTGTCATCTAGCACAGTAGAAGCACAAGAAATCGAACTCGTCTGAACCATTCTCCCAGCTATAGTACTAGTAACCCTTGCCCTCCCATCCCTACGAATCCTATACATAATAGACGAAATCAACGAACCCGACCTTACTCTAAAAGCCATCGGTCACCAATGATACTGAACATATGAATACACCGACCTAAAAGACCTAACATTCGACTCTTACATAATCCCAACATCAGACCTGCCCCTGGGACACTTCCGACTGCTAGAAGTAGACCATCGAGTTGTAGTTCCAATGAGCTCTACAATTCGAGTCATCGTCACCGCCGATGACGTACTTCACTCATGAGCAGTTCCAAGCCTAGGTGTAAAAACCGACGCAATCCCAGGCCGACTCAACCAAACTTCCTTCCTCGCCTCCCGACCCGGAGTTTACTACGGACAATGCTCAGAAATCTGCGGAGCTAATCACAGTTTCATACCAATCGTAGTAGAATCCACCCCTCTCGCCAACTTCGAAAGCTGATCTTCACTGA---TAGCCTCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGCT-ACA-CCCCTCCTTAATGATATGCCTCAACTAAACCCTGCACCATGATTTTTTATCATGATCATTTCATGACTCACCTTCTCCCTCATCATTCAACCCAAAATCCTATCATTCGTCTCAATAAACCCACCATCTAACAAAC---CCCCAGCTGCACCAAGCACCACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCTCTCCTAGGAATCCCACTCATTCTTATCTCAATAACATTCCCAGCCCTACTAATTCCCTCCATGGACAACCGATGAATCACCAACCGACTCTCAACCCTCCAACTATGATTCATTAACCTAGTCACAAAACAATTAATAATACCACTAGACAAGAAAGGACACAAATGAGCCCTAATCCTCACATCCCTAATAATCTTCCTTCTACTCATCAATCTCCTAGGTCTCCTACCATACACATTCACCCCAACCACCCAACTATCCATAAACTTAGCACTAGCCTTCCCCCTATGACTCGCCACCCTACTAACAGGGCTACGAAACCAACCTTCCGTATCACTAGGTCACCTTCTTCCAGAAGGCACCCCAACCCCACTAATCCCAGCCCTAATCCTAATCGAGACAACAAGCCTACTAATCCGCCCACTAGCCCTAGGCGTACGCTTAACAGCTAACTTAACAGCAGGACACCTGCTCATCCAACTCATCTCTACCGCCACAACAGCCCTATTCACCACAATACCAATAGTCTCACTCTTAACTCTATTAATCCTTCTATTATTAACCATCCTAGAGGTAGCAGTAGCAATAATCCAAGCCTACGTCTTTGTACTTCTACTGAGCCTGTACCTACAAGAAAACATCTAAAAC--CG--ACAATGGCACACCAAGCACACTCTTATCACATAGTAGACCCAAGCCCATGACCCATTCTAGGAGCCGCCGCCGCCCTCCTAACTACCTCAGGACTAACAATATGATTCCACTATAACTCCCCTCGACTCCTCATTCTAGGACTACTATCCACTGCCCTAGTTATATTCCAATGATGACGTGACATCATCCGGGAAAGCACATTCCAAGGTCATCACACTCCAACCGTACAGAAAGGACTACGCTACGGCATAGCCCTATTTATCACATCCGAAGCCTTCTTCTTCTTAGGGTTCTTCTGAGCCTTCTTCCACTCAAGCTTAGCCCCAACCCCAGAACTAGGAGGACAATGACCACCCGTGGGAATCAAACCTCTAAACCCCATAGAAGTACCACTACTAAACACTGCCATTCTACTAGCCTCTGGAGTCACCGTAACATGAGCCCACCACAGCATCACAGAGGCCAACCGAAAACAAGCAATCCACGCTCTAACCCTAACCGTCCTCCTAGGGTTCTACTTCACAGCCCTACAAGGCATAGAATACTACGAAGCACCATTCTCTATCGCAGATGGAATCTACGGCTCTACATTCTTCGTTGCTACCGGATTCCACGGGCTACACGTAATCATTGGCTCAACATTCCTGCTAGTATGCCTAGTACGCCTAATCAAATACCATTTCACATCAAACCACCACTTCGGATTCGAAGCCGCCGCCTGATACTGACACTTCGTAGACGTCGTATGGCTATTCCTCTACATCTCTATCTACTGATGAGGTTCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTCAAACCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTAGCCATATCATTCACCCTAAGCATCCTACTGACCGCACTAAACTTCTGATTAGCCCAAATAAACCCCGACTCAGAAAAACTATCCCCCTACGAATGCGGATTCGACCCCCTAGGATCTGCCCGACTTCCATTTTCAATCCGATTCTTCCTAGTAGCTATCCTATTCCTTCTATTCGACCTAGAAATCGCCCTATTACTACCACTACCATGAGCCACCCAACTTGAATCCCCCATCACCACCCTAATCTGAACCTCCCTACTTATTCTCCTCCTAACACTAGGACTCATTTACGAATGAATCCAAGGAGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGACTCAACAAATTATAGCTTATACCCTATAACTTTCTTTATGTCCTACCTCCACCTCAGCTTCTACTCAGCTTTCACCCTAAGCAGCCTAGGATTAGCCTTCCACCGAACCCACCTAATCTCCGCCCTACTATGTTTAGAAAGCATAATACTATCCATATATGTGGCACTAGCCATATGACCCATCCAAATACAATCTCCATCCTCCACCATCCTACCAATCATCATACTAACATTCTCCGCCTGCGAAGCAGGAACAGGCCTGGCCCTACTAGTAGCCTCTACCCGAACTCACGGCTCCGACCACCTACATAACTTCAACCTCCTACAATGCTAAAAATCTTAATTCCAACTGCAACACTCCTCCCCCTAGCCATCATATCCCCCCTCAAACACCTATGAACCAACATCACACTACACAGCCTGATCATTGCCACTATTAGCCTGCAATGACTAACCCCCACATACTACCCAAACAAAAGCTTAACCCCCTGAACATCAATCGACCAAATCTCTTCCCCTCTCCTAGTCCTATCATGCTGACTACTACCCCTCATAATCATAGCAAGCCAGAACCACCTAGAACAAGAACCTACCATCCGCAAACGAATCTTCGCTACAACAGTAATCATAGCCCAACTATTTATCCTACTAGCTTTCTCAGCCTCAGAACTGATACTATTCTACATCGCATTCGAAGCAACCCTCATCCCCACTCTCATCTTAATCACACGATGAGGAAACCAACCAGAACGACTAAACGCCGGAATCTACCTCCTATTCTACACACTAGCCAGCTCACTCCCCCTACTAATCGCTATCCTCCACTTACAAAACCAAATCGGCACGCTATACCTCCCAATAATAAAACTATCGCACCCCGCACTAAACTCCTCCTGATCCGGACTAATCGCAAGCCTCGCCCTACTTCTTGCCTTCATGGTCAAAGCCCCCCTTTACGGACTGCACTTATGACTCCCCAAAGCCCATGTAGAAGCCCCAATCGCCGGCTCCATACTACTCGCTGCCCTCCTGCTAAAACTAGGAGGATACGGCATCATGCGAATCACAATCCTAGTGAACCCAGCATCAAACAACCTACATTACCCATTTATTACTCTAGCCCTATGAGGAGCAATCATAACCAGCGCCATTTGCCTACGACAAATTGACCTAAAATCACTAATCGCCTACTCATCCGTCAGCCACATAGGACTAGTCGTAGCCGCAACTATAATCCAAACTCAATGAGCATTCTCAGGGGCAATAATTCTAATGATCTCACACGGCCTAACCTCCTCAATACTATTCTGCCTAGCCAATACCAATTACGAACGAACTCACAGCCGAATCCTCCTACTCACACGAGGCCTACAACCACTACTACCACTAATAGCCATCTGATGGCTACTAGCAAACCTAACAAACATAGCCCTCCCCCCAACAACAAACCTAATAGCAGAACTAACCATTGTCATCGCCCTATTCAACTGATCAGCTTTCACAATCATCCTAACAGGGACAACAATCCTACTCACCGCCTCATACACCCTTTACATACTCACAATAACACAACGAGGCACACTACCCTCCCACATCACCTCCATCCAAAACTCCTCCACCCGAGAGCACCTCCTCATGGCTCTTCACATAATCCCCATGCTCCTTCTAATTCTCAAACCTGAGCTAATCTCCGGCATCCCAATAT-GCAAGTATAGTTT-TAA-ACAAAACATTAGACTGTGATCCTAAAAATAGAAGTTAAAATCTTCTTACCTGCCGAGGGG-AGGTA-GAACCAACGAGAACTGCTAATTCTCGAATCTGAGTATAA-AACCTCAGTCCCCTT--GCTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTGTCCCTAGCCCTAAACACATTCATAATCCTAACCCTAGTCACCCTATCCACACCCATCCTACTCCCCCTATTATCCCACAACTTCAAAAACACTCCTGACACCATCACAAACACAGTCAAAACATCCTTCTTAATCAGCCTAATTCCAATAACAATCCACATTTACTCAGGAACGGAAAGCCTGACCCTCCTGTGAGAATGAAAATTCATCATAAACTTCAAAATCCCTATTAGCCTAAAAATAGATTTCTACTCCCTCACCTTCTTCCCCATCGCCCTATTCGTCTCATGATCTATCCTACAATTTGCAACATGGTACATAGCCTCAGACCCCCATATCACAAAATTTTTCACCTACCTACTATTCTTCCTAATAGCAATACTCATCCTAATCATCGCTAACAACCTATTCGTCCTATTCATCGGCTGAGAAGGAGTAGGAATCATATCCTTCTTACTAATCAGCTGATGACACGGACGAGCAGAAGCTAACACCGCCGCTCTACAAGCCGTACTATACAACCGAGTCGGAGACGTAGGACTTATTCTATGCATAGCCTGATTAGCCTCAGCCATAAACACCTGAGAAATCCAACAACTCTCCTCCCCAACCCAGACCCCAACACTACCCCTACTAGGCCTAATCCTGGCTGCAACCGGAAAATCCGCCCAATTCGGACTTCACCCATGACTGCCAGCCGCTATAGAAGGACCAACCCCCGTATCTGCCTTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTTATCCGAACCCACCCCCTATTCAACAACAACCAAACCGCCCTAACCCTATGCCTATGTCTAGGAGCCCTATCCACTCTATTTGCAGCCACATGCGCCCTCACCCAAAACGACATCAAAAAAATCATTGCTTTCTCAACTTCGAGCCAACTAGGACTAATAATAGTAACTATCGGACTTAACCTCCCAGAATTAGCCTTTCTCCACATTTCAACCCATGCATTTTTCAAAGCTATACTCTTCCTGTGCTCAGGATCCATCATCCACAGCCTAAATGGTGAACAAGACATCCGAAAAATAGGAGGCCTGCAAAAAATAATACCAACAACAACTTCATGCCTAACCATCGGAAACCTAGCCCTCATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAGCACATCATACCTAAACACCTGAGCCCTACTGATAACACTACTAGCCACCTCATTCACTGCAGTATACACAATTCGCATAACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCATCCCTAACCCCAATAAATGAAAACAACCCCGCAGTGACTTCACCCATCACCCGACTTGCACTAGGAAGCATCACGGCAGGATTCCTCATCACCTCATTCATCATCC---CCACAAAAACCCCCACAATAACAATACCACTGCAAATCAAAATAACAGCCCTAGTAGTAACCGCCCTAGGAATTATCCTAGCCCTAGAAATCTCAAAAATAGCCCAAACTCTCCTCCTCACAAAACAATCCTCCTTCTCAAACTTCTCCACCTCCCTAGGATACTTCAACCCACTAACTCACCGCTTAACCATGTCCAACTCCCTCAACGGAGGACAAAACATTGCTTCACACCTAATCGACCTGTCCTGATACAAAATCATAGGGCCAGAAGGACTAGCCAACTTACAATTAATAGCAACCAAAGCCTTCACCTCCCTCCATTCCGGCCTAATCAAATCCTACCTAGGAGCATTCGCCCTATCCATCATTATCATCCTCA---TATCCACATACAGAAC--CCA-C-T---AATGGCCCTCAACATTCGTAAAAACCACCAAGTCCTAAAAATCATCAACAACGCCCTAATTGACCTCCCAACACCATCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGCATCTGCTTAGTCACCCAAATTGTCACAGGTCTTCTGCTAGCCACACACTACACAGCAGACACCAACCTAGCCTTCTCTTCCGTAGCCCACATATGCCGAGACGTACAATTCGGCTGACTAATCCGTAACCTACATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGAATCTACTACGGCTCATACTTAAACAAAGAAACCTGAAACATCGGAGTCATCCTCTTATTGACCCTCATAGCAACTGCTTTCGTAGGATACGTCCTGCCATGAGGCCAAATGTCATTCTGAGGAGCTACAGTAATCACAAACCTGTTCTCAGCAATCCCATACATTGGCCAAACACTAGTAGAATGAGCCTGAGGAGGATTTTCCGTCGACAACCCCACATTAACACGATTCTTCGCTCTCCACTTCCTACTACCATTCGTTATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTACACGAAACTGGATCAAACAACCCGACAGGAGTCCCATCGGACTGCGACAAAATCCCATTCCACCCTTACTACACCGTAAAAGACATCCTAGGATTCGCACTAATAATCTCCCTCCTAGTCTCCCTAGCCCTATTCTCCCCAAACCTCCTAGGAGACCCAGAAAACTTCACACCAGCCAACCCCCTAGTAACCCCTCCCCACATTAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCCATCCCAAACAAACTAGGAGGTGTACTAGCCCTAGCCGCCTCAATCCTCGTACTATTCCTAATACCACTACTCCACACATCAAAACTACGATCCATAACATTCCGTCCTATCTCCCAAATCCTATTCTGAACCCTAGTCGCAAACGTCCTAGTCCTTACATGAGTGGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCGTTCACCTACTTCCTAATCATTCTAGTCCTGTTCCCCATCGCAGCCGCACTAGAAAACAAACTACTAAAACT----------TTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Carpodacus_roseus GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCACA--C------CAT-A--ACCGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTACTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TCGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--CCCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCAAACAGTGAGCGCAATAG-CCTAA-CCCCGCTAGTACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGATAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGAGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG---ACCCCCCCCCCCCATAAATTAATAAGCTAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACATCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--AC-ATA-CACCC----AACTAAAGCATT---C--ATTAGT-CTTAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAGCCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-C-ATGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAAAGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACATA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AGT--AATAAT-TA-AACTAT-CATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCTTCAAAAATATAAG-AACAATACGACTCCCT-CATCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--CTAAT---------CAA---ACAAGCA-GAG-TATTA-CGTACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACGAAAGCAGGGATGAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAA-CAGCAACCACC--TTAAAT-CACATA----CT-CACCCA--C-C-GGGTTCACTGCT-ACA-TAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAACCTCCAA-AAACTAGACCACACCTCTAGACTG-AGAGCAACTTCTCAACGTGCTAATAGCAACCAGACCCAATAT--AATTGACCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCATATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTCC-GCTTTAAGTGATGAAACCAACTTAATCACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT-----------TAACC--C----ATGAC----------TAACTACCCCCTCCTAATCAACCTTATTATAGCCCTCTCCTACGCCCTCCCAATTCTAATTGCAGTAGCTTTCCTTACGCTAGTAGAACGTAAAATCTTAAGCTACATGCAAGGCCGAAAAGGCCCTAATGTTGTAGGACCATACGGCCTTCTACAACCACTAGCAGACGGGGTAAAACTATTCATCAAAGAGCCCATTCGAC---------CATCAACATCCTCACCAATTCTATTTACTGCAACCCCAATACTAGCCCTACTCCTAGCAATCTCCATCTGAACCCCACTACCACTGCCTTTCTCCCTAGCAGATCTCAACCTAGGCCTACTATTTTTACTAGCTATATCAAGCCTAGCAGTATACTCCATTCTATGATCTGGCTGAGCTTCCAACTCAAAGTACGCCCTAATTGGTGCCCTACGAGCAGTAGCCCAAACAATTTCATATGAAGTAACCCTAGCAATTATCCTCCTATCAGTCGTACTTCTCAGCGGCAACTACACTTTAAATACCCTTGCAATCACCCAAGAACCCCTATATCTTATCTTCTCTTGCTGACCCCTGGCCATGATGTGGTATGTCTCTACACTTGCTGAAACCAACCGCGCCCCGTTCGATCTGACAGAAGGAGAATCCGAGCTAGTCTCTGGATTCAATGTAGAGTACGCAGCAGGACCTTTCGCACTCTTTTTCCTAGCTGAGTACGCTAACATCATGCTCATGAACACTATCACCACCATTCTATTCTTCAACCCGAGCTCACTTAATCCCCCCCAAGAGCTATTCCCCGTAGTATTAGCCACGAAAGTACTTCTCCTATCAGCAGGATTTCTCTGAATTCGTGCCTCCTGCCCACGATTCCGATATGACCAGCTAATACACCTATTATGAAAAAACTTTCTGCCCCTTACACTTGCCCTATGCCTCTGACACACCAGCATGCCAATTTGCTATGCAGGACTACCC-----CCTTATCTG-A--GA--------------TTCCCGGAAATGTGCCTGAATAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTACACTAGTCCTCTCATTTCCT-A--CAAC-------TTAGAAAGGCAGGAATCGAACCTACACTAGAGGGATCAAAACCCTCCATACTCCCCTTATATTACTTTCT----------------AGCAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCCTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTTATAGCTAGTCTACTTCTAGGGACTACCATCACAATGTCAAGCAATCATTGAATCA---TAGCCTGAGCCGGCCTTGAAATTAACACACTTGCCATCCTACCATTAATCTCAAAATCCCACCACCCACGATCCATTGAAGCCGCCACTAAATACTTCCTGACCCAAGCAGCTGCCTCAGCCCTAGTGCTGTTCTCTAGCATGACTAACGCATGACATACCGGACAATGAGATATCACTCAACTATCTCACCCAACATCTGGCCTAATCCTAACCTCAGCAATTGCAATAAAACTAGGCCTAGTTCCATTTCATTTTTGATTCCCAGAGGTACTACAAGGCGCCCCTCTCCCTACCGGCCTACTCCTATCCACTATCATAAAACTTCCTCCACTTACCCTACTATACATAACCTCCCCCTCACTAAACCCCACACTATTAACCACCCTAGCTATCCTATCAACAGCCCTTGGTGGGTGAATAGGGCTCAACCAAACACAAATCCGAAAAATCTTAGCTTTCTCCTCCATTTCTCACCTAGGATGGATAGCAATTATCATCGTCTACAACCCTAAACTGACCCTCCTCAACTTCTACCTTTATACCATAATAACTGCAACCGTATTCCTCACCCTAAACTCAATCAAAGTGCTAAAACTGTCCACACTGATAACTGCATGAACTAAAGTCCCCTCATTAAATGCAATACTCCTCTTAACCCTACTTTCCCTCGCAGGGCTTCCTCCATTAACAGGATTCCTGCCCAAATGACTCATCATCCAAGAACTAACCAAACAAGAAATAATCCCTGCAGCCATGCTTATATCACTCCTCTCACTACTAAGCCTCTTCTTCTACCTCCGCCTTGCATACTGCACAACAATTACACTACCTCCACACACCACCAACCACATAAAACAATGACGGACCAGCAAACCAATCAACATCCTAATTGCTATCTTAACCACAATATCCGTCACTCTCCTCCCCATTTCACCCATAATCCTCACCATTGT------TT----AAGAAACTTAG----GATAAACTATAAACCGAAGGCCTTCAAAGCCTTAAATAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCATTACCCTGCATCACCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-C--TAA-CCCACTAGGCAGATGGGCTTCGATCCCATAATTA-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCTTCTGCCT-A-------------AGGCTCCGGTACACAA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATTCACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGAACCCTATACTTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTAATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATTATGATCGGAGGATTTGGTAACTGACTAGTCCCCTTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGGCTACTCCCCCCATCCTTCCTCCTACTACTAGCCTCCTCCACAGTCGAAGCAGGAGTAGGTACAGGATGAACAGTATACCCACCACTAGCCGGTAATCTAGCACATGCCGGAGCATCAGTTGACCTCGCAATCTTCTCCCTACACCTAGCCGGCATTTCCTCAATCCTTGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCTCCTGCCCTGTCACAATACCAAACCCCCCTATTTGTCTGATCAGTCCTAATCACCGCAGTACTCCTACTTCTTTCTCTCCCAGTCCTCGCCGCAGGGATTACAATGCTTCTCACAGACCGTAACCTCAACACTACTTTCTTTGACCCCGCAGGAGGAGGAGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTGTATATCTTAATTCTACCAGGATTCGGAATTATCTCCCATGTCGTAACCTACTACTCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCTATACTATCCATTGGATTCCTGGGGTTCATCGTATGGGCCCACCACATGTTCACAGTCGGAATAGACGTTGACACCCGAGCATACTTTACGTCAGCCACCATAATCATTGCTATTCCAACTGGCATTAAAGTATTCAGCTGACTAGCTACACTTCACGGAGGCACAATCAAATGGGACCCACCAATATTATGGGCTCTGGGGTTCATCTTCCTATTCACAATCGGAGGCCTAACAGGTATTGTCCTAGCAAACTCCTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCTCACTTCCATTACGTCCTATCAATAGGAGCCGTATTTGCAATTCTCGCAGGCTTTACCCACTGATTCCCTCTATTCACTGGATACACCCTTCACTCAACATGAGCCAAAATCCACTTCGGCGTAATGTTCGTAGGAGTCAATCTGACCTTCTTCCCTCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCTGACGCCTACACCTTATGAAATACCATCTCCTCAGTGGGTTCACTCATTTCCCTAACAGCCGTAATCATGTTAGTATTCATCATCTGAGAAGCTTTCGCATCTAAACGTAAAGTCCTACAACCAGAACTAACAAGCACTAACGTCGAATGAATCTACGGCTGCCCACCTCCATTCCACACCTTCGAAGAACCTGCCTTCGTCCAAGTT------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---AT---AGAGACGTTAGT-AAAACA-ATTACATAG-TTTTGTCAAGACTAAATTGCAGGTGAAACCCCTGCACATCTCTT---CACCC--AAACATGGCCAACCACTCACAATTTAACTTCCAAGACGCCTCCTCCCCCATCATAGAAGAACTAATAGGATTCCACGACCACGCCCTGATAGTGGCTCTAGCAATCTGCAGCCTAGTACTATACCTACTGACTCATATACTCACCGAAAAACTTTGATCTAGCACAGTAAACGCACAAGAGATCGAACTTGTCTGAACAATCCTACCAGCCATAGTGCTAGTCACACTCGCCCTACCTTCCCTACGAATCCTCTACATAATAGACGAAATCAACGAACCTGACCTAACCCTAAAAGCCATCGGCCACCAATGGTATTGAACCTACGAATATACCGACCTTAATAACCTTACATTCGACTCCTACATAATCCCAACATCAGATCTACCCCTAGGACACTTCCGACTACTAGAAGTCGACCATCGTGTCGTAGTGCCCATAAGCTCCACAATTCGAGTAATTGTTACCGCCGACGATGTACTCCACTCATGAGCTGTTCCAAGCCTAGGCGTAAAAACCGATGCAATTCCAGGCCGTCTAAACCAAACCTCCTTCCTTGCCTCCCGACCAGGAGTATTCTACGGACAGTGCTCAGAAATTTGCGGAGCCAACCACAGCTTCATACCAATTGTAGTGGAATCCACCCCTCTCGCTAATTTCGAAAACTGATCCTCCCTAA---TAACTTCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGATAGAGGACT-ACA-CCCCTCCTTAATGATATGCCTCAACTAAACCCAGCACCTTGATTTTTTATCATGATCATTTCATGACTCACCTTCTCCCTTATCATCCAACCTAAACTTCTCTCATTCGTATCCATAAATCCCCCATCCAATAAAC---CCCCCATCGCTCCAAGTACTACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGATCAATTCTCAAGCCCATCCCTCCTAGGAATCCCGCTCATCCTTATCTCAATAACATTCCCCGCCCTCCTAATCCCCTCCCTAGACAACCGATGAATCACAAACCGACTTTCAACACTCCAACTATGATTCATCAACCTAGTCACAAAACAACTAATAATACCCTTAGACAAAAAAGGGCACAAATGAGCCCTAATCCTAACATCCCTAATAATCTTCCTCCTACTTATTAACCTTCTAGGCCTACTACCATACACATTCACCCCAACTACACAACTATCTATAAACCTAGCCCTAGCTTTCCCACTATGACTTGCAACTTTACTAACAGGCCTACGAAACCAGCCCTCCGCCTCATTAGCCCACCTACTGCCAGAGGGCACCCCAACCTTACTAATCCCCGCTTTAATCCTAATCGAAACAACGAGCTTACTCATTCGACCACTAGCCCTAGGCGTACGCCTAACAGCTAACCTCACAGCAGGACACCTACTCATCCAACTCATCTCTACAGCCACAGTAGCTCTATTCGCTACAATACCAGCAGTTTCACTCCTAACCCTACTAGTCCTCTTCTTACTAACTATTCTAGAAGTAGCAGTAGCAATAATCCAAGCTTACGTTTTCGTACTCCTTCTGAGTCTCTACCTACAAGAGAACATCTAAAGC--CC--ATAATGACACACCAAGCACACTCCTACCACATAGTAGACCCCAGCCCATGACCTATTCTAGGAGCCGCCGCCGCCCTCCTAACCACTTCAGGACTAACAATATGATTCCACTACAACTCCCCTCAACTTCTCATCCTAGGCCTACTCTCTACCTCCCTAGTTATATTTCAATGATGACGGGATATCATCCGAGAGAGCACATTCCAAGGTCACCATACCCCCTCCGTACAAAAAGGATTACGCTACGGTATAGCCCTATTTATCACATCCGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCTTTCTTCCACTCAAGCCTAGCTCCCACCCCAGAACTGGGAGGACAATGACCGCCCGTCGGAATCAAACCCCTAAACCCCATAGAAGTTCCACTATTAAACACCGCCATCCTTCTAGCCTCCGGAGTCACCGTAACATGAGCCCACCATAGCATCACAGAAGCTAGCCGAAAACAGGCAATCCACGCCCTAACCCTAACAGTCCTCCTAGGTTTCTACTTCACAGCCCTACAAGCCATAGAATACTACGAAGCACCATTCTCCATCGCAGACGGAGTTTACGGCTCTACATTCTTCGTTGCCACTGGATTCCACGGCCTACACGTAATCATCGGCTCAACATTCCTATCAGTATGCCTACTACGTCTAATCAAATACCACTTCACACCAAGCCACCACTTCGGATTTGAGGCAGCCGCTTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTCTATATCTCTATCTACTGATGAGGATCTTGCTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTCAAACCCAGAGAAGAGCAATA---AACATAATCCTATTCATACTAACCCTATCACTCACCCTAAGCATCCTACTAACCGCACTAAACTTTTGACTAGCCCAAATAAACCCAGACTCAGAAAAATTATCCCCCTACGAATGCGGATTTGACCCCCTAGGATCCGCCCGACTTCCATTCTCAATCCGATTCTTCCTAGTGGCCATCCTATTCCTCCTATTCGACCTAGAAATCGCCCTACTACTCCCACTTCCATGAGCCATCCAACTAGACTCCCCCACCACCACCCTAATCTGAACTTCCTTCCTCCTATCCCTCCTAACACTAGGGCTAATCTACGAATGAATTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTCATGTCCTACCTACACCTCAGCTTCTACTCAGCCTTCACCCTAAGCGGCCTAGGCCTAGCCTTCCACCGAACCCACCTAATTTCCGCCCTACTCTGCTTGGAAAGCATGATACTATCCATATACGTGGCACTCGCCATATGACCAATCCAAATACAATCACCATCCTCCACTATCCTACCTATCATCATACTAACATTCTCCGCCTGCGAAGCAGGAACAGGACTAGCCCTGCTAGTAGCCTCCACTCGAACCCACGGTTCCGACCACCTCCACAACTTCAACCTCTTACAATGCTAAAAATCATCATCCCAACCATAACACTACTACCCTTAGCCCTCGCATCCCCTCTTAAACACCTATGAACCAACATTACACTACATAGCCTACTCATCGCCACTGCCAGCCTACAATGACTAACACCCACCTACTACCCAGGCAAAGGCCTAACCCCATGAACTTCAATCGACCAAATTTCCTCTCCCCTCCTAGTTCTTTCATGCTGACTCCTCCCCCTCATAATCATAGCAAGCCAAAACCACCTAGAGCAAGAACCCAACATCCGCAAACGAATTTTCGCCCTAACAGTAATCCTAGCCCAACTATTCATCCTCCTAGCATTCTCAGCCTCTGAACTAATACTATTCTACATTGCATTCGAAGCAACCCTCATTCCTACCCTCATCCTTATCACACGATGAGGAAACCAGCCAGAACGACTAAACGCTGGTATCTACCTCCTATTCTACACACTAGCCAGTTCACTTCCCCTACTAATCGCTATCTTACACCTACAAAATCAAATCGGTACACTCTACCTCCCCATACTAAAACTATCACACCCAACACTAAACTCTTCCTGATCCGGACTAGCCGCAAGCCTTGCACTTCTCCTAGCTTTCATAGTTAAAGCCCCCCTATACGGCTTACACCTATGACTACCCAAAGCCCACGTAGAGGCCCCAATCGCCGGCTCCATATTACTAGCCGCCCTCCTCCTAAAATTAGGAGGCTACGGCATCATACGAATCACGATCCTAGTAAACCCAGCATCAAATAACCTACATTACCCATTTATCACCCTAGCTCTGTGAGGCGCACTAATAACCAGCGCTATTTGCCTACGACAAATCGACCTGAAATCACTAATCGCTTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCTGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACATGGCCTAACCTCCTCAATACTATTCTGCTTAGCCAACACCAACTACGAACGAACTCACAGCCGAATCCTCCTACTCACACGAGGACTTCAACCCTTACTACCATTAATAGCCATCTGATGATTACTAGCTAACCTAACAAATATGGCCCT-TCCCCAACAACAAACCTCATAGCAGAATTAACCATTGTCATCGCACTTTTCAACTGATCTGCCTTTACAATCATCCTTACAGGAACAGCAATTCTACTCACCGCCTCATACACCCTATACATACTCATAATGACACAACGAGGCACACTCCCATCTCACATCACATCAATCCAAAACTCCTCTACCCGAGAACACCTCCTCATAGCCCTCCACATAATCCCGATGTTCCTACTAATTCTGAAACCCGAACTAATTTCCGGCATTCCCATAT-GCAAGTATAGTTT-CAA-TCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTC-AAACCAACAAGAGCTGCTAACTCTCGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACCCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTAAACACATTCATACTCCTAACCCTAGTCACCCTCTCCACCCCTATCCTATTCCCACTCCTATCCCCCAGCCTTAAAAATACCCCCAATACTATTACAAACACAGTCAAGGCATCCTTCCTAATCAGCCTAATTCCTTTAACAATTCACATCTACTCAGGTACAGAAAACTTAACCACCCTGTGAGAATGAAAATTCATCATAAACTTCAAAATCCCTATCAGCTTAAAAATAGACTTCTACTCACTCACCTTCTTCCCAATTGCACTATTCGTATCATGATCCATCCTACAGTTTGCAACATGATATATAGCCTCAGACCCCTACATCACAAAATTCTTCACCTATCTACTATTCTTTCTAATAGCGATACTCATCCTAATTATCGCCAACAACCTATTCATCCTATTCATTGGCTGAGAAGGGGTGGGAATTATATCTTTCCTACTAATCAGCTGATGACAAGGCCGAGCAGAAGCCAACACCGCCGCCCTGCAGGCCGTATTATACAACCGAGTCGGAGACGTCGGACTTATCCTCTGCATGGCCTGACTAGCTTCTGCTATAAACACCTGAGAAATCCAACAACTTTCATCCCCATCCCAAACCCCTACACTTCCCCTACTAGGCCTCATCCTAGCTGCAACCGGCAAATCCGCCCAATTCGGCCTACACCCATGACTCCCAGCCGCCATAGAAGGACCCACTCCCGTGTCCGCTCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCCCTGTTCAGCAACAACCAAACCGCCCTAACTCTATGCCTATGCCTAGGGGCCCTATCTACCCTATTCGCCGCTACATGTGCCCTCACTCAAAATGACATC?AAAAAATCATCGCTTTTTCCACTTCAAGCCAGCTAGGACTAATAATAGTTACAATCGGACTAAACCTCCCAGAACTAGCCTTCCTCCATATTTCAACTCACGCATTCTTCAAAGCCATACTCTTCCTATGCTCGGGATCCATCATCCACAACCTAAACGGTGAACAAGACATTCGAAAAATAGGAGGACTTCAAAAAATATTACCCACAACCACCTCATGCCTCACTATCGGAAACCTAGCCCTAATAGGAACACCATTCCTAGCAGGATTTTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCCTACCTAAACACTTGAGCCCTACTATTAACCTTACTAGCCACGTCATTCACCGCAGTGTATACCATCCGTATAACCGTACTAGTACAGACCGGCTTCGTTCGAATCCCCTCCCTAACCCCAATAAATGAAAACAACCCCGCAGTGACCTCACCCATCACTCGACTTGCACTGGGAAGCATCCTAGCAGGATTCCTCATCACCTCATTCATCACCC---CAACAAAAACACCAACAATAACCATACCCCTTTCCATCAAAATAACAGCCCTAGTAGTAACTGCCCTAGGAATTGCTCTAGCCCTAGAAATCTCGAAAATAGCTCAAACCCTCCTCCTCACAAAACAAACCACCTTCTCAAACTTCTCCTCATCCCTAGGATACTTCAACCCCCTAACCCACCGCCTAAGCATGTCCAACCTCCTCAGCGGAGGACAGAACATCGCCTCACACCTAATCGACCTGTCCTGATACAAAACCCTAGGCCCAGAAGGACTAGCCAACCTGCAACTAATAGCAGCCAAAACCGCCACCTCCCTCCACTCTGGCCTAATCAAAGCCTACCTAGGAACATCCGCCCTATCCATTATCATCATCCTCA---TATCCACATACAGAA----AA-C-C---AATGGCCCTCAACCTTCGTAAAAACCACCAAATCCTAAAAATCATCAACAACGCCCTGATTGACCTCCCCACCCCACCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGCATTTGCCTAATCACTCAAATCGTTACCGGTCTTCTGCTAGCTACTCACTACACAGCAGACACCAACCTAGCTTTCTCCTCCGTAGCTCACATATGCCGCGACGTCCAATTCGGCTGACTAATCCGCAATCTCCATGCAAACGGTGCCTCCTTCTTCTTCATCTGCATCTACCTACACATTGGCCGAGGAATCTACTACGGCTCATACCTAAATAAAGAAACCTGAAACATCGGAGTCATCCTCCTCCTAACCCTCATAGCAACCGCCTTCGTCGGCTACGTCCTACCATGAGGCCAAATATCATTCTGAGGCGCTACAGTAATCACAAACCTGTTCTCAGCAATCCCATACATTGGACAGACACTAGTAGAATGAGCCTGAGGAGGGTTCTCAGTCGACAACCCAACACTAACCCGATTCTTCGCTCTCCACTTCCTACTACCATTCCTCATCGTAGGTCTCACACTAGTCCATCTCACCTTCCTTCACGAAACAGGATCAAACAACCCAACAGGAGTCCCCTCAGATTGCGACAAAATCCCCTTCCACCCATACTACACCGTAAAAGACATCCTAGGCTTCGCACTAATAATCTCCCTACTCGTAGCCCTAGCCCTATTCTCCCCCAATCTTCTGGGAGACCCAGAAAACTTTACACCAGCTAACCCTCTAGTCACCCC?CCTCACATCAAACCTGAATGATATTTCCTATTTGCCTACGCTATTCTACGATCCATCCCAAACAAACTAGGAGGCGTATTGGCCCTAGCCGCTTCAATCCTCGTGCTCTTCCTAATGCCCCTACTCCACACATCAAAACTACGATCAATAACCTTCCGCCCTATCTCTCAAATCCTATTCTGAGCCCTAGTTGCAAACGTCCTCATCCTAACATGAGTGGGAAGCCAACCAGTGGAACACCCATTCATCATTATTGGCCAACTAGCCTCGCTCTCCTACTTCACAATCATTCTAGTCCTATTCCCTCTCGCGGCCGCGCTAGAAAATAAAATACTAAAACT----------TTA-ACT-----------GACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGATTAAACCCCTTCTTAGAGTT Chlorophanes_spiza -TCCTTGTAGCTTATATAAAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACC-CCT-T-AAAT-------AGGAAGATAGGAGCGGGTATCAGGCTCG--C------CAT-A--ACCGCAGCCCAAGACGCCTTGCAATTGCCACACCCCCACGGGTATTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCATAAGCCCAAGATGC-CAATAAGGCCTCC--TACCAAAGAAGATCTTAGGAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATAATCCACGCTA-CACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCC--CTGAAGGCCCAACAGTGAGCGCAACAG-CCCCA-CCACGCTAACAAGACAGGTCAAGGTATAGCCTATGGAATGGTAGCAATATAGCCTATGGAATGGTAGCAATGGGCTACATT-TCTAAGCTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACACACCGCCCGTCACCCTCCTCGCAGG-??---CCCCCCCCCCCCCT?AAATTAATAAGCTAC-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGATTA-CCAAGACGTAGC-TTAAACC-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACCCCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AAACG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTCCCC---ACAACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---CC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTCACGAGCAGCTAT-C-ATGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTCCTCCAAGG-AAAT-CCATA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AACTACCTC----AAC-CATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCCA--AACCAAAAAATATAAT-AACTTTATGACTCCCT-CCCCATTAACAGGCTAACCTATAATCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCATA-CATTATTAACAAA-CCCCCA-ATATACGA--TAAAT---------CAA---ACAAGCA-CAG-TATTA-AATATC-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--GA---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTCAAAACCAGCAACCACC--TTAAAT-CACATA----CT-CACCCA--C-C-GGGTTCACTGAC-ACA-TAA-GC-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCATCCCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAAATACAAAAGGCTATCAT-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTACTTAAACACTTCTCCTCCC-------ATGGC----------AAACTACCCCCTCTTAATCAACCTAGTCATAGCCCTCTCCTACGCCCTCCCAATCTTAATCGCAGTAGCTTTCCTTACACTGGTAGAACGCAAGATCCTAAGCTACATACAAGGCCGAAAAGGACCAAACGTCGTTGGCCCTTTCGGACTCCTACAACCCCTAGCAGACGGAGTAAAACTATTCATTAAGGAACCCATTCGAC---------CATCAACATCCTCCCCAATCCTATTCATCGCAACCCCAATCTTAGCCCTGCTCCTAGCAATTTCAATCTGAACCCCATTGCCCCTCCCATTCTCTCTAGCAGACCTTAACCTGGGCTTACTCTTCTTACTAGCTATGTCCAGTCTAGCAGTATACTCCATCTTATGATCAGGTTGAGCCTCCAACTCAAAATACGCCCTAATCGGAGCACTACGGGCAGTAGCCCAAACAATCTCATATGAGGTCACCCTGGCCATTATTCTGCTGTCCGTAGTCCTCCTCAGCGGCAACTACACTCTCAGCACCCTAGCAGTTACCCAAGAACCCCTGTACCTTATCTTCTCCTGCTGACCCCTAGCCATAATATGATACGTCTCTACACTTGCCGAAACCAACCGTGCCCCCTTCGACCTGACAGAAGGAGAATCAGAACTCGTATCAGGATTTAATGTAGAATATGCAGCAGGTCCTTTCGCCCTCTTCTTCCTAGCCGAATACGCTAACATCATGCTCATAAATACCCTAACCACAATCCTATTCTTCAACCCAAGCTTCCTCAACCCCCCTCAAGAACTATTCCCCGTTATCCTAGCCACAAAAGTCCTACTCTTATCAGCAGGCTTTTTATGAATCCGTGCTTCCTATCCTCGATTCCGATATGACCAATTAATGCATCTACTCTGAAAAAACTTCCTACCACTCACACTAGCCCTATGCCTCTGACACGTCAGCATACCAATCTGCTACGCGGGCCTGCCT-----CCTTATATA-A--GACC------------CTCCTGGAAATGTGCCTGAACAC-C--AAGGGTCACTATGATAAAGTGAACATAGAGGTATACCAGTCCTCTCATTTCCTCC--CCAC-------TTAGAGAGGCAGGAATCGAACCTACACTGGAGGAATCAAAACCCTCCATACTTCCTTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAGTCCCCAAGCAAACCTAATTTTCATCACCAGCCTACTCCTAGGAACAACCATCACCCTTTCAAGCAACCACTGAATCA---CAGCCTGAGCTGGCCTCGAAATCAACACACTCGCCGTCCTCCCCCTAATCTCAAAATCCCATCACCCACGAGCCATCGAGGCCGCTACTAAATACTTCCTAACTCAAGCAGCTGCCTCCGCCCTTGTCCTATTCTCCAGCATAACCAATGCATGGCAGACAGGACAGTGAGACATCACCCAACTTACTCACCCAACATCCTGCTTGATTCTCACCTCAGCAATCGCAATGAAACTAGGACTAGTACCTTTCCATTTCTGATTCCCAGAAGTACTTCAAGGCTCCCCCCTCACCACCGGCCTCCTCCTATCCACCCTCATAAAACTCCCCCCACTTGCACTACTCTACATAACCTCTCCCTCACTAAACCCCTCCCTTTTAACTACCCTGGCCATCCTTTCAACAGCCCTAGGAGGGTGAATGGGGCTTAACCAAACACAAATCCGAAAAATTCTTGCTTTCTCCTCTATCTCCCATTTAGGCTGAATAACAGCCATCATCATCTACAACCCCAAACTCACCCTCCTCAACTTCTACTTATACACCATGATAACCGCAGCCGTCTTCCTTGCTTTAAATGCAACCAAAGTACTAAAACTATCCACCCTAATGACCGCATGAACTAAGACCCCACCCTTAAACGCAATGCTACTCCTAATTCTACTTTCCCTTGCAGGACTCCCTCCCCTAACAGGCTTCCTACCCAAATGACTCATCATCCAAGAACTGACTAAACAAGATATAGCCCTGACAGCTACACTTATCTCTCTTCTCTCCCTACTAAGCCTGTTCTTCTACCTTCGCCTTGCATACTGCGCAACAATCACACTCCCCCCACACACTACAAACCACATAAAACAATGACGCACTGGCAAACCAATCAACATCACAATCAGCATCCTAGCCAGCATATCCGTCATGCTTCTACCCATCTCCCCCATAATCCTCACCCTCAT------CT----AAGAAACTTAG----GATTACAT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGATACTACCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT---CCAATCTATCTAGGTAGATGGGCTTTGATCCCACGACTT-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTACCT-A-------------AGGCCCCGGTACATAT-TCAATGTACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTATGACATTCATCACCCGATGACTATTCTCGACCAACCACAAAGATATTGGAACCCTCTACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTACTCATCCGAGCAGAACTAGGTCAACCTGGGGCCCTCCTGGGAGACGATCAAGTCTACAACGTAGTTGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGTTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTTCTCCTTCTAGCGTCTTCTACAGTCGAAGCAGGAGTCGGTACGGGCTGAACAGTATACCCCCCACTGGCCGGCAATTTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTCCACCTAGCAGGTATCTCTTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATTAACATAAAACCTCCTGCCCTTTCACAATACCAAACTCCCCTATTCGTCTGATCAGTCCTAATCACCGCAGTCCTACTACTCCTATCCCTCCCCGTTCTTGCTGCAGGAATCACAATACTCCTCACAGACCGTAACCTCAACACCACATTCTTCGACCCTGCTGGTGGAGGAGACCCAATCCTATATCAACATCTTTTCTGATTTTTCGGCCACCCAGAAGTCTACATCTTAATTCTCCCAGGATTCGGAATTATCTCTCATGTCGTAACATACTACGCAGGTAAAAAAGAGCCATTCGGCTACATAGGAATAGTATGAGCCATGCTATCCATTGGATTCCTAGGCTTCATTGTATGAGCCCACCACATGTTTACAGTAGGAATGGATGTTGACACCCGAGCATACTTTACATCCGCCACTATAATCATTGCCATTCCAACTGGCATTAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACCGTTGGCGGACTAACAGGAATTGTACTAGCAAACTCCTCATTAGACATCGCCCTACACGACACCTACTACGTAGTAGCCCACTTTCACTACGTACTCTCCATAGGAGCAGTGTTTGCCATCCTAGCAGGCTTCACTCACTGATTCCCCCTATTTACTGGTTACACTCTACACTCAACATGAGCCAAAACACACTTCGGCGTAATATTCGTAGGAGTTAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGTATGCCTCGCCGATACTCAGACTACCCAGATGCCTACACACTATGAAACACTATCTCCTCTGTAGGCTCGCTCATCTCCCTAACAGCCGTAATCATACTAGTGTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTGCAACCAGAACTAACAAGCACTAACGTCGAATGAATCCACGGTTGCCCACCACCATTCCACACCTTCGAAGAACCCGCCTTCGTTCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--ATACCACCTATGCTTCTTTCTC---AT---AGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATCGCAGGTGAAAACCCAGCACATCTCTC----------AAACATGGCCAACCACTCACAACTTAATTTCCAAGACGCCGCCTCACCCATTATAGAAGAACTTATAGGATTCCACGACCACGCTTTAATGATTGCACTAGCAATTTGCAGCCTAGTCCTGTACCTACTAACCAACACACTCACAGGAAAACTATCATCAAACACAGTCAATGCGCAAGTAATCGAAATTGTCTGAACCATTCTTCCAGCCATAGTCCTAATTACACTCGCCCTACCCTCCCTACGAATCCTCTATATGATAGACGAAATCAACGAACCAGACCTCACCCTAAAAGCCATCGGCCACCAATGATACTGAACCTACGAATACACCGACCTCAAAGACTTAACATTCGACTCTTACATAATCCCAACAGCAGACCTACCCCTAGGTCACTTCCGCCTGCTAGAAGTTGACCACCGTGTTGTAGTCCCCATAGACTCTACCATCCGAGTCATTGTCACCGCCGACGACGTCCTCCACTCATGAGCTGTTCCTAGCCTAGGCGTAAAAACAGACGCAGTCCCAGGACGCCTCAACCAAACCTCCTTCCTAGCCTCCCGACCAGGTGTTTTCTACGGACAGTGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCACTCGCCAATTTCGAAAGCTGATCTTCTCTAA---CATCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGAC-CCTCCCCCTCCTTAATGATATGCCCCAACTAAACCCCAACCCCTGATTTTTTATCATGATCATTTCATGAATAACCCTCTCCCTAATTATCCAACCTAAAATCTTATCCTTCGTATCAATAAACCCACCCTCCAACAAAA---CACCCACTACCCCAAGCACCACCCCTTGAACCTGACCATGAACGTAACCTTCTTCGACCAATTTTCAAGCCCATCATTCCTAGGAATCCCCCTAATTCTCATCTCAATAACATTCCCAGCCCTTCTACTTCCAACCCTAGACAACCGATGAATTACTAACCGACTATCCACCCTACAACTATGATTCATCAACCTAGTCACAAAACAACTGATAATACCCCTCAACAAAAAGGGGCACAAATGAGCCTTAATCCTCACATCCCTCATAATCTTCCTCCTTCTCATCAACCTCTTAGGCTTACTACCCTATACCTTTACCCCCACCACTCAACTATCTATAAACCTAGCCCTAGCTTTCCCCCTGTGACTAGCCACCCTCCTGACAGGATTACGAAATCAACCCTCCGCCTCACTAGGACACCTCCTGCCAGAAGGCACTCCAACCCCACTAATCCCAGCCCTCATCCTAATTGAAACAACGAGTCTACTCATCCGCCCACTAGCCCTAGGCGTACGCCTAACAGTAACCCTATCAG-----CACCTTCTAATCCAACTCATTTCTACAGCCACAATAACCCTACTTTCTACAATACCATTAGTCTCACTCCTAACCTTATTAGTTCTTTTCTTGCTAACTATTCTAGAAGTGGCAGTAGCAATAATTCAAGCCTACGTCTTCGTACTCCTACTAAGCCTCTACCTACAAGAAAACATCTAACCC------CCAATGGCACACCAAGCACACTCTTACCACATAGTTGACCCTAGCCCCTGACCTATCCTGGGAGCAGCTGCTGCTCTCCTGACGACCTCAGGCCTAACAATATGATTCCACCACAACTCCCCCCAACTCCTTATCCTAGGCCTACTTTCAACCATCCTAGTCATATTCCAATGATGACGCGACATTGTACGAGAAAGTACATTCCAAGGCCACCACACCCCCACCGTACAAAAAGGATTACGCTACGGAATAGTACTATTCATTACATCAGAAGCCTTCTTCTTCCTAGGCTTCTTCTGAGCCTTCTTCCATTCAAGCCTCGCCCCCACACCCGAACTAGGAGGACAATGACCACCCGTCGGAATCAAACCCCTCAACCCCATGGACGTACCCCTATTAAACACTGCCATCCTCCTAGCTTCAGGAGTCACTGTCACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTACTGCTAACAGTACTCCTAGGATTCTACTTCACCGGCCTACAAGCCATAGAATACTACGAAGCACCCTTCTCTATTGCCGACGGAATTTACGGATCCACATTCTTCGTTGCCACCGGATTCCACGGTCTACACGTCATCATTGGATCCACATTCCTACTAGTATGCCTCCTACGCCTAATTAAATACCACTTCACACCAACCCACCACTTCGGTTTCGAAGCAGCCGCCTGATACTGACATTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATACTA-AATACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTTATACTAACCCTGTCACTAGCCCTAAGCATCCTCCTAACCATACTAAACTTCTGACTCGCCCAAACAACCCCTGACTCAGAAAAATTATCCCCATACGAATGCGGATTTGACCCCCTAGGATCCGCTCGACTCCCCTTCTCAATCCGCTTCTTCCTAGTAGCCATCCTCTTTCTCCTATTCGACCTAGAAATTGCCCTACTCCTCCCCCTACCATGAGCTACTCAATTACAATCCCCCACCACCACTCTAGCCTGAACCTCCGTACTCATCCTCCTCCTTACCTTAGGACTAGTCTACGAATGAGCCCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAATCAAGACAGTTGGTTTCGGCCCAACAGATTATAGTCCCCACCCTATAACTTTCTTTATGTCCTACCTCCATCTGAGCTTTTATTCAGCCTTTACCCTAAGCAGCCTAGGCCTAGCCTTCCACCGAACCCACCTAATCTCAGCCCTACTATGTTTAGAGAGCATAATACTATCCATGTATATCGCCCTAACCATATGACCCATCCAAACACAATCATCAACCTCCACCATCCTCCCCATTATCATACTGACCTTCTCCGCCTGCGAAGCAGGCACAGGCCTAGCCTTACTGGTAGCCTCAACCCGGACCCACGGATCCGATCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATTCCAACTGCAGCACTCCTCCCCCTAACCCTCCTCTCTCCGCGCAAACACCTATGAACCAACATCACATTATACAGCCTCCTAATTGCCACTATTAGCCTCCAATGATTCACACCAACATACTACCCAAGCAAAGGCTCAACTCCATGAACATCTATCGACCAAATTTCCTCACCTCTACTGATCCTCTCATGCTGACTCCTCCCCCTAATAATTATAGCAAGTCAAAACCATCTAGAGCAAGAACCCATCACCCGCAAACGAATCTTCACTACAACAGTAGTCCTAGCTCAACTATTCATCCTCCTAGCCTTCTCAGCCTCAGAACTGATGCTCTTCTACATCGCATTTGAAGCCACCCTCATCCCCACCCTCATCCTTATCACACGATGAGGAAGCCAACCAGAACGACTAAACGCCGGTATCTACCTCCTATTCTACACACTCGCCAGCTCACTCCCACTGCTAATTGCTATCCTGCACCTCCACAATCAAATCGGCACGCTATACTTCCCAATACTCAAACTATCACACCCTACACTAAACTCCTCCTGATCTGGCCTAGCCGCAAGTTTAGCCCTCCTATTAGCCTTCATAGTCAAAGCCCCCCTATACGGACTACACCTATGACTCCCCAAAGCCCATGTTGAGGCCCCCATTGCAGGCTCCATACTATTAGCAGCCCTCCTCCTTAAACTCGGAGGCTACGGTATTATACGGGTCACAATCCTAGTAAACCCAACATCAAACAACCTACACTATCCCTTCATCACCCTAGCCCTATGAGGAGCCCTAATAACCAGCGCTATCTGCCTACGCCAAATCGACCTAAAGTCACTAATCGCCTACTCATCCGTCAGCCACATAGGATTAGTCGTAGCTGCAACCATAATCCAAACCCAATGAGCATTTTCAGGGGCAATAATCCTAATAATCTCCCACGGCCTAACCTCCTCAATACTATTTTGCCTAGCCAACACCAACTACGAACGTACCCACAGCCGAATCCTCCTACTCACACGAGGACTTCAACCCCTCCTGCCCCTCATAGCCACCTGATGACTACTAGCCAACCTGACAAACATAGCCCTCCCCCCAACAACAAACCTCATAGCAGAACTAACCATTGTAATCGCACTCTTCAACTGATCCGCCTTCACAATCATCCTAACAGGAGCCGCAATCCTACTCACTGCTTCCTACACCCTTTACATACTAATAATAACACAACGAGGCCCCCTCCCATCCCACATCACATCAATCCAAAACTCCTCCACACGAGAGCACCTCCTCATAGCTCTACATATAATCCCTATAATCCTCCTAATTCTCAAACCCGAACTAATCTCCGGCATTCCTTCAT-GCAAGTATAGTTT--AA-CCAAAACATTAGACTGTGACTCTAAAAACAGAAGTTAAATCCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAACGAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGCCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTATCCCTAGTAACCCTCTCCACCCCCATCCTATATCCCCTCCTATCCGATAACCTCAAAAATACCCCCACCACAATCATAACCGCAGTCAAGACTTCCTTCCTAATTAGCTTAATCCCAATGACAATTCATATCCACTCAGGAGCAGAAAGTCTCATCTCCCTCTGAGAATGAAAGTTCATCATAAACTTTAAAATCCCTATCAGCCTAAAAATAGACTTTTACTCCCTCACCTTCTTCCCCATCGCATTATTCGTATCATGAGCCATCCTACAATTCGCAACATGATACATGGCCTCAGACCCCTACATCACAAAATTCTTCACCTACTTACTTCTCTTCCTAATTGCCATACTAATCCTAATCATCGCCAACAACCTATTCATCCTATTCATTGGCTGAGAAGGTGTAGGAATCATGTCTTTCCTACTAATTAGCTGATGACACGGCCGAGCGGAAGCCAACACTGCCGCCCTCCAAGCCGTACTTTACAACCGAGTCGGAGACGTAGGACTTATCCTTTGCATAGCATGACTAGCCTCTGCCATAAACACCTGAGAAATCCAACAACTCACTACTCCCTCCCAAACTCCCACATTACCCCTGCTAGGCCTCATCCTAGCCGCAACCGGAAAATCCGCCCAATTCGGCCTACACCCATGACTCCCGGCTGCAATAGAAGGACCAACCCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCCCTATTCAATAACAACCAAACCGCTATAACCCTATGCCTATGCCTAGGAGCCCTATCCACACTATTCGCAGCTACATGCGCTCTAACCCAAAACGATATCAAAAAAATCATTGCTTTCTCCACCTCTAGCCAACTAGGACTAATAATAGTCACAATCGGACTAAACCTTCCCGAACTAGCCTTCCTCCACATCTCAACCCATGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGCTCTATCATTCACAGCCTAAATGGAGAACAAGATATCCGAAAAATAGGAGGACTACAAAAAATACTACCCACAACCACCGCATGTCTTACCATCGGCAACCTTGCCCTAATAGGAACACCATTCCTAGCAGGTTTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCTTACCTAAACACTTGAGCCCTACTTCTAACCCTCCTAGCCACATCATTCACCGCAGTATACACAATTCGCATAACTGTACTAGTACAAACCGGCTTCCCTCGAATCCCACCCTTAACCCCAATAAACGAAAACAACCCCGCAGTGACCTCTCCCATTACTCGTCTTGCACTAGGAAGCATCCTAGCAGGCTTCCTCATCACCTCATTCATCACCC---CCACAAAAACCCCTCCAATAACCATACCCCTCTCCATCAAAATAACCGCTCTAGTCGTAACAGCCCTAGGAATTGCCCTAGCACTAGAAATCTCAAAAATAACCCAAACACTCATCCCTAAAAAACAAAACCACTTCTCAAACTTCTCCACATCTCTAGGGTACTTCAACCCCCTAACCCACCGCTTAAGCATAACCAACCTCCTTAGTGGAGGACAGAACATCGCCTCCCACCTAATCGACCTTTCCTGATACAAAATACTAGGCCCAGAAGGATTAGCCCACCTTCAATTAACCGCAACCAAGGCCGCCACCACTCTCCACTCTGGCCTAATCAAAGCCTACCTAGGATCATTCGCCTTATCCATCCTCATCATCCTCA---TATCCACACACAGAAA--CAACT-----AATGGCCCTTAACCTTCGTAAAAACCACCGAATCCTAAAAATTATCAACAACGCCCTAATCGACCTCCCAACACCATCAAACATCTCAACATGATGAAACTTTGGATCCCTACTAGGCCTCTGCCTAATTACTCAAATCGTCACAGGCCTTCTACTAGCTATACATTACACAGCAGACACCAACCTAGCCTTCTCCTCCGTCGCCCACATATGCCGAGACGTACAATTTGGCTGACTCATCCGCAATCTACATGCTAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATTGGCCGAGGAATTTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTCATCCTCCTCCTAACCCTCATGGCCACTGCCTTCGTAGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGAGCTACCGTAATCACAAACTTATTCTCAGCCATCCCCTACATCGGCCAAACACTAGTCGAATGAGCCTGAGGAGGATTCTCCGTCGACAACCCCACACTCACCCGATTCTTCGCCCTCCACTTCCTCCTCCCATTCGTCATTGTAGGCCTCACGCTTGTCCACCTCACCTTCCTCCACGAAACAGGCTCAAACAACCCACTAGGCATCCCCCCAGACTGCGATAAAATCCCCTTCCACCCATACTATACCATCAAAGACATCCTGGGATTTGCACTAATACTATCCCTACTCGTCTCACTAGCCTTATTCTCCCCTAATCTCCTAGGTGACCCAGAAAACTTCACACCAGCCAACCCACTAGTCACCCCTCCACACATCAAACCCGAATGATACTTCCTATTCGCTTACGCCATCCTTCGATCCATCCCAAACAAACTGGGAGGCGTACTAGCCCTAGCCGCCTCAATCCTAGTCCTATTCCTCATACCGCTACTCCACACATCAAAGCTACGATCAATAACCTTCCGTCCCCTATCACAAATCTTATTCTGAACCCTAGTTGCCAACATCCTCATCCTAACCTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATTGGCCAGCTAGCCTCGTTCACATACTTCCTCATCATCCTAGTTTTATTCCCCCTCGCGGCCGCCCTAGAAAATAAACTACTTAAGCT----------CTA-ATT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Chrysomus_cyanopus_JX516076 GTCCTTGTAGCTTATAATAAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTAAGCTGTCGCAAGCCCAAGATGT-CAGTAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTTACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCCACA--CTGAAGGCCCAACAGTGGACGCAATAG-CCCAA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGTAATGGGCTACATTTTCTAAACTAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG-CCCCCCCCCCCCCCCATAAATTAATAAGTTAC-TC--AGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ATACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-C-A-AACCC----AACTAAAGCATT---C--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAACAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-TCACG-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--ATTAA-CCC-CCTAGC-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACCCAATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAAATAGGAGAACTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAG-CCCCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-CAG-TATTA-AACACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAATCAGCGACCACCCTTCAAAT-CGCATG----CT-CACCCA--C-T-GGGTTCACCGAC-ACA-CAA-GG-C-TCTGGTC-CGCA-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACATCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TA-----CC---C--C----ATGAC----------TAACTACCCTCTACTAATCAACCTAATCATAGCCCTCTCCTATGCCCTACCCATCTTAATCGCAGTAGCTTTTCTTACACTGGTAGAACGCAAAATCCTGAGCTACATGCAGGGCCGAAAAGGCCCGAACATCGTCGGCCCCTTTGGACTTCTCCAACCCCTAGCGGACGGCATCAAACTGTTCATCAAAGAACCCGTCCGAC---------CTTCAACATCTTCCCCAATCCTATTCATTGCTACCCCAGTCCTAGCTCTTCTTCTATCCATCTCAATCTGAACCCCATTACCCATTCCATTCTCTCTGGCAGACCTCAATCTGGGACTTCTATTCTTACTAGCCATATCAAGCCTAATAGTTTACTCTATCTTATGATCAGGCTGAGCCTCCAATTCCAAATACGCCCTAATTGGAGCACTACGAGCGGTAGCCCAGACAATCTCCTACGAGGTAACCCTAGCCATCATTCTTCTTTCCGTCATCCTCCTTAGCGGTAACTACACTCTGAACACCCTAGCAATCACCCAAGAACCCCTATACCTTATTTTTTCCTGCTGACCCCTTGCCATAATATGATACGTCTCCACACTGGCCGAAACCAACCGTGCCCCCTTCGACCTGACAGAGGGAGAGTCCGAACTGGTATCCGGATTCAACGTAGAATACGCAGCAGGTCCTTTCGCACTTTTCTTTCTAGCCGAATACGCCAATATTATACTCATAAATACGCTAACCACAATCCTATTCTTCAACCCAAGCCTCTTTAACCCACCTCAAGAACTATTCCCCGTCATTCTAGCTACAAAGGTCCTGCTCTTATCAGCAGGGTTCCTATGAATTCGCGCTTCCTACCCTCGATTCCGATACGACCAATTAATACACTTACTATGAAAAAACTTCTTACCACTCACACTAGCCCTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGCCTACCC-----CCTTACCTA-A--GG-TT-----------TCGTTGGAAATGTGCCTGAACAC-T--AAGGGTCACTTTGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-T--GTAA-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGGAATCAAAACCCTCCATACTTCCTTTATATTACTTCCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATTTTCATCACTAGCCTACTTCTAGGGACAACCATCACCCTCTCAAGTAACCACTGGGTCA---TGGCTTGAACCGGCCTTGAAATTAACACACTTGCCATCCTCCCATTAATCTCTAAGTCCCACCATCCACGAGCCATTGAAGCTGCCACTAAATACTTCCTAACCCAAGCAGCTGCCTCTGCCCTCGTTCTATTCTCCAGCATAACCAATGCATGATACACCGGACAATGAGACATCACCCAACTTACCCATCCAACATCCTGCCTTATTCTTACCTCAGCAATCGCAATAAAACTAGGACTAGTGCCATTCCATTTCTGATTTCCAGAAGTACTCCAAGGCTCCCCCCTCATTACTGGCCTACTCCTATCTACTGTCATAAAACTCCCCCCAATCACATTACTCTACATAACTTCTCCCTCACTAAACCCCACACTACTAACTACCTTGGCCATCCTATCCACAGCCCTCGGAGGTTGAATAGGCCTAAACCAAACACAAATCCGAAAAATCCTGGCCTTTTCCTCCATTTCTCACCTAGGCTGAATGGCAGTCATTATCATCTACAACCCAAAACTCACACTCCTTAACTTCTACCTATACGCCGTAATAACCGCAACTGTCTTCCTCACCCTAAACACAATTAAAGTACTAAAACTATCCACCCTAATAACCGCATGATCTAAAACCCCATCCTTAAACGCAATACTACTTTTAACCCTGCTCTCCCTCGCAGGACTCCCTCCCCTAACAGGATTCCTGCCTAAATGACTTATTATCCAAGAACTAACTAAACAAGAAATAATCCCGACGGCCACACTTATCTCCCTACTCTCCCTACTAGGCCTATTCTTCTACCTCCGACTAGCATACTGTGCAACCATCACACTCCCCCCGCATACTACAAGCCACATGAAACAATGGCGCACTAACAAACCAACTAACATCACAATTGCCATCCTAATCACTGTGTCCGTCATACTCCTCCCTATCTCCCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-A--CAACTCTCCTAGACAGATGGGCTTCGATCCCACGATAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTGCCT-A-------------AGGCCCCGGCGCATAA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTTATCAACCGATGATTATTCTCAACCAACCACAAAGACATTGGGACCCTATACCTAATTTTCGGCGCGTGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAAGTCTACAACGTAGTTGTCACGGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGGTTCGGGAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGATATGGCATTCCCACGAATAAACAATATAAGCTTCTGACTACTTCCCCCATCCTTCCTACTCCTCCTAGCATCTTCCACAGTTGAAGCAGGCGTAGGAACAGGCTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGAGCTTCAGTCGACCTAGCAATTTTCTCCCTACATTTAGCCGGTATCTCATCAATCCTAGGAGCAATCAACTTCATTACAACAGCGATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACCGCAGTACTATTACTCCTATCCCTTCCAGTTTTAGCCGCAGGAATCACAATACTTCTCACAGACCGCAACCTTAACACCACATTCTTTGACCCCGCTGGAGGAGGAGACCCTGTACTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTCGGGATCATCTCCCACGTCGTAGCTTACTACTCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTAGGCTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGACACCCGAGCATATTTCACATCTGCCACCATGATCATTGCTATCCCAACCGGAATCAAAGTGTTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACTATCGGAGGACTAACAGGAATCGTCTTAGCAAACTCCTCACTAGACATTGCCCTACACGACACCTACTACGTAGTGGCTCACTTCCACTATGTGTTATCCATAGGAGCAGTATTCGCAATCCTAGCAGGCTTCACCCACTGATTCCCCCTATTTACTGGATACACACTTCATTCAACATGGGCTAAAACACACTTCGGCGTAATGTTCGTAGGTGTAAATCTAACATTCTTCCCTCAACATTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTATACTCTATGAAACACTATCTCTTCAGTAGGCTCACTCATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAGGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAGCTAACAAGCACTAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTTGAAGAGCCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACTT---AACATGGCCAACCATTCACAACTTAACTTCCAAGACGCCGCCTCACCTATTATAGAAGAACTGATAGGATTCCACGACCACGCCCTAATAATCGCACTAGCAATTTGTAGCCTCGTACTCTACCTGCTAACCCACACTCTCACAGAAAAACTGACATCAAACACAGTCAACGCACAAGTAATCGAGCTAGTCTGAACCATTCTCCCTGCCCTAGTCCTGGTCACACTTGCCCTTCCATCCCTACGAATTCTCTACATAATGGATGAAATTAATGAACCAGATCTAACCCTAAAAGCCATCGGCCACCAATGATACTGAACCTACGAATACACTGACTCCAAAGACCTAACATTCGACTCCTACATAATCCAAACAGCAGACCTGCCCTTAGGCCATTTCCGCCTACTAGAAGTTGACCATCGCGTTGTCGTCCCCATAAACTCAACTATCCGAGTCATCGTTACCGCCGACGACGTCCTCCACTCATGAGCTGTCCCAAGCCTAGGAGTAAAAACCGATGCAATCCCAGGACGCCTCAACCAAACCTCCTTCCTCGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCACTCGCTAACTTCGAAAACTGATCCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGGT--CCCACCCTCCTTAATGATATGCCTCAACTGAATCCCAACCCATGATTTTTTATCATGCTCACCTCATGACTCACTTTTTCCCTAATTATCCAACCTAAAATCCTAACATTCGTATCAATAAACCCCCCATCCAACAAGC---CACCCGCCGCTCCAAGCACTACTCCCTGAACCTGACCATGAACCTAAGTTTCTTCGACCAATTCTCAAGCCCATCACTCCTAGGAATCCCACTAATCCTCATCGCAATAACATTCCCAGCCCTTCTCCTGCCATCCCTTGACAACCGATGAATCACCAACCGACTCTCAACCCTACAACTCTGATTCATCAACCTAATTACAAAACAACTAATAATACCACTAGACAAAAAAGGTCATAAATGAGCCCTAATCCTAACATCCCTCATAATCTTCCTCCTCCTCATTAACCTCCTGGGCCTATTACCATACACATTCACCCCAACTACCCAACTATCTATAAACTTAGCCCTAGCCTTCCCCCTATGACTGGCTACACTCCTAACAGGACTGCGAAACCAACCCTCCGCCTCACTGGGCCACCTCCTGCCAGAAGGCACACCCACCCCACTAATCCCAGCCCTCATCCTGATCGAAACGACAAGCCTTCTCATCCGCCCATTAGCACTGGGCGTGCGCCTAACAGCCAACTTAACAGCAGGCCACCTACTAATCCAACTCATTTCTACCGCCACAACATCCCTATTCTCCACAATACCAATAGTCTCACTCCTAACCTTCGCAGTCCTCTTCCTACTGACAATCCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTCTTCGTGCTCCTGCTAAGCCTCTACCTTCAAGAAAACATCTAACTT--TA----AATGGCACACCAAGCACATTCTTACCACATAGTTGACCCAAGCCCATGACCCATCCTAGGAGCAGTTGCTGCTTTCCTAACTACCTCAGGACTAACAATATGATTCCACTGAAATTCCCCCAACCTCCTTATCCTAGGCCTACTATCAACCATCCTCGTCATATTCCAGTGATGACGCGACATCGTACGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGACTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTTTTCTTCCTAGGGTTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCTACACCAGAACTAGGAGGTCAATGACCACCGGTAGGGATTAAACCCCTCAACCCCATAGAAGTCCCACTCCTAAACACCGCCATCCTCCTAGCTTCAGGAGTCACCGTCACATGAGCTCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTATCCCTAACAGTCCTCCTAGGTTTCTACTTCACCGCCCTACAAGCCATAGAATATTACGAGGCGCCCTTCTCCATCGCCGACGGAATTTACGGCTCAACATTCTTCGTCGCTACCGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTGATCAAATACCACTTCACATCAAACCACCATTTCGGGTTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTTGTATGATTATTCCTCTACATCTCTATTTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTAGCCATGTCACTAACCCTGAGCATCCTCCTAACCATACTAAACTTCTGACTTGCCCAAATAACCCCAGACTCAGAAAAACTATCCCCATACGAATGCGGATTCGACCCCCTAGGATCCGCCCGACTCCCATTCTCAATCCGCTTCTTCCTAGTAGCCATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTCCCACTACCCTGAGCCACTCAACTACAATCTCCAACCACTACCTTAACCTGAACCACCACACTCATCTTACTACTCACCCTAGGCCTAGTGTACGAATGAACTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCAACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCAGCCTTTGCTCTAAGCAGCCTTGGCCTAGCCTTTCACCGAACCCACCTAATCTCTGCCCTACTATGCTTAGAAAGCATAATACTATCTATATACATCGCCCTAGCCATATGACCCATCCAAATCCAATCATCAGTATCCACTATCCTACCCATCCTCATACTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTAGCACTACTAGTAGCCTCAACCCGCACCCACGGATCCGATCACCTACACAACTTTAACCTCCTACAATGCTAAAAATCATCATCCCAACCACAACACTTCTCCCCCTAGCCCTCCTCTCCCCATGTAAACACCTATGAACTAACATCACACTGTACAGCCTACTAATCGCCACCGCCAGTCTCCAATGACTTACACCCACGTACTACCCAAACAAAGGCCTAACCCCATGAACATCAATCGACCAAATCTCCTCCCCCCTACTAGTCCTCTCATGCTGACTCCTCCCCCTCATAATCATGGCAAGCCAAAACCACCTAGAACAAGAACCCATCAATCGAAAACGAATCTTTGCCTCAACACTAGTCCTAGCCCAACTGTCAATTCTCCTAGCCTTCTCATCCTCCGAACTAATACTCTTTTACATCGCATTCGAAGCCACCCTCATCCCCACTCTAATCCTCATCACACGATGAGGAAGCCAACCAGAACGCCTAAACGCCGGCATTTACCTTCTATTCTACACTCTCATTAGCTCACTCCCACTATTAATTGCCATCCTTCACCTACAAAACCAAATCGGCTCACTCTACCTACCAATACTCAAACTTTCACACCCAACATTAAATTCTTCCTGGTCTAACTTAGCTGCAAGCCTAGCCCTCCTACTAGCCTTCATAGTTAAAGCCCCCCTATACGGCCTACATCTATGACTTCCAAAAGCCCACGTAGAAGCCCCAATTGCCGGCTCCATGCTACTAGCAGCCTTACTACTAAAACTTGGGGGCTACGGTATCATACGAATCACAATCCTGGTAAACCCATCATCAAACAACCTCCACTACCCATTCATCACCCTAGCCCTATGAGGAGCAGTAATAACCAGCGCCATCTGCTTACGTCAAATCGACCTAAAATCACTAATCGCTTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACTCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCACACGGCTTAACCTCCTCAATACTATTCTGCCTAGCCAACACCAATTACGAACGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCCCTCCTGCCACTTATAGCCACCTGATGACTACTAGCCAACCTAACAAATATAGCCCTCCCCCCAACAACAAACCTCATAGCAGAACTAACTATCGTAGTAGCACTCTTCAACTGATCTGCCCTAACAATCATCCTAACAGGAACCACCATCCTACTCACTGCCTCCTACACCCTATACATACTAATTATGACACAACGAGGCACCCTTCCATCTCACATCACATCCATCCAAAACTCTTCCACACGAGAGCACCTCCTCATAGCCCTGCACATAATCCCCATAATCTTACTGATCTTCAAACCTGAGCTGATCTCCGGCATCCCCACAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAGCCAACGAGAACTGCTAACTCTCGCATCTGAGTATAA-AACCCCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCACCCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTAACCTTAGCGACCCTTTCCACCCCCATCCTACTTCCACTACTATCCGACAACCTCAAAAACACCCCTAACACAATCACGAACACAGTCAAGACCTCATTCTTAATCAGCCTGATCCCCATAACAATTTTCATCTACTCCGGAACAGAAAACCTCATTTCCCTCTGAGAATGAAAATTCATCATAACCTTTAAAATTCCAATTAGCCTAAAAATAGACTTCTACACACTCACCTTCTTTCCCATCGCACTATTCGTATCATGATCTATCCTACAATTTGCAACATGATACATGGCCTCAGACCCCTACATCACAAAATTCTTCACCTACCTTCTATTCTTCCTAATTGCCATACTCATCTTGATTATCGCCAACAACCTATTTGTCCTATTCATCGGCTGAGAAGGAGTCGGAATTATATCCTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTACAAGCCGTCCTCTACAACCGAATTGGTGACATTGGCCTCATCCTATGTATAGCATGACTAGCCTCCACTACAAACACCTGAGAAATCCAGCAACTCCCTACCCCCTCCCAAACCCCCACATTACCCCTACTAGGCCTCATCCTAGCCGCAACCGGAAAATCCGCCCAATTCGGCCTACACCCATGACTTCCAGCTGCAATAGAAGGACCTACCCCCGTATCCGCCCTACTCCATTCCAGCACAATAGTAGTAGCAGGGATCTTCCTACTCATTCGAACCCATCCCCTATTCAACAATAACCAAACAGCCCTAACCCTATGTCTTTGCCTAGGAGCCATCTCCACCCTATTCGCAGCCACATGCGCCCTAACTCAAAATGACATTAAAAAAATCATTGCTTTCTCTACCTCTAGTCAACTAGGCCTAATAATAGTCACAATCGGATTAAACCTACCCGAATTGGCCTTCCTCCATATCTCCACCCACGCATTCTTCAAAGCCATGCTGTTCCTATGCTCAGGTTCTATCATCCACAGCCTAAATGGTGAACAAGACATTCGAAAAATAGGAGGCCTCCAAAAAACACTTCCCACAACAACCGCATGCCTCACAATCGGCAACCTCGCCTTAATAGGAACACCCTTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCTTAAACACATCCTACCTAAACACCTGAGCCCTAGTCCTAACCCTCCTAGCTACATCATTCACTGCAGTGTACACAATCCGCATAACCGTACTAGTACAAACCGGCTTCGTTCGAATTCCTCCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCCCCCATCACCCGCCTCGCACTAGGAAGCATTCTAGCAGGCTTCCTCATCACCTCATTCATCCTCC---CAACAAAAACCCCTCCAATAACCATACCACTCTACATTAAAGTAACCGCCCTAACTGTAACAGCCCTAGGAATCGCCCTAGCCCTAGAAATTACAAAAATAGCCCAAACACTTATCCTCACAAAACAGACCCCCTTCTCAAACTTCTCAACTTCCCTAGGATACTTCAACCCCCTAACCCACCGCCTAAGCATGACTAACTTCCTCAAAGGTGGACAAAACATCGCTTCCCACTTAATCGACTTATCCTGATACAAAATACTAGGCCCAGAAGGACTAGCTAGCCTACAACTGACAGCAACCAAAACTGCCACTACCCTTCACTCAGGCCTAATCAAAGCCTACCTAGGAGCATTCGCCTTATCTATCCTTATCATCCTGA---TATCCACACTCAGAAA--CAA-T-T---AATGGCCCCAAACATTCGTAAAAACCATCAAATCCTCAAAATCATCAACGACGCCCTAATCGATCTCCCAGCTCCATCAAACATCTCAACATGATGAAACTTCGGATCTCTACTAGGCGTCTGCTTAATCACTCAAATCATCACAGGTCTTCTGCTAGCCATACACTACACAGCAGATACTAACCTCGCTTTCTCCTCTGTAGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAATCTACATGCAAACGGAGCTTCCTTCTTCTTCATCTGCATCTACCTACATATCGGCCGAGGCCTCTATTATGGCTCATACCTAAATAAAGAAACCTGAAACATCGGAGTCATTCTCCTACTGACCCTGATAGCAACCGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACCTATTCTCAGCCATCCCATACATCGGACAAACACTAGTCGAATGAGCTTGAGGGGGATTCTCTGTTGACAACCCCACACTAACCCGATTCTTTGCCCTACACTTTCTCCTACCATTCGTTATCGTAGGACTCACCGTCGTCCACCTAACCCTTCTCCATGAAACAGGATCAAACAACCCACTAGGCATCCCATCAGACTGCGACAAAATCCCCTTCCACCCATACTACACCATCAAAGACATCCTAGGATTTGTCCTAATACTTTCTCTGCTCGTCTCACTAGCCCTATTCTCCCCCAACCTTCTAGGAGACCCAGAAAACTTCACCCCAGCTAACCCACTAGTCACTCCTCCACATATCAAACCCGAATGATACTTCCTATTTGCCTACGCCATCTTACGATCCATCCCAAATAAACTAGGAGGAGTTCTAGCCCTAGCCGCCTCAATCCTAGTCCTATTCCTCGTCCCACTTCTACACACATCAAAACTACGATCAATAACCTTTCGTCCTCTATCACAAATCCTATTTTGAGCCCTAGTCGCCAACATCCTAATCCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATCGGTCAACTAGCCTCGCTCTCATACTTCACAATCATCCTAATCCTATTCCCCCTCGCGGCCGCCCTGGAGAATAAAATACTGAAACT----------CTA-ATA-----------TACTCTAATAGTTTATG-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Chrysomus_icterocephalus_JX516060 GTCCTTGTAGCTTATAACAAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGAAGCCCTGGACA-CCT-T-AA-T-T-----AGGCAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTGAGCTGTCGCAAGCCCAAGATGT-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGTTA-TACCTGACCATTCCTTGC-CAA-TAA--CAGCCTACATACCGCCGTCGCCAGCCCACCCACA--CTGAAAGCCCAACAGTGGACGCAACAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAGACTAGAACA-C----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG--CCCCCCCCCCCCCCATAAACTAATAAGCCAC-TC--AGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCT-ACA-TG------ACCTGGA-ATAAC--AAAGCCACTACCC-C-A-AACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAACAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-CCACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ATTAA-ACC-CCTAAC-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACTTCATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAGATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAA-TCCCCA-ATATACGA--AAAAT---------CAA---ACAAGCA-CAG-TATTA-AATGTA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACATA----CT-CACCCA--C-T-GGGTTCACTGAC-ACA-TAA-GT-C-TCTGGTT-AGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTA-AGAGCGACCTCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACA---CA-----CC---A--C----ATGAC----------CAACTACCCCCTACTGATCAACCTCATCATAGCCCTCTCCTATGCCCTACCCATCTTAATCGCAGTAGCCTTTCTTACACTGGTAGAACGCAAAATCCTAAGTTATATGCAAGGCCGAAAAGGACCAAACATCGTCGGCCCCTTTGGACTCCTCCAACCCCTAGCAGATGGTGTCAAACTATTCATCAAGGAGCCCATCCGGC---------CCTCAACATCCTCCCCAATCTTATTCATTGCAACCCCAGTCCTAGCTCTTCTCCTAGCCATCTCAATCTGAACCCCATTACCCCTCCCATTCTCCCTGGCAGACCTCAATCTGGGGCTTCTTTTCTTACTAGCTATATCAAGCCTAGCAGTATACTCCATCCTATGATCGGGCTGAGCTTCCAACTCCAAATACGCCCTAATTGGAGCACTACGAGCGGTAGCCCAGACAATCTCCTACGAGGTGACTCTAGCCATCATTCTTCTTTCCGTTGTCCTCCTCAGCGGCAACTACACTCTGAGCACCCTTGCAGTCACCCAAGAACCTTTATACCTCATCTTCTCCTGCTGACCCCTTGCTATAATATGATACGTCTCCACACTGGCTGAAACCAACCGTGCCCCTTTTGACCTAACAGAGGGAGAGTCTGAACTAGTATCCGGATTCAACGTAGAATATGCGGCAGGTCCTTTCGCACTCTTCTTCCTAGCCGAATACGCCAACATCATACTCATAAATACACTAACCACAATCTTATTCTTCAACCCAAGCCTCTTTAACCCACCTCAAGAACTATTTCCCGTTATTCTAGCCACAAAGGTCCTACTTCTATCAGCAGGATTCCTATGAATCCGCGCCTCTTATCCACGATTCCGATACGACCAATTAATACACTTACTATGAAAAAATTTCCTACCACTTACACTAGCCCTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGCCTACCT-----CCTTACCTG-A--GG-CC-----------TTGTTGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-C--GTAA-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGGAATCAAAATCCTCCATACTCCCTTTATATTACTTCCT----------------AGTAGGGTAAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATTTTCACCGCCAGCCTACTTCTAGGGACAACTATCACCATCTCAAGCAACCACTGAATCA---TAGCTTGAACTGGCCTCGAAATTAATACACTCGCCATCCTCCCATTAATCTCTAAATCTCACCACCCGCGAGCCATTGAAGCCGCCACTAAATACTTCCTGACCCAGGCAGCTGCCTCTGCCCTAATCTTATTCTCCAGCATAACCAACGCATGACATACCGGACAATGAGACATCACCCAACTTACCCATCCAACATCCTGCCTAATTTTTACATCAGCAGTCGCAATAAAACTAGGATTAGTGCCATTCCATTTCTGATTTCCAGAAGTACTCCAAGGCTCTCCCCTCACTACTGGCCTACTCCTATCTACTGTCATAAAACTCCCCCCAATCACACTACTCTACATAACTTCTCCCTCACTAAACCCTACACTATTAACCACCTTAGCCATCCTCTCTGCAGCCTTCGGAGGTTGAATAGGCCTCAACCAAACACAAATCCGAAAAATCTTAGCCTTTTCCTCCATTTCTCACCTAGGATGAATAGCAGTCATCATCATCTACAACCCCAAACTCACACTCCTCAATTTCTACCTGTACGCCGTAATAACCGCAACCGTCTTCCTCACCCTAAACACAATTAAAGTACTAAAGCTATCCACCCTAATAACCGCATGATCTAAAACCCCACCCTTAAACGCAATATTACTTCTAACCCTTCTCTCCCTCGCAGGACTCCCTCCTCTAACAGGATTCCTACCTAAATGACTTATCATCCAAGAACTAACTAAACAAGAAATAATTCCAACAGCCACACTTATCTCCCTATTATCCCTACTGAGCCTATTCTTCTACCTCCGACTGGCATATTGTGCAACCATCACACTCCCCCCGCATACTACAAACCACATAAAACAATGACGCACTAACAAACCAACCAACATCACAATTGCCATTCTAATCACTGTGTCCGTCACACTCCTCCCTATCTCTCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAATTTTCCTAGACAGATGGGCTTCGATCCCACGATAC-TATAGTTAACAGCTATATGCCCTAACC-TACAGGCCTCTGCCT-A-------------AGGCCCCGGCGCATGA-TTAATGCACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTCATAAACCGATGATTATTCTCAACCAACCACAAAGACATTGGAACCCTATACCTAATTTTCGGCGCATGAGCCGGAATGGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAATTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTGGTCGTCACGGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGATTCGGGAACTGACTAGTTCCACTAATAATTGGAGCTCCAGACATGGCATTCCCACGAATGAACAATATAAGCTTCTGATTACTTCCACCATCCTTCCTCCTCCTCCTAGCATCTTCCACAGTTGAAGCAGGTGTGGGAACAGGCTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGATCTTCAGTCGACCTAGCAATTTTCTCCCTACATCTAGCCGGTATCTCTTCAATCCTAGGAGCAATCAACTTTATTACAACAGCTATCAACATAAAACCCCCTGCCCTCTCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTATTACTCCTATCTCTTCCAGTTCTAGCTGCAGGAATTACAATACTCCTAACAGACCGCAACCTTAACACCACATTCTTCGATCCTGCTGGAGGAGGAGACCCTGTACTATACCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATCATCTCCCACGTTGTAGCCTACTACTCAGGCAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCTATACTATCCATCGGATTCCTAGGCTTTATCGTATGAGCCCACCACATATTCACAGTAGGAATGGACGTTGACACCCGAGCATACTTTACATCTGCCACTATAATCATTGCTATCCCAACCGGAATCAAAGTGTTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTTATCTTCCTATTTACTATTGGAGGACTAACAGGAATCGTCTTAGCAAATTCCTCACTAGACATCGCCCTACACGACACCTATTACGTAGTAGCCCACTTCCACTATGTGTTATCCATAGGAGCAGTATTCGCAATTCTAGCAGGCTTCACCCACTGATTCCCTCTATTCACCGGTTACACACTTCATTCAACATGAGCTAAAACACACTTCGGCGTAATATTCGTAGGTGTAAACCTAACATTCTTCCCACAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTGTGAAACACCATTTCCTCGGTGGGCTCACTTATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAGCTAACAAGCACCAACGTCGAATGAATTCACGGCTGCCCGCCCCCATTCCACACCTTTGAGGAACCCGCCTTTGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAG-CCTTGTCGAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCC-----ACTT---AACATGGCCAACCACTCACAACTTAACTTCCAAGATGCCGCCTCACCTATTATAGAAGAACTAATAGGATTCCACGATCACGCCCTAATAATCGCACTAGCAATCTGCAGTCTCGTACTCTACCTACTAACCCACACCCTAACAGAAAAACTGACATCAAACACAGTCAACGCACAAGTAATCGAACTAATTTGAACAATTCTCCCCGCCCTAGTCCTAGTAACACTCGCCCTACCATCCCTACGAATCCTCTACATAATGGACGAAATCAATGAACCAGACCTAACCCTAAAAGCCATCGGCCACCAATGATATTGAACCTACGAATATACTGACTCCAAAGACCTAACATTTGACTCCTACATAATCCAAACAGCAGATCTACCCCTAGGTCATTTCCGCCTGCTAGAAGTTGACCACCGCGTTGTCGTCCCAATAAACTCAACTATCCGAGTCATCGTCACTGCCGACGACGTACTCCACTCATGAGCTGTCCCCAGCCTAGGTGTAAAAACTGACGCAATCCCAGGACGCCTTAACCAAACCTCCTTCCTCGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTCATGCCAATCGTAGTAGAATCCACCCCACTCGCCAACTTCGAAAACTGATCCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAATCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGAT-TCCCCCCCTCCTTAATGATATGCCCCAACTAAACCCCAACCCCTGATTTTTTATCATGCTCACTTCATGACTCACCTTCTCCCTAATTATCCAACCCAAACTACTAACATTCGTATCAATAAATCCCCCATCTAACAAAC---CGCCCGCCGCCCCAAGCACTACTCCCTGAGCCTGACCATGAACTTAAGCTTCTTCGACCAATTCTCAAGCCCGTCATTCCTAGGAATCCCACTAATTCTTATCTCAATAACATTCCCAGCCCTCCTCCTGCCATCCCTCGATAACCGATGAATCACTAACCGACTATCAACTCTTCAATTATGATTCGTCAACCTAGTCACAAAACAACTAATAATACCACTAGACAAAAAAGGACATAAATGAGCCCTAATCCTAACATCCCTCATAATCTTCCTCCTACTCATTAATCTCCTAGGCCTGCTGCCATACACATTCACCCCAACCACCCAATTATCTATAAACTTAGCCCTAGCCTTCCCCCTATGGCTAGCCACACTCCTAACAGGACTACGAAATCAACCCTCTGCCTCACTAGGCCACCTCCTGCCAGAGGGCACACCCACCCCACTAATCCCCGCCCTCATCCTAATCGAAACGACAAGTCTTCTCATCCGCCCATTAGCACTAGGCGTGCGCCTAACAGCCAACTTAACAGCAGGCCACCTACTAATCCAACTCATCTCTACCGCCACAACAGCCTTATTCTCCACAATACCACTAGTTTCACTCCTAACCTTCGTAGTCCTATTCCTACTGACAATCCTAGAAGTAGCAGTAGCGATAATCCAAGCCTACGTCTTCGTACTCCTACTAAGCCTTTACCTCCAAGAAAACATCTAACCC--TA----AATGGCACACCAAGCACATTCCTACCACATAGTTGACCCCAGCCCATGACCTATCCTAGGAGCAGGAGCTGCTTTCCTCACTACCTCAGGACTAACAATATGATTCCACTGAAACTCCCCCCGTCTCCTTATCCTAGGCCTACTATCAACCATCCTTGTCATATTCCAATGATGACGAGACATCGTGCGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGCCTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGATTTTTCTGAGCCTTCTTCCACTCAAGCCTGGCCCCCACACCAGAACTAGGAGGTCAGTGACCACCCGTAGGGATTAAACCCCTCAACCCCATGGAAGTACCACTCCTAAACACTGCCATCCTCCTAGCCTCAGGAGTCACCGTCACATGAGCCCATCACAGCATCACAGAAGCTAACCGAAAACAAGCAATCCAAGCCCTATCCTTAACAGTCCTCCTTGGCTTCTACTTCACTGCCCTACAAGCCATAGAGTACTACGAGGCACCCTTCTCCATCGCCGACGGAGTTTACGGCTCAACATTCTTCGTCGCCACCGGATTCCACGGCCTGCACGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATTTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTGACCCTATCACTAACCCTAAGCATTCTCCTAACCACATTAAACTTCTGACTCGCCCAAATAACCCCAGACTCAGAAAAACTATCACCATACGAATGCGGATTCGACCCCCTAGGATCTGCTCGACTCCCATTCTCAATCCGCTTCTTCCTAGTAGCCATTCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTTCCACTACCCTGAGCCACCCAACTACAATCTCCCACCACCACCTTAGCCTGAACCGCCACACTCATCTTCCTACTCACCCTAGGCCTAGTGTACGAATGAATTCAAGGTGGACTAGAGTGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTATCTCCACTTAAGCTTTTACTCAGCCTTTGCTCTAAGCAGCCTTGGCCTAGCCTTCCACCGAACCCACCTAATCTCCGCCCTACTATGTTTAGAGAGCATAATACTATCCATGTACGTCGCCCTGGCCATATGACCTATCCAGATCCAATCATCAGTATCAACCATCCTACCCATTCTTATACTAACATTCTCAGCCTGCGAAGCAGGCACAGGCCTAGCACTACTAGTAGCCTCAACCCGCACTCACGGATCCGACCATCTACACAACTTTAACCTCCTACAATGCTAAAAATCATCATTCCAACTATAACACTTCTCCCCCTAGCTATCCTATCCCCATGAAAACACTTATGAACTAACATCACACTATACAGCCTACTAATCGCCACCATCAGCCTACAATGATTCACACCCACATACTACCCAAACAAAAGCCTAACTCCATGAACATCAATCGACCAAATCTCTTCCCCCCTACTAATCCTCTCATGCTGACTCCTCCCCCTCATAATCATGGCAAGCCAAAACCATCTAGAACAAGAACCCATCAGCCGAAAACGAATCTTTGCCTCAACACTAATCCTAGCCCAACTATCCATCCTCCTAGCCTTCTCAGCCTCCGAACTAATACTCTTCTACATTGCTTTCGAAGCCACTCTCATTCCAACCCTAATCCTCATCACACGATGAGGAAGCCAACCAGAACGTTTAAACGCTGGCATTTACCTCCTATTCTATACCCTCGCTAGCTCACTCCCACTATTAATTGCCATCCTCCACCTACAAAACCAAATCGGCTCACTCTACCTACCAATACTCAAACTTTCACACCCAACATTAAGTTCTTCCTGATCCAATTTAGCTGCAAGCCTAGCCCTTCTACTGGCCTTCATAGTTAAAGCCCCACTATATGGCCTACACCTATGACTTCCCAAAGCCCACGTAGAGGCCCCAATCGCCGGATCCATACTACTAGCAGCCCTACTACTAAAACTCGGAGGCTATGGTATCATACGAATCACAATCCTAGTAAACCCATCATTGAACAACCTCCACTACCCATTCATCACCCTAGCCCTATGGGGAGCAGTAATAACTAGTGCCATCTGCCTGCGCCAAATTGACCTAAAATCACTAATCGCTTACTCTTCCGTCAGTCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACTCAATGAGCATTCTCAGGGGCAATGATCCTAATAATCTCACACGGCTTAACTTCCTCAATACTATTCTGCCTAGCCAATACCAACTACGAACGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCTCTTTTACCACTTATAGCCACTTGATGACTACTCGCTAACCTGACAAACATAGCCCTCCCTCCAACAACGAATCTCATAGCAGAACTAACCATTGTAGTAGCACTCTTCAACTGATCTGCCCTAACAATCATCCTAACAGGAACTACCATCCTACTCACTGCCTCATACACCCTATACATACTAATTATAACACAACGAGGCACCCTCCCATCTCACATCACATCCATCCAAAACTCTTCCACACGAGAACACCTCCTCATAGCCCTACACATAATCCCTATAATCCTACTAATCTTCAAACCCGAACTGATCTCCGGCATCCCCACAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAGCCAGCGAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCCCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTAACCCTAGCAACCCTCTCCACCCCCATCCTACTTCCACTACTATCCAACAACCTCAAAAACACCCCCAACACAATTACGAATGCAGTCAAAACCTCATTCCTAATCAGCCTGATCCCCATAACAATTTTCATCTACTCCGGAACAGAAAGCCTCATCTCCCTATGTGAATGAAAATTCATCATAACCTTCAAAATCCCAATCAGCTTAAAAGTAGACTTCTACACACTCACCTTCTTTCCCATCGCACTGTTCGTATCATGATCCATCCTACAATTTGCAACATGATACATAGCTTCAGACCCTTACATCACAAAATTCTTCACCTACCTCCTATTCTTCCTAATTGCTATACTCATCCTAATTATCGCCAACAACCTATTCGTCCTATTCATCGGCTGAGAAGGAGTCGGAATCATATCCTTCCTCCTAATCAGCTGATGACATGGTCGAGCAGAAGCCAACACCGCCGCCCTACAAGCCGTCCTCTACAATCGAATCGGCGACATTGGCCTCATCCTATGTATAGCATGACTAGCCTCCGCTACAAACACATGAGAAATCCAACAACTCCCTACCTCCTCCCAAACCCCCACACTACCCCTACTAGGTCTCATCCTAGCCGCCACCGGAAAATCCGCCCAATTCGGCCTACACCCATGACTCCCAGCTGCAATAGAAGGGCCAACCCCCGTATCCGCCCTACTCCATTCCAGCACAATAGTAGTAGCAGGAATCTTCCTACTAATCCGAACCCATCCACTATTTAACAACAACCAAACCGCCCTAACCCTGTGCCTATGCCTAGGAGCCATCTCCACCCTATTTGCAGCCACATGCGCCCTAACTCAAAATGATATCAAAAAAATCATTGCCTTCTCCACCTCCAGCCAACTAGGCCTAATGATAGTCACAATCGGATTAAACCTGCCCGAATTAGCCTTCCTCCACATCTCCACCCACGCATTCTTCAAAGCCATGCTCTTCCTATGCTCAGGATCCATCATCCACAGTCTAAATGGTGAACAAGACATTCGAAAGATAGGAGGACTCCAAAAAACACTCCCCACAACAACCGCATGCCTTACAATCGGCAACCTCGCCCTAATAGGAACACCATTCCTAGCAGGATTTTACTCAAAAGACCAAATCATCGAAAGCTTAAATACATCCTACCTAAACACCTGAGCCCTAACTCTTACCCTTCTAGCCACATCATTCACCGCAGTATATACAATCCGCATAACCGTACTAGTACAGACCGGCTTCACTCGAATTCCCCCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCCCCCATCACCCGCCTTGCACTAGGAAGCATCTTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACAAAAACCCCTACAATAACTATACCGCTACACATTAAAATAACCGCTCTAATCGTAACAGCCCTAGGAATCGCCCTAGCCCTAGAAATCACAAAAATAGCCCAAACACTTATCCTTACAAAACAAACCCCTTTCTCAAACTTCTCAACTTCCCTAGGATACTTTAACCCCCTAACCCATCGCCTAAGCATAACCAACTTCCTCAAAGGAGGACAGAACATCGCCTCCCACTTAATCGACCTATCCTGATACAAAATACTAGGCCCAGAAGGACTAGCCAACCTACAATTGACGGCAACCAAAACCGCCACCACCCTTCACTCAGGCCTAATCAAATCCTACCTAGGATCATTCGCCCTATCCATCCTCATCATCCTCA---TATCTACACTCAGAAA--CAA-C-C---AATGGCACCCAACATTCGTAAAAACCACCAAATCCTCAAAATCATCAATGATGCCTTAATTGATCTCCCAGCTCCATCAAACATCTCAACATGATGAAACTTCGGATCCCTATTAGGCGTCTGCTTAATCACTCAAATCATCACAGGCCTTCTGCTAGCCATACACTACACAGCAGACACCAACCTGGCCTTCTCCTCTGTAGCCCACATATGCCGAGATGTACAATTCGGCTGACTCATCCGCAACCTCCATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGCCTCTACTACGGCTCATACCTAAATAAAGAGACCTGAAACGTCGGAGTCGTTCTTCTACTAACCCTAATAGCAACCGCCTTCGTAGGATACGTCCTTCCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACCTATTCTCAGCCATTCCATACATCGGACAAACACTAGTCGAATGAGCTTGAGGAGGATTTTCCGTCGACAACCCCACACTAACCCGATTCTTTGCCCTCCACTTCCTCCTCCCCTTTGTCATCGTAGGGCTTACCGTCGTCCACCTCACTCTCCTCCACGAAACAGGATCCAACAACCCACTAGGAATCCCATCAGACTGCGACAAAATCCCCTTCCACCCATACTACACCATCAAAGACATTCTAGGATTTGTCCTAATACTCTCCCTACTCGTCTCACTAGCCCTATTCTCCCCTAACCTCCTAGGAGACCCAGAAAACTTCACCCCAGCCAACCCGCTAGTCACCCCTCCACATATCAAACCTGAATGATACTTCCTATTTGCTTACGCTATCCTCCGATCCATCCCAAACAAACTAGGAGGTGTATTAGCCCTAGCCGCCTCAATCCTAGTCCTATTCCTCATTCCACTCCTGCACACATCAAAACTACGATCAATGACCTTCCGCCCCCTATCACAAATCCTATTCTGAACCCTAGTCGCCAACGTCCTTGTACTAACCTGAGTAGGCAGCCAACCAGTAGAACACCCGTTCATCATCATTGGCCAACTAGCCTCACTCTCATACTTCACAATTATCCTAGTCCTATTCCCCCTCGCGGCCGCCCTGGAGAATAAAATACTCAAACT----------TTA-ACA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Chrysomus_ruficapillus_JX516056 GTCCTTGTAGCTTATAACAAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGAAGCCCTGGACA-CCT-T-AA-T-T-----AGGCAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTGAGCTGTCGCAAGCCCAAGATGT-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGTTA-TACCTGACCATTCCTTGC-CAA-TAA--CAGCCTACATACCGCCGTCGCCAGCCCACCCACA--CTGAAAGCTCAACAGTGGACGCAACAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGTAATGGGCTACATTTTCTAAACTAGAACA-C----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG--CCCCCCCCCCCCCAATAAACTAATAAGCTAC-TC--AGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCT-ACA-TG------ACCTGGA-ATAAC--AAAGCCACTACCC-C-A-AACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAACAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-CCATA-AACCCTA--ATGAAGT---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ATTAA-ACC-CCTAAC-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACTTCATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAGATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAA-TCCCCA-ATATACGA--AAAAT---------CAA---ACAAGCA-CAG-TATTA-AATGTA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACATA----CT-CACCCA--C-C-GGGTTCACTGAC-ACA-TAA-GT-C-TCTGGTT-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTA-AGAGCAACCTCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACA---TA-----CC---A--C----ATGAC----------CAACTACCCCCTACTGATCAATCTCATCATAGCCCTCTCCTATGCCCTACCCATCTTAATCGCAGTAGCCTTTCTTACACTGGTAGAGCGCAAAATCCTAAGTTACATGCAAGGCCGAAAAGGACCAAACATCGTCGGCCCCTTTGGACTCCTCCAACCCCTAGCAGATGGTGTCAAACTATTCATCAAGGAACCCATCCGGC---------CCTCAACATCTTCCCCAATCTTATTCATTGCAACCCCAGTCCTAGCTCTTCTCCTAGCCATCTCAATCTGAACCCCATTACCCCTTCCATTCTCCCTGGCAGACCTCAATCTGGGGCTTCTTTTCCTACTAGCTATATCAAGCCTAGCAGTATACTCCATTCTATGATCAGGCTGAGCTTCCAACTCCAAATACGCCCTAATTGGAGCACTACGAGCGGTAGCCCAGACAATCTCCTACGAGGTAACCCTAGCCATCATTCTTCTTTCCGTTGTCCTCCTTAGCGGTAACTACACTCTGAGCACCCTTGCAGTCACCCAAGAACCTTTATACCTCATTTTCTCCTGCTGACCCCTTGCTATAATATGATACGTCTCCACACTGGCTGAAACCAACCGTGCCCCTTTTGACCTAACAGAGGGAGAGTCTGAACTAGTATCCGGATTTAACGTAGAATATGCAGCAGGTCCTTTCGCACTCTTCTTCCTAGCCGAATACACCAACATCATGCTCATAAATACACTAACCACAATCTTATTCTTCAACCCAAGCCTCTTTAACCCACCTCAAGAACTATTTCCCGTTATTCTAGCCACAAAGGTCCTACTTTTATCAGCAGGATTCCTATGAATCCGCGCTTCTTATCCACGATTCCGATACGACCAATTAATACACTTACTATGAAAAAATTTCCTACCACTTACACTAGCCCTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGCCTACCT-----CCTTACCTA-A--GG-CC-----------TTGTTGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-T--GTAA-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGGAATCAAAATCCTCCATACTCCCTTTATATTACTTCCT----------------AGTAGGGTAAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATTTTCACTGCCAGCCTACTTCTAGGGACAACTATCACCATCTCAAGCAACCACTGAATCA---TAGCTTGAACCGGCCTCGAAATTAATACACTCGCCATCCTCCCATTAATCTCTAAATCTCACCATCCGCGAGCCATTGAAGCCGCCACTAAATACTTCCTAACCCAGGCAGCCGCTTCCGCCCTAGTATTATTCTCCAGCATAACCAACGCATGGTATACCGGACAATGAGACATCACCCAACTTACCCATCCAACATCCTGCCTAATTTTTACATCAGCAGTCGCAATAAAACTAGGATTAGTGCCATTCCATTTCTGATTTCCAGAAGTACTCCAAGGCTCTCCCCTCACTACTGGCCTACTCCTATCTACTATCATAAAACTCCCCCCAATCACACTACTCTACATAACTTCTCCCTCACTAAACCCCACACTATTAACCACCTTAGCCATCCTCTCTGCAGCCTTCGGAGGTTGAATGGGCCTCAACCAAACACAAATCCGAAAAATCTTAGCCTTTTCCTCCATTTCTCACCTGGGATGAATAGCAATCATCATCATCTACAACCCCAAACTCACACTCCTCAATTTCTACCTGTACGCCGTAATAACCGCAACCGTCTTCCTCACCCTAAACACAATTAAAGTACTAAAACTATCCACCCTAATAACCGCATGATCTAAAACCCCACCCTTAAACGCAATGTTACTTCTAACCCTCCTCTCCCTCGCAGGGCTCCCTCCTCTGACAGGATTCCTGCCTAAATGACTTATCATCCAAGAACTAACTAAACAAGAAATAATCCCGGCAGCCACACTTATCTCCCTATTATCCCTACTGAGCCTATTCTTCTACCTCCGACTGGCATATTGTGCAACCATCACACTCCCCCCGCATACTACAAACCACATAAAACAATGACGCACTAACAAACCAACCAACATCACAATTGCCATTCTAATCACTGTGTCCGTCACACTCCTCCCTATCTCTCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAATTTTCCTAGACAGATGGGCTTCGATCCCACGATAC-TATAGTTAACAGCTATATGCCCTAACC-TACAGGCCTCTGCCT-A-------------AGGCCCCGGCGCATGA-TTAATGCACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTCATAAACCGATGATTATTCTCAACCAACCACAAAGACATTGGAACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAATTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTGGTCGTCACGGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGATTCGGGAACTGACTAGTTCCCCTAATAATTGGAGCTCCAGATATGGCATTCCCACGAATGAACAACATAAGCTTCTGATTACTTCCACCGTCCTTCCTCCTCCTCCTAGCATCTTCCACAGTTGAAGCAGGTGTAGGAACAGGCTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGAGCTTCAGTCGACCTAGCAATTTTCTCCCTACATCTAGCCGGTATCTCTTCAATCCTAGGAGCAATCAACTTTATTACAACAGCTATCAACATAAAACCCCCTGCCCTCTCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTACTACTCCTATCTCTTCCAGTTCTAGCTGCAGGAATTACAATACTCCTAACAGACCGCAACCTTAACACCACATTCTTTGATCCTGCTGGAGGAGGAGACCCTGTACTGTACCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGGATCATTTCCCATGTTGTAGCCTACTACTCAGGTAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCTATACTATCCATCGGATTCCTAGGCTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGACACCCGAGCATACTTTACATCTGCCACTATAATCATTGCCATCCCAACCGGAATCAAAGTGTTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCACCAATACTATGAGCCCTAGGATTTATCTTCCTATTTACTATTGGAGGACTAACAGGAATCGTCTTAGCAAATTCCTCACTAGACATCGCCTTACACGACACCTACTACGTAGTAGCCCACTTCCACTATGTACTATCCATAGGGGCAGTATTCGCAATTCTAGCAGGATTCACCCACTGATTCCCTCTATTCACCGGATACACACTTCATTCAACATGAGCTAAAACACACTTCGGCGTAATATTCGTAGGCGTAAACCTAACATTCTTCCCACAACACTTCCTAGGCCTAGCCGGTATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTGTGAAACACCATTTCCTCGGTAGGCTCACTTATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAGCTAACAAGCACCAACGTCGAATGAATTCACGGCTGCCCACCCCCATTCCACACCTTTGAAGAACCCGCCTTTGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAG-CCTTGTCGAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACTT---AACATGGCCAACCACTCACAACTTAACTTCCAAGATGCCGCCTCACCTATTATAGAAGAACTAATAGGATTCCACGATCACGCCCTAATAATCGCACTAGCAATCTGCAGTCTCGTACTCTACCTACTAACCCACACCCTAACAGAAAAACTGACATCAAACACAGTCAACGCACAGGTAATCGAACTAGTTTGAACAATTCTCCCCGCTCTAGTCCTAGTAACACTCGCCCTACCATCCCTACGAATCCTCTACATAATGGACGAAATCAATGAACCAGACCTAACCCTAAAAGCCATCGGCCACCAATGATATTGAACCTACGAATATACTGACTCCAAAGACCTAACATTTGACTCCTACATAATCCAAACAGCAGATCTGCCCCTAGGTCATTTCCGCCTACTAGAAGTTGACCACCGCGTTGTCGTCCCAATAAACTCAACTATCCGAGTCATCGTCACTGCCGACGACGTACTCCACTCATGAGCCGTCCCCAGCCTAGGTGTAAAAACTGACGCAATCCCAGGACGCCTTAACCAAACCTCCTTCCTCGCCTCCCGACCAGGTGTATTCTACGGGCAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTCATGCCAATCGTAGTAGAATCCACCCCACTCGCCAACTTCGAAAACTGATCCTCTCTAA---TATCATCTT----------AATCATTAAGAAGCTATGAATCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGAT-CCCCCCCCTCCTTAATGATATGCCTCAACTAAACCCCAGCCCCTGATTTTTTATCATGCTCACTTCATGACTCACCTTCTCTCTAATTATCCAACCCAAACTACTAACATTCGTATCAATAAATCCCCCATCTAACAAAC---CGCCCGCCGCCCCAAGCACTACTCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCATTCCTAGGAATCCCACTAATTCTTATCTCGATAACATTCCCAGCCCTCCTCCTGCCATCCCTCGACAACCGGTGAATCACTAACCGACTATCAACTCTTCAATTATGGTTCGTCAACCTAGTCACAAAACAACTAATAATACCACTAGACAAAAAAGGACATAAATGAGCCCTAATCCTAACATCCCTCATAATCTTCCTCCTACTTATTAATCTCCTAGGCCTGCTGCCATACACATTCACCCCAACCACCCAACTATCTATAAACTTAGCCCTAGCCTTCCCCCTATGGCTAGCCACACTCCTAACAGGACTACGAAACCAACCCTCTGCCTCACTAGGCCACCTCCTGCCAGAGGGCACACCCACCCCACTAATCCCAGCCCTCATCCTAATCGAAACGACAAGTCTTCTCATTCGCCCATTAGCACTAGGCGTACGCCTAACAGCCAACTTAACAGCAGGCCACCTACTAATCCAACTCATCTCTACCGCCACAACAGCCTTATTCTCCACAATACCACTAGTCTCACTCCTAACCTTCGTAGTCCTATTCCTACTGACAATCCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTCTTCGTACTCCTACTAAGCCTTTACCTCCAAGAAAACATCTAACCC--TA----AATGGCACACCAAGCACATTCCTACCACATAGTTGACCCCAGCCCATGACCTATCCTAGGAGCAGGAGCTGCTTTCCTCACTACCTCAGGACTAACAATATGATTCCACTGAAACTCCCCCCATCTCCTTATCCTAGGCCTACTATCAACCATCCTTGTCATATTCCAATGATGACGAGACATTGTGCGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGCCTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGATTTTTCTGAGCTTTCTTCCACTCTAGCCTGGCCCCCACACCAGAACTAGGAGGTCAGTGACCACCCGTAGGGATTAAGCCCCTCAACCCTATAGAAGTACCACTTCTAAACACTGCCATCCTTCTAGCCTCAGGAGTCACCGTCACATGAGCCCATCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTATCCCTAACAGTCCTCCTTGGCTTCTACTTCACTGCCCTACAAGCCATAGAGTACTACGAGGCACCCTTCTCCATCGCCGACGGAGTTTACGGCTCAACATTCTTCGTCGCCACCGGATTCCACGGTCTACACGTAATTATCGGCTCTACATTTCTACTAGTATGCCTCCTACGCCTGATCAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTAACCCTATCACTAACCCTAAGCATTCTCTTAACCACATTAAACTTCTGACTCGCCCAAATAACCCCAGACTCAGAAAAACTATCACCATACGAATGCGGATTCGACCCCCTAGGATCCGCTCGACTCCCATTCTCAATCCGCTTCTTCCTAGTAGCCATTCTATTCCTCCTATTTGACCTAGAAATTGCCCTACTCCTTCCACTACCCTGAGCCACCCAACTACAATCCCCCACCACCACCTTAGCCTGAACCGCCACACTCATCTTCCTACTCACCCTAGGCCTAGTGTACGAATGAATTCAAGGTGGACTAGAGTGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTATCTCCACTTAAGCTTTTACTCAGCCTTTGCCCTAAGCAGCCTTGGCCTAGCCTTCCACCGAACTCACCTAATCTCCGCCCTACTATGTTTAGAGAGCATAATACTATCTATGTACGTCGCCCTAGCCATATGACCCATCCAAATCCAATCATCAGTATCCACCATCCTACCTATTCTTATATTAACATTCTCAGCCTGCGAAGCAGGCACAGGCCTAGCACTACTAGTAGCCTCAACCCGCACTCACGGATCCGATCATCTACACAACTTTAACCTCCTACAATGCTAAAAATCATCATTCCAACTATAACACTCCTCCCCCTAGCTCTCCTATCCCCATGAAAACACTTATGAACTAACATCACACTATACAGCCTACTAATCGCCGCCGTCAGCCTACAATGATTCACACCCACATACTACCCAAACAAAAGCCTAACCCCATGAACATCAATCGACCAAATTTCCTCCCCCCTACTAATCCTCTCATGCTGACTCCTCCCCCTCATAATCATGGCAAGCCAAAACCATCTAGAACAAGAACCCGTCAGCCGAAAACGAACCTTTGCCTCAACACTAATCCTGGCCCAACTATCCATCCTCCTAGCCTTCTCAGCCTCCGAACTGATACTCTTCTACATTGCTTTTGAAGCCACTCTCATTCCAACCCTAATCCTTATCACACGATGAGGAAGCCAACCAGAACGTCTAAACGCTGGCATTTACCTCCTATTCTATACCCTCGCTAGCTCACTCCCATTATTAATTGCCATCCTCCACCTACAAAACCAAATCGGCTCACTCTACCTACCAATACTCAAACTTTCACACCCAACATTAAATTCTTCCTGATCCAATTTAGCTGCAAGCCTAGCCCTTCTACTAGCCTTCATAGTTAAAGCCCCACTATATGGCCTACACCTATGACTTCCCAAAGCCCACGTAGAGGCCCCAATCGCCGGATCCATGTTACTAGCAGCCTTACTACTAAAACTCGGAGGCTATGGTATCATACGAATCACAATCCTAGTAAACCCATCATCAAACAACCTCCACTACCCATTCATCACCCTAGCCCTATGAGGAGCAGTAATAACTAGTGCCATCTGCCTACGCCAAATTGACCTAAAATCACTAATCGCTTACTCTTCCGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACTCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCCCACGGCTTAACTTCCTCAATACTATTCTGCCTAGCCAACACCAACTACGAACGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCTCTTTTACCACTTATAGCCACCTGATGACTACTAGCTAACCTTACAAACATAGCCCTCCCTCCAACAACAAATCTTATAGCAGAACTAACCATTGTAGTAGCACTATTCAACTGATCTGCCCTAACAATCATCCTAACAGGAACTACCATCCTACTCACTGCCTCATACACCCTATACATACTAATTATAACACAACGAGGCACTCTCCCATCTCACATCACATCTATCCAAAACTCTTCCACACGAGAGCACCTCCTCATAGCCCTACACATAATCCCTATAATCCTACTAATCTTCAAACCCGAACTGATCTCCGGCATCCCCACAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAGCGAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCCCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTAACCCTAGCAACCCTCTCCACCCCTATCCTGCTCCCACTACTATCCAACAACCTCAAAAACACCCCCAACACAATTACGAATGCAGTCAAAACCTCATTCCTAATCAGCCTGATCCCAATAACAATTTTCATCTACTCCGGGACAGAAAGCCTCATCTCCCTATGTGAATGAAAATTCATCATAACCTTCAAAATCCCAATCAGCTTAAAAGTAGACTTCTATACACTCACCTTCTTTCCCATCGCACTGTTCGTATCATGATCCATCCTACAATTTGCAACATGATACATAGCCTCAGACCCTTACATCACAAAATTCTTCACCTACCTCCTATTCTTCCTAATTGCTATACTCATCCTAATTATCGCCAACAATCTATTCGTCCTATTCATCGGCTGAGAAGGAGTCGGAATCATATCCTTCCTCCTAATCAGCTGATGACATGGTCGAGCAGAAGCCAATACTGCCGCCCTACAAGCCGTCCTCTACAATCGAATCGGCGACATTGGCCTCATCCTATGTATAGCATGACTAGCCTCCGCTACAAACACATGAGAAATCCAACAACTCCCTACCTCCCCCCAAACCCCCACACTACCCCTACTAGGCCTCATCCTAGCCGCCACCGGAAAATCCGCCCAATTCGGCCTACACCCATGACTCCCAGCCGCAATAGAAGGACCGACTCCCGTATCCGCCCTACTCCATTCCAGCACAATAGTAGTAGCAGGAATCTTCCTACTAATCCGAACCCATCCACTATTTAACAACAACCAAACCGCCCTAACCCTATGCCTATGCCTAGGAGCCATCTCCACCCTATTTGCAGCCACATGCGCCCTAACTCAAAATGATATTAAAAAAATCATTGCCTTCTCCACCTCCAGCCAACTAGGACTAATAATAGTCACAATCGGATTAAACCTGCCCGAATTAGCCTTCCTCCACATCTCCACCCACGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGATCCATCATCCACAGTCTAAACGGTGAACAAGACATTCGAAAGATAGGAGGACTCCAAAAAATACTCCCCACAACAACCGCATGTCTTACAATCGGCAACCTCGCCCTAATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCTTAAATACATCCTACCTAAACACCTGAGCCCTAATTCTCACCCTCCTAGCCACATCATTTACCGCAGTATATACAATCCGCATAACCGTACTAGTACAGACTGGCTTCACTCGAATTCCCCCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCCCCCATCACTCGCCTCGCACTAGGAAGCATCCTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACAAAAACTCCTACAATAACTATACCACTACACATTAAAACAACCGCTCTAATCGTAACAGCCCTAGGAATCGCCCTAGCCCTAGAAATCACAAAAATAGCCCAAACACTTATCCTTACAAAACAAACCCCTTTCTCAAACTTCTCAACTTCCCTAGGATACTTTAACCCCCTAACTCACCGCCTAAGCATAACTAACTTCCTCAAAGGAGGACAAAACATCGCCTCCCACTTAATCGACCTATCCTGATACAAAATACTAGGCCCAGAAGGACTAGCCAACCTACAATTGACGGCAACCAAAACCGCCACCACCCTTCACTCAGGCCTAATCAAATCCTACCTAGGATCATTCGCCCTATCCATCCTCATCATTCTCA---TATCTACACTCAGAAA--CAA-C-C---AATGGCACCCAACATTCGTAAAAACCACCAAATCCTCAAAATCATCAATGATGCCTTAATTGATCTCCCAGCTCCATCAAATATCTCAACATGATGAAACTTCGGATCCCTACTAGGCGTCTGCTTAATCACTCAAATCATCACAGGTCTTCTGCTAGCCATACACTACACAGCAGACACCAACCTGGCCTTCTCCTCTGTAGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTACATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAAGCATCTACTACGGCTCATACCTAAACAAAGAGACCTGAAACGTCGGAGTCGTTCTTCTACTAACCCTAATAGCAACCGCCTTCGTAGGATATGTCCTCCCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACCTATTCTCAGCCATTCCATACATCGGACAAACACTAGTCGAATGAGCTTGAGGAGGATTCTCCGTTGACAACCCCACACTAACCCGATTCTTTGCCCTCCACTTCCTCCTCCCCTTTGTCATCGTAGGGCTTACCGTCGTCCACCTCACCCTCCTACACGAAACAGGATCCAACAACCCACTAGGAATCCCATCGGACTGCGACAAAATCCCCTTCCACCCATACTACACCATCAAAGACATTCTAGGATTCGTCCTAATACTTTCCCTGCTCGTCTCACTAGCCCTATTCTCCCCTAACCTCCTAGGAGACCCAGAAAACTTCACCCCAGCCAACCCGCTAGTCACCCCTCCACATATCAAACCTGAATGATATTTCCTATTTGCTTACGCTATCCTCCGATCCATCCCAAACAAACTAGGAGGTGTATTAGCCCTAGCTGCCTCAATCCTAGTCCTATTCCTCATTCCACTCCTGCACACATCAAAACTACGATCAATGACCTTCCGCCCTCTATCACAAATCCTATTCTGAGCCCTAGTCGCCAACGTCCTTGTACTAACCTGAGTAGGTAGCCAACCAGTAGAACACCCGTTCATCATCATTGGCCAACTAGCCTCACTCTCATACTTCACAATTATCCTAGTCCTATTCCCCCTCGCGGCCGCCCTGGAGAATAAAATACTCAAACT----------TTA-ACA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Chrysomus_thilius_JX516069 GTCCTTGTAGCTTATAACAAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-TACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-T--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACGTTA--T----AACGGCGTAAAGGGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTAAGCTGTCATAAGCCAAAGATGT-CAGTAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGTTA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCTCACCTACA--CTGAAAGCCCAACAGTGAGCGCAATAG-CCTCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAAACTAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG-CCCCCCCCCCCCCCCATAAATTAATAAGCCAC-TC--AGCCGGAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-T-A-AACCC----AACTAAAGCATT---C--ATTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-TCACG-AACCCTA--ATGAAGT---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ACCAA--CC-CCTAAC-TGAATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAT-GACACAAAAATATAAG-AACTACATGACTCCCT-CCCCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAA-CCCCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-CAG-TATTA-AACGCA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCGACCACC--TTAAAT-CACATA----CT-CACCCA--C-T-GGGTTCACTGAC-ACA-CAA-GA-C-TCTGGTC-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCATACCTCTAGACTG-AGAGCAACCTCTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TA-----CC---C--C----ATGAC----------CAACTACCCCCTCCTGATCAACCTCATCATAGCCCTCTCCTATGCCCTACCCATTTTAATCGCAGTAGCTTTTCTTACATTAGTAGAACGCAAAATCCTAAGCTACATACAAGGCCGAAAAGGCCCAAACATCGTCGGCCCTTTCGGACTCCTCCAACCCCTAGCAGACGGTGTTAAACTGTTCATCAAAGAGCCCATCCGAC---------CTTCAACATCTTCCCCAATCTTATTCGTTGCAACCCCGGTCCTAGCTCTTCTTCTAGCCATCTCAATCTGAACCCCATTACCCCTCCCATTCTCTCTAGCAGATCTCAACCTAGGACTTCTCTTCCTACTGGCCATATCAAGCCTGGCAGTATACTCCATCTTATGGTCAGGCTGAGCCTCCAATTCCAAATACGCCCTAATTGGAGCACTTCGAGCAGTAGCTCAGACAATCTCCTACGAAGTAACCCTGGCCATCATTCTTCTCTCCGTTATCCTCCTTAGCGGTAACTACACTCTGAACACCCTCGCAGTCACCCAAGAACCCCTATACCTCATTTTCTCCTGCTGACCCCTTGCTATAATATGATACGTCTCCACACTGGCCGAAACTAACCGTGCCCCTTTCGACCTAACAGAAGGAGAGTCTGAACTGGTGTCCGGATTCAACGTAGAATATGCGGCAGGTCCTTTCGCACTCTTCTTTCTAGCCGAATACGCCAATATTATACTCATAAATACACTAACCACAATCCTATTCTTCAACCCAAGCCTCCTTAACCCTCCTCAAGAGTTATTCCCCGTCATTCTAGCCACAAAGGTCTTACTCTTATCAGCAGGATTCCTATGAATTCGCGCTTCCTATCCACGATTCCGATACGACCAATTAATACACTTACTATGAAAAAACTTCTTACCACTCACATTAGCCCTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGCCTGCCC-----CCTTACCTA-A--GG-CC-----------TTATTGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-A--GTAA-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGGAATCAAAATCCTCCATACTCCCTTTATATTACTTCCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATCTTCACCACTAGCCTACTTCTAGGGACAACCATTACCCTCTCAAGTAACCACTGAATCA---TAGCTTGAACCGGCCTTGAAATCAACACACTTGCCATCCTCCCTTTAATCTCTAAATCCCACCACCCACGAGCCATCGAAGCTGCCACTAAATACTTCCTGACCCAGGCAGCTGCCTCTGCCCTCGTCCTATTCTCCAGCATAACCAATGCATGACACACCGGACAATGGGACATCACCCAACTTACCCATCCAACATCCTGCCTAATCCTCACCTCGGCAATCGCAATAAAACTAGGACTAGTGCCGTTCCACTTCTGATTTCCAGAAGTACTCCAAGGCTCTCCCCTTACCACTGGCCTACTCCTATCCACTGTCATAAAACTCCCCCCAATCACATTACTCTACATAACTTCCCCCTCACTAAACCCTACACTACTAACTACCTTAGCCATCCTCTCCGCAGCCCTCGGAGGTTGAATAGGCCTTAACCAAACACAAATCCGAAAAATCCTAGCCTTTTCCTCCATCTCTCACCTGGGCTGAATGGCAATCATTATCATCTACAACCCCAAACTTACACTCCTTAACTTCTATCTATACGCCGTAATAACCGCAACCGTCTTTCTCACCCTAAACACAATCAAAGTACTGAAACTATCCACCCTGATAACCGCATGATCTAAAACCCCATCCTTAAACGCAATACTACTTCTAACCCTACTTTCACTCGCAGGTCTCCCCCCTCTGACGGGATTCCTGCCTAAATGACTTATCATTCAAGAACTAACTAAACAAGAAATAGTCCCAGCAGCTACACTAATATCTCTGCTCTCCCTGCTAGGCCTATTCTTCTACCTCCGACTAGCATACTGCGCAACCATCACACTCCCCCCACATACCACTAACCACATGAAACAATGACGCACTAAAAAACCAACTAACATCACAATTGCCATCCTAATCACTGTGTCCGTCATACTCCTCCCTATCTCTCCCATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT-A--TAACTCTCCTAGGCAGATGGGCTTCGATCCCACGACAC-TATAGTTAACAGCTATATGCCCAAACC-AACGGGCCTCTACCT-A-------------AGGCCCCGGCGCATGA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACGGAACC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTTATCAACCGATGATTATTCTCAACTAACCACAAAGACATTGGGACCCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGGTTCGGTAACTGACTAGTTCCCCTAATGATCGGAGCCCCAGACATGGCATTCCCACGAATAAACAATATAAGCTTCTGGCTGCTCCCCCCATCCTTCCTACTCCTCCTAGCATCTTCCACAGTTGAAGCAGGTGTAGGAACAGGTTGAACAGTATACCCTCCACTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTTGACCTAGCAATTTTCTCCCTACATCTAGCCGGTATCTCTTCAATCCTAGGAGCAATCAACTTTATTACAACAGCAATCAACATAAAACCCCCCGCCCTATCACAATACCAGACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTATTACTTCTATCTCTTCCAGTCCTAGCCGCAGGAATCACAATGCTCCTCACAGACCGTAACCTCAATACCACATTCTTTGATCCTGCTGGAGGGGGAGACCCTGTACTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATCCTCCCAGGATTCGGGATCATCTCCCACGTTGTAGCTTACTACTCAGGCAAAAAAGAACCATTCGGTTATATAGGAATAGTATGAGCCATACTATCTATCGGATTCCTAGGCTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGACACTCGAGCATATTTCACATCCGCCACTATAATCATTGCTATCCCAACCGGAATCAAAGTGTTCAGCTGACTAGCCACACTACATGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTTACTATCGGAGGACTAACAGGAATCGTTTTAGCAAACTCCTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCTCACTTCCACTACGTACTATCCATAGGAGCAGTATTTGCAATCCTAGCAGGCTTCACTCACTGATTCCCCCTATTCACCGGATACACACTTCATTCAACATGAGCTAAAACACACTTCGGCGTAATATTCGTAGGTGTAAACCTAACATTCTTCCCCCAACATTTCCTAGGCCTAGCCGGTATACCACGACGATACTCAGACTACCCAGATGCCTACACACTATGAAACACCATCTCCTCAGTAGGCTCACTCATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTTGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACTAACGTTGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCAGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAA-CCTTGTCAAGGTTAAATTGCAGGTGAAAATCCAGCACATCTCT-----ACTT---AACATGGCCAACCATTCACAACTCAACTTCCAAGACGCCGCCTCACCTATTATAGAAGAACTGATAGGATTCCACGACCACGCCCTAATAATCGCACTAGCAATCTGTAGCCTCGTACTCTACCTGCTAACCCACACCCTCACAGAAAAACTGACATCAAACACAGTCAACGCACAAGTAATCGAGCTAGTTTGAACAATTCTCCCTGCCCTAGTCCTGGTCACACTCGCCCTACCATCCCTACGAATTCTCTACATAATGGATGAAATCAACGAACCAGATCTAACCCTAAAAGCCATTGGCCACCAATGATACTGAACCTATGAATACACTGACTCCAAAGACCTAACATTCGACTCCTACATAATCCAAACGGCAGACTTACCTTTAGGCCATTTCCGCCTACTAGAAGTTGACCATCGAGTTATCGTCCCCATAAACTCAACTATCCGAGTCATCGTCACCGCCGACGACGTCCTCCACTCATGAGCTGTACCAAGCCTAGGTGTAAAGACCGACGCAATCCCAGGACGCCTTAACCAAACTTCCTTCCTTGCTTCCCGACCAGGCGTATTCTACGGACAATGCTCAGAAATCTGTGGGGCTAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCACTCGCCAACTTCGAAAACTGATCCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAATCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGATTCCCCCCCCTCCTTAATGACATGCCTCAACTAAACCCAAACCCATGATTTTTTATCATGCTCACTTCATGACTCACTTTCTCCCTAATTATCCAACCTAAAATTCTAACATTCGTATCAATAAACCCACCATCCAACAAAC---CACCCGCCGCCCCAAGCACTACTCCCTGAACCTGACCATGAACCTAAGTTTCTTCGACCAATTCTCAAGCCCATCATTCCTAGGGATCCCACTAATCCTCATCTCAATAACATTCCCAGCCCTCCTCCTACCATCCCTTGACAACCGATGAATCACCAACCGGTTGTCAACCCTCCAACTCTGATTTATCAACCTAGTTACAAAACAACTAATAATACCACTAGACAAAAAAGGACATAAATGAGCCCTAATCCTAACATCTCTAATAATCTTCCTCCTCCTCACTAATCTCCTGGGCCTATTACCATACACATTCACCCCAACCACCCAACTATCCATAAACTTAGCCCTAGCCTTCCCCCTATGACTAGCCACACTCCTAACAGGACTGCGAAACCAACCTTCTGCCTCACTAGGCCACCTCCTACCAGAAGGCACACCCACCCCACTAATTCCAGCCCTCATCCTAATCGAAACAACAAGCCTTCTAATCCGCCCATTAGCACTGGGCGTGCGCCTAACAGCCAACTTAACAGCAGGCCATCTCCTAATCCAACTCATTTCTACCGCCACAACAGCCCTATTCACTACAATACCAGTAGTTTCACTACTGACCTTCGTAGTCCTCTTCCTATTGACAATCTTAGAAGTAGCAGTAGCAATAATTCAAGCCTACGTCTTCGTGCTCCTACTAAGCCTCTACCTCCAAGAAAACATCTAACCC--TA----AATGGCACACCAAGCACATTCTTACCACATAGTTGACCCAAGCCCATGACCCATCCTAGGAGCAGTTGCTGCCTTTCTCACTACCTCAGGACTAACAATATGATTCCACTGAAACTCCCCTAAACTCCTTATCCTAGGCCTACTGTCAACCGCCCTCGTCATATTCCAATGATGACGTGACATCGTACGAGAAAGTACATTCCAAGGCCACCACACCCCAGCCGTACAAAAAGGACTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTTTTCTTCCTAGGATTTTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCCACACCAGAACTAGGAGGTCAATGACCTCCCGTAGGAATTAAACCTCTCAACCCCATAGAAGTCCCACTCCTGAACACTGCCATCCTCCTAGCCTCAGGAGTCACCGTCACATGAGCCCATCACAGCATCACAGAAGCCAACCGGAAACAAGCAATCCAAGCCCTATCCCTAACAGTCCTCCTCGGCTTCTACTTCACCGCCCTACAAGCCATAGAATATTACGAAGCACCCTTCTCCATTGCCGACGGAATTTACGGTTCAACATTCTTCGTTGCTACCGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAACCACCATTTCGGATTTGAGGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATCA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTAACCATATCACTAACCTTGAGCATCCTCCTAACCATACTAAACTTCTGACTTGCCCAGATAACCCCAGACTCAGAAAAACTATCCCCATATGAATGTGGATTCGACCCCCTAGGATCTGCCCGACTCCCTTTCTCAATCCGCTTCTTTCTAGTAGCCATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTTCCACTACCCTGAGCCACCCAACTACAATCTCCAACCACTACCTTAACCTGAACCACCGCACTCATCTTTTTACTCACCCTAGGCCTAGTATACGAGTGAATTCAAGGCGGACTAGAATGAGCAGAATA-G------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTGCCTCCACCTAAGCTTCTACTCAGCCTTCGCTCTAAGCAGCCTTGGCCTAGCCTTTCACCGAACCCATCTAATCTCTGCTCTACTATGCTTAGAAAGCATGATACTATCCATATACGTTGCCCTAGCCATATGACCCATCCAAATCCAATCATCAGTATCAACTATCCTACCTATCCTAATACTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTAGCATTACTAGTAGCCTCAACCCGCACCCACGGATCCGACCACCTACACAACTTTAACCTCCTACAATGCTAAAAATTATCATCCCAACTACAACTCTCCTTCCCCTAGCCCTCCTCTCCCCATGTAAACACCTATGAACTAACATCACACTGTACAGCCTACTAATCGCCACCGTCAGCCTCCAATGACTCACACCAACATACTACCCAAACAAAAGCTTAACCCCATGAACATCAATCGACCAAATCTCCTCCCCCCTTCTAGTCCTCTCATGCTGACTCCTCCCCCTCATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCATCAGCCGAAAACGAATCTTCGCCTCAACGCTAATCCTGGCCCAACTGTCAATCCTCCTAGCCTTCTCAGCCTCCGAACTAATACTCTTTTACATCGCATTCGAAGCCACCCTAATCCCTACTCTAATCCTCATTACACGATGAGGAAGCCAACCAGAACGCCTAAACGCTGGCATCTACCTTCTATTCTATACTCTCGCCAGCTCACTACCACTATTAATTGCCATCCTCCACCTACAGAACCAAATTGGCTCACTCTACCTGCCAATACTCAAACTTTCACACCCAACATTGAGCTCTTCCTGATCTAACTTAGCTGCAAGCCTAGCCCTCCTAGTAGCCTTCATAGTCAAAGCCCCCCTATACGGTCTACACCTATGGCTCCCCAAAGCCCACGTAGAAGCCCCAATTGCCGGCTCCATGCTACTAGCAGCCTTATTACTAAAACTAGGAGGCTACGGTATCATACGAATCACAATCCTAGTAAACCCGTCATTAAACAACCTCCACTACCCATTCATCACCCTAGCCCTATGAGGAGCAGTAATAACCAGCGCCATCTGCCTACGCCAAATCGACCTAAAATCACTAATCGCTTACTCATCTGTCAGCCACATAGGACTAGTAGTAGCCGCAACCATAATCCAAACTCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCACACGGCTTAACCTCATCAATACTATTCTGCCTAGCCAACACCAATTACGAGCGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCCCTCCTACCACTTATAGCCACCTGATGACTATTAGCCAATCTAACAAACATAGCTCTCCCCCCAACAACAAACCTCATAGCAGAACTAACTATCGTAGTAGCACTCTTCAACTGATCTGCCCTAACAATTATTCTAACAGGAACTGCCATCTTACTCACCGCCTCATACACCCTATACATACTAATTATAACACAACGAGGTACTCTTCCATCTCACATCACATCCATCCAAAACTCCTCCACGCGAGAGCACCTCCTCATAGCCCTACACATACTCCCCATAATCCTACTAATCTTCAAACCTGAGCTGATCTCCGGCATCCCCGCAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAGCCAGCGAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCCCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTAAATACATTCATACTCCTAACCCTAGCAACCCTCTCCACCCCCATCCTACTCCCACTACTATCCGACAACCTCAAAAACACCCCCAATACAATCACGAACACAGTCAAAACCTCGTTCCTAATCAGTCTAATCCCTATAACAATTTTCATCTACTCCGGAACAGAAAACCTTATTTCCCTCTGAGAATGAAAATTCATCATAACTTTCAAAATCCCAATTAGCTTAAAAATAGACTTCTACACACTCACCTTCTTTCCCATCGCACTATTCGTATCATGATCCATCCTACAATTTGCAACATGATACATGGCCTCAGACCCCTACATTACAAAATTCTTTACTTACCTCCTATTCTTCCTAATTGCCATACTCATCCTAATCATCGCCAACAATCTATTTGTCCTGTTCATCGGCTGAGAAGGAGTCGGAATCATATCCTTCCTCCTAATCAGCTGATGACACGGCCGAGCGGAAGCCAACACTGCCGCCTTACAAGCCGTCCTCTACAACCGAATCGGTGACATCGGCCTTATCCTATGCATAGCATGACTAGCCTCTACCACAAACACCTGAGAAATCCAACAACTCCCTACCCATTCCCAAACCCCAACACTACCCCTACTAGGCCTCATCCTAGCCGCAACCGGAAAATCCGCCCAATTCGGCCTACACCCATGACTCCCAGCCGCAATAGAAGGACCAACCCCCGTATCTGCCCTACTCCACTCCAGCACAATAGTAGTAGCAGGGATCTTCCTACTCATCCGAACTCATCCTCTATTCAACAACAACCAAACCGCCCTAACCCTGTGCCTTTGCCTGGGAGCCATTTCCACCCTATTCGCAGCTACATGCGCCCTAACCCAAAACGACATCAAAAAAATCATTGCCTTCTCCACTTCCAGTCAACTAGGCCTAATAATAGTTACAATCGGACTAAACCTACCCGAACTAGCCTTCCTCCACATCTCCACCCACGCGTTCTTCAAAGCCATGCTCTTCCTATGCTCAGGTTCTATCATCCACAGCCTAAACGGTGAACAAGACATTCGAAAAATAGGAGGACTCCAAAAAATACTACCCACAACAACCGCATGCCTTACAATCGGCAACCTCGCCCTAATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCTTGAACACATCCTACCTAAACACCTGAGCCTTAGTTCTAACCCTACTAGCCACATCATTCACCGCAGTATATACAATCCGCATAACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCCCCTTTAACCCCAGTAAATGAAAACAACCCCGCAGTAACCTCCCCCATCACCCGTCTCGCACTAGGAAGCATTCTAGCAGGCTTCCTCATCACCTCATTCATCATCC---CAACAAAAACCCCCCCAATAACCATACCACTATACATCAAAATAACCGCTCTAGTCGTAACAACCCTAGGAATCGCCCTAGCTCTAGAAATTACAAAAATAGCCCAAACACTTATCCTCACAAAACAGACTCCCTTCTCAAACTTCTCAACTTCCCTAGGATACTTCAACCCCCTAGTCCACCGCCTAAACATAACTAACTTCCTCAAAGGAGGACAAAACATCGCTTCCCACTTAATCGACTTATCCTGATACAAAATACTAGGCCCAGAAGGACTGGCTAACCTACAACTGATAGCAACCAAAACTGCCACCACCCTTCACTCAGGCCTAATCAAAGCCTACCTAGGATCATTCGCCCTATCTATCCTTATCATCTTAA---TATCCACACTCAGAAA--CAA-C-C---AATGGCCCCCAACATTCGTAAAAACCACCAAATCCTCAAAATCATCAATGACGCCCTAATCGATCTCCCAGCTCCATCAAACATCTCAACATGATGAAACTTCGGATCCTTACTAGGCGTCTGCCTAATCACTCAAATCATCACAGGTCTTCTGCTAGCCATACACTACACAGCAGACACCAACCTAGCCTTCTCCTCTGTAGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTGCATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGCCTCTACTACGGCTCATATCTAAATAAAGAGACCTGAAACGTCGGAGTCATTCTTCTACTAACCCTAATAGCAACCGCCTTCGTCGGATATGTCCTACCATGAGGACAAATGTCATTCTGAGGCGCCACCGTAATCACAAACCTATTCTCAGCCATCCCATACATCGGACAAACACTAGTCGAATGAGCTTGAGGAGGATTCTCCGTTGATAACCCCACATTAACCCGATTCTTTGCCCTCCACTTCCTCCTTCCCTTCGTCATCGTAGGTCTCACCGTCGTCCATCTAACCCTTCTCCACGAAACAGGATCAAACAATCCACTAGGCATTCCATCGGACTGTGACAAAATTCCTTTCCACCCATACTACACCATCAAAGACATTCTAGGATTTGTCCTAATACTTTCCCTCCTCGTCTCACTAGCCCTATTCTCCCCCAACCTTTTAGGAGACCCAGAAAACTTCACCCCAGCCAACCCGCTGGTCACCCCTCCACACATCAAACCTGAATGATACTTCCTATTTGCCTACGCCATTCTTCGATCCATCCCAAACAAACTAGGAGGTGTACTAGCCCTAGCCGCCTCAATCCTAGTCCTATTCCTAGTGCCACTCCTACACACATCAAAACTACGATCAATAACTTTCCGCCCTCTATCACAAATCCTATTTTGAGCCCTAGTAGCCAACGTCCTCGTTCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCACTCTCATATTTCACAATTATCTTAATCCTATTCCCCCTCGCGGCCGCCCTGGAGAATAAAATACTCAAACT----------CTA-ATA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Chrysomus_xanthophthalmus_JX516059 GTCCTTGTAGCTTATAATAAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTGGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTAAGCTGTCGCAAGCCCAAGATGT-CAGTAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTTACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCCACA--CTGAAGGCCCAACAGTGGACGCAATAG-CCCAA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGTAATGGGCTACATTTTCTAAACTAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG---CCCCCCCCCCCCCATAAATTAATAAATTAC-TC--AGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ATACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-C-A-AACCC----AACTAAAGCATT---C--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAACAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-TCACG-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--ATTAA-CCC-CCTAGC-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACCCAATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAGATAGGAGAACTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAA-CCCCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-CAG-TATTA-AACACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAATCAGCGACCACCCTTCAAAT-CGCATG----CT-CACCCA--C-T-GGGTTCACCGAC-ACA-CAA-GG-C-TCTGGTC-CGCA-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACATCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTGATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TA-----CC---C--C----ATGAC----------TAACTACCCTCTACTAATCAACCTAATCATAGCCCTCTCCTATGCCCTACCCATCTTAATCGCAGTAGCTTTTCTTACACTGGTAGAACGCAAAATCCTAAGCTACATGCAGGGCCGAAAAGGCCCGAACATCGTCGGCCCCTTTGGACTTCTCCAACCCCTAGCGGACGGCATCAAACTGTTCATCAAAGAACCCGTCCGAC---------CTTCAACATCTTCCCCAATCCTATTCATTGCTACCCCAGTCCTAGCTCTTCTTCTATCCATCTCAATCTGAACCCCATTACCCATTCCATTCTCTCTGGCAGACCTCAATCTGGGACTTCTATTCTTACTAGCCATATCAAGCCTAATAGTTTACTCTATCTTATGATCAGGCTGAGCCTCCAATTCCAAATACGCCCTAATTGGAGCACTACGAGCGGTAGCCCAGACAATCTCCTACGAGGTAACCCTAGCCATCATTCTTCTTTCCGTCATCCTCCTTAGCGGTAACTACACTCTGAACACCCTAGCAATCACCCAAGAACCCCTATACCTTATTTTTTCCTGCTGACCCCTTGCCATAATATGATACGTCTCCACACTGGCCGAAACCAACCGTGCCCCCTTCGACCTGACAGAGGGAGAGTCCGAACTGGTATCCGGATTCAACGTAGAATACGCAGCAGGTCCTTTCGCACTTTTCTTTCTAGCCGAATACGCCAATATTATACTCATAAATACGCTAACCACAATCCTATTCTTCAACCCAAGCCTCTTTAACCCACCTCAAGAACTATTCCCCGTCATTCTAGCTACAAAGGTCCTGCTCTTATCAGCAGGGTTCCTATGAATTCGCGCTTCCTACCCTCGATTCCGATACGACCAATTAATACCCTTACTATGAAAAAACTTCTTACCACTCACACTAGCCCTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGCCTACCC-----CCTTACCTA-A--GGTTT-----------TCGTTGGAAATGTGCCTGAACAC-T--AAGGGTCACTTTGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-T--GTAA-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGGAATCAAAACCCTCCATACTTCCTTTATATTACTTCCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATTTTCATCACTAGCCTACTTCTAGGGACAACCATCACCCTCTCAAGTAACCACTGGGTCA---TGGCTTGAACCGGCCTTGAAATTAACACACTTGCCATCCTCCCATTAATCTCTAAGTCCCACCATCCACGAGCCATTGAAGCTGCCACTAAATACTTCCTAACCCAAGCAGCTGCCTCTGCCCTCGTTCTATTCTCCAGCATAACCAATGCATGATACACCGGACAATGAGACATCACCCAACTTACCCATCCAACATCCTGCCTTATTCTTACCTCAGCAATCGCAATAAAACTAGGACTAGTGCCATTCCATTTCTGATTTCCAGAAGTACTCCAAGGCTCCCCCCTCATTACTGGCCTACTCCTATCTACTGTCATAAAACTCCCCCCAATCACATTACTCTACATAACTTCTCCCTCACTAAACCCCACACTACTAACTACCTTGGCCATCCTATCCACAGCCCTCGGAGGTTGAATAGGCCTAAACCAAACACAAATCCGAAAAATCCTGGCCTTTTCCTCCATTTCTCACCTGGGCTGAATGGCAGTCATTATCATCTACAACCCAAAACTCACACTCCTTAACTTCTACCTATACGCCGTAATAACCGCAACTGTCTTCCTCACCCTAAACACAATTAAAGTACTAAAACTATCCACCCTAATAACCGCATGATCTAAAACCCCATCCTTAAACGCAATACTACTTTTAACCCTGCTTTCCCTCGCAGGACTCCCTCCCCTAACAGGATTCCTGCCTAAATGACTTATTATCCAAGAACTAACTAAACAAGAAATAATCCCGACAGCCACACTTATCTCCCTACTCTCCCTACTAGGCCTATTCTTCTACCTCCGACTAGCATACTGTGCAACCATCACACTCCCCCCGCATACTACAAGCCACATGAAACAATGGCGCACTAACAAACCAACTAACATCACAATTGCCATCCTAATCACTGTGTCCGTCATACTCCTCCCTATCTCCCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-A--CAACTCTCCTAGACAGATGGGCTTCGATCCCACGATAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTGCCT-A-------------AGGCCCCGGCGCATAA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTTATCAACCGATGATTATTCTCAACCAACCACAAAGACATTGGGACCCTATACCTAATTTTCGGCGCGTGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAAGTCTACAACGTAGTTGTCACGGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGGTTCGGGAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGATATGGCATTTCCACGAATAAACAATATAAGCTTCTGACTACTTCCCCCATCCTTCCTACTCCTCCTAGCATCTTCCACAGTTGAAGCAGGCGTAGGAACAGGCTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGAGCTTCAGTCGACCTAGCAATTTTCTCCCTACATCTAGCCGGTATCTCATCAATCCTAGGAGCAATCAACTTCATTACAACAGCGATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACCGCAGTACTATTACTCCTATCCCTTCCAGTTTTAGCCGCAGGAATCACAATACTTCTCACAGACCGCAACCTTAACACCACATTCTTTGACCCCGCTGGAGGAGGAGACCCTGTACTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTCGGGATCATCTCCCACGTCGTAGCTTACTACTCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTAGGCTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGACACCCGAGCATACTTCACATCTGCCACCATGATCATTGCTATCCCAACCGGAATCAAAGTGTTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACTATCGGAGGACTAACAGGAATCGTCTTAGCAAACTCCTCACTAGACATTGCCCTACACGACACCTACTACGTAGTGGCTCACTTCCACTATGTGCTATCCATAGGAGCAGTATTCGCAATCCTGGCAGGCTTCACCCACTGATTCCCCCTATTTACCGGATACACACTTCATTCAACATGGGCTAAAACACACTTCGGCGTAATGTTCGTAGGTGTAAATCTAACATTCTTCCCTCAACATTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTATACTCTATGAAACACCATCTCTTCAGTAGGCTCACTCATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAGGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAGCTAACAAGCACTAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTTGAAGAGCCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACTT---AACATGGCCAACCATTCACAACTTAACTTCCAAGACGCCGCCTCACCTATTATAGAAGAACTGATAGGATTCCACGACCACGCCCTAATAATCGCACTAGCAATTTGTAGCCTCGTACTCTACCTGCTAACCCACACTCTCACAGAAAAACTGACATCAAACACAGTCAACGCACAAGTAATCGAGCTAGTCTGAACCATTCTCCCTGCCCTAGTCCTGGTCACACTTGCCCTACCATCCCTACGAATTCTCTACATAATGGATGAAATCAATGAACCAGATCTAACCCTAAAAGCCATCGGCCACCAATGATACTGAACCTACGAATACACTGACTCCAAAGACCTAACATTCGACTCCTACATAATCCAAACAGCAGACCTGCCCTTAGGCCATTTCCGCCTACTAGAAGTTGACCATCGCGTTGTCGTCCCCATAAACTCAACTATCCGAGTCATCGTTACCGCCGACGACGTCCTCCACTCATGAGCTGTCCCAAGCCTAGGGGTAAAAACCGATGCAATCCCAGGACGCCTCAACCAAACCTCCTTCCTCGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCACTCGCTAACTTCGAAAACTGATCCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGAT--CCCACCCTCCTTAATGATATGCCTCAACTAAATCCCAACCCATGATTTTTTATCATGCTCACCTCATGACTCACTTTTTCCCTAATTATCCAACCTAAAATCCTAACGTTCGTATCAATAAACCCCCCATCCAACAAGC---CACCCGCCGCTCCAAGCACTACTCCCTGAACCTGACCATGAACCTAAGTTTCTTCGACCAATTCTCAAGCCCATCACTCCTAGGAATCCCACTAATCCTTATCGCAATAACATTCCCAGCCCTTCTCCTGCCATCCCTTGACAACCGATGAATCACCAACCGACTCTCAACCCTACAACTCTGATTCATCAACCTAATTACAAAACAACTAATAATACCACTAGACAAAAAAGGTCATAAATGAGCCCTAATCCTAACATCCCTCATAATCTTCCTCCTCCTCATTAACCTCCTGGGCCTGTTACCATACACATTCACCCCAACTACCCAACTATCTATAAACTTAGCCCTAGCCTTCCCCCTATGACTGGCTACACTCCTAACAGGACTGCGAAACCAACCCTCCGCCTCACTGGGCCACCTCCTGCCAGAAGGCACACCCACCCCACTAATCCCAGCCCTCATCCTGATCGAAACGACAAGCCTTCTCATCCGCCCATTAGCACTGGGTGTGCGCCTAACAGCCAACTTAACAGCAGGCCACCTACTAATCCAACTCATTTCTACCGCCACAACATCCCTATTCTCCACAATACCAATAGTCTCACTCCTAACCTTCGCAGTCCTCTTCCTACTGACAATCCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTCTTCGTGCTCCTACTAAGCCTCTACCTTCAAGAAAACATCTAACTT--TA----AATGGCACACCAAGCACATTCTTACCACATAGTTGACCCCAGCCCATGACCCATCCTAGGAGCAGTTGCTGCTTTCCTAACTACCTCAGGACTAACAATATGATTCCACTGAAATTCCCCCAACCTCCTTATCCTAGGCCTACTATCAACCATCCTCGTCATATTCCAATGATGACGCGACATCGTACGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGACTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTTTTCTTCCTGGGGTTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCTACACCAGAACTAGGAGGTCAATGACCACCGGTAGGGATTAAACCCCTCAACCCCATAGAAGTCCCACTCCTAAATACCGCCATCCTCCTAGCTTCAGGAGTCACCGTCACATGAGCTCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTATCCCTAACAGTCCTCCTAGGTTTCTACTTCACCGCCCTACAAGCCATAGAATATTACGAGGCGCCCTTCTCCATCGCCGACGGAATTTACGGCTCAACATTCTTCGTCGCTACCGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTGATCAAATACCACTTCACATCAAACCACCATTTCGGGTTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTTGTATGATTATTCCTCTACATCTCTATTTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTAGCCATGTCACTAACCCTGAGCATCCTCCTAACCATACTAAACTTCTGACTTGCCCAAATAGCCCCAGACTCAGAAAAACTATCCCCATACGAATGCGGATTCGACCCCCTAGGATCTGCCCGACTCCCATTCTCAATCCGCTTCTTCCTAGTAGCCATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTCCCACTACCCTGAGCCACTCAACTACAATCTCCAACCACTACCTTAACCTGAACCACCACACTCATCTTACTACTCACCCTAGGCCTAGTGTACGAATGAACTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCAACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCAGCCTTTGCTCTAAGCAGCCTTGGCCTAGCCTTTCACCGAACCCACCTAATCTCTGCCCTACTATGTTTAGAAAGCATAATACTATCTATATACATCGCCCTAGCCATATGACCCATCCAAATCCAATCATCAGTATCCACTATCCTACCCATCCTCATACTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTAGCACTACTAGTAGCCTCAACCCGCACCCACGGATCCGACCACCTACACAACTTTAACCTCCTACAATGCTAAAAATCATCATCCCAACCACAACACTTCTCCCCCTAGCCCTCCTCTCCCCATGTAAACACCTATGAACTAACATCACACTGTACAGCCTACTAATCGCCACCGCCAGTCTCCAATGACTTACACCCACGTACTACCCAAACAAAGGCCTAACCCCATGAACATCAATCGACCAAATCTCCTCCCCCCTACTAGTCCTCTCATGCTGACTCCTCCCCCTCATAATCATGGCAAGCCAAAACCACCTAGAACAAGAACCCATCAATCGAAAACGAATCTTTGCCTCAACACTAGTCCTAGCCCAACTGTCAATTCTCCTAGCCTTCTCATCCTCCGAACTAATACTCTTTTACATCGCATTCGAAGCCACCCTCATCCCCACTCTAATCCTCATCACACGATGAGGAAGCCAACCAGAACGCCTAAACGCCGGCATTTACCTTCTATTCTACACTCTCATTAGCTCACTCCCACTATTAATTGCCATCCTTCACCTACAAAACCAAATCGGCTCACTCTACCTACCAATACTCAAACTTTCACACCCAACATTAAATTCTTCCTGGTCTAACTTAGCTGCAAGTCTAGCCCTCTTACTAGCCTTCATAGTTAAAGCCCCCCTATACGGCCTACATCTATGACTTCCAAAAGCCCACGTAGAAGCCCCAATTGCCGGCTCCATGCTACTAGCAGCCTTACTACTAAAACTTGGGGGCTACGGTATCATACGAATCACAATCCTGGTAAACCCATCATCAAACAACCTCCACTACCCATTCATCACCCTAGCCCTATGAGGAGCAGTAATAACCAGCGCCATCTGCTTACGTCAAATCGACCTAAAATCACTAATCGCTTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACTCAATGAGCATTCTCAGGGGCAATAATCCTAATAATTTCACACGGCTTAACCTCCTCAATACTATTCTGCCTAGCCAACACCAATTACGAACGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCCCTCCTGCCACTTATAGCCACCTGATGACTACTAGCCAACCTGACAAATATAGCCCTCCCCCCAACAACAAACCTCATAGCAGAACTAACTATCGTAGTAGCACTCTTCAACTGATCTGCCCTAACAATCATCCTAACAGGAACCACCATCCTACTCACTGCCTCCTACACCCTATACATACTAATTATGACACAACGAGGCACCCTTCCATCTCACATCACATCCATCCAAAACTCTTCCACACGAGAGCACCTCCTCATAGCCCTGCACATAATCCCCATAATCTTACTGATCTTCAAACCTGAGCTGATCTCCGGCATCCCCACAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAGCCAACGAGAACTGCTAACTCTCGCATCTGAGTATAA-AACCCCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCATCCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTAACCCTAGCGACCCTTTCCACCCCCATCCTACTTCCACTACTATCCGACAACCTCAAAAACACCCCTAACACAATCACGAACACAGTCAAGACCTCATTCTTAATCAGCCTGATCCCCATAACAATTTTCATCTACTCCGGAACAGAAAACCTCATTTCCCTCTGAGAATGAAAATTCATCATAACCTTCAAAATTCCAATTAGCCTAAAAATAGACTTCTACACACTCACCTTCTTTCCCATCGCACTATTCGTATCATGATCTATCCTACAATTTGCAACATGATACATGGCCTCAGACCCCTACATCACAAAATTCTTCACCTACCTTCTATTCTTCCTAATTGCCATACTCATCTTAATTATCGCCAACAACCTATTTGTCCTATTCATCGGCTGAGAAGGAGTCGGAATTATATCCTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTACAAGCCGTCCTCTACAACCGAATTGGTGACATTGGCCTCATCCTATGTATAGCATGACTAGCCTCCACTACAAACACCTGAGAAATCCAGCAACTCCCCACCCCCTCCCAAACCCCCACATTACCCCTACTAGGCCTCATCCTAGCCGCAACCGGAAAATCCGCCCAATTCGGCCTACACCCATGACTTCCAGCTGCAATAGAAGGACCTACCCCCGTATCCGCCCTACTCCATTCCAGCACAATAGTAGTAGCAGGGATCTTCCTACTCATTCGAACCCATCCCCTATTCAACAATAACCAAACAGCCCTAACCCTATGTCTTTGCCTAGGAGCCATCTCCACCCTATTCGCAGCCACATGCGCCCTAACTCAAAATGACATTAAAAAAATCATTGCTTTCTCTACCTCTAGTCAACTAGGCCTAATAATAGTCACAATCGGATTAAACCTACCCGAATTGGCCTTCCTCCATATCTCCACCCACGCATTCTTCAAAGCCATGCTGTTCCTATGCTCAGGTTCTATCATCCACAGCCTAAATGGTGAACAAGACATTCGAAAAATAGGAGGCCTCCAAAAAACACTTCCCACAACAACCGCATGCCTCACAATCGGCAACCTCGCCTTAATAGGAACACCCTTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCTTAAACACATCCTACCTAAACACCTGAGCCCTAGTCCTAACCCTCCTAGCTACATCATTCACTGCAGTGTACACAATCCGCATAACCGTACTAGTACAAACCGGCTTCGTTCGAATTCCTCCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCCCCCATCACCCGCCTCGCACTAGGAAGCATTCTAGCAGGCTTCCTCATCACCTCATTCATCCTCC---CAACAAAAACCCCTCCAATAACCATACCACTCTACATTAAAGTAACCGCCCTAACTGTAACAGCCCTAGGAATCGCCCTAGCCCTAGAAATTACAAAAATAGCCCAAACACTTATCCTCACAAAACAGACCCCCTTCTCAAACTTTTCAACTTCCCTAGGATACTTCAACCCCCTAACCCACCGCCTAAGCATGACTAACTTCCTCAAAGGTGGACAAAACATCGCTTCCCACTTAATCGACCTATCCTGATACAAAATACTAGGCCCAGAAGGACTAGCTAGCCTACAACTGACAGCAACCAAAACCGCCACCACCCTTCACTCAGGCCTAATCAAAGCCTACCTAGGAGCATTCGCCTTATCTATCCTTATCATCCTGA---TATCCACACTCAGAAA--CAA-T-T---AATGGCCCCAAACATTCGTAAAAACCATCAAATCCTCAAAATCATCAACGACGCCCTAATCGATCTCCCAGCTCCATCAAACATCTCAACATGATGAAACTTCGGATCTCTACTAGGCGTATGCTTAATCACTCAAATCATCACAGGTCTTCTGCTAGCCATACACTACACAGCAGACACTAACCTCGCTTTCTCCTCTGTAGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTACATGCAAACGGAGCTTCCTTCTTCTTCATCTGCATCTACCTACATATCGGCCGAGGCCTCTATTATGGCTCATACCTAAATAAAGAAACCTGAAACATCGGAGTCATTCTCCTACTGACCCTGATAGCAACCGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACCTATTCTCAGCCATCCCATACATCGGACAAACACTAGTCGAATGAGCTTGAGGGGGATTCTCTGTTGACAACCCCACACTAACCCGATTCTTTGCCCTACACTTTCTCCTACCATTCGTTATCGTAGGACTCACCGTCGTCCACCTAACCCTTCTCCATGAAACAGGATCAAACAACCCACTAGGCATCCCATCAGACTGCGACAAAATCCCCTTCCACCCATACTACACCATCAAAGACATCCTAGGATTTGTCCTAATACTTTCTCTGCTCGTCTCACTAGCCCTATTCTCCCCCAACCTTCTAGGAGACCCAGAAAACTTCACCCCAGCTAACCCACTAGTCACTCCTCCACATATCAAACCCGAATGATACTTCCTATTTGCCTACGCCATCTTACGATCCATCCCAAATAAACTAGGAGGCGTTCTAGCCCTAGCCGCCTCAATCCTAGTCCTATTCCTCGTCCCACTTCTACACACATCAAAACTACGATCAATAACCTTCCGTCCTCTATCACAAATCCTATTTTGAGCCCTAGTCGCCAACATCCTAATCCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATCGGTCAACTAGCCTCGCTCTCATACTTCACAATTATCCTAATCCTATTCCCCCTCGCGGCCGCCCTGGAGAATAAAATACTGAAACT----------CTA-ATA-----------TACTCTAATAGTTTATG-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Cnemotriccus_fuscatus_NC_007975 GTCCCTGTAGCTTATAATAAAGCATAACACTGAAGATGTTAAGATGGCTGC--CCTA-TACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACCGTTAGTTCTTGCTATATATATACATGCAAGTATCCGCATTCCAGTG-AAAATGCCCTCAACA-TCT---TACC-------AAGATAACAGGAGCAGGCATCAGGCTCACCCCTCCTCCCT-----CCGTAGCCCAAGACGCCTTGC-CTAGCCACACCCCCACGGGTATTCAGCAGTAATTGACATTAAGCAATAAGTGTAAACTTGACTTAGTTAAAGCAATCC---TTAGGGTTGGTAAATCTTGTGCCAGCCACCGCGGTCATACAAGAAACCCAAATTAACCTTA-------CACGGCGTAAAGAGTGGTTCT-TCATTAT-CAACTCAACTAAGATTGAAATGCAACCAAGCTGTTATAAGCATAAGATGC-ACCTAACGTCTCC--TATTAAA-ACGATCTTAGCCA--CCTGACTGATAAAACTCCACGAAAGCTAGGACACAAACTGGGATTAGATACCCCACTATGCCTTGCCCTAAATCTTGATGTTCT----TCCTACCCAAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCTCCAAACCCTCCTAGAGGAGCCTGTTCTATAATCGATAATCCACGATA-CACCTAACCATCTCTCGC-CAT--AT--CAGCCTATATACCGCCGTCGCCAGCTCACCCTCATCCTGAAGGCCTAACAGTGAGCACAATAGCCCTCTCCCCCGCTAACAAGACAGGTCAAGGTATAGCTTATGAGATG----------------------GA-AGAAATGGGCTACATTTTCTAATATAGAAAACC---CCACGACAA-GGAATGTGAAACCATCCCTAAAAGGCGGA-TTTAGTAGT-AAAGCAGGATAATCATGCCTTCTTTAACCTGGCCCTGGAGCACGTACATACCGCCCGTCACCCTCCTCAAAAGCTG-------CCACCACCCAC-AATTCATAAAATACCCCCAAGCTAAAGACGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGTCTA-CCAAGACGTAGC-TATAATG-AAAGCATTCAGCTTACACCTGAAAGATATCTGCTCCATA-CAGGTCGTCTTGA-AGCCTA-CTCTAGCCC--------ACCCTTCCACTA------ACATGAA-CTAGC--AA---CCCT---------CACCTCAAAAAGTAAAACATT---T-GCTTTAT-CCTAGTATAGGTGATAGAAAGGTACCTCA--AGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAATAATG-AAA--ATC--CAAGCAC-CAAGTAGCAAAGACCAACTCTTGTACCTTTTGCATCATGATTTAGCAAGAACTAACCAAGCAAAATGCTAATTTAAGCTTGCCCCCCCGAAACCCGCGCGAGCTACTCACGAGCAGCTA--TATTGAGCAAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTCGTTAGTAGAGGTGAAAAGCCAAC-CGAGCCAGGTGATAGCTGGTTGCCTATGAAACGAATCTTAGTTCACCCTCAATTCTTCTCTAAGG--ACCATATCATAACCCAC--ACGAAGC---AAATCGAGGGCTACTTAAAGGAGGTACAGCTCCTTTAAAAAGGA-TACACTCTTCC-CTAGCGGATA---------AGCATCCCC--ATAAT-CTAACTGTGGGCCTTAAAGCAGCCACCACCAAAGAATGCGTCAAAGCTCGAC--CATTAAAAATTCAAA-TGCCCCACGACTCCCT-TATCCCCAATAGGCTAACTTATACT--AATAAGAGAATTTATGCTAAAATGAGTAACTAAGGGTT-----CCCCTCT----ATGGCGCAAGCTTACATCTTTA-CATTATTAACAAA--CCTCA-AGATACTTA-CTAAC---------CCA---ACAAGACTCAG-TATCA-TTTAGC-TTGTTAACCCACCCAC-GGAGCG-CCTCA-AAGAAAGATTAAAATCTGTAAAAGGAACTAGGCAAACAT---AAGGCCCGACTGTTT-ACCAAAAACATAGCCTCCAGCAATC-------CAAGTATTGGAGGTGAAGCCTGCCCAGTG--ACAACAA----GTTCAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACATGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGATAATCAGTGAAATTGATCTTCCTGTGCAAAAGCAGGAATCATAACATAAGACAAGAAGACCCTGTGGAACTTCAAAATCAACAGCCATT--CCCACA-CACCAT----TC-CCCCTATTCAT--GGACCACTCCC-----CGGGATCTTACTGGCC-TGTA-TTTTTTGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AGATTAGACCATCCCTCTATACCA-AGAACAACCTATCTACGTGCTAACAGTATCCAGACCCAATAC--CATTGATTAATGAACCTAGCTACCCCAGGGATAACAGCGCAATCTCCCCCAAGAGCCCCAATCGACAGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGTAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATA-AACTCCTTCCAGTACGAAAGGACAGAAA-GAGTAAGGCCAATACTACAA-GCACGCCTTC-GCCCAAAGATATGAACTCAACTTAATTTCTTAGGGCCAAATC-CCTCC---------CCTCCTAAAAAAGGA----CTGCTAGCGTGGCAGAGCTCG--GCAAATGCAGAAGGCTTAAGCCCTTTA-CCCAGAGGTTCAAATCCTCTCCCTAGC------TGTCT----------GCTAACTAC----ATGAC----------CACCCACCCCAACTTAACCCACCTCATTATATCACTATCCTATGCCGTACCCATCCTAATTGCTGTAGCCTTCCTAACCCTAGTCGAACGCAAAATCCTAAGCTACATACAAACGCGCAAAGGCCCCAACATTGTAGGTCCATTTGGCCTCCTACAACCCATAGCAGACGGAGTAAAGCTTTTCATTAAAGAACCAATTCGTC---------CATCCACCTCCTCCCCTTACTTATTTATCGCCACCCCAATACTAGCCCTTCTTCTAGCAATTACAATCTGAACCCCACTTCCACTCCCCTTCCCTCTTACAGACATAAACCTTGGTATGCTCTTTCTCCTTGCATTATCCAGTCTTATGGTCTACTCAATTTTATGGTCAGGATGGGCCTCGAACTCAAAATATGCACTTATTGGTGCCCTACGAGCAGTTGCACAGACAATTTCCTACGAAGTTACATTAGCCATTATCCTCCTATCCATAATCATCCTCAGTGGAAACTATACCCTTAACACTCTCGCCACAACCCAAGAACCAATATATCTCATTTTCTCTTCCTGACCACTGGCAATAATATGATATATCTCCACTCTTGCAGAAACAAACCGTGCCCCATTTGATCTCACAGAAGGTGAATCTGAATTAGTCTCAGGATTTAACGTAGAATACGCCGCAGGACCATTCGCCCTATTTTTCCTAGCCGAATATGCTAACATCATATTAATAAACACACTCACCACTATTCTATTCTTAAACCCAAGTTCATTTAACACCTCCCAAGAACTTTACCCCCTATTCCTGGCTACAAAAACCCTCCTTCTATCCGCAGGGTTTCTATGAATCCGCGCCTCCTATCCTCGATTCCGCTATGATCAGCTTATGCACTTACTCTGAAAAAATTTCCTACCCCTAACACTAGCACTATGCCTATGGCATATTAGCCTTCCAATTTCATACGCAGGCCTACCA-----CCCTATCTA-A--GACA------------TTCAAGGAAATGTGCCTGAAACTCA--AAGGGTCACTATGATAAGGTGAACATAGAGGTGCACCAACCCTCTCATTTCCT----AGAC-------TTAGAAAAGTAGGAATCGAACCTACACAGAAGGAATCAAAATCCTTCATACTTCCTTTATATTATTTCCT----------------AGTAAGGTCAGCTAACTAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAATTCCTTCCCTTACTA-ATGAACCCCCAGGCTAAACTCATTTTCTCCACAAGCTTACTCTTAGGGACAACAATCACAATTTCAAGCAACCATTGAATAA---TAGCATGAACTGGGCTTGAAATTAACACTCTAGCTATCCTCCCTCTAATCTCAAAATCCCACCATCCACGAGCTATTGAAGCCTCAACTAAATATTTCTTAACCCAAGCGACTGCCTCCACATTATTACTATTCTCTAGTATAACTAACGCGTGATTTACTGGCCAATGAGACATTACTCAACTTACTCACTCAATATCGTGCACGCTACTAACAACTGCAATCTCAATAAAACTGGGTTTGGTACCATTCCACTTCTGATTTCCGGAAGTCCTACAAGGTTCTTCCCTAATAACAAGCTTACTGCTAGCTACAATCATAAAACTTCCCCCCACCATTCTACTCCTTCTAACGTCCCCCTCACTCAACCCCACCTTACTGCTCACAATAGCAATTGCTTCAGCAGCTTTAGGGGGGTGAATAGGTCTTAACCAAACTCAAGTCCGTAAAATTATAGCCTTCTCATCTATCTCCCACCTGGGCTGAATAATTATTATCCTCATCTACAACCCCAAACTTACGTTAATCGCTTTTTACCTCTATTCTCTAACAACAGCCGCCATTTTCTTTACTCTTGACACTACCAACACCTTTAAACTATCAACCTTGATAACTGCATGATCTAAGATCCCCACACTCACTGCAACTCTTATGCTTGCTCTTCTATCCCTTGCTGGCCTTCCCCCACTAACTGGATTTCTCCCCAAATGACTGATTATCCAGGAACTGACTAAGCAAGGACTTACAACCACAGCAACTATGATTGCCCTACTATCCCTTCTAGGTCTTTTCTTCTATCTTCGCCTTGCCTACTGTGCAACAATCACCCTCCCTCCAAACTCTATTAACCATATGAAACAATGGCAAATCAACAAGTCTGTTAATACGCTTACTTCTACTCTTATCACACTATCAATCATACTTCTACCTATGACACCTACAATTCTTACCATTAC------AT-----AGAAACTTA-----GGTTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGCCATCCTCTCTTAGTTTCTGTTAAAACCCGCAGGACACTAACCTGCATCCTCTGAATGCAACTCAGATACTTTAA-TTAAGCTAGGATTTT-----------CCTAGACAGATGGGCTTCGATCCCATAACAC-TCTAATTAACAGTTAGATGCCATAACC-TATAGGCTTCTGTCT-ACT-----------AAGCCCTGGCGTATGC-CTAATACGCATCTCTGAGTTTGCAACTCAGCATGAAATTCACTACAGAGCT---GATAAGAAGAGGAATTAAACCTCTGTCAAAAGGACTACAGCCTAACGCTT-TAACACTCAGCCATC--------------TTACCTATGACTTTCATCAACCGATGACTATTTTCAACCAATCATAAAGACATTGGTACATTATATCTAATCTTCGGCGCCTGAGCCGGCATGATCGGCACCGCTCTAAGTCTCCTTATTCGAGCAGAACTAGGTCAACCAGGGACTCTTCTGGGAGATGACCAGATTTATAATGTCATTGTTACTGCTCATGCCTTTGTAATAATCTTCTTTATAGTAATACCCATCATAATCGGAGGTTTCGGCAACTGATTAGTCCCCCTAATAATTGGTGCTCCTGACATAGCATTTCCTCGTATAAACAACATAAGCTTCTGACTACTTCCACCCTCATTCCTCCTCCTCCTAGCCTCCTCTACAGTTGAAGCCGGAGTAGGGACCGGATGAACTGTTTACCCACCATTAGCTGGAAATCTAGCACATGCCGGAGCTTCAGTAGACCTAGCCATCTTTTCTCTACACCTAGCAGGTGTTTCTTCAATCCTAGGAGCTATCAACTTCATTACTACAGCAATTAACATAAAACCACCAGCTCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTCTTAATCACCGCAGTACTTCTTTTACTTTCTCTACCAGTACTCGCTGCTGGCATCACTATGCTATTAACAGACCGCAACCTTAACACTACATTCTTTGATCCTGCAGGAGGTGGAGACCCAGTCTTATATCAACATCTTTTCTGATTCTTTGGTCATCCAGAAGTCTACATTCTCATCTTACCCGGATTCGGTATTATCTCTCATGTAGTTGCATACTATGCTGGTAAAAAAGAACCGTTTGGCTACATAGGAATAGTCTGAGCCATGCTATCCATTGGGTTCTTAGGTTTTATCGTGTGAGCTCATCACATATTTACAGTTGGAATAGACGTAGACACCCGAGCATACTTCACATCCGCTACAATAATTATTGCAATCCCCACTGGTATCAAAGTGTTTAGCTGATTAGCCACCCTACATGGAGGAACTATCAAATGAGATCCACCCATATTATGAGCCTTAGGGTTCATCTTCCTGTTTACCATTGGGGGACTTACAGGTATTGTCTTGGCCAATTCCTCCCTAGATATCGCCCTTCATGACACTTACTATGTAGTTGCTCATTTCCACTACGTGCTATCCATAGGGGCTGTATTCGCAATCTTAGCAGGCTTTACACACTGGTTCCCTCTCTTTACAGGATATACCCTCCATCCCACATGAGCCAAAGCTCACTTTGGAGTAATATTTACAGGAGTAAACTTAACTTTCTTTCCTCAACACTTCCTAGGCCTAGCTGGTATACCACGACGATACTCAGATTACCCAGACGCCTATACTCTATGAAACACCTTATCCTCTATCGGCTCTCTCATCTCTATAACTGCCGTAATTATACTTATATTCATCATCTGGGAAGCCTTCGCATCTAAACGAAAAGTCATACAACCCGAACTTACCATAACCAATATCGAATGAATTCACGGCTGCCCTCCTCCATACCACACCTTTGAAGAGCCAGCCTTTGTCCAAATT------CAAGAAAGGAAGGAATCGAACCCTCATAAGCTGGTTTCAAGCCAACCGC--AT-TAAACCACTCATGCTTCTTTCTT---AT----GGGCTGTTAGT-AAAACA-ATTACATAG-TCTTGTCAAGACTAAATCACAGGTGAAAACCCAGTACATCCCAT---CACCT--TCCCATGGCCAACCACTCCCAACTCGGTTTCCAAGACGCCTCTTCCCCTATCATAGAAGAATTAATCGAATTTCACGATCACGCTTTAATAGTTGCTCTAGCAATCTGCAGCCTAGTTCTCTACCTTCTAACCCTCATACTCATAGAAAAACTTTCATCCAATACCGTCGACGCACAGGAAGTAGAATTAGTTTGAACTATCCTGCCCGCAATTGTCTTAATTATACTAGCACTTCCTTCATTACAAATTCTTTACATAATAGATGAAATTGACGAACCTGATCTCACGCTCAAAGCTATCGGTCACCAATGGTACTGAACCTACGAGTATACAGACTTTAAAGACCTATCTTTTGACTCCTACATGATACCAACAACAGAACTCCCATCAGGCCACTTCCGACTACTAGAAGTTGACCACCGTATTGTTGTTCCTATAGAATCCCCTATCCGAGTTATTGTTACAGCTGATGATGTTCTACACTCCTGAGCTATCCCCAGCCTCGGTGTAAAAACTGATGCAATCCCAGGACGACTTAATCAAACTTCCTTTATTACCTCCCGACCTGGAATTTTCTACGGCCAGTGCTCAGAAATCTGTGGAGCTAACCATAGCTTCATGCCCATTGTAATTGAATCAGCTCCCCTAACCCACTTTGAAAGCTGATCTTCACTTC---TCTCATCAT----------AAACATTAAGAAGCTATGGATCAGCACTAGCCTTTTAAGCTAGAGAAAGAGGATTTCCCAACCCTCCTTAATGACATGCCTCAACTCAACCCAACGCCATGATTCTCAATCATAGTAACTTCTTGATTCATCTTTTCTTTTATTCTCCAACCCAAAATCTCACAATTCACCTCAACAAATCAACCTTCTAATAAAA---CCTTCTCTGCTACAAAAGCCCCCTCTTGAAACTGACCATGAACCTAAGCTTCTTCGACCAATTTATAAGCCCCTCCCTACTAGGAATCCCATTAATCCTCATCTCACTTCTACTCCCAATACTTCTATATCCCTCTCCAAACAACCGATGAATTACAAACCGCGTTTCCACCCTCCAACTCTGATTCTTTCAACTAATCACAAAACAACTTATAACCCCACTGAACAAGAAAGGACATAAGTGAGCCTTAATTTTACTCTCACTTATAATCCTCTTACTAACAATTAATCTCCTAGGCTTACTACCTTACACATTTACCCCTACCACTCAGCTATCTATAAACCTGGCCCTGGCTTTCCCACTATGACTCGCTACCCTACTTACAGGGCTACGAAACCAACCTTCAGCCACTCTAGGCCACCTTTTACCAGAAGGTACCCCTACACCCCTAATTCCTGCTCTCATCCTAATCGAAACTACTAGCCTACTTATCCGTCCCCTGGCATTAGGAGTTCGTCTCACGGCTAACCTTACAGCTGGACATTTACTCATCCAACTCATTTCAACTGCCACTACAGTCCTTCTGCCTATTATACCAGCAGTATCCATACTCACCACAACTATTCTCCTCCTACTTACTCTCCTAGAAGTAGCAGTTGCTATAATTCAGGCATACGTATTCGTTCTCTTACTAAGCCTTTATCTCCAAGAAAACATCTAAACC------CTAATGACCCACCAAGCACACTCATTTCACATAGTAGATCCAAGCCCCTGACCTATTTTCGGAGCAGCAGCCGCCCTCCTCACCACCTCCGGACTGACTATATGGTTCCATCATAACTCCGCTCAATTACTAGTTTTAGGCTTGCTGTCAATAATCCTCGTTATAGTCCAATGATGGCGCGATATCGTACGGGAAAGCACATTCCAAGGTCATCACACCCCTACTGTACAAAAAGGCCTACGTTACGGTATAATTCTTTTCATTACATCAGAAGCTTTCTTTTTCCTAGGCTTTTTCTGAGCATTTTTCCATTCGAGTCTAGTCCCAACCCCAGAGCTAGGAGGTCAATGACCCCCTATAGGAATCAAACCTCTCAACCCAATAGAAGTCCCTCTGCTAAATACAGCAATCCTACTTGCATCCGGCGTCACTGTCACATGAGCGCACCACAGTATCACGGAAGGCAATCGAACCCAAGCTACCCAAGCTCTATTCATAACCATTTTATTAGGATTCTACTTCACAGCCCTACAGGCAATAGAATACTATGAAGCTCCATTTTCAATCGCTGATGGGGTCTATGGCTCAACATTCTTTGTAGCCACAGGATTTCATGGCCTTCATGTAATCATCGGCTCTTCTTTCCTACTGATCTGTTTCCTTCGTCTAATCAAATTCCACTTTACATCTAATCATCACTTTGGCTTCGAAGCAGCAGCCTGATACTGACATTTCGTTGACGTCATCTGACTATTCCTCTATATAACTATCTACTGATGAGGATCCTGCTCTTCTAGTATAATA-ATTACAATTGACTTCCAATCTTTAAAATCTGGATCAAAACCAGAGAAGAGCAATT---AACACAATCCTTTTTATATTTATTTTATCCTCCTCACTAAGCATAATCCTAACTATACTGAACCTATGGCTAGCACAAACCAACCCAGATTCAGAAAAACTATCCCCCTACGAATGTGGATTCGACCCCCTAGGTTCCGCCCGACTCCCATTCTCAATCCGATTCTTTCTAGTTGCAATTTTATTCCTCCTCTTTGATCTAGAAATTGCCCTGCTCTTACCTCTTCCCTGAGCTACTCAACTTCAATCTCCCCTTACAACCCTAACATTAACATCTAGCATCCTCATCCTCCTTACACTAGGACTAGTTTATGAATGAATCCAAGGAGGTCTAGAATGAGCAGAATA-ACTA---CAGAAAGTTAGTCTAATAAAGACAGTTGATTTCGACTCAACAAATCACAG-TCCCATCCTGTGACCTTCTTCATGACCTTCTTACATTTAACCTTCTATTCTGCCTTTGCTCTAAGCAGCCTAGGACTAGCCTTTCACCGTACACACCTAATCTCAGCCTTACTATGCTTGGAAAGCATAATACTATCTATATATATTGCTCTATGCTTATGACCAATCCATACACAAACAACTTCCTGCACCTTAATACCCATCCTAATACTAGCATTCTCAGCCTGTGAAGCAGGCACCGGCCTTGCAATCCTGGTAGCCTCAACCCGAACCCACGGATCCGATCATCTTCACAACCTCAACCTACTACAATGCTAAAAATTATTCTCCCCACAATCATACTACTCCCAACAGCCCTTTTATCCCCCTCAAAATATTTATGAGTTAATGTTACCTCCCACAGCTTTCTAATTGCAACTGCCAGCCTTCATTGACTTTCCCCAACCTATTACACTGACAAAAATTTATCTCAATGACTTGGAGTTGACCAAATCTCATCCCCCCTACTAGTCCTATCTTGCTGACTTCTTCCCCTCATAGTCTTAGCTACCCAAAGTCACCTCCAACAAGAACCATCCACACGAAAACACATCTTTATCCTAACCATAATTCTCACCCAACCTTTCATTCTACTAGCATTCTCAGCTTTAGAATTGATACTATTTTACATTGCATTCGAAGCCACCTTAATTCCCACCCTAATTCTAGTCACACGATGGGGAAGCCAACCAGAACGCTTAAGTGCCGGCATTTACCTACTATTCTATACACTCATTAGCTCTATACCCTTATTAATTGTCATCCTTCACCTCCATACTCAAACAGGCACTATACACCTTGCTATAATAAAACTTACCCATCCATTCCTTGCCCATACATGAGCAGGAGCTATCTCCAGCCTAGCTTTACTACTTGCCTTCATAGTAAAAGCCCCCCTCTACGGATTGCACTTATGACTCCCAAAAGCACACGTAGAAGCTCCAATTGCAGGCTCCATACTTCTAGCTGCCCTCCTACTAAAACTTGGAGGATACGGCATCATACGAGTCTCCATAATTACAAACCCCATCCTCAACCATCTGCACTACCCATTTCTAACCCTAGCCCTATGAGGAGCACTAATAACAAGCTCCATCTGCCTACGCCAAATTGATTTAAAATCTATAATCGCATATTCCTCCGTAAGCCATATAGGCTTAGTTATCGCTGCAATCATAATCCAAACCCACTGATCATTTTCAGGTGCTATAATCTTAATAATCTCTCACGGCCTTACATCCTCTATACTATTCTGTCTAGCCAATACAAACTACGAACGAACCCATAGCCGAATCCTATTTCTAACACGAGGCTTACAACCTCTCCTCCCACTAATAGGAATCTGATGACTTTTAGCAAGCCTCACAAATATAGCACTTCCACCCACAACCAACCTCATAGCCGAGCTTACTATCATAATTGCTCTCTTTAACTGATCTACCTTTACTATCATCCTAACTGGAATTGCAACCTTACTAACCGCATTATATACTTTATATATACTACTATCAACTCAACGAGGCCCTATTCCCACCTACATTACATCTATCCAAAACTCAAACACTCGAGAACACTTACTAATGGCTCTCCACATTTTACCTACACTCCTACTCATCTTAAAACCAGAGCTTATCTCAACAATCCCCTCAT-GCAAGCATAGTTT-CAA-TCCAAACATTAGACTGTGATCCTAAAAATAGAAGTTAAAACCTTCTTGCCTGCCGAGGAG-AGGTT-TGACCAACAAGAACTGCTAACTCTTGCATCTGAGTTTAA-ATCCTCAGTCTCCTT--ACTTTTAAAGGATAGTAGTAATCCACTGGTCTTAGGAGCCATTTACCTTGGTGCAAGTCCAAGTAAAAGT--AGTGGATCTCCCATTAATCCTGAACTCCTCTATACTCCTCACCCTCCTAATCCTACTTACCCCGATCTTTATACCCTTATTAATTAAAAACTACCAAAACTCCCCAGCCAGTATCACATTAACTGTTAAAACCTCCTTTATCACCAGCTTAGTTCCCATAACCCTTTTTATGTACCTGAATATTGAAAGCATTACCCTCTGCTGAGAATGAAAATTCATCACAAGTTTTAAAATTCCCCTAAGCTTCAAGATAGACCACTACTCCCTAATATTTTTTCCCATTGCATTATTTGTAACCTGATCAATCCTCCAATTTGCATCATGATATATAGCCTCAGAACCTTTCATCACAAAATTTTTCTTTTATCTTCTAACCTTCCTTATTGCTATACTTATTCTCATCATTGCCAACAACATATTTCTTCTATTCATTGGATGAGAAGGAGTCGGAATTATATCTTTCCTCCTCATTGGATGATGACACGGACGAGCAGAAGCCAACACAGCTGCCCTTCAAGCCGTTCTTTACAATCGCATTGGAGACATTGGCCTAATCCTCTCAATGGCTTGACTCGCCTCCTCCATAAACACTTGAGAAATTCAACAACTATCACTCCAAAACCAAATTCCATTACTTCCTCTCCTAGGCCTTATCCTCGCAGCCACAGGAAAATCCGCCCAGTTTGGCCTACACCCATGACTTCCAGCTGCCATAGAAGGCCCTACCCCTGTGTCTGCATTACTCCACTCCAGTACCATAGTTGTAGCAGGAATCTTCCTACTTATCCGCACTCACCCCCTACTCTGCAATAGCCAGATAGCTCTTACTCTTTGTCTCTGCCTAGGAGCTCTATCCACACTATTTGCCGCTACATGCGCTCTTACCCAGAACGACATCAAAAAAATTATTGCTTTCTCTACATCAAGTCAATTAGGCCTAATAATAGTAACAATCGGCCTAAACCTCCCACAACTAGCATTCCTACACATTTCAACCCATGCATTCTTTAAAGCAATACTTTTCTTATGCTCTGGGTCAATCATTCACAGTCTCAATGGCGAACAAGACATTCGAAAAATAGGAGGAATACAAAAATTGCTCCCTACAACAACATCATGCCTAACTATTGGTAATCTTGCCCTTATAGGAACCCCCTTCCTAGCAGGATTCTACTCAAAAGACCTTATCATCGAAAATCTAAACACTTCCTACCTCAACACCTGAGCACTCCTCCTAACACTCCTAGCTACATCCTTCACTGCAACCTATAGCATACGCATATCCTTACTAGTCCAAACTAACTTCATCCGAATCCCCCCTTATACCCCTATCAACGAAAATCACCCAGCAGTCACAAACTCAATCACCCGCCTTGCCCTTGGAAGCATCCTAGCTGGTTTACTAATCACCTCCTTCATCATCC---CTACAAAAACTCCACCAATAACCATACCCCTTACCACAAAAACTACAGCTATAATCATTTCTATATTAGGAATCATAATCGCACTAGAACTATCAAAACTCACCCATACTTTCATCAACCCTAAACAAAACGCTTTCACCAACTTCTCTGCTACCCTAGGATATTTTAATCCTCTAATACACCGCTTAACCTCAACCAAACTCCTAAGCAATGGACAAAAAATTGCATCACATCTAATCGACCTATTTTGATACAAAAAAGCAGGACCAGAAGGACTCGCAACTCTCCAACTCAAAGCTACTAAAGCCTCAACTACATTCCACACCGGTCTAATTAAAACATACCTAGGATCCTTTGCCCTATCCATTCTTATCATTATCC---TATCTATGTACAGAAC--CAA-C-CATCAATGGCACCCAACCTACGAAAACAACATCCACTCCTAAAGATAGTAAACAACTCCCTTATTGACCTCCCCACGCCATCAAATATTTCAGCCTGATGAAACTTTGGCTCCCTCCTAGGAATCTGCCTAATAACACAAATCATCACCGGTCTTCTTCTAGCAATACACTATACCGCAGACACCTCTCTGGCCTTCACATCAGTTGCCCATACATGCCGAAACGTTCAATTCGGATGACTTATCCGAAACCTCCATGCAAATGGGGCATCCTTCTTCTTCATTTGTATCTACCTACATATTGGACGAGGATTTTACTACGGATCTTACTTATATAAAGAAACCTGAAACACAGGCATCATCTTACTCCTAACTCTAATAGCTACTGCTTTCGTTGGCTATGTATTACCATGAGGCCAAATATCATTCTGAGGTGCTACAGTTATCACTAACTTATTTTCAGCAATCCCTTACATCGGCCAAACACTCGTAGAATGGGCATGAGGCGGATTCTCAGTTGACAACCCCACCCTCACTCGATTCTTTGCTCTCCACTTCCTCCTTCCATTTGCCATTGCAGGTCTAACTCTAATCCATCTAACCTTCCTCCATGAAACAGGATCAAACAACCCCCTAGGAATCTCCTCAAACTGTGATAAAATTCCATTCCACCCCTACTTCTCTACAAAAGACATTCTAGGTTTTACCATCCTCCTTCTCCCTCTAATAACTCTAGCTTTATTCTCCCCTAACCTCCTAGGTGACCCCGAAAATTTCACGCCCGCCAACCCACTAGTAACTCCACCCCACATTAAACCAGAATGGTACTTCCTCTTTGCTTACGCTATCCTACGTTCTATCCCAAATAAACTCGGCGGAGTTCTAGCTCTCGCCGCCTCTGTCTTAGTACTATTCCTAGTCCCATTCCTCCACATATCAAAACAACGCACAATAACCTTCCGCCCTCTCTCCCAGTTCTTATTCTGAACTCTAGTAGCTAATCTCCTTATCCTCACATGAATTGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCATTTACCTACTTCTCTATCCTTCTTATTCTATTCCCCACCATCGAAATCCTAGAGAACAAACTACTAAAACT----------CTA-ACT------------ACTCTAATAGTTTATAAAAAACATTGGTCTTGTAAACCAAAAACTGAAGGCTTTTCCCCTTCTTAGAGTT Coccothraustes_coccothraustes GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGATGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCCCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----TGGTAGATAGGAGCTGGTATCAGGCTCA--C------CAT-A--ACTGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTACTCAGCAGTAATTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGC-AA-T---TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGATAT-CCAAGTAGCTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-CCCTTAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCTAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTAACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGTCCACCTCCC--CTGAAAGCCCAACAGTGGACGCAATAG-CCCAA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GGAAGCAATGGGCTACATTTTCTAAGATAGAACA-T-----ACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCTGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG-CCCCCCCCCC-----ATAAATTAATAAGCCAT-CT--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAGTA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--GC-CCA-CACTC----AACCAAAGCATT---C--ACTAGT-CCTAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGTAGTG-AAACAATC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTTAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAAAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ACTAAC-AT-TCCAAT-TATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCTA-AAAAATACAAG-AACCTTATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAAATAGGAGAATCAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCATA-CATTATTAACAAA-TTACCA-ATATACGA--ACAAT---------CAA---ACAAGCA-GAG-TATTA-GACATT-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTCAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCGATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTCAAAACCAGCAACCACC--TTATAA-CACATC----CC-TACCCA--C-C-GGGTTCACTGAC-ACA-TAA-GA-TGATTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAGCCTCCAA-AAATTAGACCATAACTCTAAACTG-AGAGCAACTCCTCAACGTGCTAATAGTACCCAGACCCAATAT--AATTGACCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCATATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AGCTCTTCCCAGTACGAAAGGATAGGAA-AAGCAAGGCCAATACTACAA-GCAAGCCTTC-GCCCTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAAACCCAAA-----CCAGCC--C----ATGCT----------CAAATCTCCCCTCATAATTAACCTCATCATAACTCTCTCCTATGCACTTCCAATCCTAATCGCAGTAGCCTTCCTCACGCTAGTAGAGCGAAAGATCCTAAGCTACATGCAAAGCCGAAAAGGCCCTAACATTGTCGGGCCATTCGGACTTCTACAGCCCTTAGCTGACGGAGTAAAGCTATTCATTAAAGAACCCATTCGAC---------CCTCAACATCCTCCCCAATCCTATTTCTAACAACCCCAATATTAGCCTTACTCCTAGCAATCTCAATCTGAACCCCACTGCCCTTGCCCTTCTCATTAGCAGACCTCAACCTAGGATTACTATTTCTACTAGCCATATCAAGCCTAGCTGTGTACTCCATCCTATGATCGGGCTGGGCCTCTAACTCAAAATATGCACTCATTGGTGCACTACGAGCAGTAGCCCAAACAATTTCATATGAAGTAACCCTAGCAATTATCCTTCTCTCTGTTGTCCTCCTTAGCGGAAACTACACCCTTAATACCCTAGCAGTCACCCAAGAACCTCTATACCTCGTATTCTCATGCTGACCCCTAGCCATGATATGGTATGTCTCCACACTTGCCGAAACTAATCGCGCCCCATTTGATCTCACGGAAGGAGAGTCTGAACTAGTATCTGGATTTAATGTAGAATACGCAGCAGGCCCATTCGCACTATTCTTCCTAGCCGAATACGCTAATATTATGCTTATAAACACTATCACCACAATCCTATTCTTCAACCCAAGCTTCCTTAACCCTCCTCAAGAATTATTCCCTGTCGTACTGGCTACAAAAGTCCTCTTGTTATCGACTGGGTTCCTATGGATTCGTGCCTCCTACCCCCGATTCCGATACGACCAGCTAATGCACTTACTATGAAAAAACTTCCTACCACTTACACTAGCCCTCTGCTTCTGACACATCAGCATGCCAATCTGCTACGCGGGCCTACCC-----CCATACCTA-A--GAA-------------TCTACGGAAATGTGCCTGAACAT-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-G--GCCC-------TTAGAAAAGCGGGAATCGAACCCACACTAGAGGAATCAAAACCCTCCATACTTCCCTTATATTACTTTCT----------------AGCAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCGACTCCTTCCCCTGCTA-ATGAACCCCCAGGCAAAACTAATTTTCATCTCCAGCCTACTTCTAGGGACAACTATCACAATCTCAAGCAACCACTGAATCA---TAGCCTGAGCCGGTCTAGAAATCAACACACTTGCTATTCTCCCACTAATCTCAAAATCTCACCACCCACGGGCTATTGAAGCCGCCACCAAATATTTCCTGACTCAAGCAGCTGCTTCAGCCCTAGTCTTATTCTCTAGCATGACTAATGCCTGACATACCGGACAATGAGACATTACCCAGCTATCACACCCTACGTCCAGCCTAATCCTAACCTCAGCAATCTCAATAAAACTAGGACTAGTCCCCTTCCATTTCTGATTCCCAGAAGTCCTTCAAGGCTCACCGCTACTCACCGGTCTACTACTATCCACTATCATAAAACTCCCCCCAATCACACTCCTATACATAACCTCTCCTTCACTAAACCCAACACTCCTAACTACCCTAGCCATTCTCTCCACAGCTATCGGTGGATGAATAGGTCTTAACCAAACTCAAATCCGAAAAATCTTAGCTTTCTCCTCTATCTCTCACCTAGGCTGAATAGCAATCATCATCGTCTACAACCCAAAACTCACCCTTCTAAACTTCTACCTATATACCATAATAACTGCAGCTATTTTCCTCACCCTAAACTCAATCAAAGTACTAAAGCTATCCTCCCTAATAACCGCATGAACCAAAGTCCCCTCAATAAACGCAATACTACTTCTAACCTTATTATCCCTTGCGGGTCTACCTCCCCTAACAGGATTCCTACCTAAATGACTAATCATCCAAGAGCTAACTAAACAAGAAATAGCCACCGCAGCCACACTAATATCCCTACTCTCCCTGCTAAGCTTATTCTTCTACCTTCGCCTCGCATATTGCACAACAATCACACTCCCCCCACACACCACAAACCACATAAAACAATGACGCACTAGCAAACCAACCAGCGTCTCAATCGCCATCTTAACCACAATATCTGTCATCCTACTCCCGATCTCCCCCATAATCCTGACCGTTGT------GT----AAGAAACTTAG----GATTACCT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGATACTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-T--CAA-CTTACTAGACAGATGGGCTTCGATCCCATAACTC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACATAA-TCAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTAAACCTCTGTGAAAAGGACTACAGCCTAACGCTT-TTACACTCAGCCATC--------------TTACCTGTGACTTTCATTAACCGATGATTATTCTCAACTAACCACAAAGACATCGGGACCCTATACCTTATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGACAACCCGGAGCCCTGCTGGGAGACGACCAAGTCTACAACGTAATCGTCACAGCCCATGCATTCGTAATAATTTTCTTCATAGTTATACCTATCATAATCGGAGGGTTTGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTACTACTAGCATCTTCTACAGTAGAAGCAGGAGTCGGTACAGGTTGAACAGTATACCCACCATTAGCCGGTAACCTAGCCCACGCCGGAGCCTCAGTAGACCTCGCAATCTTCTCCCTACACCTAGCCGGCATCTCCTCAATTCTAGGAGCAATCAACTTTATCACAACAGCAATTAACATAAAACCTCCCGCCCTATCACAATACCAAACCCCCCTATTTGTATGATCAGTCTTAATCACCGCAGTACTCCTACTGCTCTCCCTACCAGTACTAGCTGCAGGAATTACAATGCTACTAACAGACCGCAATCTCAACACCACATTCTTTGACCCTGCTGGTGGAGGAGACCCTGTCCTTTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTGTACATCCTTATCCTACCAGGATTCGGTATCATCTCCCACGTAGTAACCTACTACGCAGGTAAAAAAGAACCATTCGGATATATAGGAATAGTATGAGCCATGCTATCCATCGGATTCTTAGGATTTATCGTCTGAGCCCACCACATATTTACAGTAGGAATGGACGTTGACACCCGAGCTTACTTCACATCCGCCACTATGATTATTGCCATCCCAACTGGCATCAAAGTATTTAGCTGACTGGCCACTCTCCACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGCTTCATCTTCCTATTCACCATCGGAGGCTTAACAGGAATCGTCCTGGCAAACTCCTCATTAGACATCGCCCTTCATGATACCTACTACGTAGTAGCCCACTTCCACTACGTACTGTCAATAGGGGCAGTATTCGCTATCCTGGCCGGTTTCACACACTGATTCCCCCTATTCACCGGATATACCCTACACTCAACATGAGCCAAAGCCCACTTTGGTGTAATATTCGTCGGAGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGCCTAGCTGGTATGCCACGACGATACTCAGACTACCCCGACGCCTACACACTTTGAAACACCATCTCCTCAGTAGGTTCCCTCATTTCCCTAACAGCCGTAATCATGCTGGTCTTCATCATCTGAGAAGCCTTCGCATCCAAACGCAAAGTCCTACAACCAGAACTAACAAGCACTAACGTTGAATGAATCCACGGCTGCCCTCCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTCCAAGATCAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACCTATGCTTCTTTCTC---AT---AGAGATGTTAGT-AAAACA-ATTACATAG-TCTTGTCAAGGCTAAATTGCAGGTGAAACCCCAGCACATCCCT-----ACCC--AAATATGGCTAACCACTCACAATTCAACTTCCAAGACGCCTCCTCACCCATCATAGAAGAACTAATAGGATTCCACGACCATGCCCTAATAGTCGCACTAGCAATCTGCAGCCTAGTCCTCTATCTCTTAACCCACATGTTAACGGAAAAACTCTCATCCAGCACAGTAGACGCACAAGAAATTGAACTCGTCTGAACAATCCTTCCGGCCATAGTACTAGTCATACTAGCCTTACCATCACTACGAATCCTATACATAATAGACGAAATCAACGAACCTGACCTAACCTTAAAAGCCATCGGCCACCAATGATATTGAACCTACGAATATACTGACCTAAAAGACCTCACATTCGACTCCTATATAATCCCCACATCAGACCTCCCCCTAGGACACTTCCGCCTTCTAGAAGTCGACCATCGCGTAGTAGTTCCCATAAGCTCTACAATCCGAGTAATTGTCACCGCTGACGATGTACTACACTCATGAGCCATCCCCAGCCTAGGTGTAAAAACTGACGCAATCCCAGGACGCCTTAACCAAACTTCCTTCCTAGCCTCTCGACCTGGAGTCTTCTACGGACAATGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCAATCGTTGTAGAATCCACTCCACTCGCCAACTTCGAAAGCTGATCCTCCCTGA---TAGCCTCCT----------AATCATTAAGAAGCTATGTACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGA-C-AAACACCCTCCTTAATGACATGCCTCAACTGAACCCAGCTCCATGATTTTTTATCATGATCATTACATGACTCACTTTCTCCCTGATCATCCAACCCAAGCTCTTATCATTCGTGTCAATAAACCCACCATCTAACAAAC---CCCCAATTCCTCCAACAACCACTCCCTGAACCTGACCATGAACCTAAGTTTTTTCGACCAATTCTCAAGCCCATCCTTCCTAGGAATCCCACTAATCCTAATCTCAATAACATTTCCAGCCCTTCTACTCCCATCCCTAGACAACCGATGAATTACTAACCGACTTTCAACCCTCCAACTATGATTTATCAACCTAGTAACTAAACAATTAATAATGCCCCTAGACAAAAAAGGACACAAATGAGCTCTAATTCTGACATCCCTAATAATCTTTCTCCTGCTCATTAACCTCTTAGGTTTACTACCCTACACATTCACTCCAACCACCCAACTATCAATAAACCTAGCCCTAGCCTTCCCCCTATGACTCGCCACTTTACTAACAGGATTACGAAATCAACCTTCTGCCTCACTAGGCCATCTCCTACCAGAAGGCACCCCAACCCCCTTAATCCCGGCCCTAATTCTAATCGAAACAACAAGCCTACTAATCCGCCCACTCGCCCTGGGTGTACGCCTAACAGCCAACCTTACAGCAGGCCATTTACTTATCCAACTCATCTCCACAGCCACAACAGCCCTATTCTCCACGATACCAATGGTTTCACTACTAACTCTAATAGTGCTCCTCCTACTAACCATCCTAGAGGTGGCAGTAGCAATAATCCAAGCTTACGTCTTCGTACTCCTACTAAGCCTCTACCTACAAGAAAATATCTAAACC--AC--ACAATGGCACACCAAGCACACTCTTACCACATAGTAGACCCAAGCCCATGACCTATCTTAGGAGCCGCTGCCGCCCTCCTAACCACCTCCGGATTAACAATATGATTTCACTACAACTCCCCCCGACTCCTTATCCTGGGCCTACTTTCCACCGCCCTAGTTATATTCCAATGATGACGGGACATCATCCGAGAAAGCACATTCCAGGGTCATCACACCCCCACCGTACAGAAAGGACTGCGATACGGTATGGCCCTATTCATCACATCCGAAGCCTTCTTCTTTCTGGGATTCTTCTGAGCCTTCTTCCACTCAAGCCTTGCTCCAACACCAGAACTAGGAGGGCAATGACCACCTGTAGGAATCAAACCACTAAACCCCATAGAAGTCCCACTATTAAACACTGCCATCCTCCTAGCCTCAGGAGTTACCGTAACATGAGCCCACCACAGCATTACAGAAGCCAAACGAAAACAAGCAATTCATGCCTTATCCCTAACAGTCCTACTAGGATTCTACTTCACCGCTCTACAAGCTATAGAATACTACGAGGCACCATTCTCCATCGCAGACGGAGTATACGGCTCCACCTTCTTTGTAGCTACCGGATTCCACGGCCTACACGTAATCATTGGCTCTACATTCCTACTAGTATGCCTCCTACGTCTAATCAAATACCACTTCACATCAAATCACCACTTCGGATTCGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTATATCTCAATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAACCCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTAACACTATCACTCACTTTAAGCATAACCCTAACTGCACTAAACTTTTGACTAGCCCAAATAAACCCAGACTCAGAAAAACTATCCCCATACGAATGTGGCTTCGACCCACTGGGATCTGCCCGACTTCCATTCTCCATCCGCTTCTTCCTAGTAGCTATTCTATTCCTCCTATTCGACCTAGAAATCGCCCTACTACTCCCACTCCCATGAGCCCTACAACTAGAATCCCCCACCACTACCTTGATTTGAGCCTCCTCCCTTCTCCTAATCCTCACACTAGGACTCATTTACGAATGAATCCAAGGCGGATTAGAATGAGCAGAGTA-G------TAGAAAGTTAGTCTAAACAAGACGGTTGATTTCGACTCAACAAATTATAGCTCATACCCTATAACTTTCTTCATGTCCTATCTTCACCTGTGCTTCTACTCTGCCTTTACCCTAAGCAGCCTAGGCCTAGCCTTCCACCGAACTCACCTAATCTCAGCCCTACTATGCCTAGAGAGCATAATACTATCCATATACGTCGCACTAGCCATATGACCTATCCAAATGCAATCACCATCTTCTACCATCCTACCAATTATTATACTGACATTCTCCGCCTGCGAGGCAGGCACGGGCCTAGCCCTACTAGTAGCCTCCACCCGGACCCATGGCTCCGACCACCTACACAACTTCAACCTACTACAATGCTAAAAATTATTATTCCAACCGCAACACTACTCCCCCTCGCCTTTTTCTCCCCACTCAAACACCTATGAACTAACATCACACTGCATAGCCTATTGATCGCCACTGTTAGTCTACAATGATTAACCCCTACATACTTCCCAAACAAAAGCTTAACCCCATGAACTGCCATTGACCAAATCTCCTCTCCCCTACTGGTGCTATCGTGCTGGCTACTGCCCCTCATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCAACCATCCGCAAACGAATCTTTGCCACAACAGTAATCCTAGCTCAACTATTTATTCTCCTAGCCTTCTCAGCCTCAGAACTAATGCTCTTCTATATCGCATTCGAAGCAACCCTAATCCCCACACTCATCCTCATCACACGATGAGGTAACCAACCAGAACGCCTAAATGCAGGCATCTACCTCTTATTTTACACATTAGCCAGCTCACTTCCCCTGCTAATCGCTATCTTACACCTACAAAACCAATTAGGCACACTATACCTACCAATACTTAAGCTACACCACCACACACTAAACTCCTCCTGATCAGGATTAATTGCCAGCACAGCCCTACTCCTAGCCTTCATAGTCAAAGCCCCCCTATACGGCCTACACCTATGATTACCTAAGGCCCACGTAGAAGCCCCCATCGCTGGCTCTATACTACTAGCTGCACTTCTCCTAAAACTAGGAGGCTACGGCATCATACGAATCACAATGCTAGTAAACCCAACATCAAACAACCTACACTACCCATTCATCACTCTAGCCCTATGAGGAGCACTAATGACTAGCGCCATCTGCCTACGACAAATTGACCTAAAATCACTAATTGCCTACTCATCTGTCAGCCACATAGGCCTAGTAGTAGCCGCAACTATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACACGGACTGACCTCTTCAATACTATTCTGTCTAGCCAACACCAACTACGAACGAACTCACAGTCGAATCCTACTCCTCACACGAGGTCTTCAACCCCTTCTACCACTAATGGCCACCTGATGATTACTCGCCAACTTAACAAACATAGCCCTACCTCCTACAACCAACCTCATAGCAGAACTAACCATTGTAGTCGCCCTATTCAACTGATCCGCTTTCACAATCGTCCTAACAGGAGCCGCAATCCTACTCACTGCCTCATACACCCTATATATGCTTATAATAACACAACGAGGCACACTCCCATCACACATCACCTCAATCCAAAACTCCTCTACACGAGAACACCTTCTCATAGCCCTACACATAATCCCAATACTGCTTCTAATCCTAAAGCCCGAATTAATCTCCGGCATCCCCATAT-GCAAATATAGTTT-CAA-CTAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAAACCTTCTTATTTGCCGAGGGG-AGGTGTAAACCAACGAGAACTGCTAACTCCCGAACCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGCAATCCAGTGGTCTTAGGAGCCATTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGATCTTTCGCTAATCCTAAACACATTTATACTTCTAACCCTAACAACCCTCTTTACCCCTATCCTATTTCCTCTCCTATCTAACACCCTCAAAAACACACCTAACACCATCACCAACACGGTTAAAACTTCCTTCCTAATCAGCCTTATCCCCATAACAATTTATATCTACTCAGGCACAGAAAGCCTAACATCCATCTGAGAATGGAAATTCATCATAAACTTCAAGATCCCAATCAGCCTAAAAATAGACTTCTATTCACTTACATTCTTCCCAATCGCATTATTCGTCTCATGATCCATCCTGCAATTCGCAACATGATACATAGCATCAGATCCATATATTACAAAATTCTTCACCTATCTCCTATTCTTCCTAATCGCAATGCTCATCCTAATTATCGCCAACAACCTCTTCGTCCTGTTCATTGGCTGAGAAGGGGTAGGAATCATATCCTTCCTACTAATCAGCTGATGACATGGCCGAGCAGAAGCTAACACTGCTGCCCTCCAAGCCGTACTATACAATCGAATTGGAGACGTAGGACTTATTCTCTGCATAGCCTGACTAGCCTCCACCACAAACACCTGAGAAATCCACCAACTTCCTATCTCAACACAAACCCCCACACTACCCCTCCTAGGCCTAATTCTAGCCGCAACTGGTAAATCCGCCCAATTCGGCCTCCACCCGTGACTCCCAGCCGCCATAGAAGGGCCAACCCCAGTATCAGCCCTACTTCACTCCAGCACAATGGTCGTAGCAGGAATCTTCCTACTCATCCGAACCCATCCTCTATTCAACAACAACCAAACCGCCTTAACCCTTTGCCTATGTCTAGGAGCTCTATCCACACTATTTGCAGCCACATGTGCCCTCACCCAAAACGATATTAAAAAAATCATTGCCTTCTCCACCTCAAGCCAACTAGGACTGATAATAGTCACAATTGGACTAAATCTGCCCGAACTAGCCTTCCTACACATTTCAACCCACGCATTCTTCAAAGCCATGCTCTTCCTATGCTCAGGTTCCATCATCCACAGCCTAAACGGCGAACAGGATATCCGAAAAATAGGAGGCCTACAAAAAATATTACCCACAACCACTTCATGTCTCACCATCGGAAACCTAGCCCTAATAGGAACACCATTCCTAGCAGGTTTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCATACCTAAACACCTGAGCCCTACTAATAACCTTACTAGCTACATCCTTCACCGCAGTTTACACAATTCGAATAACCATACTCGTACAAGCCGGCTTCGTCCGAATCTCCCCTCTAACCCCAGTAAACGAAAACAACCCAGCAGTAACTTCCCCAATCACCCGCCTTGCACTAGGAAGTATCCTAGCAGGATTCCTCATCACCTCCTTCATCATCC---CTACAAAAACTCCTACCATGACCATACCCCTCTCCATCAAAATAACTGCCCTAGCAGTAACAGCCCTAGGAATTGCTTTCGCCTTAGAGATCTCAAAAATAACCCAAACCCTAATCCTCACAAAACAAACCACTTTCTCAAACTTCTCTACCTCCCTAGGATACTTCAACCCCCTAACCCATCGATTAACCATAACTAACCTACTCAACGGAGGACAAAACATCGCCTCCCACCTAATCGACCTCTCTTGATACAAAATAATAGGTCCAGAAGGACTAGCCCATTTACAGCTAATAGCAACCAAAACCGCTACCTCATTCCACTCCGGCCTAATTAAAGCCTACCTAGGATCATTCGCCCTGTCCATCCTAATCCTTCTTA---TATCCATATACAGAAC--TAA-C-T---AATGGCCCTCAACCTTCGTAAAAACCATCAAATCCTAAAAATCATCAACGACGCCCTAATCGACCTCCCCACACCACCTAACATCTCAACATGATGAAACTTCGGATCTCTATTAGGGATTTGCCTGATCACTCAAATTGTCACAGGTCTTCTGCTAGCCATACACTACACAGCAGATACCAACCTAGCCTTCGCCTCCGTAGCCCACATATGCCGAGACGTCCAATTCGGCTGACTAATCCGCAACCTTCACGCAAACGGAGCCTCATTCTTCTTCATCTGCATTTACCTACATATCGGCCGAGGAATCTACTACGGCTCATACTTAAATAAAGAAACCTGAAACGTTGGAGTCATCCTCCTACTCACCCTGATAGCCACCGCCTTCGTAGGATATGTCCTACCATGAGGACAAATATCATTCTGAGGAGCTACAGTAATTACAAACCTATTCTCAGCAATCCCCTACATCGGCCAAACATTAGTAGAATGAGCCTGAGGTGGATTCTCCGTAGACAACCCTACATTAACCCGATTCTTCGCCCTTCACTTCTTACTCCCATTCGTCATCGTAGGCCTCACATTAGTCCACCTCACCTTCCTACACGAAACAGGATCAAACAACCCAACTGGAGTACCCTCAGATTGCGATAAAATCCCATTCCACCCATACTACACCGTAAAAGACGTCCTAGGCTTCGCTCTAATGATCTCACTACTAGTCTCTCTAGCCCTATTCTCCCCTAACCTCCTAGGAGACCCAGAAAACTTCACCCCTGCCAACCCCCTAGTAACTCCCCCTCATATCAAACCCGAATGATACTTCCTATTTGCTTACGCTATCCTACGATCCATCCCAAACAAACTAGGAGGCGTACTAGCCTTAGCCGCATCAATCCTAGTTCTATTCCTACTACCTCTTCTCCACACATCAAAACTACGATCAATAACCTTCCGCCCCATCTCCCAAGTCCTATTCTGAGCCCTAGTTGCAAACGTCCTAATCCTAACATGAGTAGGAAGCCAACCAGTAGAACACCCGTTCATCATCATTGGACAACTAGCCTCATTCACCTATTTCACAATTATTCTAGTGCTATTCCCCATCGCAGCCGCACTAGAAAACAAACTACTAAAACT----------CTA-ATA-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGAATAAACCTCTTCTTAGAGTT Coccothraustes_vespertinus GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--TACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCCCCAGTG-TAAATGCCCTGGACA-CCT-T-GA-C-C-----AAGTAGATAGGAGCAGGTATCAGGCTCA--C------CAT-G--ACTGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTACTCAGCAGTAGTTGATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAAACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCATAAGCCCAAGCTGC-CAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACCCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCTAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTAACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGTTCACCTCCC--CTGAAAGCCCAACAGTGGACGCAATAG-CCCAA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GG-AGCAATGGGCTACATTTTCTAAGATAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCTGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG-CCCCCCCCCCCCCCACTAAATTAATAAGCCAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAGCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--GA-CCA-CACCC----AACTAAAGCATT---C--ACCAGT-CCTAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAGTG-AAACAATC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTTAGTTTGCCATCCCGAAACCCAAGCGAGCTACTCACAAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAAACC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--ATT-AC-CT-CCAAGT-TATATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCTA-AAAAATATAAG-AACCTTATGACTCCCT-CCCCATTAACAGGCTAACCTATATATAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-CCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-TAACCA-ATATACGA--ACAAT---------CAA---ACAAGCA-AAG-TATTA-AACATT-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCAGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACACT----AC-CTCCCA--C-C-GGGTTCACTGAC-ACA-TAA-GA-TGATTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCATACCTCTAGACTG-AGAGCAACCCCTCAAAGTGCTAATAGCACCCAGACCCAATAT--AATTGACCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCGAGAGTCCGTATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGACG-AGCTCTTCCCAGTACGAAAGGATAGGAA-AAGCAAGGCCAATACTGCAA-GCAAGCCTTC-ACCCTAAGTAATGAAACCAACTAAATTACAAAGGGTTATCAC-CCCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTCAACCTAAC-----CTAACC--C----ATGCT----------CAAATTCCCCCTCGTAATTAACCTCATTATAGCCCTTTCCTACGCCCTTCCAATCTTAATCGCAGTAGCCTTTCTCACACTAGTAGAGCGCAAAATCTTAAGCTATATACAAAGCCGAAAAGGCCCGAACATTGTTGGACCATTTGGCCTTTTACAACCCCTAGCTGACGGAGTGAAGTTATTTATCAAGGAACCCATTCGAC---------CCTCGACATCTTCCCCAATCCTATTTATAGCCACTCCCATACTAGCCCTACTCCTGGCAATCTCAATCTGAACCCCACTACCCCTGCCCTTCTCACTAGCAGACCTAAACCTAGGACTGCTCTTCCTACTGGCCATATCCAGTCTAGCTGTGTACTCTATCCTATGGTCAGGATGGGCTTCTAACTCAAAATACGCACTCATTGGGGCACTCCGAGCAGTAGCCCAAACAATTTCATATGAAGTAACCCTGGCGATTATCCTCCTTTCTGTAGTCCTCTTAAGTGGCAACTATACCCTTAACACCCTCGCAGTCACCCAAGAACCTCTATACCTCATCTTCTCGTGCTGACCCCTTGCCATAATATGATACGTCTCTACACTTGCCGAAACTAACCGCGCCCCCTTTGACCTCACAGAAGGGGAATCTGAGTTGGTCTCTGGGTTTAATGTAGAATATGCAGCAGGCCCATTCGCACTATTCTTCTTAGCCGAATACGCTAACATCATACTCATGAACACATTAACTACCATCCTATTCTTCAATCCAAGTTTCCTCAATCCTCCCCAAGAATTATTTCCAGTCGTACTGGCCACAAAAGTACTTTTACTATCAGCGGGGTTCCTGTGAATCCGTGCCTCCTACCCACGATTCCGATATGACCAACTAATACACCTCCTATGAAAAAACTTTCTACCCCTCACATTAGCCCTATGCCTCTGACACATCAGCATACCAATCTGCTATGCGGGTCTTCCC-----CCCTACCTA-A--GAC-------------ACTACGGAAATGTGCCTGAACAC-T--AAGGATCACTATGATAAAGTGAGCATGGAGGTATACCAGCCCTCTCATTTCCT-T--ACCC-------TTAGAAAAGCGGGAATCGAACCCACACTAGAGGAATCAAAACCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCGACTCCTTCCCCTACTA-ATGAATCCCCAGGCAAAACTAATCTTCATCTTCAGCCTACTACTAGGAACAACTATCACAATCTCAAGCAACCATTGAATTA---TAGCCTGAGCCGGCCTAGAAATCAACACACTTGCCATCCTGCCCCTAATCTCAAAATCCCACCACCCACGAGCCATCGAAGCCGCCACTAAGTACTTCCTAACCCAAGCAGCCGCCTCTGCCCTAGTCCTATTCTCTAGCATAACTAACGCCTGACATACCGGACAGTGAGACATCACCCAATTATCACACCCCACATCTAGCCTTATCTTAACTTCAGCAATCTCAATGAAACTAGGACTGGTCCCATTCCATTTCTGATTCCCAGAGGTACTTCAAGGCTCCCCATTACCTACCGGCCTACTCCTGTCCACTATCATAAAACTCCCCCCAATCACACTCCTATATATAACATCCCCATCACTAAACCCAACACTCCTGACCACCCTAGCCATCCTCTCTGCAGCCATCGGTGGATGAATGGGTCTTAATCAAACCCAAATCCGGAAAATCCTAGCTTTCTCCTCCATCTCTCACCTAGGCTGAATAGCAATCATCATCATCTACAACCCTAAACTCACCCTCCTCAATTTCTACGTATATACTATAATAACCGCAGCCATTTTCCTCACTCTAAATTCAATCAAAGTGCTGAAACTATCTTCCCTGATAACCGCATGAACCAAAATCCCCTCAATAAACGCAATACTACTGCTAACCCTTCTATCCCTAGCAGGACTTCCACCACTAACAGGATTCTTACCTAAATGACTTATTATCCAAGAACTAACTAAACAAGAGATAGCCCCTGCAGCCACACTCATGTCTCTCCTCTCCCTGCTGAGCCTGTTCTTCTACCTCCGCCTCGCATATTGCACAACAATTACACTCCCCCCACATACCACGAACCACATAAAACAATGACGCACTAACAAACCAACCAGCATCCTAATTGCCATCTTAACTACAGCATCTGTCATCCTCCTACCAATTTCCCCCATAATCCTCACCATTGT------GT----AAGAAACTTAG----GATTACCT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCACTATCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-T--CAA-TTTACTAGGCAGATGGGCTTCGATCCCATAACTC-TATAGTTAACAGCTATATGCCCCAACC-AACAGGCCTCTACCT-A-------------AGGCTCCGGTACATGA-TCAATGCACATCAATGAGTTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-TTACACTCAGCCATC--------------TTACCTGTGACTTTCATCAACCGATGATTATTTTCAACCAACCACAAAGACATCGGTACCCTATACCTTATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGTCTCCTCATCCGAGCAGAACTGGGCCAACCAGGAGCCCTCCTGGGAGACGACCAAGTCTACAACGTAATCGTCACAGCCCATGCATTCGTAATAATCTTCTTCATAGTTATACCCATCATAATTGGAGGATTCGGAAACTGACTAGTCCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCACGAATAAATAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTCCTGCTAGCATCTTCCACAGTAGAAGCAGGAGTTGGTACAGGTTGAACGGTATACCCCCCACTAGCTGGCAACCTAGCTCACGCCGGAGCCTCAGTTGACCTCGCAATCTTCTCCTTACACCTAGCCGGCATTTCCTCAATCCTAGGAGCAATCAACTTTATCACAACAGCAATCAACATAAAACCTCCCGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTAATTACTGCTGTACTACTACTCCTATCTCTGCCAGTTCTAGCTGCAGGAATTACAATACTACTAACAGACCGTAACCTCAACACCACATTCTTTGACCCTGCAGGCGGAGGAGACCCTGTCCTATACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTATACATCCTAATCCTACCAGGATTTGGCATCATTTCCCACGTAGTAACCTACTACTCAGGCAAAAAAGAACCATTTGGTTACATAGGAATAGTATGAGCCATGCTATCTATTGGATTCCTAGGCTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATAGACGTAGACACCCGAGCCTACTTCACATCTGCCACCATAATCATTGCCATCCCAACCGGCATCAAAGTGTTTAGCTGACTGGCCACACTTCATGGAGGCACAATCAAATGAGACCCACCAATACTATGAGCCCTAGGCTTCATCTTCCTATTTACCATCGGAGGCCTAACAGGAATCGTACTAGCAAACTCTTCACTAGATATCGCCCTACACGACACCTACTATGTAGTAGCCCACTTCCACTATGTACTATCCATAGGAGCAGTGTTTGCAATCCTAGCTGGCTTCACACACTGATTCCCTCTATTCACCGGATACACCTTACACTCAACGTGAGCCAAAACTCACTTTGGTGTGATATTCGTAGGCGTAAACCTAACCTTCTTCCCCCAACATTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTCTGAAATACTATCTCCTCAGTAGGCTCCCTCATCTCCCTAACAGCCGTAATCATGCTAGTCTTCATCATCTGAGAAGCCTTTGCATCTAAACGTAAAGTACTACAACCAGAACTAACAAGCACCAACGTTGAATGAATTCACGGCTGCCCTCCTCCATTCCACACATTCGAGGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACCTATGCTTCTTTCTC---AT---AGAAATGTTAGT-AAAATA-ATTACATAG-TCTTGTCAAGACTAAATTGCAGGTGAAACCCCAGCACATCTCT-----ACCC--AAACATGGCTAACCACTCACAATTCAACTTTCAAGACGCTTCCTCACCCATCATAGAAGAACTAATAGGATTCCACGACCATGCCCTGATAGTCGCCCTAGCAATCTGCAGCCTAGTCCTGTACCTTCTAACCCACATATTAACAGAAAAACTCTCATCCAACACAGTAGACGCACAAGAAATTGAACTCGTCTGGACAATCCTCCCAGCCATAGTACTAGTCATACTCGCCCTACCATCCCTACGAATCCTCTACATAATAGACGAAATCAACGAACCCGATCTAACTCTAAAAGCCATCGGCCACCAATGATACTGAACCTACGAATATACTGACCTAAAAGACCTCACATTCGACTCCTACATAATCCCAACATCAGACCTACCCCTAGGACACTTCCGTCTCCTAGAAGTTGATCACCGCGTAGTTGTCCCTATAAGCTCTACAATTCGAGTAATTGTTACCGCTGACGATGTACTACACTCATGAGCCGTCCCCAGCCTAGGTGTAAAAACCGATGCAATCCCAGGACGTCTCAACCAAACTTCCTTCCTTGCCTCTCGACCCGGAGTTTTCTACGGACAATGTTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCAATCGTAGTTGAATCCACTCCACTCGCCAACTTCGAAAGCTGATCTTCCCTAA---TAGCCTCCT----------AATCATTAAGAAGCTATGTACCAGCATTAGCCTTTTAAGCTAAAGAGAGAGGGCC-GACCACCCTCCTTAATGACATGCCCCAACTAAACCCAGCTCCCTGATTTTTTATCATGATCATTACATGACTCACCTTCTCCCTGATTATTCAACCCAAACTGCTCTCATTCGTATCAATAAACCCACCATCTAATAAAC---CTCCAATCCCCCCAACAACTACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCTCTCCTAGGAATCCCACTAATCCTTATTTCAATAACATTCCCCGCCCTCCTACTCCCATCCCTAGACAACCGATGAATTACAAACCGACTCTCAACCCTCCAACTATGATTCATCAACCTAGTAACAAAACAACTAATAATGCCTCTAGACAAAAAAGGACACAAATGAGCCCTAATCCTGACATCCCTAATAATCTTCCTCCTACTCATCAACCTCCTAGGCCTACTACCCTACACATTCACCCCTACCACCCAATTATCTATAAACCTAGCCCTAGCCTTCCCACTATGACTAGCCACCCTCCTCACAGGCCTACGAAACCAACCTTCCATCACACTAGGCCACCTCCTCCCAGAAGGTACACCAACCCCCCTAATCCCCGCCCTAATTCTAATTGAAACAACAAGCCTACTAATCCGCCCACTCGCCCTGGGCGTACGACTAACAGCCAACCTAACAGCAGGACATCTACTTATTCAACTCATTTCTACTGCCACAACAGCCCTATTCTCCACAATACCAGTACTCTCGCTCCTAACCCTAGTAGTACTTCTATTACTAACCATCCTAGAAGTAGCAGTAGCAATAATCCAGGCCTACGTCTTCGTACTTCTATTAAGCCTCTACCTCCAAGAAAACATCTAAACC--AC--ACAATGGCACACCAAGCACACTCTTACCACATAGTAGACCCCAGCCCATGACCCATCCTAGGAGCCGCTGCCGCCCTTCTAACTACCTCCGGACTAACCATATGATTCCACTACAACTCCCCCCGACTACTTATCCTAGGCCTAATTTCCACCACCCTAGTGATATTCCAATGATGACGAGATATCATCCGAGAAAGCACATTCCAAGGCCACCACACTCCTACCGTACAAAAAGGACTACGATATGGCATAGCCCTATTCATCACATCCGAAGCCTTCTTCTTCCTAGGCTTCTTCTGAGCTTTCTTCCACTCAAGCCTAGCCCCCACACCAGAATTAGGAGGACAATGGCCGCCCGTCGGAATCAAACCCCTAAACCCTATAGAAGTCCCCCTACTAAACACCGCTATCCTCCTAGCCTCAGGAGTCACCGTAACATGAGCCCACCATAGTATCACAGAGGCCAAACGAAAACAAGCAATCCACGCCCTATTACTAACAGTCCTACTAGGATTCTACTTCACCGCACTACAAGCCATAGAATACTACGAAGCACCATTCTCTATCGCAGACGGAGTGTACGGCTCCACCTTCTTCGTCGCTACTGGATTCCACGGCCTACACGTAATCATTGGCTCTACATTTCTACTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAACCACCACTTTGGGTTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATCA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTAACACTATCCCTAGCCCTAAGCATAATCTTAACCGCACTAAACTTCTGACTAGCCCAAATAAACCCCGACTCAGAAAAACTATCTCCATATGAATGTGGCTTCGACCCCCTAGGATCTGCCCGACTTCCATTTTCCATCCGATTTTTCCTAGTAGCCATCCTATTCCTCCTATTTGACCTAGAAATCGCTCTACTCCTCCCACTCCCATGGGCCATCCAACTAGAGTCTCCAACCACCACCATAATCTGAGCCTCCTCCCTCCTCTTACTCCTCACACTAGGCCTCATCTACGAATGAACCCAAGGCGGATTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAAACAAGACAGTTGATTTCGACTCAACAAATTATAGTACACACCCTATAACTTTCTTTATGTCCTACCTACATCTCTGCTTTTACTCAGCTTTCACCCTAAGCAGCCTAGGCCTAGCCTTCCACCGAACCCACCTAATTTCAGCCCTACTATGTCTAGAAAGCATGATACTATCCATATACGTCGCACTAGCCATATGACCCATCCAAATACAATCACCATCCTCTACCATCCTACCAATCATTATACTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTAGCCCTACTAGTAGCCTCCACCCGAACCCACGGCTCTGACCACCTACACAACTTTAACTTACTAAAATGCTAAAAATCATTATCCCAACTGCAATACTTCTCCCCCTCACCTTCTTCTCACCCCTCAAACACTTATGAACTAACACCACATTATACAGCCTACTAATCGCTACTATCAGCCTACAATGACTAACCCCCACATACTTCCCAAACAAAAGTCTAACCCCATGAACGGCTATTGACCAAATCTCCTCCCCCTTATTAGTCCTATCATGCTGACTCTTACCCCTCATAATCATAGCAAGCCAGAACCATCTAGAACAAGAACCAACTATTCGCAAACGAATCTTTGCCACAACAGTAGTCCTAGCCCAATTATCCATCCTCTTAGCCTTCTCAGCCTCAGAACTAATACTCTTCTACATTGCATTTGAAGCAACCCTAATCCCCACCCTCATCCTAATTACACGATGAGGAAATCAACCAGAACGCCTAAACGCAGGCATCTACCTTCTATTTTACACACTAGCCAGCTCACTACCCCTGCTAATTGCCATACTACATCTACAAAATCAAATCGGCACTCTATACCTACCAATGCTAAAACTACATCACCCCACACTAAACTCTTCCTGATCCGGACTGATTGCCAGCATAGCCCTGCTTCTAGCCTTCATAGTCAAAGCCCCTTTGTATGGTTTACATCTGTGGTTACCAAAAGCCCACGTAGAAGCCCCAATCGCCGGCTCCATACTACTAGCCGCGCTTCTACTGAAACTAGGAGGCTACGGCATCATACGAATCACAATACTAGTAAACCCAACATCAAACAACCTGCACTATCCATTCATCACCCTTGCCCTATGAGGAGCGCTAATAACCAGCGCTATCTGCCTACGACAAATTGACCTAAAATCACTAATCGCCTACTCATCTGTAAGCCACATGGGCCTGGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACACGGACTAACCTCCTCAATACTATTCTGCCTAGCCAACACTAACTACGAACGAACCCACAGCCGAATCCTACTCCTCACGCGAGGACTTCAACCCCTCCTACCACTAATAGCCACCTGATGACTTCTTGCCAACCTAACAAACATAGCCCTCCCCCCTACAACCAACCTCATAGCAGAACTAACCATTATTATCGCACTATTCAACTGATCCGCCTTCACAATCATCCTAACAGGAGCCGCAATCCTACTCACCGCCTCATACACCCTATACATGCTCATAATAACACAGCGAGGCACACTCCCATCCCACATCACCTCAATCCAAAACTCCTCTACACGAGAACACCTCCTCATAGCCCTACACATAATCCCCATACTACTTCTAATCCTAAAACCCGAATTAATCTCCGGCATTCCCATAT-GCAAATATAGTTT-TAA-CCAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAAATCTTCTTACTTGCCGAGGGG-AGGTA-AAACCAACGAGAACTGCTAACTCCCGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTAATCTTGGTGCAAATCCAAGTGAAAGT--AATGGATCTCTCACTAATCCTAAACACATTTATACTCCTCACCCTAGTAACCCTCACTACCCCCATCCTACTCCCACTCTTATCAGACACTCTCAAAAACACACCCAATACCATCACCAACACAGTCAAAACTTCCTTCCTAATCAGCCTCATTCCTATAACAATCTACATTCACTCAGGCACAGAAAGCCTAACCTCTATCTGAGAATGAAAATTCATTACAAACTTCAAAATCCCAATCAGCCTAAAAATAGACTTCTACTCCCTTACCTTCTTCCCAATCGCACTATTCGTCTCATGATCCATCCTACAATTCGCAACATGATACATAGCATCCGACCCACACATCACAAAATTCTTCATCTACCTCTTATTCTTCCTAATCGCAATACTCATCCTAATTATCGCTAACAACCTATTCGTCCTATTCATTGGCTGAGAAGGAGTAGGGATTATATCCTTCCTGCTAATTAGCTGATGACATGGCCGAGCAGAAGCTAACACCGCCGCCCTCCAAGCCGTATTATATAACCGAGTCGGGGACATTGGACTTATCCTCTGCATAGCTTGACTAGCCTCTGCCACAAACACCTGAGAAATCCACCAACTTCCCATCTCAAACCAAACTCCAACACTACCCATCCTAGGTCTCATTCTAGCCGCAACTGGCAAATCCGCCCAATTCGGCCTTCACCCCTGACTCCCCGCTGCCATAGAAGGGCCAACCCCCGTATCAGCCCTGCTTCACTCCAGCACTATAGTCGTAGCCGGGATCTTCCTACTCATCCGAACTCACCCTCTATTCAACAACAACCAAACCGCCCTAACCCTCTGCCTATGCCTAGGCGCTCTATCCACACTATTCGCAGCTACATGTGCCCTCACCCAAAACGACATCAAAAAAATCATTGCATTTTCCACCTCCAGCCAACTAGGATTAATAATAGTCACAATCGGACTAAACCTACCCGAACTAGCCTTCCTCCACATCTCCACCCACGCATTCTTTAAAGCCATACTCTTCTTATGCTCAGGCTCCATCATCCACAGCCTAAACGGCGAACAAGACATCCGAAAAATAGGAGGTCTCCAAAAAATAATACCCACAACCACTTCATGCCTCACCATCGGAAACCTCGCCCTAATAGGAACACCATTCCTCGCAGGATTCTACTCAAAAGATCAAATCATCGAAAGCCTAAATACATCGTACCTAAACACCTGAGCTCTCCTACTAACCTTACTAGCCACATCCTTCACCGCAGTATACACAATCCGAATAACCGTACTTGTACAAACCGGCTTCGTTCGAATCTCCCCTCTAACCCCAGTAAATGAAAACAACCCCGCAGTGACCTCCCCCATCACCCGACTCGCACTCGGGAGCATCCTAGCAGGATTCCTCATTACCTCATTCATCATCC---CTACAAAAACTCCCACCATAACCATACCCCTCTCTATTAAAATAACCGCCCTAGCAGTAACAGCCCTAGGAATTGCTTTCGCCCTAGAAATCTCAAAAATAACCCAAACCCTTATCCTCACAAAACAAACTACTTTCTCAAACTTCTCCACCTCCCTAGGATACTTCAACCCCCTAACCCACCGACTAACCATAACCAACCTCCTCAACGGAGGACAAAACATCGCTTCCCACTTAATCGACCTCTCCTGATACAAAATAATAGGCCCAGAAGGACTAGCCCACCTGCAACTAATAGCAACCAAAACCGCCACCTCTTTCCACTCAGGCCTAATCAAAACCTATCTCGGATCATTCGCCCTATCCATCCTAATCCTTCTCA---TATCCATATACAGAAC--CAA-C-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAACGACGCCCTAATTGACCTTCCCACACCACCCAACATCTCAACATGATGAAACTTCGGATCCCTACTAGGAATCTGCCTCATCACCCAAATCGTCACAGGCCTTCTGCTAGCCATACACTACACAGCAGACACCAGCCTAGCCTTCTCCTCCGTCGCCCACATATGCCGAGATGTCCAATTCGGCTGACTAATCCGCAATCTCCACGCAAACGGAGCCTCATTTTTCTTCATCTGCATCTACCTACATATCGGACGAGGAATCTATTATGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTCATCCTCCTACTAACCCTCATAGCCACCGCCTTCGTAGGATATGTCCTACCATGAGGCCAAATATCATTCTGAGGCGCTACAGTAATCACAAACCTATTCTCAGCAATCCCCTAC?TCGGCCAAACACTAGTAGAATGAGCTTGAGGGGGATTCTCAGTAGACAACCCCACACTTACTCGATTCTTCGCTCTTCACTTCCTACTCCCATTCGTCATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTACACGAAACAGGATCAAACAACCCAACCGGAGTCCCCTCAGACTGCGACAAAATTCCATTCCACCCATACTACACCGTAAAAGATATCCTAGGCTTCGCATTAATAATTTCACTACTAGTCTCCCTAGCTCTATTCTCCCCCAACCTCCTGGGAGACCCAGAAAACTTCACCCCTGCTAACCCCCTAGTCACACCCCCTCACATCAAACCCGAATGATACTTCCTATTCGCTTACGCCATCCTACGATCCATCCCAAACAAACTAGGAGGCGTATTAGCCCTAGCAGCCTCAATCCTTGTACTATTCCTCCTGCCTCTACTCCACACATCAAAACTACGATCAATGACCTTCCGACCTATCTCCCAAATCCTATTCTGAGCCCTAGTTGCAAACGTCCTAATCCTGACATGAGTAGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCATTCACCTACTTCACAATTATCCTAGTACTCTTCCCTCTCGCGGCTGCACTAGAAAACAAACTATTAAAACT----------CTA-ACC-----------GACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGAATAGACCCCTTCTTAGAGTT Corvus_frugilegus_NC_002069 GTCCATGTAGCTTACAACAAAGCATGACACTGAAGATGTCAAGACGGCTGC--CACA-AACACCCCATGGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCCAGAATTATACATGCAAGTATCCGCGTTCCAGTG-TAAATGCCCT-GGCA-CCCTTTAACC-------AAGTCGATAGGAGCGGGCATCAGGCACA---------CAC-A--ATTGTAGCCCAAGACGCCTTGCACTTGCCACGCCCCCACGGGTATTCAGCAGTGGTTAACATTAAGCAATGAGTGTAAACTTGACTTAGTCATGGCAACCT---TAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACTCAAATTAACAGTA--T----AACGGCGTGAAGGGTGGTAAC-ATGCTAT-CTAAGTAACTAAGATTAAAAAGCAACTGAGCTGTAATAAGCCCAAGATGC-TCATAAGGCCAAC--TACCAAAGAAGATCTTAGGCT--GACGATTGATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-CTA--TGCTACCTGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCACTCCTCGC-TGA--AT--CAGCCTACATACCGCCGTCGCCAGCCCACCCCC---CTGATGGTTCAACAGTGAGCGCAATAG-TCCAA--CACACTAGTAAGACAGGTCAAGGTATAGCCCATGGAGTG----------------------GA-AGTAATGGGCTACATTTTCTAGATTAGAACA-T----TACGGCAAAAGGGTCTGAAATGGCCCTTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCAAAAG-CG---ACCCAAACCCCTAATACATTAATACGCTAT-TC--AGCTAAAGAGGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACAA-CCAAGACGTAGC-TTAAGCA-AAAGCATTCAGCTTACACCTGAAAAATATCTGCTA-ACACCAGATCGTCTTGA-TGCCAAATTCTAGCCC--------AACC--ACATTG------ACCTGGA-ATAAC--AAAGCTACT--AC-ATA-CACCA----AACTAAAGCATT---T--ACTAGT-CTTAGTATAGGCGATAGAAAAGACACCCA-TTGGC-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATAATAATG-AAA-AAAC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAACGA--ATTTAAGTTTGCCACCCCGAAACCTAAGCGAGCTACTTGTGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTACTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-TAATAAAACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA---------AATAATCTATAGAAAGATCTCCTGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTTC-GACTAAAAAATATAAG-AACTACATGACTCCCT-CATCATTAACAGGCTAACCTATATGTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTTTA-CATTATTAACAAA-TCACCA-AGATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATCA-GGTAAATTTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACACGTCAAGGCCCGACTGTTT-ACCAAAAACATA-CCTTCAGCAAACAACAA-ACAAGTATTGAAGGTGATGCCTGCCCTGTG--ACTT-AGT---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCTCATAAATCGGGACCCGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCGATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAACTACATAAGACGAGAAGACCCTGTGGAGCTTAAAAATCAGCAGCCACCCCTTCA---CACATT----CA-CACCCA--C-T-GGGTACACGCTTTACAGGGA------ACTGGCC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAATTAGACCACAACTCTAGACTG-AGAGCGACCCCTCAACGTGCGAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGTTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCCATCTATGATG-AACTCTTCCCAGTACGAAAGGACAGGAA-AAGTGAGGCCAATACTACAG-GCAAGCCTTC-GCCTTAAGTAATGAATCCAACTAAATTACGAAAGGCTATCAC-ACCAC---AACCA-TGTCCTAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTATATCAGAGGTTCAAATCCTCTCCCTAGCTAAACTTAAA------------------------ATGGC----------CAACTATCCCATCCTAGTCAACCTCATTATAGCACTTTCTTATGCTATCCCTATTCTAATCGCCGTAGCCTTCTTAACCCTAGTAGAACGCAAAATCCTAAGCTACATGCAGGGCCGAAAAGGCCCCAATGTTGTAGGCCCTTTTGGGCTTCTACAGCCCGTAGCAGATGGGGTAAAACTATTCATCAAAGAACCAATCCGCC---------CGTCAACATCTTCCCCAATCCTATTTATCATTACCCCAATGCTAGCTCTCCTCCTAGCAATCTCTATCTGAACCCCACTTCCAATCCCATTTCCCCTCGCAGACCTAAACCTCGGACTACTATTCATACTAGCCATGTCAAGTCTAGCAGTGTACTCCATCCTATGATCCGGATGAGCCTCTAACTCAAAATATGCTCTAATCGGATCTCTACGGGCAGTAGCCCAAACAATCTCATACGAAGTAACTCTAGCAATCATCCTACTATCAATTATCCTTCTTAGCGGAAATTATACCCTAAGCACCCTAGCAGTTGTCCAGGAACCCCTATTTCTGATCTTCTCCTGCTGACCTCTCGCCATAATATGATATGTATCTACACTGGCTGAAACAAACCGCGCTCCATTCGACCTTACAGAAGGAGAATCAGAGCTAGTTTCGGGATTCAATGTAGAATATGCTGCAGGACCATTCGCCCTGTTCTTTCTAGCAGAATACGCAAACATCATACTCATAAATACACTAACCGTAATCCTATTCTTCAACCCAAGCCTGTACAAACCGCCCCAAGAACTCTTCCCTGTGATCCTAGCTACAAAAGTCCTACTTCTATCCATAGGATTCCTATGAATCCGTGCCTCCTACCCACGATTCCGATACGACCAACTAATGCACTTACTATGAAAAAACTTCCTCCCATTAACACTCGCCCTATGCCTATGACACATTAGCATGCCAATTTCCTATGCAGGTCTGCCT-----CCCTACCTAAG--GAAC------------CACCAGGAAATGTGCCTGAACAT-CAAAAGGGTCACTATGATAAAGTGAACATAGAGGTACACCAGCCCTCTCATTTCCT-A--CATC-------TTAGAAAAACAGGAATCGAACCTGTACAAGAGGGATCAAAACCCTCCATACTTCCTTTATATTATTTTCT----------------AGTAGGGTCAGCTAATCAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACCCCTTCCCCTGCTA-ATGAACCCACAGGCAAAACTAATTTTTGTCACTAGCCTACTCCTAGGTACAACCATCACAATTTCAAGCAATCATTGAATCA---TAGCCTGAACCGGCCTTGAAATCAACACACTCGCTATTTTACCCCTAATTTCAAAATCTCACCACCCTCGAGCCATTGAAGCGGCAACCAAATACTTTCTAGTTCAAGCAACCGCCTCAACTCTAGTACTATTCTCCAGCATGACTAACGCATGATACACTGGACAATGGGACATCACCCAGCTAACCCACCCCACATCCTCCCTTATCCTAACTGCAGCCATCTCAATGAAGCTTGGATTAGTGCCTTTCCACTTCTGATTCCCAGAAGTCCTACAGGGTTCCCCCCTCATTACTGGCCTTCTCCTATCCACAGCCATGAAATTTCCACCAATTACCCTACTCTATATAACTTCCCTGTCTCTCAACCCCACACTACTAACTACCCTGGCCATTCTCTCCGTAGCCCTAGGAGGCTGAATAGGACTAAACCAAACACAAACCCGAAAAATTATGGCCTTCTCCTCTATCTCTCACCTAGGCTGAATGGCCATCATCCTAATCTACTACCCTAAACTCACTCTTCTCAACTTCTATCTATATGCCATAATAACTGCTGCCGTATTCCTAACCCTAAATTCAATAAAAGTCCTAAATCTATCTACGCTAATAACTGCATGAACAAAAGCACCTTCACTTAGCACAATCCTCCTACTAACACTCCTATCCTTAGCCGGCCTCCCCCCTCTGACTGGCTTCCTCCCAAAATGACTCATTATTCAAGAACTAACTAAACAAGAAATAGCCTCAGCGGCAATTATTATCTCTCTTCTATCACTGCTGAGTCTTTTCTTCTACCTCCGTCTTGCATATTGTGCAACAATCACGCTCCCACCTCACACAACAAATCACATAAAACAGTGACATACAAATAAACCAATCAACCCCTCAATCGCCGTTCTGACCACCCTCTCCATTATGCTCCTCCCAGTTTCCCCCATACTTACTACCATTAT------TT-AAAGAGAAACTTAG----GTTTACTG--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGTTAAAATCCGCAGGACGTTATCCTGCATCCCCTGAATGCAACTCAGATGCTTTAA-TTAAGCTAGGATTTT---TACACCCCCCTAGACAGATGGGCTTCGATCCCATGATAC-TATAGTTAACAGCTATATGCCCCAAACCAACAGGCTTCTGCCT-AGC-----------AGACTCCGGTGTACTG-TTAGTACACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACTTTCATCAACCGATGACTATTCTCAACTAACCACAAAGACATTGGCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCAGGTGCTCTGCTAGGAGACGACCAAATCTACAATGTAATCGTTACAGCCCATGCTTTCGTCATAATTTTCTTTATAGTAATGCCAATCATAATCGGAGGATTTGGAAACTGACTAGTTCCTCTAATAATTGGTGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCCTCATTCCTCCTCCTTCTAGCTTCTTCAACAGTAGAGGCAGGAGCAGGAACAGGATGAACTGTGTACCCACCACTAGCTGGTAACCTAGCTCATGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCACTTCACCTAGCAGGTATTTCCTCCATCCTAGGGGCAATTAACTTCATTACCACAGCAATCAACATGAAACCTCCAGCCCTATCACAATACCAAACCCCTCTGTTCGTATGATCCGTACTAATTACCGCAGTACTACTCCTTCTCTCTCTACCCGTACTTGCTGCAGGAATCACTATGCTCCTAACAGACCGAAACCTCAATACCACATTCTTTGATCCAGCCGGAGGAGGAGATCCAGTACTATACCAACATCTATTCTGATTCTTCGGACACCCAGAAGTTTATATCCTAATCCTACCAGGATTCGGCATCATCTCTCATGTAGTAGCATACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGAATAGTATGAGCTATGCTATCCATTGGGTTCCTAGGTTTCATCGTTTGAGCACACCACATGTTTACAGTCGGAATGGACGTAGACACTCGAGCATACTTCACATCCGCCACCATAATCATTGCCATCCCCACCCGAATCAAAGTATTCAGCTGACTAGCAACTCTACACGGAGGAACAATCAAATGAGACCCACCAATGCTGTGAGCCCTAGGATTCATCTTCCTATTCACTATTGGTGGACTGACAGGAATTGTCCTAGCAAACTCCTCTCTAGATATTGCCCTACACGATACCTACTATGTAGTAGCTCATTTCCACTACGTACTATCCATAGGTGCAGTATTTGCAATCCTAGCAGGATTCACCCACTGATTCCCGCTATTCACCGGATACACCCTACACTCTACATGAGCTAAAATCCACTTCGGAGTAATATTCGTGGGAGTAAACCTCACCTTCTTCCCCCAACACTTCCTTGGACTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACCCTATGAAACACTATCTCATCAGTAGGCTCACTAATCTCCCTAACTGCCGTAATCATGCTAATGTTCATCATCTGAGAAGCTTTCGCATCCAAACGCAAAGCCCTACAACCAGAACTTATTAGCACAAACGTTGAATGAATCCACGGCTGCCCACCCCCATTCCACACATTTGAAGAACCAGCCTTCGTTCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATT-TAGAGGTGTTAGT-AAAACC-ATTACATAG-TCTTGTCAAGACTAAATTACAGGTGAAAGCCCAGTACACCTCAA---CAC----AAATATGGCCAACCACATGCAATTCGGTTTTCAAGACGCTTCATCCCCTATCATAGAAGAACTAGTTAAATTCCACGACCACGCTCTAATAACCGCCCTAGCTATCTGTAGCCTGGTACTATACCTACTAACTATAATACTCACAGAAAAACTATCATCCAGCACAGTCGATGCCCAAGAAATCGAACTTGTCTGAACAATCCTTCCTGCAGTCGTACTAATCATGCTTGCTCTACCATCCCTACAAATCCTCTACATAATGGATGAAGTTAACGAGCCCGACCTGACACTAAAAGCCATTGGGCACCAATGATACTGATCCTACGAATACACTGACTTCAAGGACCTAACATTTGACTCTTACATGACACCAACTGCAGACCTACCACTAGGCCACTTTCGACTACTAGAAGTGGACCACCGCGTAGTAGTCCCAATAGAATCACTAGTCCGGGTCATCGTTACTGCCGACGACGTACTTCACTCATGAGCCGTTCCAAGCCTAGGCGTAAAAACTGACGCAATCCCAGGACGACTAAACCAAACCTCATTCACCGCCACCCGACCTGGAGTATTCTACGGTCAATGCTCAGAAATCTGCGGGGCTAATCACAGCTTCATACCAATTGTAGTTGAATCCGCCCCACTCGCTGACTTCGAGAACTGATCTTCTCTAC---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCACTAGCCTTTTAAGCTAGAGAAAGAGGACT-ATCTATCCTCCTTAATGGTATGCCTCAACTAAACCCAAATCCATGATTTTTTATCATGCTAACTTCGTGACTCACCTACTCCATAATCATCCAACCCAAACTACTATCCTTTATCACCATAAACCCTCCACTTAACAAAA---CTCAAACAACCCTAACCACCTCCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCACTACTAGGTATCCCACTGATCCTAATTGCAATAACATTCCCTGCTCTCCTGCTGCCGACCCAAGGCAACCGATGAATCACCGATCGCCTATCTACCCTACAATCATGATTCATTAACCTAGTCACAAAACAACTAATAATACCACTAGGCAACAAAGGACACAAATGAGCCTTAATCCTGACATCACTAATAATCTTCCTATTACTTACTAACCTACTAGGCCTACTGCCCTACACATTCACGCCAACAACCCAACTTTCTATAAACCTAGCCCTAGCAATTCCCCTATGACTTGCCACCCTACTTACAGGGCTACGTAACCAACCCTCAATCTCCCTAGGCCATCTCCTACCAGAGGGCACCCCAACCCCACTAATCCCAGCCCTAATCCTCATTGAAACAACCAGCCTCCTTATTCGTCCCCTAGCCCTAGGCGTTCGTCTCACAGCCAATCTTACAGCAGGCCACCTACTAATCCAACTTATTTCAACGGCCACTGCCGCCCTAGTCTCAACAATACCAATAATCTCACTACTAACACTATTAGTCCTATTCCTACTTACAATCCTAGAAGTAGCAGTAGCCATAATCCAAGCCTACGTATTCGTGCTACTACTAAGCCTGTACCTACAAGAGAACATCTAAATC-----ACCAATGACTCACCAAGCACACTCCAGCCACATAGTTGACCCTAGCCCATGACCCATCCTAGGAGCAGCCGCCGCTCTCCTTACTACATCCGGCCTAACCGTGTGATTCCACCATAACTCGCCTTACCTACTGATTATTGGACTCACCTCCACTGCCCTAGTCATGCTCCAATGATGACGAGACATCGTCCGAGAAAGTACATTCCAAGGCCACCACACGCCTACAGTACAAAAAGGCCTACGATATGGAATAGTCCTATTCATCACATCAGAGGCTTTTTTCTTCCTAGGTTTCTTTTGAGCATTCTTCCACTCCAGCCTAGCCCCAACACCAGAACTAGGGGGACAGTGACCTCCAGTTGGAATTAAACCTCTAAATCCAATAGACGTTCCCCTCCTAAACACTGCCATCCTACTTGCCTCAGGGGTTACAGTCACATGAGCACACCACAGCATCATAGAAGCTAACCGAAAACAAGCAATCCACGCCCTTACCCTCACAGTTCTACTAGGCTTTTACTTCACTGGCCTACAAGCCATAGAGTACTACGAAGCTCCATTCTCCATCGCTGATGGGGTGTACGGCTCTACCTTTTTCGTAGCAACTGGATTCCACGGCCTTCACGTAATTATTGGTTCCACATTCCTCCTAGTATGTCTCCTACGCCTAATCAAATACCATTTTACACCAAAACACCACTTTGGCTTTGAAGCAGCAGCTTGATACTGACACTTTGTAGACGTCGTATGACTATTCCTCTATATGACTATCTACTGATGAGGATCCTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAATCCAGAGAAGAGTAATG---AACATAATCCTATTCATGATAATCTCATCATTAATTCTAAGTGTCATCCTCACCGCACTAAACTTCTGATTAGCACAAATAAACCCAGACTCAGAGAAACTATCCCCATACGAATGTGGATTTGACCCATTAGGGTCCGCCCGGCTGCCATTTTCAATTCGATTCTTCCTAGTAGCAATCCTATTTCTACTATTTGACCTAGAAATTGCACTGCTTCTTCCACTACCATGAGCCATCCAGCTACAAACCCCTACCATTACCCTAACATGAGCCTCCATCCTCATTCTTCTCTTAACTCTAGGCCTAGTATACGAGTGAAGTCAAGGAGGATTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAATCAAGACAGTTGATTTCGACTCAACAGATTATAGCTCACACCCTATAACTTTCTTAATGTCTGCCCTACAACTAAGCTTTTTCTCCGCCTTCACCCTAAGCAGCCTGGGTCTGGCTTTCCACCGCACACACCTAATTTCTGCACTATTATGTCTGGAAAGCATGATACTCTCCATATATGTCGCCCTTTCTATGTGACCCATTCAAACCCAATCAACATCTGCTACCATACTACCACTTCTAATACTCGCATTTTCCGCCTGCGAAGCAGCAACAGGCCTAGCCCTGCTAGTCGCCTCTACTCGGACCCACGGCTCCGACCACCTACACAACTTTAACCTACTACAATGCTAAAAATCATCATTCCAACCATCATACTCCTACCACTAACTTTCCTCTCTCCTTGCAAGCACCTATGAACCAATACCACAACACACAGCCTACTAATTGCCACTGTCAGCCTCCAATGACTTGTTCCAACATACTACCCAAGCAAAGGACTGACTCACTGAACTTCAATCGACCAAATCTCTTCTCCTCTACTAGTTCTATCGTGCTGACTACTTCCCCTTATGCTCATAGCAAGCCAAAACCACCTAGAACAAGAACCAATTATCCGCAAACGAATCTTTATCACAACCATAATTACAGTACAACCCTTTATCCTACTAGCCTTCGCAGCCTCAGAACTAATACTATTCTACATCGCATTTGAGGCAACCCTTATTCCAACTCTAATCCTCATTACACGATGAGGAAATCAACCTGAACGACTAAACGCAGGCATTTACCTACTATTCTACACGCTTGCCAGCTCTCTCCCCCTACTAATCACAATTCTTCACCTGCACAACCAAATCGGCACATTATACTTCCCCATACTCAAACTATCACACCCAACAATAAACAACTCTTGAACAGGCCTACTAGCAAGCTTAGCTCTTCTACTAGCCTTCATAGTAAAAGCCCCCCTATATGGACTGCACCTATGACTCCCAAAAGCACACGTAGAAGCCCCAATTGCCGGATCAATACTACTAGCAGCCCTCCTCCTAAAGCTAGGTGGCTACGGCATTATACGAATCACTATCCTAGTAGATCCTTCCACAAACAACCTGCACTATCCATTCATCACCTTAGCACTATGAGGAGCAGTAATAACCAGCGCCATCTGTCTACGACAAATCGACCTGAAATCCCTGATCGCCTACTCCTCTGTAAGCCACATAGGGCTAGTCATCGCTGCAACCATAATCCAAACCCAATGAGCCTTCTCAGGAGCAATAATCCTAATAATCTCCCATGGCCTAACCTCCTCAATACTATTCTGTCTAGCCAATACAAACTACGAACGAACCCATAGCCGAATCCTTCTACTAACTCGAGGACTGCAACCACTCCTACCACTTATGGCTACCTGATGACTACTAGCAAACCTAACAAACATGGCACTGCCACCAACAACTAACCTCATAGCAGAACTAACTATTGTAGTAGCCCTATTCAACTGATCCCCACTGACAATTATTCTAACAGGAACTACAATTGTACTAACTGCCTCCTACACCCTCCACATACTAATAATAACACAACGAGGAATACTGCCATCCCACATCACCTCAATTCAAAATTCCTCTACACGAGAACACCTCCTGATAGCCCTACATATAATCCCCATAATCCTACTTATTTTCAAACCTGAACTAATCTCAGGAATCCCCATAT-GCAAGTATAGTTT--AA-CCAAAACATTAGATTGTGATTCTAAAAATAGAAGTTAGACCCTTCTTACTTGCCGAGGGG-AGGTT-AAACCAACAAGAACTGCTAATTCTTGCATCTGAGCATAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCAGTAATCTTGGTGCAAATCCAAGTGAAAGT--AATGGATCAAATATTTATCCTAAACACATTCATACTACTCACCCTAGCAGTCCTCTGCACCCCAATCATCTTCCCAATACTATCAGACAGTCTAAAAAACACCCCAACTATTATTACTAATACTGTCAAGACTTCCTTCCTAATTAGCCTAGTCCCCATAACCATTTACATTCACTCAGGAATAGACAGCCTAACTTCTTTCTGAGAATGAAAATTCATTATAAACTTCAAAATCCCTGTCAGCCTAACAATAGACTTCTACTCACTAACTTTCTTCCCAATCGCCCTATTCGTCTCCTGATCAATCCTACAATTTGCAACATGATACATAGCTTCAGACCCGCACATCACAAAATTTTTCACCTTCCTCCTCCTATTCCTCATTGCCATACTCATCCTAATTATCTCCAACAACCTATTCCTACTATTCATCGGATGAGAAGGGGTAGGAATCATATCCTTCCTACTAATTAGCTGATGACATGGCCGGGCAGAAGCAAACACCGCTGCCCTACAAGCCGTACTATACAACCGAGTCGGAGATGTAGGGCTCATCCTATGTATAGCATGACTAGCCTCCACCATAAACACGTGAGAAATTCAACAAATTTCATCTCAAGACCAAACCCCTACACTACCACTACTAGGCCTAATTTTAGCTGCGGCCGGCAAATCCGCCCAATTTGGCCTCCACCCGTGACTGCCAGCTGCTATAGAAGGCCCAACCCCTGTGTCTGCCCTACTCCACTCCAGCACCATAGTAGTTGCCGGAATTTTCCTACTCATTCGAACTCACCCCCTCTTCCACAATAACCCTACTGCCCTATCCCTATGCCTATGTCTAGGGGCCCTTTCCACACTATTTGCAGCCACCTGCGCCCTAACCCAAAACGATATCAAAAAAATCATCGCTTTCTCCACATCCAGCCAACTAGGCCTAATAATAGTTACAATCGGCCTAAACCTACCTCAACTGGCCTTCCTACACATTTCAACTCATGCATTCTTTAAGGCCATACTATTCCTATGCTCCGGGTCAATCATCCACAGCCTTAACGGCGAACAAGACATCCGAAAAATAGGGGGCCTTCAAAAAATACTACCAACAACAACTTCATGCCTAACTATTGGAAACCTAGCCCTAATAGGAACGCCATTCCTAGCAGGATTTTACTCCAAAGACCAAATCATCGAAAGCCTAAACACCTCATACCTGAATGCCTGAGCTCTAGTTCTAACCCTCCTAGCCACATCATTTACCGCAGTCTATACTATTCGAATAACCCTATTAGTCCAAACAGGATATGTTCGAATCCCCCCTTTAACTCCTATAAACGAAAACAACCCAGCAGTTCTTTCTTCAATCACCCGCCTTGCACTAGGAAGCATCGTAGCAGGTTTCCTAATCACTTCATACATTCCACCTGCAACAAAAACCCCACCAATAACTATACCACTCTCTATCAAAATTACAGCCCTCGTAGTAACACTACTAGGAATTATTCTAGCCCTAGAACTCTCAAAAATAACTCAAGCCTTAATCCTCCCTAAACAGAATCGCTTCTCAAACTTCTCTACAACCCTAGGATACTTTAATCCCCTAGTACACCGATTTATCTCAACAAAACTACTAAGCGGGGGCCAAAACATTGCCTCCCACCTAATTGACCTCTCCTGATATAAACTTCTAGGCCCTGAAGGACTAGCCAACCTGCAAATAATAGCATCAAAAACCGCTACCACCTTCCACACAGGGCTAATTAAAGCCTACCTAGGATCTTTCGCCCTATCAATCTTCATTATCCTTC---TATCCACATACAGAAC--CAAACCT---AATGGGCCTAAATCTACGAAAAAACCACCCACTACTAAAAATCATCAACAATTCCCTAATTGACCTTCCAACCCCATCAAACATCTCAGCTTGATGAAACTTTGGATCCCTACTAGGCCTATGCCTAATCATACAAATCATTACAGGTCTGCTACTAGCCATGCACTACACAGCAGATACCTCCCTAGCCTTCGCTTCTGTAGCCCACATATGCCGAGACGTACAATTCGGATGACTAATCCGAAACCTCCACGCAAACGGAGCTTCCTTCTTTTTCATTTGCATCTACCTACACATCGGCCGAGGATTTTACTACGGTTCATACCTAAACAAAGAAACCTGAAACATCGGAGTAATCCTTCTCCTAACACTAATAGCAACTGCCTTCGTAGGCTACGTTCTGCCTTGAGGACAAATGTCTTTTTGAGGAGCAACAGTTATCACAAACCTTTTCTCAGCAATCCCATACATTGGACAAACACTGGTAGAATGACTATGAGGTGGATTCTCAGTAGACAACCCCACACTAACCCGATTCTTTGCCTTCCACTTCCTCCTACCCTTTGTAATCGCAGGCCTAACACTAGTTCACCTAACCTTCCTTCACGAAACAGGCTCAAACAACCCGCTAGGTATTCCCTCAGACTGCGACAAAATCCCATTCCACCCATACTACTCAATCAAAGATCTACTAGGATTCGCACTAATGCTCATCCCTCTCATCACCCTGGCTCTATTCTCCCCAAACCTTCTAGGAGACCCAGAAAATTTCACGCCCGCCAATCCTCTAGCCACACCCCCACACATTAAACCTGAATGATACTTCCTATTTGCATACGCCATTCTACGATCTATCCCAAACAAACTAGGAGGAGTCCTAGCCCTGGCCGCCTCAGTCCTAGTCCTATTCCTAATCCCTCTCCTCCATGTCTCTAAACAACGTTCCATAACCTTCCGACCCCTATCACAAATCCTATTCTGAACCCTAGTTGCAGACCTCCTAATCCTAACATGAGTAGGAAGCCAACCAGTCGAACACCCATTCATCATTATTGGCCAACTAGCCTCCTTCGCCTACTTCGCAATCATTCTAATCCTATTCCCTGTCGTGAGTGCGCTAGAAAATAAAATTCTCAAACT----------TTA-ATT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACATCTTCTTAGAGTT Curaeus_curaeus_JX516070 GTCCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGGGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTAAGCTGTCGCAAGCCCAAGATGT-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACCTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCTCACCTACA--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAAAATAGAACA-C----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG----CCCCCTCCCCCCATAAAGTAATAAGTTAT-CC--AGCCGGAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAGCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-T-A-AACCT----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAGTG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-CTACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ATTAACCCC-TCTAAC-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTGC-ACCACAAAAATATAAG-AACCTTATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCGAGCTTACATCCGTA-CATTATTAACAAA-TCTCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-CAG-TATTA-AATGTA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCGACCACC--TTAAAT-CACACA----CT-CACCCA--C-T-GGGTTCACTGAC-ACA-TAA-GA-C-TTTGGTC-TACG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTGGACCATACCTCTAGACTA-AGAGCAACCTCTCAACGTGCTAATAGCAACCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCTCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AGCTCTTCCCAGTACGAAAGGATAGGAA-AAGCGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAATCAACTTAATTACAAAAGGCTATAAT-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TCAACC---TA-----CC---C--C----ATGAC----------CAACTACCCCCTCCTGATCAACTTTATCATAGCCCTCTCCTATGCCCTACCAATTTTAATCGCAGTAGCTTTTCTCACATTAGTAGAGCGCAAAATTCTGAGTTACATGCAAGGCCGAAAAGGCCCAAACATCGTCGGCCCATTTGGACTCCTCCAACCCCTAGCAGACGGTATTAAACTATTCATCAAAGAACCCATCCGAC---------CTTCAACATCCTCCCCAATCCTATTTATTGCGACCCCCGTCCTAGCTCTCCTCCTGGCCATCTCAATCTGAACCCCACTACCCCTCCCATTCTCTCTAGCAGACCTCAATCTAGGACTTCTTTTCCTACTAGCCATGTCAAGCCTAGCGGTGTACTCCATCCTATGATCAGGCTGAGCCTCCAACTCCAAATACGCTCTAATCGGAGCACTACGAGCGGTAGCCCAGACAATCTCCTACGAGGTAACCCTGGCTATCATTCTTCTCTCCGTTGTCCTACTTAGCGGTAACTACACCCTGAACACCCTCGCAGTCACCCAAGAGCCCTTATACCTTATCTTCTCCTGCTGACCCCTTGCTATAATATGATACGTCTCTACACTAGCTGAAACCAACCGTGCTCCCTTTGACCTGACAGAGGGGGAGTCTGAACTAGTATCAGGATTCAACGTAGAATATGCAGCAGGTCCTTTTGCACTCTTCTTTCTAGCCGAGTACGCCAACATTATGCTAATGAACACACTAACCACAATCCTATTCTTCAACCCAAGCCTCTTTAACCCGCCTCAAGAGCTATTCCCCGTCATCCTGGCCACAAAGGTCCTGCTTTTATCAGCAGGATTCCTATGAATTCGTGCCTCCTATCCACGGTTCCGATACGACCAATTAATACACTTATTATGAAAAAATTTCTTACCACTCACACTAGCCCTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGCCTACCC-----CCCTACCTA-A--GA-AC-----------CTGTTGGAAATGTGCCTGAACAC-T--AAGGGTCACTTTGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-T--ATAA-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGGAATCAAAACCCTCCATACTCCCTTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATTTTCACCACTAGCCTACTTTTAGGGACAACTATCACTATCTCAAGCAACCACTGAATTA---TAGCTTGAACCGGCCTTGAAATTAATACACTTGCCATCCTCCCACTAATCTCTAAATCCCACCACCCACGAGCCATTGAAGCTGCCACTAAATACTTCCTAACCCAAGCAGCTGCCTCCGCCCTCGTCTTATTCTCCAGCATAACCAATGCGTGACACACTGGACAATGAGACATCACTCAACTTACCCACCCAACATCCTGCTTGATTCTCACCTCAGCAATCGCAATGAAACTAGGACTAGTGCCATTCCATTTCTGATTCCCAGAAGTACTCCAAGGTTCTCCCCTCATCACTGGCCTACTCCTGTCAACTATCATAAAACTCCCCCCAATTACATTACTCTACATAACTTCCCCCTCACTAAACCCAACACTACTAACTATCCTAGCCATCTTCTCCGCAGCACTCGGAGGTTGAATAGGCCTCAACCAGACACAAATCCGAAAAATCTTAGCCTTTTCATCCATCTCCCACCTAGGCTGAATATCAATTATTATCATCTACAACCCAAAACTCACACTCCTTAACTTCTACCTGTACGCCGTAATGACCGCAACCATCTTCCTTACTCTAAACACAATCAAAGTACTAAAACTATCCACCCTAATAACCGCATGAACTAAAACCCCATCCTTAAACGCAATACTTCTCCTAACCCTGCTCTCCCTTGCAGGACTCCCTCCTCTGACAGGATTCCTGCCCAAATGACTTATCATCCAAGAACTAACGAAACAAGAAATAGCCCCAACAGCTACACTTATCTCCCTACTTTCCCTACTAAGCCTGTTCTTCTACCTCCGACTAGCGTACTGCGCAACCATCACACTCCCCCCACACACCACAAACCACATAAAACAATGACGCACTAACAAACCAACTAACATCGCAACCTCCGTCCTGATCATTATGTCCGTCATACTCCTCCCCATCTCCCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGTTAAGATCCGCAGGCCATTATCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAA----TCTAGACAGATGGGCTTTGATCCCACGATAG-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTGCCT-A-------------AGGCCCCGGTGCACTA-TTAATACACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGACTATTCTCAACTAACCACAAAGACATTGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGTCAGCCTGGAGCCCTCCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGGTTCGGGAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTACTTCCACCATCCTTCCTCCTCCTCCTAGCATCTTCCACAGTTGAAGCAGGCGCAGGAACAGGCTGAACAGTATATCCCCCACTAGCAGGTAACCTAGCCCACGCCGGAGCTTCAGTCGACCTAGCAATTTTCTCCCTACACCTAGCCGGTATCTCCTCAATCCTAGGGGCAATCAACTTTATTACGACAGCAATCAACATAAAACCCCCTGCCCTATCACAGTACCAAACCCCTCTATTTGTTTGATCCGTCCTAATTACTGCAGTACTACTACTTCTATCCCTTCCAGTTCTTGCCGCAGGAATCACAATACTTCTAACAGACCGCAACCTTAACACTACATTCTTTGACCCTGCCGGAGGAGGAGACCCCGTACTATACCAACACTTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGGATCATCTCCCACGTTGTAGCCTACTACTCAGGCAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCCATGCTATCTATCGGATTCCTAGGCTTTATTGTCTGAGCCCACCACATATTCACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCTATCCCAACCGGAATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCACCAATACTATGAGCCCTAGGATTTATCTTCCTATTTACTATCGGAGGACTAACAGGAATCGTACTAGCAAACTCTTCACTAGACATCGCCCTGCACGACACCTACTACGTAGTAGCTCACTTCCACTACGTACTATCTATAGGAGCAGTATTCGCAATTCTAGCAGGTTTCACCCACTGATTCCCCCTATTCACCGGATACACGCTCCACTCAACATGAGCTAAAACACATTTCGGCGTAATATTCGTAGGTGTAAATCTAACCTTCTTCCCCCAACATTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACCATTTCCTCAGTGGGCTCACTCATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTTGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAACACTAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCGAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACTT--AAACATGGCCAACCACTCACAACTTAACTTCCAAGATGCCGCCTCACCTATTATAGAGGAACTAATAGGATTCCACGACCATGCCCTAATAATCGCACTAGCAATCTGTAGCCTTGTCCTCTACCTACTAACCCACACTCTCACAGAAAAACTGACATCAAACACAGTCAACGCACAAGTAATCGAACTAGTCTGAACAATCCTCCCTGCCCTAGTCCTAGTCACACTTGCTCTACCATCCTTACGAATTCTCTACATAATGGATGAAATCAACGAACCAGACCTAACCCTAAAAGCCATTGGCCACCAATGATACTGAACATATGAATACACTGATACCAAAGATCTAACATTCGACTCCTACATGATTCAAACAGCAGACCTACCCTTAGGCCATTTCCGCCTACTAGAAGTCGACCATCGTGTTGTCGTTCCCATAAACTCAACCATCCGAGTCATCGTCACCGCCGATGACGTCCTCCACTCATGAGCTGTCCCCAGCCTAGGTGTAAAAACCGACGCAATCCCAGGACGTCTTAACCAAACTTCCTTCCTTGCCTCTCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCTACCCCACTCGCCAACTTCGAAAGCTGATTCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGG--ACCCCCCCTCCTTAATGGTATGCCCCAACTAAACCCCAACCCCTGATTTTTTATCATGCTCACTTCATGACTCACTTTCTCTCTAATCATCCAACCCAAACTCTTAACGTTCGTGTCAATGAATCCACCATCTAACAAAC---CGCCCGCCGCCCCAAGCACTACCCCCTGAACCTGACCATGAACCTAAACTTCTTTGACCAATTCTCAAGCCCATCATTCTTAGGAATCCCACTAATCCTCATCTCAATAACATTCCCAGCTCTTCTCCTACCATCCCTTGACAACCGATGAATCACTAACCGATTATCAACCCTACAACTCTGATTTGTCAACCTGGTCACAAAACAACTAATAATGCCTCTAGACAAAAAAGGACATAAATGGGCCCTAATCCTGACATCCCTCATAATCTTCCTCCTCCTCATCAACCTTCTAGGCCTACTACCATATACATTCACCCCAACCACCCAACTATCCATAAATCTAGCTTTAGCCTTCCCCCTATGACTAGCCACACTCCTAACAGGACTGCGAAACCAACCCTCTGCCTCACTAGGCCATCTCCTGCCAGAAGGCACACCCACTCCACTAATCCCAGCCCTCATCCTGATCGAAACAACAAGTCTTCTCATCCGCCCACTAGCACTGGGCGTTCGCCTAACAGCCAACCTAACAGCAGGTCACCTTCTAATCCAACTTATTTCCACCGCCACAACAGCCCTATTCTCCACGATACCACTAGTCTCACTTCTAACCTTCGCAGTCCTCTTCCTACTAACAATTCTGGAAGTAGCAGTGGCAATAATCCAAGCCTACGTCTTCGTACTCCTACTAAGCCTCTACCTCCAAGAAAACATCTAACCT--TA----AATGGCACACCAAGCACACTCCTACCACATAGTTGACCCAAGCCCATGACCTATCCTGGGAGCAGTCGCTGCTTTCCTTACTACCTCAGGACTAACAATATGATTCCACTGAAACTCTCCTCGACTCCTTATCTTAGGCCTACTGTCAACCATCCTCGTCATATACCAATGATGACGTGACATTGTACGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGACTACGATACGGTATAGCCCTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGATTTTTCTGAGCTTTCTTCCACTCAAGCCTAGCCCCTACACCAGAACTAGGAGGGCAATGACCACCCGTAGGAATTAAACCCCTCAACCCCATAGAAGTCCCACTCCTAAACACTGCCATCCTCCTAGCCTCAGGAGTTACTGTCACATGAGCACATCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTATCCCTAACAGTCCTCCTAGGCTTCTACTTCACCGCCCTACAAGCCATAGAATACTATGAAGCACCCTTCTCCATCGCCGATGGAATTTACGGCTCAACATTCTTCGTCGCCACCGGATTCCACGGCCTACATGTAATTATTGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCGAACCACCACTTCGGATTTGAAGCTGCCGCTTGATACTGACACTTTGTAGACGTTGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAATCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTAACCCTATCACTAACCCTAAGCATCCTCCTAACCATACTAAACTTCTGACTTGCCCAAATAACCCCTGACTCAGAAAAACTATCCCCCTACGAATGCGGATTCGACCCATTGGGGTCTGCTCGACTCCCCTTCTCCATCCGCTTCTTCCTAGTAGCTATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTTCCACTGCCCTGAGCCATCCAACTACAATCCCCCACCACCACCCTAACCTGAACTGCTACACTCATCTTCCTACTCACCTTAGGCCTAGTGTACGAATGAATTCAAGGCGGATTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTACAACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCAGCCTTCACTCTAAGCAGTCTTGGCTTAGCCTTCCACCGAACCCACCTAATCTCCGCCCTACTATGTTTAGAGAGCATAATACTATCCATATACGTCGCCCTAGCCATATGACCCATCCAAATCCAATCACCAATATCCACTATCCTACCTATCCTCATACTAACATTCTCCGCCTGCGAGGCAGGCACAGGCCTAGCATTGCTAGTAGCCTCAACTCGCACCCACGGATCCGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCATAACACTCCTCCCCCTAGCCCTCCTCTCCTCACGTAAACACCTATGAACCAACACTACACTGTACAGCCTACTAATTGCTGCCCTCAGCCTACAATGACTCACACCCACATACTACCCAAACAAAAACCTAACTCCATGAACATCAATTGACCAAATCTCCTCTCCTCTACTAGTCCTCTCATGCTGACTCCTCCCCCTAATAATCATAGCAAGCCAAAACCATCTAGAACAAGAACCCATCAGCCGTAAGCGAATCTTTGCCTCAACACTAATCTTAGCTCAACTATCCATCCTACTAGCATTCTCAGCCTCCGAACTGATACTCTTCTACATCGCATTTGAAGCTACCCTCATTCCTACCCTAATCCTTATCACACGATGAGGGAGCCAACCAGAACGTCTAAACGCTGGCATCTACCTCCTATTCTACACTCTAGCTAGCTCACTCCCACTACTAATTGCCATCCTCCACCTACAAAACCAAATTGGCTCACTCTACCTACCAATACTCAAACTTTCACATCCAACGTTAAACTCTTCTTGATCTAGCTTAGCTGCAAGCCTAGCCCTTCTACTAGCCTTCATAGTTAAAGCCCCCCTGTACGGCCTACACCTATGACTACCCAAAGCCCACGTAGAAGCCCCAATTGCCGGCTCAATGCTACTAGCAGCCCTACTACTAAAACTCGGAGGTTATGGTATTATACGAATCACAATCTTAGTGGACCCGTCATCAAACAACCTCCACTACCCCTTCATCACCCTAGCCCTGTGAGGAGCAGTAATAACCAGTGCCATCTGCTTACGCCAAATTGACCTAAAATCACTAATTGCTTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCTGCAACCATAATTCAAACCCAATGAGCATTCTCAGGGGCAATAATTCTAATAATTTCACACGGCCTGACTTCCTCAATACTATTCTGCCTAGCTAATACCAACTACGAACGAACCCACAGCCGAATTCTTCTACTCACACGAGGACTCCAACCCCTCTTACCACTCATAACCACCTGATGACTATTAGCCAACCTGACAAACATAGCCCTCCCACCCACAACAAACCTCATAGCAGAACTAACCATTGTAGTGGCACTTTTCAACTGATCTGCCCTAACAATCATCCTAACAGGAACTGCCATCCTACTCACCGCCTCATACACCCTATACATACTAATCATGACGCAGCGAGGCACCCTCCCATCCCATATTACATCAATCCAAAACTCTTCTACGCGGGAACATCTTCTCATAGCCCTGCACATAATCCCAATAATCCTACTAATCTTCAAACCCGAACTGATCTCCGGCATCCCTACAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGGG-AGGTA-TAACCAGCGAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAATACATTCATACTCCTAACCCTAACAACCCTCTCCACTCCTATCCTACTCCCATTACTATCCGACAATCTCAAAAACACTCCTAACACAATCACAAACACAGTCAAAACCTCGTTCCTAATCAGTCTCATCCCCATAACAATCTTCATCTACTCAGGAACAGAGAGCCTCATCTCCCTCTGAGAATGAAAATTCATCATAACCTTCAAAATCCCAATTAGCTTAAAAATAGACTTCTACACACTCACCTTCTTCCCCATTGCACTATTCGTATCATGATCCATCCTACAATTCGCAACATGATACATAGCCTCAGACCCTTACATCACAAAATTCTTCACCTACCTCCTATTCTTCCTAATCGCCATACTCATCCTAATCATCGCCAACAACCTATTTGTCCTATTCATCGGCTGAGAGGGGGTCGGAATTATATCTTTCCTCCTAATTAGCTGATGACACGGCCGAGCGGAAGCCAACACCGCCGCTCTACAGGCCGTCCTCTACAATCGAATCGGCGACATCGGCCTTATCCTATGCATAGCATGACTAGCCTCCACTATAAACACCTGAGAAATCCAACAACTCTCTACCCCCTCCCAAACTCCCACATTACCCCTATTAGGTCTCATCCTAGCTGCAACTGGAAAATCCGCCCAATTCGGTCTACACCCATGACTTCCAGCCGCAATAGAAGGACCAACCCCCGTATCTGCCTTACTCCACTCCAGCACAATAGTAGTAGCAGGGATCTTCCTACTCATCCGAACTCACCCCCTATTCAACAACAACCAAACTGCCCTAACCCTATGCCTCTGCCTAGGAGCCATCTCCACCTTATTTGCAGCCACATGCGCCCTAACCCAAAACGACATTAAAAAAATCATTGCTTTCTCCACCTCCAGTCAACTAGGCCTAATGATAGTTACAATCGGATTAAACCTACCCGAACTAGCTTTCCTCCACATCTCTACCCACGCGTTCTTCAAAGCTATACTCTTCCTATGCTCAGGCTCTATCATCCACAGCCTAAATGGCGAACAAGACATCCGAAAAATAGGAGGACTCCAAAAAATACTCCCCACAACAACTGCATGCCTTACAATCGGTAACCTCGCCCTAATAGGAACACCCTTCCTAGCAGGATTTTACTCAAAAGACCAAATCATCGAAAGCCTAAACACGTCCTACCTAAACACCTGAGCCCTAGTCCTAACCCTCCTAGCCACTTCATTCACCGCAGTATACACAATCCGCATAACCGTACTAGTACAGACCGGCTTCGTTCGAATTCCTCCCTTAACCCCAATTAATGAAAACAACCCCGCAGTAACTTCCCCCATCACCCGCCTTGCACTAGGAAGCATCTTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACAAAAACTCCCCCAATAACCATGCCACTACACATTAAAATAACCGCCCTAGTTGTAACAGCTCTAGGAATCGCCTTAGCCCTAGAAATTACAAAAATAGCCCAGACACTCATCCTCACAAAACAAAACCATTTCTCGAACTTTTCAACTTCCCTAGGATATTTTAACCCCCTAACCCACCGCCTAAACACAACCAACTTCCTCAAAGGAGGACAAAATATCGCCTCCCACCTAATCGACCTATCCTGATACAAAATACTAGGCCCAGAAGGACTAGCCAGCCTACAACTGGCAGCAACCAAAACCGCCACTACCCTCCACTCAGGTCTAACTAAAGCCTACTTAGGATCATTCGCCCTATCCATCCTCATCATCCTCA---TATCCTCACTCAGAAA--CAA-C-C---AATGGCCCCTAACATTCGTAAAAACCACCAAATCCTCAAAATCATCAACAATGCCTTAATTGATCTCCCAGCTCCATCAAATATCTCAACATGATGAAACTTCGGATCTCTACTAGGCCTTTGCTTAATCACCCAAATTATTACAGGCCTCCTGCTAGCCATACATTACACAGCAGACACTAACCTGGCCTTCTCCTCCGTAGCTCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTTCACGCAAACGGAGCCTCCTTCTTCTTTATCTGCATCTACCTACACATCGGCCGAGGTCTCTACTACGGCTCATACCTAAACAAAGAGACCTGAAACGTCGGAGTCATCCTTCTACTAATCCTAATAGCAACCGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATTACAAACCTATTCTCAGCCATTCCATACATCGGACAAACATTAGTCGAATGAGCCTGAGGAGGATTCTCCGTCGACAACCCCACACTAACCCGATTCTTTGCCCTTCACTTCCTCCTCCCTTTCGTCATTGTAGGGCTCACCGTCGTCCATCTTACCCTCCTTCACGAAACAGGATCAAACAACCCACTAGGCATCCCATCAGACTGTGACAAAATCCCCTTCCACCCCTACTATACCATCAAAGACATCCTAGGATTTGTCCTAATACTTTCCCTGCTCGCCTCACTAGCCCTATTCTCCCCCAATCTGCTAGGAGACCCAGAAAACTTCACCCCAGCCAACCCGCTAGTCACTCCTCCACACATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTTCGATCCATCCCAAACAAACTAGGAGGCGTACTAGCCCTAGCCGCCTCAATCTTAGTCCTATTCCTCATTCCACTCTTACACACATCAAAACTACGATCAATAACCTTCCGCCCTCTATCACAAATCCTATTCTGAGCCCTAGTCGCCAACGTCCTCATCCTAACTTGAGTGGGCAGCCAACCAGTAGAGCACCCATTCATCATCATTGGTCAGCTAGCCTCACTCTCATACTTTACAATCATCCTAGTCCTGTTCCCCCTCGCGGCCGCCCTGGAGAATAAAATACTCAAACT----------TTA-ATA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Cyanopica_cyanus_NC_015824 GTCCATGTAGCTTAAAGCAAAGCATGACATTGAAGACGTCAAGATGGCAGT--CACA-AACACCC-ATGGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCTAGACATATACATGCAAGTATCCGCATTCCAGTG-TAAATGCCCTAGGCACCCT-TTAACC-------AAGTCGATAGGAGCGGGTATCAGGCACA---------CAC-A--GCTGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTACTCAGCAGTAGTTAACATTAAGCAATGAGTGTAAACTTGACTTAGTCATAGCAAATC---CTAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATCAACATTA--T----AACGGCGTAAAGGGTGGTAAC-ATGCTAT-CTAAGTAACTAAGATTAAAAAGCAACTGAGCCGTAACAAGCCCAAGATGC-CCATAAAACCAAC--TACCAAAGAAGATCTTAGGCT--GACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGTCTGGCCCTAAATCTTGATGCT-CTA--TGCTACCTGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATACTACCTGACCATTCCTCGC-TGA--GC--CAGCCTACATACCGCCGTCGCCAGCCCACCCCCC--CTGATGGTTCAACAGTGAGCGCAATAGTCCATA--ACCACTAGTAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAGACTAGAACA-T----CACGGCAAAAAGGCCTGAAACGGACTTTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGATAATTAAGCCCTCTTTAAGCCGGCTCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAAG-CG-----ACCAAACTCTAATACACTAATACGCCAT-CC--AGCTAAAGAGGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACAA-CCAAGACGTAGC-TTTAACA-AAAGCATTCAGCTTACACCTGAAAGATATCTGCTA-ATACCGGATCGTCTTGA-TGCCAAATTCTAGCCC--------AATC--ACATCG------ACCCAGA-ATAAC--AAAGCTACTACAC---A-CACCA----AACTAAAACATT---C--ACTAGT-CTTAGTATAGGCGATAGAAAAGACACCCA-TTGGC-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATAATAATG-AAAAACA---TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCTTCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TTTTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAAAAT--AACAAAACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA---------AATAATCTATAGAAAGATACCATGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTTC-ACTAAAAAAATATATA-AACTACATGACTCCCT-CATCATTAACAGGCTAACCTATATGTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATGTGCA-CATTATTAACAAA-TCACCA-AGATACGA--AAAAT---------CAA---ACAAGCA-GAG-TATCA-GGTACA-TTGTTAACCCGACATA-GGAGCGTCCGTT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACACGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACAACAA-ACAAGTATTGAAGGTGATGCCTGCCCTGTG--ACTT-CGT---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCTCATAAATCGAGACCTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCGATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAACCACATAAGACGAGAAGACCCTGTGGAGCTTAAAAATCAGCAGCCACC--CCATAA-CACATT----CA-CACCCA--C-T-GGGTTCACGTTT--CA-CAAGGA---ACTGGCC-TGCA-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAATTAGACCACAAGTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGTTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATA-AACTCTTCCCAGTACGAAAGGACAGGAA-AAGTGAGGCCAATACTACAG-GCAAGCCTTC-GCCTTAAGTAATGAATACAACTAAATTACAAAAGGCTATCAC-ACCAT---A-CCA-AGCCCTAGAAAAGGG--C-CAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC----------------------------------AAGACTGGAGATCTGCGACTATCCAATTCTAATCAACCTTATTATAGCCCTTTCCTATGCCATCCCAATCTTAATTGCTGTAGCCTTCCTAACTTTAGTAGAACGTAAAATCCTAAGCTACATGCAAGGCCGAAAGGGCCCCAATGTTGTAGGCCCATTCGGACTTCTGCAACCTGTAGCAGACGGAGTAAAACTGTTCATTAAGGAACCAATCCGAC---------CATCAACATCCTCCCCAATCCTGTTCATCACTACCCCCATACTAGCCCTCCTCTTAGCCATCTCCATTTGAACACCCCTACCCATCCCATTTCCACTAGCAGACCTTAACCTAGGACTACTGTTTTTACTTACCATATCAAGCCTAGCTGTGTACTCAATTCTATGATCCGGCTGAGCCTCAAACTCAAAATACGCCCTGATCGGAGCACTACGAGCAGTAGCCCAAACAATTTCATACGAAGTTACCCTAGCAATTATCCTACTTTCTGTCATCCTTCTTAGCGGGAGCTATACCCTGAGCACCCTAGCAATTACTCAAGAACCCTTATTCCTGATCTTCTCTTGCTGACCCCTTGCCATAATATGATACGTATCTACACTAGCCGAAACAAACCGTGCTCCATTTGACCTCACAGAGGGAGAATCAGAGCTAGTGTCAGGATTCAATGTAGAATATGCAGCAGGACCCTTTGCTCTATTCTTCTTAGCGGAATATGCAAATATTATACTCATAAATACACTAACCGTTATTCTGTTTTTTAACCCAAGCCTATTCAACCCACCTCAAGAACTTTTCCCAATAATTCTAGCCACAAAAGTCTTACTATTGTCTGCAGGATTCCTATGAGTCCGTGCCTCCTATCCACGATTCCGATATGACCAACTCATGCACCTATTATGAAAAAACTTTCTCCCCCTAACACTGGCCTTATGCCTATGACACATTAGCATACCAATCTCCTATGCAGGCCTACCT-----CCCTGCCTA-A--GAACC-----------CGCCCGGAAATGTGCCTGAGCAC-CAAAAGGGTCACTATGATAAAGTGAACATAGAGGTACACTAACCCTCTCATTTCCTTA--AACC-------TTAGAAAAGTAGGAATTGAACCTACACGGGAGAGATCAAAACCCTCCATACTTCCTTTATATTATTTTCT----------------AGTAAGGTCAGCTAATCAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACCCCTTCCCCTACTA-ATGAACCCCCAAGCCAAATTAATCTTCATCACCAGTCTATTCATAGGCACAACTATCACAATCTCAAGTAACCACTGAGTAA---TAGCCTGAACCGGACTTGAAATTAACACTTTAGCCATCCTGCCCCTAATTTCAAAGTCTCACCACCCTCGGGCTATCGAAGCGGCTACCAAATATTTCTTAGTACAAGCAGCCGCCTCAACCCTAGTGCTATTCTCTAGCATAACCAATGCATGACACACGGGACAGTGAGATATTACCCAACTGACCCATCCAACCTCCTCCCTAATCTTAACCGCAGCTATTTCAATAAAACTAGGACTAGCACCATTCCACTTTTGATTCCCAGAAGTACTTCAAGGTTCCCATCTAACTACTGGCCTTCTTCTATCCACCGCTATAAAATTCCCACCAATCACTCTACTCTATATAACATCCCAATCACTGAATCCTACCCTACTCACCATAATGGCGATCCTTTCCGTAGCCGTAGGAGGATGAATAGGACTAAACCAAACACAAACTCGAAAGATCATAGCCTTCTCCTCCATTGCCCACCTAGGATGAATGGCTATCATTATCATCTACTACCCCAAACTTACCCTACTTAATTTCTACCTATACACCATAATAACCGCTGCCGTATTCCTGACCCTAAACTCAATAAAAATCCTAAAACTATCAACACTAATAACCGCATGAACAAAAGCACCCTCACTTAGCACAATCCTCATATTAACTCTTCTATCCCTAGCCGGCCTCCCCCCTCTAACCGGCTTCCTCCCAAAGTGACTTATCATCCAAGAACTAACCAAACAAGACATAGCACCAGCAGCAATAATTATCTCGCTACTATCGTTACTAGGCCTATTTTTCTACCTCCGCCTCGCATACTGCGCAACAATCACACTTCCACCTCATATCACAAACCACATAAAACAGTGACACGTCAACAAACCAATCAACACCTCAGTTGCCGTCCTAACCACTATGTCTATCATGCTTCTACCAATATCGCCCGTACTAGCCACAATCCT------TT-AAAAAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGTTAAGACCCGCAGGACACTACCCTGCATCTCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT--------ACACCTAGACAGATGGGCTTCGATCCCATGACAC-TATAGTTAACAGCTATATGCCCAAACC-AACAGGCCTCTGCCT-A-------------AGGCTCCGGTGCACGA-CTAGTACACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACTTTCATTAACCGATGACTTTTCTCAACCAACCACAAAGACATTGGCACTCTGTACCTAATTTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCATTCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTGCTAGGAGATGACCAAATCTACAACGTAATTGTTACAGCCCATGCCTTCGTAATAATCTTCTTTATAGTGATACCAATCATGATCGGAGGATTTGGAAACTGACTAGTCCCACTAATGATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAACATGAGCTTCTGACTCCTTCCCCCATCCTTCCTTCTGCTACTGGCATCCTCTACGGTAGAAGCAGGGGCAGGAACAGGATGAACTGTGTACCCCCCTCTAGCTGGTAACCTGGCCCACGCTGGAGCTTCAGTCGACCTAGCTATTTTCTCCCTACATCTAGCAGGTATCTCCTCTATCCTGGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCTCCAGCCCTATCACAATACCAAACCCCTCTATTTGTATGATCTGTACTAATCACTGCAGTACTGCTTCTCCTCTCACTCCCCGTCCTCGCCGCCGGAATCACAATGCTCCTAACAGACCGCAACCTCAACACTACATTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATCCTACCAGGATTCGGCATCATCTCGCACGTTGTAGCGTACTACGCAGGCAAAAAAGAACCATTCGGATATATAGGAATAGTATGAGCTATGCTATCTATCGGATTCCTAGGCTTCATCGTTTGAGCCCACCACATGTTCACAGTCGGAATGGACGTAGATACTCGAGCATACTTCACATCTGCCACTATAATCATTGCCATCCCAACCGGAATTAAAGTATTTAGCTGACTAGCAACCCTACATGGAGGAACAATCAAATGAGACCCACCAATGCTATGAGCCCTAGGCTTCATCTTCCTCTTTACCATTGGTGGACTAACAGGAATCGTCCTAGCAAACTCTTCCCTGGACATTGCCCTACACGACACTTATTACGTAGTAGCTCACTTCCACTACGTCCTATCCATGGGAGCAGTATTTGCAATCCTAGCAGGTTTCACCCACTGATTCCCACTATTCACCGGCTACACCCTACACTCCACATGAGCCAAAATTCACTTCGGAGTAATATTCGTAGGAGTAAACCTCACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGATTATCCAGACGCCTACACCCTATGAAACACTATCTCCTCAGTGGGATCACTAATCTCTCTAACCGCCGTAATCATGCTAATGTTCATCATCTGAGAAGCCTTCGCATCCAAACGCAAAGCTCTTCAGCCTGAACTAGTCAGCACAAACGTTGAATGAATCCACGGCTGCCCTCCCCCATTCCACACATTCGAAGAACCAGCCTTTGTCCAAGTC------CAAGAAAGGAAGGAATCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AC--AAACCACTTATGCTTCTTTCTC---ATT--AGAGATGTTAGT-AAAACA-ATTACATAG-TCTTGTCAAGGCTAAATTACAGGTGAAAACCCAGTACATCTCAA---CACTA--AAATATGGCTAATCACATACAATTCGGCTTCCAAGACGCCTCATCCCCTATCATAGAAGAACTAGTAGAATTCCACGACTACGCTCTAATAACTGCCCTAGCTATCTGCAGCCTAGTACTATACCTGCTAACCCTCATACTCACTGAAAAACTATCATCCAGCACAGTCGATGCACAAGAAATCGAACTCGTCTGAACAATCCTCCCTGCAATCGTCCTAATCATGCTCGCTCTGCCATCCCTACAAATCCTATACATAATGGATGAAGTCAACGAGCCGGACTTAACACTGAAGGCCATCGGTCATCAATGATACTGATCTTATGAGTATACAGACTTCAAAGACCTAACATTCGACTCATATATGACACCAACTGCCGACCTACCACTAGGACACTTCCGACTACTAGAAGTAGACCATCGCGTAATCGTCCCCATGGACTCACTAGTACGAGTTATTGTTACTGCCGACGACGTACTACACTCGTGAGCCGTCCCAAGCCTAGGTGTGAAAACTGACGCAATTCCCGGACGACTCAACCAAACTTCATTCACTGCTACTCGACCTGGAGTGTTCTATGGACAGTGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATACCAATTGTAGTAGAATCTGCTCCACTCGCTAACTTTGAAAGCTGATCCTCCATAC---TATCATCTT----------AATCATTAAGAAGCTATGAACCAGCACTAGCCTTTTAAGCTAGAGAAAGAGGACT-ACTAATCCTCCTTAATGGCATGCCACAACTAAACCCAAACCCATGATTCTTTATCATGCTAACTTCATGATTCACCTATTCAATGATCATCCAACCTAAACTTCTATCATTCATCTCTATAAATCCCCCATCTAGCAAAA---CACAAATAACTCAAACCACCACCCCCTGAACCTGACCATGAACCTAAGTTTCTTTGATCAATTCTCAAGTCCATCACTACTAGGAATCCCCCTAATTCTAATCTCAATAACATTCCCTGCCCTATTACTACCAACCCAAAGCAATCGATGAGTCACCAGCCGACTATCAACCCTACAGCTATGGTTCATCAACCTAGTCACAAAACAACTAATAATGCCCTTAGACAAAAAAGGCCACAAATGAGCTATAATCCTAACTTCACTTATAATCTTCCTGCTACTCATTAACCTACTAGGCCTACTCCCATACACATTCACCCCAACCACCCAACTATCCATAAATCTAGCCCTAGCTGTCCCTCTCTGACTTGCTACACTGCTCACAGGCCTGCGCAATCAACCCTCAGTATCTCTAGGACATCTACTGCCAGAAGGGACCCCAACCCTACTAATCCCAGCCCTAATCCTCATCGAGACAACTAGTCTACTAATCCGCCCACTAGCTCTGGGCGTCCGCCTAACTGCTAACCTCACAGCAGGCCACCTCCTCATCCAACTTATCTCAACAGCAACAGCTACCCTAATATCAACAATACCGATAGTATCACTACTAACACTACTAGTCCTATTCCTACTCACTATCCTAGAAGTAGCAGTAGCCATAATCCAGGCCTACGTCTTCGTACTTCTACTAAGCCTATATCTACAAGAAAACATCTAGCAG------CCAATGACCCACCAAGCACACTCTTACCACATAGTAGACCCAAGCCCATGACCTATTCTAGGAGCAGCCGCCGCCCTCCTTACCACTTCCGGCCTAACTATATGATTCCACTACAACACGCCATACCTACTAATCATTGGACTAACCTCTACTGCCCTAGTAATACTCCAATGATGACGGGATATTGTCCGAGAGAGCACGTTCCAAGGACATCACACTCCCACAGTACAAAAAGGACTACGATATGGCATAGTCCTGTTCATCACATCAGAAGCATTCTTCTTCCTAGGGTTCTTCTGAGCATTCTTCCACTCTAGCCTGGCCCCGACTCCAGAGCTTGGAGGACAATGACCCCCAGTCGGAATTAAACCACTAGACCCGATAGACGTCCCCCTTCTAAATACCGCAATTCTACTAGCCTCAGGAGTTACAGTCACATGAGCCCACCATAGCATTATAGAAGCCAACCGTAAGCAAGCAATTCAGGCCCTCACTCTTACAGTCCTACTAGGTTTCTACTTCACTGGTCTACAAGCTATAGAATACTACGAAGCCCCATTCTCCATCGCTGACGGAGTATACGGCTCCACCTTCTTCGTAGCCACAGGGTTCCACGGCCTTCATGTAATCATTGGCTCTACATTCCTCCTAGTATGCCTTCTACGCCTAGTAAAATACCACTTTACACCTAAACACCACTTTGGCTTTGAAGCAGCAGCTTGATACTGACATTTCGTAGACGTCGTATGACTGTTCCTCTATATGACTATCTACTGATGAGGATCCTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATG---AATATAATCCTATTCATAGTCATCACCTCCCTCGTCCTAAGTATTGTCCTCACCATACTAAACTTTTGACTAGCACAAACCAGCCCAGACTCAGAAAAACTATCACCCTATGAATGCGGATTTGACCCACTAGGGTCCGCCCGGCTGCCATTTTCAATTCGATTCTTCCTAGTAGCAATCCTATTTCTACTATTTGACCTAGAAATCGCCCTACTGCTACCACTACCATGAGCCATCCAGCTTCAATCCCCTACTATCACACTAATATGAGCCTCCATCCTCATCCTCCTGCTCACCCTAGGCCTAGTCTATGAGTGAATTCAAGGAGGACTAGAGTGGGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGGCTCAACAGATTATAGCTCACACCCTATAACTTTCTTAATGTCAGCCCTACATCTAAGTTTTTTCTCCGCCTTCACTTTAAGTAGCCTAGGCCTAGCCTTCCACCGAACACATCTGATTTCAGCCCTGCTCTGCTTAGAAAGCATGATACTATCCATATATGTCGCTCTCTCCATATGACCAATTCAAACCCAAACATCTTCCGCTACCATACTACCCCTTCTCATGCTGTCATTCTCTGCTTGCGAAGCAGCAACAGGACTAGCCCTGCTAGTAGCCTCAACCCGAACTCACGGATCCGACCACTTACACAACTTTAACCTACTACAATGCTAAAAATCATAATCCCAACCATCATACTACTACCACTAGCTATACTATCCCCTCGCAAACATCTGTGAACCAATACTACAACACATAGCCTGCTAATTGCCACAATCAGCCTTCAATGACTTGTCCCTACGTACTACCCAAGCAAAGGACTGACCCACTGAACCTCAATCGACCAAATCTCCTCCCCCTTATTAGTTCTATCCTGCTGACTATTGCCCCTTATACTTATGGCAAGTCAAAACCACCTGGAACAAGAACCTACCATTCGCAAACGAATCTTCATCACAACCGTGGTCGCAGTACAACCATTTATCCTTCTAGCCTTCTCAGCTTCAGAACTAATACTATTCTACATTGCATTTGAAGCAACCCTCATCCCAACCCTAATTCTCATTACACGATGAGGAAACCAACCCGAACGACTAAATGCAGGCATTTACCTACTATTCTATACACTAGCCAGCTCCCTCCCACTACTAATCACAATCCTCCACCTACACAACCAAATTGGGACACTATACTTTCCCATGCTAAAACTATCACACCCAACAATAAACGCCTCATGAACAGGCTTAGTATCAAGTCTAGCCCTACTACTAGCCTTCATGGTCAAAGCACCTCTATACGGCCTACACCTATGACTGCCTAAAGCACATGTAGAGGCCCCAATCGCCGGATCAATGCTACTAGCTGCCCTCCTCCTAAAACTAGGAGGCTATGGCATTATACGAGTCACCATCCTAGTAAACCCATCCGTAAATAACCTCCACTACCCATTTATTGTCCTAGCACTATGAGGGGCATTAATAACAAGCGCTATCTGTCTACGACAAATCGACCTAAAATCATTGATTGCTTATTCCTCCGTGAGCCATATAGGACTAGTCATTGCCGCAACAATAATCCAAACTCAATGAGCCTTCTCAGGAGCTATAATCCTAATAATCTCCCACGGCCTAACCTCCTCAATACTATTCTGCCTGGCCAACACAAACTATGAACGAACCCATAGCCGAATTCTACTCCTTACTCGAGGCCTACAACCTCTACTGCCCCTAATAGCCACCTGATGACTCCTAGCAAACCTAGCAAACATGGCCCTACCACCAACAACGAACCTTATAGCAGAACTAACAATCGTAGTAACCCTATTCAATTGATCCCCGCTAACAATTATCTTAACAGGAGCTACAATCATTCTAACTGCCTCTTACACCCTTTACATGCTAACAATGACCCAACGAGGCACGCTACCATCCCACATCACATCAATCCAAAACTCCTCTACGCGAGAACATCTCCTGATAGCTCTCCACATGATTCCGATAATCCTACTCATCTTCAAACCCCAACTAATCTCAGGAATCCCCATAT-GCAAGTATAGTTT-CAA-TCAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAGCAAGAACTGCTAATTCTTGCATCTGAGTCTAA-AGCCTCAGCCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCAGTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGATCACACACTAATCCTAAATACATCCATACTACTTGTCCTAACAATCCTCTGCACTCCAATCATCTTTCCCCTATTGTCCAACAGCCTAAAAAGCACCCCAACTATCATCACAAACACTGTCAAAACTTCCTTCCTAATCAGTTTAATTCCCATAACTATCTACATCCACTCAGGAACAGAAAGCCTTACCTCCCTATGAGAATGAAAATTCATCACAAACTTTAAAATCCCAATCAGCCTGACAATAGATTTTTACTCACTAACTTTCTTCCCTATCGCTCTATTTGTCTCCTGATCAATCCTACAATTTGCAACATGATACATAGCCTCAGACCCGTACATTACCAAATTTTTCACCTTCCTACTCCTATTCCTAATTGCCATACTCATCCTAATCGTATCCAACAACCTATTCCTACTCTTTATCGGATGAGAAGGGGTAGGGATCATATCATTCCTACTAATCAGCTGATGACATGGACGAGCAGAGGCCAACACCGCTGCCCTACAAGCCGTCCTATACAACCGAGTAGGAGACGTAGGACTCATCCTGTGCATAGCATGACTAGCCTCTACTATAAACACATGAGAAATCCAACAAATCTCGTTCCAAGACCAAACTCCAACCCTCCCCCTACTGGGACTAATCCTAGCCGCAGCAGGCAAATCAGCCCAATTTGGCCTCCACCCATGACTTCCAGCAGCAATAGAAGGTCCAACCCCAGTATCCGCTCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTTCTAATCCGAACCCACCCTCTCTTCAGCAACAACCCTACCGCTCTATCCCTATGCCTATGCCTGGGGGCCCTATCAACACTATTTGCAGCCACATGCGCCCTAACTCAAAACGACATCAAAAAAATCATTGCTTTCTCAACATCCAGCCAACTAGGCCTAATAATAGTTACAATCGGACTAAACCTACCACAATTAGCCTTTCTCCACATTTCAACCCATGCCTTCTTCAAAGCCATACTATTTCTATGTTCCGGATCAATCATCCACAACCTAAATGGAGAACAAGACATCCGAAAGATAGGAGGACTTCAAAAAATATTACCAACAACCACCTCATGCCTGACTATCGGAAACCTTGCTCTAATAGGAACTCCGTTCTTAGCAGGATTCTACTCAAAAGACCAGATTATTGAAAGTCTAAGCACCTCATACCTAAACGCCTGAGCCCTTGCCCTTACCCTTCTGGCTACATCATTCACCGCAGTATACACCATCCGAATGACACTTTTAGTCCAAACAGGACATGCCCGAATCCCCCCGCTCGCCCCAATAAATGAAAACAACCCAGCAATTTTATCACCAATTACTCGTCTTGCATTAGGAAGCATTACAGCAGGGTTCCTAATCACTTCATACATCCCAC---CTGCAAAAACCCCACCAATGACTATGCCACTCTCTATCAAAATAACAGCCATCGTAATCACACTCCTAGGAATCGCCATAGCCCTAGAATTATCAAAAATAACTCAATTATTAATCCTCCCTAAACAGAATCGCTTCTCAAACTTCTCTACAACCCTAGGATACTTCAACCCCCTAGTTCACCGATTCATCACAACAAAAGTTCTAAGCAATAGCCAAAATATCTCCTCTCACCTAATAGACCTCTCTTGATATAAACTCCTAGGCCCTGAAGGACTAGCCAACATACAAGTAATAGCATCAAAAACAATCACCTCTTTCCACACTGGCATAATCAAAGCCTACCTAGGATCATTCGCTCTATCAATCCTCATCATCCTCC---TATCAACATATAGAAC--TAACC-C---AATGGCCCTAAATCTACGCAAAAACCACCCCCTACTAAAAATCATCAACGACTCCTTAGTCGACCTTCCAACCCCATCAAACATTTCAACCTGATGAAACTTTGGATCCCTACTAGGCATCTGTCTCGTCACACAAATCGTTACAGGTCTCCTACTAGCCATGCACTATACCGCAGACACTTCCTTAGCCTTTGCCTCAGTAGCTCACACATGCCGAAACGTACAATTCGGATGACTAATCCGAAACCTGCATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATTGGCCGAGGAATCTACTACGGATCCTACCTAAATAAAGAAACCTGAAATGTAGGAGTAATCCTCCTCCTAACCTTAATAGCAACTGCCTTCGTAGGATATGTACTACCTTGAGGACAAATATCCTTCTGAGGCGCTACCGTTATTACCAACCTCTTCTCAGCAATCCCATACATCGGACAAACACTAGTAGAGTGACTCTGAGGCGGATTCTCAGTGGACAACCCAACACTGACTCGATTTTTCGCCCTACACTTTCTACTCCCCTTTGTAATCGCAGGCCTGACACTAGTCCACCTGACCTTCCTACATGAAACAGGCTCAAACAACCCACTAGGAATCCCATCAGACTGCGATAAAATCCCATTCCACCCTTACTACTCTATCAAAGACCTACTAGGTTTCGCGCTAATACTAATCCTACTCGCCACTTTAGCATTATTCTCCCCGAACCTACTAGGAGACCCAGAAAACTTCACGCCCGCCAACCCACTAGCCACACCCCCTCATATTAAACCTGAGTGATACTTCCTATTTGCCTATGCCATCCTCCGATCCATCCCAAACAAATTAGGAGGAGTCCTAGCCCTAGCCGCCTCCGTACTAATCCTATTCTTAATCCCCCTGCTGCACACCTCTAAACAACGCTCAATAACCTTCCGACCATTATCCCAAATCCTGTTTTGAACCCTAGTAGCCGACCTCCTCATCCTAACATGAGTCGGGAGCCAACCAGTCGAACACCCATTCATCATCATCGGACAATTAGCTTCATTTGCCTACTTCACAATTATCCTAATCCTATTCCCCATTGTGAGTGCCCTAGAGAACAAAATACTCCGCCT----------CTA-ATA-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTATACATCTTCTTAGAGTT Cyanoptila_cyanomelana_NC_015232 GTCCTCGTAGCTTACAACAAAGCATGGCACTGAAGATGCCAAGACGGCTGC--CACC-CGCACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTGTTGCTAGGTTTATACATGCAAGTATCCGCGCCCCAGTG-CGTATGCCCTGGACA-CCT-TAAACCCC-----AAGTAGATAGGAGCGGGCATCAGGCTCA--C------CACCA--ACCGTAGCCCAAGACGCCTAGCAATTGCCACGTCCCCACGGATTATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCACAGCAAACT---CTAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTAT-T----GACGGCGTAAAGAGTGGACGC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAGCAACTGAGCTGTCATAAGCCCAAGATGC-TCATAAGGCCTCCGTCCTCAAAGAAGATCTTAGAAC--AACGACTAACTGAATTCCACGAAAGTCAGGGCCCAAACTGGGATTGGATACCCCACTATGCCTGACCCTAAATCTTGATATTCTAC---CCTACCTGAATATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCTCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATACTACCTGACCATTTCTCGC-TCA-AAA--CAGCCTATATACCGCCGTCGCCAGCTCACCTTCA--CTGACAGCCCAACAGTGAGCGCAATAG-CCCAA-CCACGCTAGTAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAACTAGAACA-T-----ACGGCAAAGGAACATGAAACTGTTCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATTGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCACAGG-CG---ACCAACACTCCCTAT-AACTAATAAGCCAT-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTTAATA-AAAGCATTCAGCTTACACCTGAAAGATATCTGCTA-ACATCAGATCGTCTTGA-TGCCAAAATCTAGCCC--------AACAT-ACATTG------ACCTGGA-ATAAC--AAAGCTACT--GC-CTA-AACCC----AACCAAAGCATT---T--GCTAGT-CCTAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAACGATGAAATAACAATG--AACAAGC--CAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGG--ATTTAAGTTTGCCACCCCGAAACCTAAGCGAGCTACCCACGAGCAGCTAT-C-TTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTATGGGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC--TACG-AACCCCA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--AAC----CTACACAAAACCTATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCCGT-ACCC--AAAATATCAG-AACCATATGACTCCCT-CCCCACTAACAGGCTAACCTATAACCAGATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTATA-CATTATTAACAAG-TCCCCA-ATATACGA--CCAAT---------CCA---ACAAGCA-GAG-TATTA-AACACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGCAAAAGGAACTCGGCAAA-CCATCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAATAAAA--ACAAGTATTGAAGGTAATGCCTGCCCGGTG--ACCT-GAC---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCAGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTCAAAAACAGCAGCCACC--CCAAAT-TACATA----AC-CACCCA--C-T-GGGCCCACTTAC-ACA-TAA-GC-C-TCTGGCC-TGCATTTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAACTGGACCATACCTCTAGACCA-AGAGCAACCTCTCGACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCCCCTTTAAGAGTCCATATCGACAAGGGGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGAAGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACTA-GCAAGCCTTC-GCCTTAAGTGATGAAACCAACTCAATCACAAAGGGC--TCAC-ACCCC---A-CTA-CGCCCTAGAAAAGGG--CCCAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TGTCCC-----------------------ATGAC----------CAACCACCCCATCTTAATCAACCTCATTATAGCCCTCTCCTACGCCCTCCCCATCTTAATCGCAGTAGCCTTCCTTACCCTAGTTGAACGTAAAATCCTAAGCTACATACAGGGACGAAAGGGCCCAAACATCGTCGGACCATACGGCCTACTCCAACCCCTAGCAGACGGAGTAAAATTATTTATCAAAGAGCCCATCCGCC---------CATCAACATCCTCCCCAGTTCTATTCATCGCAACCCCCATACTCGCACTTCTACTTGCAATCTCCATCTGAACCCCACTCCCACTGCCATTCTCGCTAGCAGACCTAAACCTAGGCTTACTGTTCCTTTTAGCCATATCAAGCCTAGCAGTATACTCCATCCTATGGTCAGGCTGGGCCTCCAACTCAAAATACGCTCTAATCGGAGCGCTACGAGCAGTAGCCCAGACCATCTCCTACGAAGTAACCCTGGCCATAATTCTCCTATCCGTCGTTTTACTTAGCGGCAATTACACCCTCAGCACCCTTGCAGTAACCCAAGAGCCCCTATACCTGATCTTTTCTTGCTGACCGCTGGCCATAATATGATATGTCTCTACACTAGCTGAAACTAACCGAGCCCCATTCGACCTCACAGAAGGTGAATCCGAGCTAGTTTCAGGGTTCAACGTAGAATACGCAGCCGGACCCTTCGCCCTATTCTTCCTAGCTGAGTATGCAAACATTATGCTCATAAACACATTGACTGCTATCCTCTTCCTCAACCCAAGTGCCCTCAACCCACCCCAAGAGTTATACCCCGTTATCCTAGCCACTAAAGTTCTCCTCCTATCCGCGGGCTTCCTATGAATCCGCGCCTCCTACCCACGTTTCCGGTACGATCAACTAATACACCTTCTATGAAAAAACTTCCTCCCACTCACACTAGCCCTATGCCTATGGCACACTAGCATGCCAATCTGCTATGCAGGCCTGCCC-----CCTTACCTAAG--AAC-------------AACAAGGAAATGTGCCTGAGTGC-T--AAGGGTCACTATGATAAAGTGAATACAGAGGTATACCAACCCTCTCATTTCCT-A--AAAC-------TTAGAAAAGTAGGAATTGAACCTACACTAGAGAAATCAAAATCCTCCATACTCCCCTTATATTATTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATCTTTACCATTAGCCTACTCCTAGGGACCACTATCACAGTCTCAAGCAACCACTGAATCA---CAGCCTGGGCCGGGCTCGAAATCAATACCCTAGCCATCCTACCCATAATCTCAAAATCCCACCACCCTCGAGCCATTGAAGCTACAACCAAGTATTTTCTAGTACAGGCAGCCGCCTCCACCCTTATCCTGTTTTCCAGCATGACCAACGCATGACAAACCGGACAATGAGATATCACCCAACTAACTCATCCAACATCATGCCTGATCCTTACTACAGCCATTGCGATAAAACTAGGACTAGTCCCATTCCACTTCTGATTCCCCGAAGTACTACAAGGAACCTCTCTAACTACCGGCCTCCTCCTATCCACAGCCATGAAATTTCCCCCAATGGCACTATTCTTCATAACTTCCCAATCACTAAACCCAACCCTACTAACTACCATGGCCATTCTCTCTGCAGCCCTGGGAGGGTGAATAGGGCTCAACCAGACACAAACTCGAAAAATCCTAGCCTTCTCATCCATCTCCCACTTAGGCTGAATAGCAATTATTATCGTCTACAGCCCTAAACTAGCCCTGCTAAACTTTTACCTATACGCCCTAATAACCGCAGCCGTATTTATAGCCCTAAACTCCATCAAAACCCTAAACCTATCCACGCTCCTAACCACGTGAACAAAAACCCCAGCACTAAGCGCAACACTAATGCTATCCCTCCTCTCCCTCGCAGGTCTACCCCCCATGACAGGATTCCTGCCCAAATGACTAATTATCCAAGAACTTACCAAACAAGAAGTAGCCCCAGCAGCAGTACTTATCTCCCTTCTCTCTCTCCTGAGCCTATTCTTTTACTTACGCCTCGCATACTGTGCGACAATCACACTACCCCCACACACCACAAACCACATAAAACAATGACATATTAACAAACCAACCAACATCTTAGTGGCCATCCTAATCACCACATCTATCACCCTCCTACCAACCTCACCCATAATCCTCACCATTGT------CT----AAGAAACTTAG----GATCACCT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAGATTCGCAGGACATTACCCTGCATCTCCTGAATGCAACCCAGATGCTTTAA-TTAAGCTAGAACCTT-------ACGAACTAGACAGATGGGCTTCGATCCCACAACAC-TATAGTTAACAGCTATATGCCCAAACC-AACAGGCCTCTGCCTAA-------------AGGCCCCGGTACGCAA-TCAACGCACATCAATGAGCTTGCAACTCACCATGAATTTCACCACGGAGCC---GATAAGAAGAGGAATTAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTATACCTGATCTTCGGCGCATGAGTCGGAATGGTAGGTACCGCCCTAAGCCTTCTCATTCGAGCAGAACTCGGCCAACCAGGCGCCCTTCTAGGAGATGACCAGATCTACAATGTGATCGTCACGGCCCACGCCTTCGTGATGATTTTCTTCATAGTTATACCAATTATAATCGGCGGGTTCGGAAACTGACTAGTCCCACTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCCTCATTCCTACTTCTCCTAGCTTCCTCCACAGTAGAAGCAGGGGTAGGAACCGGCTGAACTGTATATCCCCCCCTGGCTGGAAACCTAGCCCACGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTACATCTAGCAGGTATTTCCTCAATCCTAGGTGCTATCAACTTCATCACAACAGCAATCAACATAAAACCACCCGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTAATCACCGCAGTCCTTCTCCTCCTCTCACTTCCCGTCCTTGCCGCCGGTATTACCATACTCCTTACCGACCGCAACCTAAACACTACCTTCTTCGACCCCGCAGGAGGGGGGGACCCAGTCCTCTACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTGTATATCCTAATCCTCCCAGGATTCGGAATTATCTCCCACGTAGTAGCCTACTACGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTGTCCATCGGATTCTTAGGGTTCATTGTCTGAGCCCACCACATATTCACAGTAGGCATGGACGTAGATACCCGAGCCTACTTCACATCCGCCACTATAATCATTGCAATCCCAACAGGAATCAAAGTGTTCAGCTGACTAGCAACGCTACACGGAGGCACAATCAAATGAGATCCCCCAATACTGTGAGCTATAGGATTCATCTTCCTGTTCACCATTGGAGGCCTAACTGGAATCGTCCTAGCAAACTCTTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTACTATCAATAGGAGCAGTATTCGCAATTCTAGCAGGCTTTACCCACTGATTCCCTCTATTCACCGGCTACACCCTGCACTCCACATGAGCTAAAGCCCACTTCGGTGTAATATTCGTAGGTGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGAATGCCACGACGATACTCAGACTACCCAGACGCCTACACCCTATGAAATACCATTTCCTCAATCGGTTCCCTAATCTCCCTCACAGCCGTAATCATGCTCGTGTTCATCATCTGAGAAGCTTTCGCATCAAAACGTAAAGCAACACAACCAGAGCTAACAAGCACTAACATTGAATGAATCCACGGCTGCCCACCACCATTCCACACCTTCGAAGAACCAGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGCATAT--AAACCACTTATGCTTCTTTCTC---AT---AGAGGTGTTAGT-AAAGCA-ACTACATAG-CCTTATCAAGACTAAATCACAGGTGAAACCCCCGTACACCT------CACCCCCAAAAATGGCCAACCACTCACAATTCGGTTTCCAAGACGCTTCATCACCTATCATAGAAGAACTTGTACAATTCCACGACCACGCCCTAATGGTTGCTCTAGCAATTTGCAGCCTAGTTCTCTACCTATTAGCTCTAATACTCACAGAAAAACTTTCATCAAGCACTGTTGACGCCCAAGAAATCGAGCTCGTCTGAACAATCCTCCCAGCTGCTGTCCTAATCATACTCGCTCTCCCCTCCCTGCGAATCTTATACATAATGGATGAGGTAAACGAGCCAGACTTAACCCTAAAAGCCATCGGTCACCAGTGATACTGATCCTACGAATACACCGACTTCAAAGATCTCACATTCGACTCCTACATAATCCCCACATCAGACCTACCACTAGGCCACTTCCGCCTACTAGAAGTAGACCATCGAGTCATTGTACCCACAGAGTCCAAAGTGCGAGTTATCGTTACAGCCGACGACGTACTCCACTCATGAGCTGTCCCAAGCCTAGGGGTAAAAACTGACGCAATTCCAGGACGCCTCAACCAAACCTCATTTCTTGCCTCCCGCCCTGGAGTTTACTATGGACAGTGCTCAGAAATCTGCGGGGCCAACCACAGCTTCATACCAATCGTAGTCGAGTCAACCCCCCTAGCTAACTTCGAAAACTGATCCTCTCTAC---TATCCTCCT----------AATCATTAAGAAGCTATGAAACAGCACTAGCCTTTTAAGCTAGAGAAAGAGGGCT---AAACCCTCCTTAATGATATGCCTCAACTAAACCCAAACCCCTGATTTTTTATCATGCTCACTTCATGACTCACCTTCTCCCTAATTATTCAACCCAAACTACTCACATTCATCACCATAAACCCCCCATCCAATAAAA---CGCCTACAGCCCCTAAAACTACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCCCTACTAGGAATCCCACTAATTCTAATCTCAATAACATTCCCAGCTCTTCTCCTACCCTCCCCAGGCAACCGATGAATCACCAATCGACTCTCAACACTACAGCTATGATTCATCAACCTAGTCACAAAACAATTAATGATACCACTACATAAAAAAGGCCATAAATGAGCCCTTATCCTTACATCTTTAATGGTCTTCTTACTACTAGTAAACCTACTGGGCCTGTTACCCTACACATTTACACCAACCACCCAACTATCCATAAACCTAGCCCTAGCCTTCCCCTTATGACTTGCCACACTCCTAACGGGCCTACGAAATCAACCCTCCGCCTCTCTAGGCCACCTTCTACCAGAAGGCACCCCCACACCCCTAATTCCTGCCCTAATTATAATCGAAACAACAAGCCTACTCATCCGCCCCCTAGCCCTAGGCGTCCGCCTAACCGCTAACCTAACGGCAGGCCACCTTCTCATCCAACTAATCTCCACCGCCACAATAGCCCTATTCTCAACAATACCAGCAGTCTCCCTACTGGCACTATTAGTACTGTTCCTCCTAACCATCTTAGAAGTAGCAGTAGCCATAATCCAAGCCTATGTATTCGTCCTCTTACTAAGCCTTTACCTACAAGAAAACATTTAACAC-------TAATGGCACACCAAGCACACTCATACCACATAGTAGACCCCAGCCCATGACCTATCCTCGGGGCAGCCGCTGCCCTCCTAACCACCTCAGGCCTAACCATATGATTTCACTACAACTCCCCTCTGCTCTTAATCATCGGCCTCATCTCAACTATCTTAGTCATATTCCAATGATGACGTGACATCGTGCGCGAAAGCACCTTCCAAGGACACCACACCCCCACCGTCCAGAAAGGCCTACGATACGGCATAGTCCTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCATTCTTCCACTCGAGCCTAGCCCCCACCCCAGAATTAGGAGGACAATGACCCCCTGTTGGAATTAAACCACTAGACCCGATAGACGTCCCCCTTCTAAACACCGCTATCCTACTAGCCTCAGGAGTGACAGTCACATGAGCCCATCACAGCATCACAGAAGCAAACCGTAAACAAGCCATCCAGGCCCTAACCCTGACAGTTCTCCTAGGATTCTACTTCACCGGCCTTCAAGCCATGGAATACTACGAAGCCCCATTCTCCATCGCAGATGGAGTCTACGGCTCAACCTTCTTCGTTGCCACAGGATTCCACGGTCTTCACGTGATTATCGGCTCTACATTCCTCTTAGTATGCCTCTTCCGCCTAATTAAATACCACTTCACATCAAACCACCACTTCGGCTTCGAAGCAGCAGCATGATATTGACACTTCGTAGACGTCGTATGACTCTTCCTCTATATTTCCATCTACTGATGAGGATCCTGCTCTTCTAGTATATCC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTCAACCCCAGAGAAGAGCAATG---AACATAATCATATTCATAATCACCCTATCCCTAACCCTAAGCATTGCTTTAACAGCCCTAAACTTCTGACTAGCCCAAATAACCCCAGACTCAGAAAAGCTGTCCCCGTACGAATGCGGATTCGACCCCCTAGGATCTGCCCGACTCCCCTTTTCAATCCGATTCTTCCTGGTAGCCATTCTATTTCTACTTTTCGACCTAGAAATTGCCTTACTACTCCCCCTGCCATGAGCAACACAACTTCAATCGCCCACAACTACCCTAACCTGAACGTCCATCCTCATCCTCCTGCTCACCCTAGGCCTAGTATATGAATGAATCCAAGGAGGACTAGAATGAGCAGAATA-A------CAGGAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAAATTATAGTACCCACCCTATAACTCCCTTCATGTCCCACCTACATCTAAGCTTCTACGCAGCATTTACCCTAAGCAGCCTAGACCTAGCCTTCCACCGAACACACCTGATCTCAGCCCTACTCTGCCTAGAAAGCATAATACTATCCATATACGTCGCCCTAGCCATATGGCCCATCCAAACACAAACATCATCCTCCGCTATCCTCCCCATCCTCATACTGACATTCTCTGCTTGCGAGGCAGGAGCAGGACTAGCACTACTAGTAGCCTCCACCCGAACTCATGGCTCTGACCACCTTCACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCCTGATACTCCTACCCCTAACCTTCCTCTCCCCATGCAAGTTCTTATGGACCAATATTACCGCCCATAGCCTATTAATCGCCACCTTAAGCCTCCAGTGACTAGTCCCCACATACTACCCAAGCAAAACCCTAACTTTCTGAACCTCTGTCGACCAAATCTCCTCCCCCCTACTAGTCCTATCGTGCTGACTATTACCCCTCATAATCATGGCAAGCCAAAATCACCTAGAACAGGAACCCGCCATTCGAAAACGAATATTCGCTACCGCCCTAGTCCTAGCCCAACCATCTATTCTCCTTGCCTTTTCAGCCTCAGAACTAATACTATTCTACATCGCATTCGAAGCCACCCTAATCCCAACTCTAGTCCTCATCACACGATGAGGCAACCAACCAGAACGACTAAGCGCAGGAATCTACCTACTATTCTACACACTAGCCAGCTCACTACCCCTACTCATCGCCATCCTCCACCTACACAACCAAATCGGCACCCCCTACCTTCCCATACTTAAACTCTCACACCCTACAGTCTCAACCTCATGAACAGGCCTAATATCCACCCTAGCCCTCCTAATAGCCTTCATGGTCAAGGCCCCTCTATATGGACTTCACCTATGACTACCTAAAGCCCACGTAGAGGCCCCAATCGCCGGGTCAATACTACTAGCTGCCCTGCTCCTAAAACTAGGGGGCTACGGCATTATACGAATCACACTACTAGTAAACCCATCAACAAACAACCTACATTACCCCTTCATCACCCTCGCCCTATGAGGTGCATTAATAACTAGCGCCATCTGCCTACGACAAATAGACCTAAAATCACTAATTGCATATTCATCAGTAAGCCACATAGGACTAGTCGTTGCCGCCACCATAATCCAAACCCAATGAGCATTCTCAGGCGCAATAATCCTAATAATCTCACACGGACTAACCTCCTCAATACTATTCTGCCTAGCTAACACCAACTACGAGCGAACCCACAGCCGAATCCTCCTACTAGCACGAGGCCTACAACCACTCCTACCCCTAATAGCCACCTGATGACTACTAGCAAACCTAGCAAACATGGCGATTCCCCCCACAATCAACCTCATAGCAGAACTAACCATTGTAGTCGCCCTATTCAACTGATCCTCCCTAACACTCATCCTAACAGGGACTGCAATCCTACTAACTGCCTCATACACACTGTACATACTCATAATAACACAACGAGGTGCCTTACCATCACACATCACCTCCATCCAAAACTCCTCTACGCGAGAGCACCTCCTCATGGCCCTACACATAATCCCTATAATCCTCCTAATCCTTAAACCCGAACTTATCTCCGGTGTACCCATAT-GCAAGTATAGTTT-CAACCCAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAATCCTTCTTACCTGCCGAGGGG-AGGTT-CAACCAATGAGAACTGCTAACTCTCACATCTGAGCATAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGTCCTAAACACATTTATACTACTAACCCTAGCAACCCTCTCTACCCCAATTTTCTTCCCACTTCTCTCAGACTCCCTCAAAAACACCCCAACCATCATCACAAACACAGTAAAAACCTCTTTCCTAATCAGCCTAATTCCCATGACAATCTACACCTACTCAGGGACAGAAAGCTTAACCACCCTATGGGAATGAAAATACATTATAAACTTCAAAATTCCCATCAGCCTAAAAATAGACTTCTACTCCCCGACATTTTTCCCAATTGCCCTATTCGTATCCTGATCCATTCTACAATTTGCAACATGATACATAGCATCAGACCCCTACATCACAAAATTCTTCACCTACCTACTATTTTTCCTAATAGCAATACTCATCCTAATCGTCGCCAACAACCTCTTCATCCGGTTCATTGGCTGAGAGGGAGTAGGAATTATGTCCTTCCTACTAATTAGCTGATGACACGGACGAGCAGAAGCCAACACTGTCGCCCTCCAAGCCATTCTATATAACCGAATTGGGGATATCGGCCTTATCCTATGCATAGCATGACTGGCCTCCACCTTAAATACCTGAGAAATTCAACAAACCTTCACGTCATCCCAAACTCCCACACTCCCCCTACTAGGCCTCATCCTAGCTGCAACAGGCAAATCCGCCCAATTTGGCCTACACCCATGACTCCCAGCGGCCATGGAAGGCCCAACCCCTGTATCCGCCCTACTCCATTCCAGCACAATAGTGGTCGCCGGAATCTTCCTGCTCATCCGAACCCACCCCCTGTTCAACAATAACCAGACCGCCCTAACCCTGTGCTTATGCCTCGGAGCTCTATCCACGCTATTTGCATCCACCTGTGCCCTCACCCAAAACGATATCAAAAAAATCATCGCCTTCTCTGCCTCAGGCCAACTAGGCCTAATAATAGTAACAATCGGATTAAACCTCCCCCAACTAGCCTTCCTACACATTTCAACCCATGCCTTCCTCAAAGCCATGCTATTCCTGTGCTCCGGCTCCATCATCCATAACCTTAACGGTGAGCAAGACATTCGAAAAATAGGAGGCCTCCAAAAACTACTACCCACAACAACCTCCTGCTTAACCATCGGCAACCTAGCCCTAATAGGAACCCCATTCCTAGCAGGCTTCTACTCAAAAGACCAAATTATCGAATGTATAAACACATCCTACCTAAACTCCTGAGCCCTCCTACTAACCCTACTAGCCACAACCTTCACCGCAGTTTACACCATCCGCATGACTGTACTCGTCCAAGCCGGCTTTGTGCGCATCCCCCCTCTAACACCAATAAACGAAAACAATCCCGCAGTAACCTCACCAATTACTCGCCTCGCACTAGGCAGTATCACAGCCGGATTCCTCATCACTTCATTTATCCTCC---CAACAAAAACCCCACCCATAACAATACCTACCTACATCAAAATTACTGCCATAATCGTCACAATCTTAGGCGTCCTCATCGCCCTAGAAATAGCAAAAATAACCCAAACCATAATCCTCACAAAACAAGGACCTTTCTCAAACTTCTCTACATCACTAGGATACTTCAACCCCCTAACACACCGACTTAGCACAACAAGCCTACTAAACGCAGGCCAAAACATTGCCTCCCACTTAATCGACCTCTCCTGATACAAACTACTAGGCCCAGAAGGACTGGCCAACCTACAAACAATAGCAGCCAAAACCGCTACCACCCTACACTCAGGACAAATCAAATCCTACTTAGGGGCCTTTGCCCTATCTATCCTCATTATACTCA---TATCCATACACAGAAC--CAGTT-----AATGGCCCTCAATCTTCGTAAAAACCACCCACTATTCAAAACCATCAACGACGCACTAATTGACCTCCCTACACCATCGAACATCTCTGCTTGATGAAACTTCGGATCCCTGCTAGGCGTCTGCCTAATTACACAAATCATCACCGGCTTACTACTAGCCACACACTACACAGCAGACACCTCCCTAGCCTTCAACTCCGTCGCCCACATATGCCGCAATGTACAGTTCGGATGATTAATCTGAAACATCCACGCAAACGGAGCCTCATTCTTCTTCATCTGTATCTACCTACACATCGGCCGAGGATTCTACTACGGCTCATACCTAAACAAAGAGACCTGAAACGTAGGAGTAATCCTCCTCCTAATCCTAATGGCAACCGCTTTCGTAGGATACGTACTCCCCTGAGGACAAATATCCTTCTGAGGTGCCACAGTAATTACCAACCTATTCTCAGCAATCCCCTACATTGGCCAAACACTAGTAGAATGAGCCTGAGGAGGATTTTCAGTAGACAACCCCACACTAACCCGATTCTTTGCCCTCCACTTCCTACTACCATTCGTCATCGTAGGCCTCACATTAGTCCATCTAACCTTCCTACACGAAACCGGATCAAACAACCCACTAGGCATTCCTGCAGACTGCGATAAAATCCCACTCCACCCATACTACTCCACAAAAGACATCCTAGGATTTGCACTCATACTCATCCCACTGGTATCCCTAGCCCTATTCTCCCCCAACCTGCTAGGAGACCCAGAAAACTTCACACCAGCCAACCCCCTATCCACACCACCCCACATTAAACCTGAATGATACTTCCTATTTGCATACGCCAGCCTACGCTCCATCCCAAATAAACTAGGAGGAGTACTAGCCCTAGCCGCCTCCGTCCTAGTCCTATTCCTAGCCCCCCTACTCCACAAATCCAAACAACGCTCACTAACTTTCCGGCCTATCTCCCAAGTCCTATTCTGAGCCCTAGTAGCCAACCTATTCATCCTAACCTGAGTGGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAATTGGCCTCCCTATCATACTTCACAATTATCCTAGTCCTATTCCCACTTGCAGCCGTACTAGAGAACAAAATACTAAAACT----------CTA-ACC-----------CACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Dives_dives_JX516061 GTCCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGATCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-C-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ATCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAG-C---CCAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTAT-T----AACGGCGTAAAGGGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAGCATCTAAGCTGTCACAAGCCCAAGATGC-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-CACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCA--CTGAAAGCCCAACAGTGGGCGCAATAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAGACTAGAACA-C----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGCGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACACACCGCCCGTCACCCTCCTCGCAGG-CG-CCCCTTCCCCTATA----AACTAATAAGCTAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-T-A-AACTT----AACTAAAGCATT---C--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AC--CAAGCTA-TAAACAGCAAAGATCAGCCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTCAGTAGTGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-CCACA-AACCCTA--ATGAAGT---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ATTAA-CCA-CCTAAC-TGAATTGTGGGCCCTCAAGCAGCCACCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACCTCATGACTCCCT-CCCCATTAACAGGCCAACCTATACTTAGATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCAGTA-CATTATTAACAAA-TCCCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-CAG-TATTA-AACATA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACATA----TT-CACCCA--C-C-GGGTTCACTGAC-ACA-TAA-GA-C-CCTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACCTCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAAGCTATCAC-TTCCC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT---TA-----TC--CC--C----ATGAC----------CAACTACCCCCTCCTGATCAGCTTCATCATAGCCCTCTCCTACATCCTACCAATCTTAATCGCAGTAGCTTTTCTTACACTAGTAGAACGCAAAATCCTAAGTTATATGCAAGGCCGAAAAGGCCCAAACATCGTAGGACCCTTCGGACTCCTTCAACCCCTAGCAGACGGTGTCAAACTGTTCATCAAAGAGCCCATCCGAC---------CCTCAACATCTTCCCCAATCTTGTTCATTGCAACCCCAATTCTAGCCCTTCTCCTGGCCATCTCAATCTGAACCCCACTACCCCTCCCATTCTCCCTAGCAGACCTCAATCTGGGACTGCTCTTCTTACTAGCCATATCAAGCCTAGCAGTATACTCCATCCTATGATCAGGCTGAGCCTCCAACTCCAAATACGCCTTAATTGGAGCACTACGAGCAGTAGCCCAGACAATCTCCTATGAAGTAACCCTAGCTATCATTCTTCTTTCCGTTGTCCTCCTCAGCGGCAACTACACTCTGAGCACTCTCGCCATCACCCAAGAACCCCTGTACCTTATTTTCTCCTGCTGACCCCTTGCTATAATGTGATACGTCTCCACACTAGCTGAGACCAATCGCGCTCCTTTCGACCTGACAGAAGGAGAATCCGAACTGGTGTCCGGATTCAACGTAGAATACGCAGCAGGTCCTTTCGCACTATTCTTTCTAGCCGAATATGCCAACATTATGCTCATAAACACATTAACCACAATTCTATTCTTCAATCCAAGCCTCTTCAACCCACCCCAAGAGCTATTCCCCATCATCCTAGCCACAAAAGTCCTGCTCCTATCAGCAGGATTTCTATGAATTCGAGCTTCCTATCCACGATTCCGATATGACCAATTAATGCACCTACTGTGAAAAAATTTCTTACCACTCACACTGGCCCTATGCCTTTGACACACCAGCATACCAATTTCCTACGCGGGCCTGCCC-----CCTTACCTG-A--GG-CC-----------TTGCCGGAAATGTGCCTGAACGC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-A--ATAA-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTCCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCGAGCAAGCCTAATTTTCATCATTAGCCTACTTCTAGGGACAACTATCACCATATCAAGTAACCACTGAATTA---TAGCCTGAACCGGCCTTGAAATTAACACACTCGCCATTCTCCCATTAATCTCAAAATCCCACCACCCACGAGCCATTGAAGCCGCCACTAAATACTTCTTAACCCAGGCAGCTGCCTCTGCCCTAGTCCTATTCTCCAGCATAACTAACGCATGACACACCGGACAATGAGACATCACCCAACTCACCCATCCAACATCATGCCTAATTCTTACCTCAGCAATCGCCATAAAACTTGGACTAGTGCCATTCCACTTCTGATTCCCAGAAGTACTCCAAGGCTCTCCCCTCATCACCGGCCTACTCCTATCTACCATCATAAAACTCCCCCCAATCACACTACTCTACATAACTTCCCCCTCACTAAACCCTACACTCTTAACTGCCTTAGCCATCCTCTCCGCAGCCCTAGGAGGCTGAATAGGCCTCAACCAAACACAAATCCGAAAAATCCTGGCCTTCTCCTCCATCTCCCACCTAGGCTGAATAGCAATCATTATCATCTACAACCCAAAACTCACACTCCTCAACTTCTACCTATACACCGTAATAACCGCAACCGTCTTCCTCACCCTAAACACAATTAAAGTACTAAAACTATCAACCCTAATAACTGCATGAACTAAAATCCCATCCTTAACCGCAATATTACTTCTAACCTTACTTTCCCTCGCAGGACTTCCACCTCTCACAGGATTCCTACCCAAATGACTTATCATCCAAGAACTAACTAAACAAGAAATAGCCCCAGCAGCCACACTCATCTCCCTACTCTCCCTACTGAGCCTATTCTTCTACCTCCGACTAGCGTACTGCACAACCATCACACTCCCTCCACATACCACAAACCACATAAAACAATGACGCACTAACAAATCAACCAACATCATAATTGCCATTTTAACCACTATGTCCGTCATACTTCTCCCTATCTCCCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCACTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-C--CAA-CCCCCTAGACAGATGGGCTTCGATCCCATAATAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGGCCCCGGTACATAA-TCAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGACTATTCTCAACCAACCACAAAGACATTGGTACCCTCTACCTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCGGGGGCCCTCCTAGGAGACGACCAAGTCTACAACGTGGTCGTCACGGCTCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATCATGATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTACTTCCCCCATCCTTCCTTCTCCTCCTAGCATCTTCTACAGTTGAAGCGGGTGTAGGCACAGGCTGAACAGTATACCCACCACTGGCAGGTAACTTAGCCCACGCCGGAGCCTCAGTCGACCTAGCAATCTTCTCCCTACACCTAGCCGGTATCTCTTCAATCCTAGGGGCAATCAACTTCATTACAACGGCAATCAACATAAAACCACCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTGCTACTTCTATCTCTTCCTGTCCTCGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTTAACACCACATTCTTTGACCCCGCTGGGGGAGGAGACCCTGTACTATATCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCCTACCAGGATTCGGCATCATCTCTCACGTCGTAGCTTACTACGCAGGTAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCAATCGGATTCCTAGGCTTCATTGTCTGAGCTCACCACATATTCACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCTATCCCAACCGGAATCAAAGTATTTAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTGGGATTCATCTTCCTATTCACCATCGGAGGACTAACAGGAATCGTCTTAGCAAACTCCTCACTAGACATCGCTTTACATGACACCTACTATGTAGTAGCTCATTTCCACTACGTACTATCCATAGGAGCAGTATTCGCAATCCTAGCAGGCTTCACCCACTGATTCCCCCTATTCACCGGATACACACTCCATTCAACATGAGCCAAAACACACTTCGGCGTAATATTTGTAGGCGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCGGACTACCCAGATGCTTACACACTATGAAACACCATCTCTTCCGTAGGCTCACTCATCTCCCTGACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCTCCATTCCACACCTTCGAAGAGCCCGCTTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACCTATGCTTCTTTCTC---ATACAAGAGATGTTAGT-AAAATA-ATTACATAA-CCTTGTCAAGGTTAAATTGCAGGCGAAAATCCAGCACATCTCT-----ACTC--AAACATGGCCAACCACTCACAACTTAACTTCCAAGACGCCGCCTCACCCATTATAGAAGAACTAATAGGATTCCATGACCACGCCCTAATAATCGCACTAGCAATCTGTAGCCTGGTCCTATACCTATTAACCCACACTCTCACAGAAAAACTGACATCAAACACAATCAACGCACAAGTAATTGAGCTAGTATGAACAATTCTCCCTGCCCTAGTCCTAGTAACACTCGCCCTACCATCCCTACGAATCCTCTACATGATAGACGAAATCAATGAACCAGACCTAACCCTAAAAGCCATCGGCCACCAATGATACTGAACCTACGAATACACCGACCTCAAAGACTTGACATTCGACTCCTACATAATCCCAACAGCAGACCTACCTTTAGGCCACTTCCGCCTACTAGAAGTCGACCATCGTGCTGTCGTCCCTATAAACTCAACCATCCGAGTCATCGTCACCGCCGACGACGTCCTCCACTCATGAGCTGTTCCCAGCCTAGGTGTAAAAACCGACGCGATCCCAGGACGACTTAACCAAACCTCCTTCCTCGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCACTCGCCGACTTCGAAAACTGATCCTCCCTAA---TCCCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGA--CCCCTCCCTCCTTAATGATATGCCTCAACTAAACCCCGGCCCCTGATTTTTTATCATGCTCACTTCATGACTCACCTTCTCCCTAATCATCCAACCCAAACTCTTATCGTTCGTATCAATAAACCCCCCATCCAATAAAC---CACCCGCCGCTCCAAGCACCACCCCCTGAACCTGACCATGAATCTAAATTTATTCGACCAATTCTCAAGTCCATCCTTCCTAGGGATCCCACTAATCCTCATCTCAATGACATTCCCAGCCCTCCTACTACCATCCCTTGACAACCGATGAATCACCAACCGACTATCAACCCTTCAACTTTGATTCATCAACCTAGTCACAAAACAACTAATAATACCCCTAGACAAAAAAGGACATAAATGAGCCCTAATCTTAACATCCCTCATAATCTTTCTCCTCCTCATCAATCTCCTAGGCCTACTACCATATACATTCACCCCAACCACCCAACTATCCATAAACTTAGCCCTAGCCTTTCCCCTATGACTAGCTACACTCCTAACAGGGCTACGAAACCAACCCTCTACCACACTAGGCCACCTCCTGCCAGAAGGTACACCCACCCCACTAATCCCAGCCCTCATCCTGATCGAAACAACAAGCCTTCTCATCCGCCCACTAGCACTAGGCGTGCGCCTAACAGCCAACCTAACAGCAGGTCACCTCCTAATCCAACTCATTTCTACCGCCACAACAACTTTATTCACCACTATACCAATACTCTCGCTCCTAACCTTTGTAATCCTCTTCCTACTAACAATTCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTCTTCGTACTCCTACTAAGCCTCTACCTCCAAGAAAACATCTAACTC--CA----AATGGCACACCAAGCACATTCTTACCACATAGTCGATCCCAGCCCATGACCTATCCTAGGAGCAGCTGCAGCCCTCCTCACTACCTCAGGACTAACAATATGATTCCACTGAAACTCTCCCCGACTTCTTATCCTAGGCCTACTATCAACCATTCTCGTCATGTTCCAATGATGGCGCGACATCGTGCGAGAAAGCACATTCCAGGGCCACCACACCCCTACCGTACAAAAAGGCCTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCCTTCTTCCACTCAAGCCTGGCCCCCACACCAGAACTAGGAGGACAATGACCGCCCGTTGGAATTAAACCCCTCAACCCCATAGAAGTTCCACTCCTAAACACCGCCATCCTCCTAGCCTCAGGAGTAACCGTTACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAAGCTATCCAAGCCCTCTCCCTAACAGTCCTTCTAGGCTTCTACTTCACCGCTCTACAAGCCATAGAATACTACGAGGCACCATTCTCCATCGCCGATGGAATTTACGGCTCAACATTCTTTGTCGCCACCGGATTCCACGGCCTGCATGTAATTATCGGCTCTACATTCCTATTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCAGCTGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCTTATTCATACTAACCCTATCACTAACCCTGAGCATCCTCCTAACCATACTAAACTTCTGACTTGCCCAAATGACCCCAGACTCAGAAAAACTATCACCGTACGAATGCGGATTCGACCCCCTAGGATCTGCTCGACTCCCTTTCTCAATCCGCTTCTTCCTAGTAGCCATTCTATTCCTCCTGTTCGACCTAGAAATCGCCTTACTCCTCCCGCTACCCTGAGCTATCCAACTACAATCCCCCATCACCACCTTAACCTGAACTGCCGCACTCCTCCTCTTACTTACCCTGGGCCTAGTATACGAATGAATTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACGGTTGATTTCGACTCAACAAATTATAGCTACCACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCAGCCTTCGCCCTAAGCACCCTTGGACTAGCTTTCCACCGAACCCACCTAATCTCCGCCCTACTATGTTTAGAGAGCATAATGCTATCTATATACGTCGCCCTAGCCATATGACCTATCCAAATCCAATCATCAGCATCAACCATCCTACCCATCCTCATACTAACATTCTCCGCCTGCGAGGCGGGTACAGGCCTAGCACTGCTAGTAGCCTCAACCCGCACCCACGGATCAGACCACCTACACAACTTTAACCTTCTAAAATGCTAAAAATCATCATCCCAACTACAACACTCCTCCCCCTAGCCCTCCTCTCCCCACGTAAACACCTATGGACTAACACCACACTTTATAGCCTACTAATCGCCGCTGCCAGCCTCCAATGACTCGCACCCACGTACTACCCAAGCAAAAGCCTAACCCCATGAACATCAATCGACCAAATCTCCTCTCCCCTACTAGTCCTCTCATGCTGACTCCTTCCCCTTATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCATCAGCCGCAAACGAATCTTCGCCTCAACGCTAATCCTAGCCCAACTATCCATCCTCCTAGCCTTCTCAGCCTCTGAACTAATACTCTTCTACATTGCATTCGAAGCCACCCTTATCCCCACCCTAATTCTCATCACACGATGAGGAAGCCAACCAGAACGCCTAAACGCTGGCATTTATCTCCTATTTTACACCCTCGCCAGCTCACTCCCACTATTAATTGCCATCCTCCACCTGCAAAACCAAATCGGCTCACTTTACCTACCTATACTCAAACTCTCACACCCAACATTAAACCACTCTTGATCCAACTTAATCGCAAGCCTAGCCCTTCTACTAGCCTTCATGGTTAAAGCTCCCCTATACGGCCTACACCTATGACTCCCCAAAGCCCACGTAGAAGCCCCAATTGCGGGCTCCATACTACTAGCAGCACTACTACTAAAACTCGGAGGATACGGCATCATACGAATCACAATCCTAGTGAACCCATCATCAAACAACCTCCACTACCCATTCATCACCCTAGCCCTATGAGGAGCAGTAATAACCAGCGCCATCTGCTTACGCCAAATTGACCTAAAATCACTAATCGCTTACTCATCAGTTAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCACACGGCCTAACCTCCTCAATATTATTCTGCCTAGCCAATACCAACTATGAACGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCCCTCCTACCACTTATAGCCACCTGATGACTATTAGCTAACCTAACAAACATAGCCCTCCCCCCTACAACAAACCTCATGGCAGAACTAACTATTGTCGTAGCACTCTTCAACTGATCCGCCCTAACAATCATCCTAACAGGAACCGCCATCCTGCTTACCGCCTCATACACCCTATACATACTAATAATAACACAACGAGGCACCCTACCATCCCACATCACATCAATTCAGAACTCCTCCACACGAGAGCACCTCCTCATAGCCCTACACATGATCCCTATAATCCTCCTAATCTTCAAACCCGAACTGATCTCCGGCATCCCCACAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAGCCAGCTAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCTCAGTCTCCTT--GCTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCAATAGTCCTAAACACATTCATACTCCTAACCCTAACAACCCTTTCCACTCCCATCCTATTCCCACTACTATCCGACAACCTCAAAAACACCCCCAACACGATCACGAACACAGTCAAAACCTCATTCTTAATCAGCCTAATCCCCATAACAATTTTTATCTACTCCGGAACGGAAAGTCTCACCTCACTCTGAGAATGAAAATTCATCATAACCTTCAAAATCCCAATCAGCTTAAAAATAGACTTCTACACACTAACCTTCTTCCCTATCGCACTATTCGTATCGTGATCCATCCTACAATTCGCAACATGATACATAGCCTCAGATCCCTACATCACAAAATTCTTCACCTACCTTCTATTCTTCCTAATCGCCATACTCATCCTAATCATCGCCAACAACCTATTCGTCCTATTCATCGGCTGAGAAGGAGTCGGTATTATATCCTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTACAAGCCGTACTCTACAACCGAATCGGCGACATCGGCCTCATCCTCTGCATAGCATGACTAGCCTCCACCACAAACACCTGAGAAATCCAACAACTACCCACCCCCTCCCAAACCCCTACACTACCCTTACTAGGACTAATCCTAGCTGCAACTGGAAAATCTGCCCAATTCGGCCTGCACCCGTGACTCCCAGCTGCAATAGAAGGGCCAACCCCTGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCAGGGATCTTCCTACTCATCCGAACCCATCCACTATTCAACAACAACCAGACCGCCCTAACCCTATGCCTCTGCCTAGGAGCCATCTCCACCCTGTTCGCAGCCACATGCGCCCTGACCCAAAACGACATTAAAAAAATCATTGCCTTCTCTACCTCCAGCCAACTAGGCCTAATGATAGTCACAATCGGACTAAACCTGCCCGAACTAGCCTTCTTCCACATCTCCACCCACGCATTCTTCAAAGCTATGCTCTTCCTCTGCTCAGGCTCCATCATCCACAGCCTAAATGGTGAACAAGACATCCGAAAAATAGGAGGACTCCAAAAAGCACTACCTACAACAACCACATGCCTCACAATCGGCAACCTCGCCCTAATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCTTAAACACGTCCTACCTAAACACCTGAGCCCTAGTTCTAACTCTACTAGCCACATCATTCACTGCAGTATACACAATCCGCATAACCGTACTAGTACAAACCGGATTCACCCGAATTCCCCCCTTAACCCCAATAAATGAAAACAACCCAGCAGTAACCTCCCCCATCACCCGCCTTGCATTAGGAAGCATCCTAACAGGATTCTTAATTACCTCATTCATCATCC---CAACAAAAACCCCCCCAATAACTATACCACTCCCCATTAAGATAACTGCCTTAATCGTAACAGCCTTAGGAATCGTCTTAGCCCTAGAAATCTCAAAAATAACCCAAACACTTATCCTCACAAAACAAACTCCCTTCTCAAACTTCTCAACCTCCCTAGGATACTTCAACCCCCTAACCCACCGCCTAAGCACAACCAACTTCCTCAAAGGTGGACAAGACATCGCTTCGCACTTAATCGACCTATCCTGATATAAAATACTAGGACCAGAAGGACTGGCCAGCCTACAACTGACAGCAACCAAAACCGCCACTACCCTCCACTCGGGCCTAATCAAAGCCTACCTAGGATCATTCGCCCTATCCATCCTCATCATCCTCA---TATCCACACTCAGAAA--CAA-C-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTCAAAATCATCAACAATGCCTTAATCGACCTACCAGCGCCATCAAATATCTCAACATGATGAAACTTCGGGTCCCTTCTAGGCCTTTGCTTAATCACTCAAATCATCACAGGTCTTCTGCTAGCCATACACTACACAGCAGATACCAACCTAGCCTTCTCCTCCGTAGCTCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGTATCTATTACGGCTCATACCTAAACAAAGAGACCTGAAACGTCGGTGTCATTCTTCTCCTAACCCTAATAGCAACAGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACAGTAATCACTAACCTATTCTCAGCCATCCCATACATCGGACAAACACTAGTCGAATGAGCCTGAGGAGGATTCTCCGTCGACAATCCAACACTAACCCGATTCTTCGCCCTCCACTTCCTCCTCCCATTCCTTATCGTAGGACTTACCCTAGTCCACCTAACCCTTCTCCACGAAACGGGCTCAAACAACCCACTAGGAATCCCACCAGACTGCGACAAAATCCCCTTCCACCCATACTACACCATCAAAGACATCCTAGGATTCGTCCTAATACTTTCCCTGCTCGTCTCACTAGCCCTATTCTCCCCCAACCTCCTAGGAGACCCAGAAAATTTCACCCCAGCCAACCCACTAGTCACTCCCCCACACATTAAACCTGAATGATACTTCCTATTCGCCTACGCCATCCTCCGATCCATCCCAAACAAACTAGGAGGAGTCCTAGCCCTAGCCGCCTCAATCCTAGTTCTATTCCTCATACCACTGCTACACACATCAAAACTGCGATCTATAACTTTCCGCCCTCTATCACAAATCCTATTCTGAGCCCTAGTCGCCAACGTCCTCATCCTAACATGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCACTCTCATACTTCACAATCATCCTAATCCTATTCCCCCTCGCGGCCGCCCTAGAGAACAAAATACTCAAACT----------CTA-ATA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Emberiza_chrysophrys_NC_015233 GTCCCTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-AACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACA-CCT-C-AA-T-C-----AGGTAGATAGGAGCGGGCATCAGGCTCA--C------TAC-A--ACCGTAGCCCAAGATGCTTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAA--T---CCAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGATTAAAAAGCAACTGAGCTGTCGCAAGCCCAAGATGC-CAATAAAACCACC-ACATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACCATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTGAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCA--CTGAAAGCCCAACAGTGGGCGCAACAG-CCCCA-CCACGCTAACAAGAGAGGTCAAGGTATAGCCTATGGAATG----------------------GT-AGCAATGGGCTACATTTTCTAGACTAGAACA-T-----ACGGCAAAGGGGTGTGAAACAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG-CCCCCCACCCCCCCAATAAACTAATAAGCCAC-TT--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AAACG-ACA-CG------ACCTGGA-ATAAC--AAAGCTACTCCCC-A-C-CCCTCCCCAAACTAAAGCATT---C--ACTAGT-CCTAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAGTG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAGCCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTGCGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTCGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGGAAACC-CCACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCT-CGAGCGGATA----AAT--ACTAACCCCTTCCAAT-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTGT-ACCCCAAAAATACAAG-AACCCTATGACTCCCT-CCCCATTAACAGGCTAACCTATACTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGGGCC--CC-CCCCTCT----ACGACGCGAGCTTACATCCGTA-CATTATTAACAAA-CAACCA-ATATACGA--CAAAT---------TAA---ACAAGCA-CAG-TATTA-AACACC-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTTCTAT---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGTAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTCAAAACCAGCAACCACC--TTAGAT-CACACA----CC-CACCTA--C-C-AGGTTCACTGCC-ACA-TAA-GC-C-TCTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAAACTA-AGAGCAACCCCTCAACGTGCTAATAGTACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGACG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAAGCAACTTAATTACAAAAGGCTATCGC-ACCAC---A-TCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTACCC----AACCACCC--CC--A----ATGGC----------CAACTACCCCCTCCTAGTCAACTTCATCATAGCCCTCTCCTACGCCCTCCCAATCTTAATCGCAGTAGCCTTCCTAACACTAGTAGAACGCAAAATCCTGAGCTATATACAAGGCCGAAAAGGCCCAAACATTGTCGGCCCCTTCGGACTCCTCCAACCCCTAGCAGATGGTGTGAAGCTGTTTATCAAAGAACCAATTCGAC---------CATCAACATCCTCCCCCATCCTATTCATTGCAACTCCAATGCTAGCCTTACTTCTAGCAATCTCAATCTGAACCCCACTACCCCTGCCATTTTCCCTAGCAGACCTCAACCTAGGCCTGCTCTTCCTGTTAGCAATGTCAAGTCTGGCAGTGTACTCCATCTTATGATCAGGCTGAGCCTCCAACTCCAAATACGCTCTAATTGGAGCACTACGAGCCGTAGCCCAGACAATCTCCTATGAAGTCACCCTGGCCATCATCCTCCTCTCCGTCGTCCTGCTCAGCGGCAACTATACTCTCAGCACCCTGGCAGTTACACAAGAGCCCCTCTACCTCATCTTCTCCTGCTGGCCCCTCGCCATAATATGGTATGTCTCCACACTCGCCGAAACTAACCGCGCCCCCTTCGACCTGACAGAGGGGGAATCCGAGCTAGTATCCGGGTTTAACGTGGAATACGCAGCAGGCCCATTCGCACTTTTCTTCCTAGCTGAATACGCCAACATCATGCTCATAAATACACTCACCACTATTCTGTTCTTCAACCCAAGCTTCCTCAACCCCCCTCAAGAGCTTTACCCCGTTATCTTAGCCACAAAAGTACTACTCCTGTCAGCAGGGTTTCTATGAATCCGTGCCTCCCACCCACGATTTCGGTACGACCAACTAATACACCTGCTATGAAAAAACTTCCTGCCACTCACACTAGCCCTGTGCCTCTGACACATCAGCATACCAATCTGCTACGCGGGCCTGCCT-----CCCTACCTA-A--GG-GC-----------CTGCTGGAAATGTGCCTGAATCC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-A--ATAC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTCCCTTTATATTACTTTCT----------------AGTAGGGTAAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTAATCTTCATTATCAGCCTCCTCCTAGGAACAACCATCACCATCTCAAGCAACCATTGAATCA---TAGCCTGAGCTGGCCTTGAGATCAACACACTCGCCATCCTCCCACTAATCGCAAAATCTCATCACCCGCGAGCTATTGAGGCTGCCACTAAATACTTCCTTACCCAGGCAGCTGCCTCCGCCCTAGTCCTATTCTCCAGCATGGCCAACGCATGATGCACGGGACAATGAGACATCACCCAACTAACCAACCCCACATCCTGCCTAATTCTCACCTCAGCAATCGCAATAAAACTAGGACTAGTGCCATTTCACTTCTGATTCCCAGAAGTACTTCAAGGCGCTCCTCTCACTACCGGCCTTCTCCTATCCACCCTTATAAAACTCCCCCCAATTGCACTGCTCTACATAACCTCCCCCTCACTAAACCCCACCCTCCTAACTACTCTAGCTATCCTTTCAACTGCGCTGGGAGGATGAATAGGCCTCAATCAAACACAAATCCGAAAAATCCTAGCCTTTTCCTCTATCTCCCACCTGGGCTGAATAGCGATCATCATCATCTACAACCCCAAACTCACCTTACTCAACTTCTACCTATACGCCATAATAACTGCCACCATTTTCCTCACTCTCAACACAATCAAGGTCTTAAAGCTCTCCACGCTAATGACCGCATGAACTAAAACCCCGCCCCTAAGCGCAATACTGCTGTTAGCCCTACTCTCCCTCGCAGGACTTCCCCCTCTAACAGGCTTCCTACCAAAATGACTCATCATCCAGGAGCTAACTAAACAAGACATAACCCCAGCAGCCACACTCATTTCTCTCCTCTCCCTACTAAGCCTGTTCTTCTACCTACGGCTCGCGTACTGCACAGCCATCACGCTGCCCCCACACACCACAAACCACATGAAACAATGGCGCACTAACAAACCGACCAACATCGTGATTGCCGTCCTAACTACCATAACAGTCATACTCCTCCCTATCTCCCCTATAATCCTTACCATCGT------CT----AAGAAACTTAG----GATTACCC--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTC-C--CAA-CCCACTAGGCAGATGGGCTTTGATCCCATAATAG-TATAGCTAACAGCTATATGCCCCAACC-AACAGGCTTCTGCCT-A-------------AGGCCCCGGTACATAA-TCAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTGTGACCTTCATTAACCGATGATTATTCTCAACCAACCACAAAGACATTGGGACCCTATACCTAATTTTCGGCGCATGAGTCGGAATAGTGGGTACCGCCTTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTTGTAATAA---TCTTCATAGTCATGCCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCTCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTCCTACTGTCTTCCACTGTTGAAGCAGGTGTCGGTACGGGCTGAACAGTATATGCCCCACTAGCTGGCAACCTAGCCCACGCTGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTTCACCTAGCCGGTATCTCTTCAATCCTAGGGACAATCAACTTCATCACAACAGCAATCAATATGAAACCCCCTGCCCTCTCACAATACCAAACTCCTCTATTCGTTTGATCAGTCCTAATTGCCGCAGTCCTCCTACTCCTATCCCTCCCAGTCCTTGACGCAGGAATCACAATACTCCTTACAGACTGCAACCTTAACACCACATTCTTTGACCCCGCCGGAGGAGGAGACCCCGTCCTATACCAACATCTTTTCTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATCTTCCCAGGATTCGGGATCATATCCCACATAGTAACATACTATGCGGGTAAAAAAGAACCATTCGGCTACATAGGAATAGTGTGAGCTATACTATCCATTGGATTCCTAGGCTTCATCGTCTGAGCTCATCACATGTTCACAGTAGGAATGGACGTTGACACTCGCGCATATTTCACATCCGCCACTATAATCATTGCCATCCCAACCGGAATCAAAGTGTTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCTCCGATGCTATGAGCCCTGGGCTTCATCTTCCTGTTTACCATCGGAGGTCTAACAGGAATTATTCTAGCAAACTCCTCGCTAGACATCGCCCTGCACGACACCTACTATGTAGTAGCGCACTTCCACTATGTACTGTCCATAGGAGCAGTCTTTGCCATCCTAGCGGGATTCACCCATTGATTCCCACTGTTCACGGGATACACACTCCACTCAACATGAGCTAAAACACACTTCGGCGTAATATTCGTGGGCGTAAACCTAACATTCTTCCCTCAGCACTTCCTAGGTCTAGCAGGTATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACCATCTCCTCAGTAGGATCACTCATCTCCCTGACAGCCGTAATCATACTAGTCTTCATTATCTGAGAAGCCTTTGCATCAAAACGTAAAGTCCTACAACCAGCACTAACAAGTACAAACGTTGAGTGAATCCACGGCTGCCCACCCCCATTCCACACCTTTGAAGAACCCCCCTTCGTCCAAGTC------CAAGAAAGGAAGGAATCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AC--AGACCACTTATGCTTCTTTCTC---ATA---GAGACGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCCAAATTGCAAGTGAAAACCTTGCACATCTCT-----ACCC--AAATATGGCCAACCACTCACAACTTAATTTCCAAGACGCCTCCTCCCCAATCATAGAAGAACTAATAGGATTCCACGACCACGCCCTAATAGTCGCACTAGCAATCTGCAGCCTAGTCCTCTATCTACTAACCCACACACTCACAGAAAAACTATCATCCAACACAGTCAACGCACAAGTAATCGAGCTCGTCTGAACAATCCTCCCCGCTATAGTCCTAGTCACCCTAGCCCTGCCATCCCTACGAATCCTCTACATAATGGACGAAATTAACGAACCCGACCTGACCCTAAAAGCCATCGGCCACCAATGATATTGAACCTACGAATACACCGACCTTAAAGAACTAACATACGACTCCTACATGATTCCAACAGCGGACCTCCCCCTAGGCCACTTCCGCCTACTAGAAGTTGACCACCGCGTTATCGTCCCCATAAACTCCACCATTCGAGTCATTGTCACCGCTGACGACGTTATCCACTCATGAGCCGTTCCCAGCCTAGGAGTAAAAACCGATGCAATCCCAGGACGCCTCAACCAAACCTCATTCCTTGCCTCCCGACCAGGCGTTTACTACGGACAGTGCTCAGAAATCTGCGGAGCCAACCACAGCTTTATACCCATCGTAGTGGAATCTACCCCACTCGCCAACTTCGAAAGCTGATCCACTATAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGACTCCCCCCCCTCCTTAATGATATGCCTCAACTAAACCCAGGTCCATGATTTTTTATCATGATCACTTCATGACTCACCTTCTCCCTAATCATTCAGCCCAAACTCCTCTCATTTGTGTCAATAAACCCCCCTTCTAACAAAC---CGCCCATCACCCCAAGCACCACCCCCTGAACTTGACCATGAACGTAAGTTTCTTCGACCAATTTTCAAGCCCCTCGTTCCTAGGAATCCCACTAATCCTCATCTCAATAACATTTCCAGCCCTTCTCCTACCATCCCTAGACAACCGATGAATCACCAACCGACTTTCAACCCTCCAATTATGATTCGTCAACCTAGTCACAAAACAATTAATAATACCACTAGACAAAAAAGGACACAAATGAGCCCTAATCCTAACATCCCTGATAATCTTTCTCCTACTCATCAACCTCCTGGGCCTATTACCCTACACATTCACCCCAACCACCCAACTATCCATAAACCTAGCCCTAGCCTTCCCCCTATGACTCGCCACCCTACTAACAGGGCTACGAAACCAACCCTCCGCCTCACTAGCCCACCTCCTGCCAGAAGGCACCCCCACCCCACTAATCCCAGCCCTCATCCTAATCGAAACAACAAGCCTACTCATCCGCCCATTAGCCCTGGGCGTACGCCTAACAGCCAACCTGACAGCAGGACACCTGCTCATCCAACTCATCTCCACAGCCACAACAGCCCTGTTCTCAACAATACCAGTAGTCTCACTACTAACCTTCCTAGTCTTATTCTTACTAACCATCTTAGAGGTAGCCGTGGCAATAATCCAAGCCTACGTCTTCGTCCTTCTACTAAGCCTCTACCTACAAGAAAATATCTAACCC--T-----AATGGCACACCAAGCACACTCCTACCACATAGTTGACCCCAGCCCATGACCCATCCTGGGAGCAGCATCCGCTCTGCTCACCACCTCAGGACTAACAATATGGTTCCATTTCAACTCCCCCCGGCTCCTAATCCTAGGACTAATCTCAACTGCCCTAGTCATATTCCAATGATGACGAGACATCGTACGAGAAAGCACATTCCAAGGCCACCACACCCCCACCGTACAAAAAGGACTACGCTACGGAATAGCCCTGTTCATCACATCAGAAGCCTTCTTCTTCCTGGGCTTTTTCTGGGCCTTCTTCCATTCAAGCCTAGCCCCCACACCCGAACTAGGAGGACAATGACCACCTGTAGGAATTAAACCCCTCAACCCCATAGAAGTCCCGCTACTAAATACCGCCATCCTCCTAGCCTCAGGAGTCACCGTCACATGAGCCCACCATAGTATCACAGAGGCCAACCGAAAACAAGCAATCCAAGCCCTATCCCTGACAGTCCTGCTAGGATTCTATTTCACCGCCCTACAAGCCATAGAGTACTATGAAGCACCATTCTCTATCGCCGACGGAGTCTACGGCTCAACATTCTTCGTCGCCACCGGATTCCACGGCCTACATGTAATCATTGGCTCTACATTCCTACTAGTATGCCTTCTACGCCTAATTAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCGGCTGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTCTACATCTCAATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAGCCCAGAGAAGAGTAATA---AACATAATCCTATTTATACTGACCTTATCGCTCACCCTAAGCATCCTTTTAACCGCATTAAACTTTTGACTCGCCCAAATAAGCCCAGACTCAGAAAAACTATCCCCATACGAATGCGGATTCGACCCACTAGGGTCCGCCCGACTCCCCTTTTCAATCCGCTTCTTCCTAGTAGCCATCCTCTTCCTCCTATTCGACCTAGAAATCGCCCTACTGCTACCACTCCCATGAGCCACCCAACTACAATCCCCCACCACCACCCTAACCTGAGCCTCCACCCTCATCTTCCTCCTCACCCTAGGTCTAGTGTACGAATGAATTCAGGGCGGACTAGAATGGGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCCGCCTTCACCCTAAGCACCCTGGGCCTAGCCTTCCATCGCACCCACCTAATCTCAGCCCTACTATGTCTAGAGAGCATAATGCTATCCATATACGTTGCCCTAGCTATATGGCCGATCCAAGCCCAATCATCAACCTCCACCATCTTACCTATCTTCATATTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTAGCCCTTCTAGTGGCTTCAACCCGAACCCACGGATCCGACCACCTACACAACTTCAACCTACTACAATGCTAAAAATCATCGCCCCAACTGCAATGCTCCTTCCCCTGGCCCTCTTCTCCCCACGCAAACACTTATGAACCAACATCACACTATACAGCCTATTAATTGCCTCCATCAGCCTCCAGTGACTCACACCAACCTACTACCCAAACAAAGGCCTAACCCCCTGAACGTCCATTGACCAAATCTCCTCCCCCCTACTCGTCCTCTCATGCTGACTCCTCCCCCTCATAATCATAGCAAGCCAAAATCACCTAGAACCAGAACCGATCAGCCGTAAACGAATCTTCGCCTCAACAGTAGTCCTGGCCCAACTATTTATCCTAATTGCCTTCTCAGCCTCAGAGCTCATACTATTCTACATCGCATTCGAAGCCACCCTCATCCCCACCCTTATCCTCATCACGCGATGAGGCAACCAACCAGAACGCCTAAACGCTGGCATCTATCTCCTATTTTACACACTCGCCAGCTCCCTACCACTATTAATCGCCATCCTCCACCTACACAACCAAGTCGGCACCCTATACCTCCCAATACTTAAACTCTCACACCCCACTTTAAACTCCTCCTGATCGGGCCTAGTAGCAAGCCTAGCCCTCCTACTCGCATTTATAGTCAAAGCCCCCTTATACGGCCTACACCTCTGACTCCCCAAAGCCCATGTAGAAGCACCCATCGCCGGCTCCATACTACTCGCTGCCCTCCTACTAAAACTAGGAGGCTATGGCATCATACGAATCACAATCCTAGTAAACCCATCATCAAACAACCTGCACTACCCCTTCATCACCCTGGCCCTATGAGGAGCTCTAATAACCAGCGCCATCTGCCTACGCCAAATTGACCTAAAATCGCTAATTGCCTACTCATCCGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACCCAATGGGCATTTTCGGGGGCAATAATCCTAATAATCTCGCACGGATTAACATCCTCAATACTATTCTGCTTAGCCAACACCAACTACGAACGAACACACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCCCTACTCCCACTTATGGCCACCTGATGACTGCTAGCCAACTTAACAAACATAGCCCTCCCTCCAACAACAAACCTCATAGCGGAATTAACCATTGTAATCGCACTTTTCAACTGATCTGCCTTCACACTCATCCTAACAGGGGCCGCAATCTTACTCACTGCCTCCTACACCCTGTACATATTAACAATAACACAACGCGGCACCCTCCCATCCCACATTACATCCATCCAAAACTCCTCCACGCGAGAACACCTCCTCATGGCTCTACACATAATCCCCATGATACTCCTAATCCTAAAACCCGAACTAATCTCAGGCATCCCCATAT-GCAAGTATAGTTT-TAA-TCAAAACATTAGACCGTGACTCTAAAAACAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAACGAGAACTGCTAATTCTTGCCTCTGAGCATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTGAACACGCTCATACTCCTAACCCTGGCAACACTCTCCACTCCCATCCTATTCCCCCTCTTATCCAACAACCTCAAAAACACCCCCGACACAATCACAAACGCAGTCAAAACCTCCTTCCTAATCAGCCTGATCCCCATAACAATCTACCTCCACTCGGGAACAGAAAGCCTCACCTCTCTATGAGAATGAAAATTCATCATAACCTTCAAAATCCCTATCAGCCTAAAAATGGACTTCTACTCCCTCACTTTCTTCCCCATTGCACTATTCGTGTCATGATCCATCCTACAATTTGCAACATGATACATAGCCTCAGACCCATACATTACAAAATTCTTCACCTATCTACTTTTCTTTTTAATCGCCATACTCGTCCTAATCATCGCCAATAACTTATTCGTCCTATTCATCGGCTGAGAGGGAGTCGGAATCATGTCTTTCCTCCTAATCAGTTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTCCAAGCCGTACTCTACAACCGAGTCGGAGACATTGGACTCATTCTCTGCATAGCATGACTAGCCTCCACCACAAACACCTGAGAAATCCAACAACTTACCTCCCCATCCCAAACTCCAACACTACCCCTACTAGGCCTCATCCTAGCCGCCACTGGAAAGTCAGCCCAATTCAGCCTCCACCCATGACTGCCAGCTGCAATAGAAGGACCAACCCCCGTATCCGCCCTACTTCACTCCAGCACAATAGTAGTGGCCGGGATCTTCTTACTCATCCGAACCCACTCCCTATTCAACAACAACCAAACCGCCCTAACCCTGTGCCTCTGCCTAGGAGCCCTATCCACACTATTTGCAGCCACATGCGCCCTCACCCAAAACGACATCAAAAAAATCATCGCCTTCTCTACTTCAAGCCAACTCGGACTAATAATAGTTACAATCGGACTAAACCTACCAGAACTAGCCTTCTTCCATATCTCAACCCATGCATTCTTCAAGGCCATGCTGTTCCTATGCTCAGGATCCATCATCCACAGCCTAAACGGGGAACAGGACATCCGAAAAATAGGCGGACTCCAAAAAATACTCCCCACAACCACCGCATGTCTCACCATCGGCAACCTGGCCCTAATAGGAACTCCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAATACATCATACCTAAACACCTGAGCCCTACTCCTAACCCTCCTAGCCACGTCATTCACCGCAGTATATACAACACGCATGACCGTACTAGTACAAACCGGCTTCGTCCGAATTCCCCCCTTAACCCCAATAAATGAAAACAACCCAGCAGTAACCTCCCCCATTACCCGCCTCGCATTAGGAAGCATTCTGGCAGGATTTTTCATCTCCTCCTTCATCATCC---CTACAAAAACCCCCCCAATAACCATGCCATTGTCCATTAAAATAACAGCCCTACTCGTAACAGCCCTAGGCATCGCCCTCGCCCTAGAAATTTCAAAAATAGCCCAAACACTCATCCTTACAAAACAAAACACCTTCTCAAACTTCTCCACTTCCCTGGGATACTATAACCCCCTAATTCACCGCCTAAGCATAACCAACTTCCTCAAGGGAGGACAAAACATCGCATCCCACCTAATCGACCTCTCCTGATACAAAATACTGGGCCCAGAAGGACTGGCCAACCTACAACTAATAGCAACTAAAACCGCCACCTCCTTCCACTCAGGCCTAATCAAAGCCTACCTGGGATCATTTGCCCTATCCATCATTATCATCCTCA---TATCTACATACAGAAA--CAA-C-C---AATGGCCCCCAACCTTCGTAAAAACCATCGAATCCTCAAAATCATCAACGACGCCCTAATTGACCTCCCAGCACCATCAAACATCTCAATGTGATGAAACTTCGGATCCCTACTAGGAGTTTGCCTAATCACCCAAATCATCACAGGCCTCCTACTAGCCATACACTATACAGCAGATACCAACCTAGCCTTCTCCTCCGTTGCTCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATTTGCATCTACCTTCACATCGGCCGAGGATTGTATTACGGCTCATACCTGTACATAGAAACCTGAAACATTGGAGTCATTCTACTCCTAGCCCTCATAGCAACCGCCTTCGTAGGCTACGTCCTACCATGAGGCCAAATGTCATTCTGAGGGGCTACCGTAATCACAAACCTATTCTCAGCCATCCCTTACATCGGACAAACGCTAGTAGAATGAGCTTGAGGCGGATTCTCCGTCGACAACCCCACACTAACCCGATTCTTTGCCCTCCACTTCCTCCTCCCCTTCGTCATCGTGGGAATCACTCTCGTCCACCTCACCTTCCTGCACGAAACGGGCTCAAACAACCCACTAGGCATTCCCTCAGATTGCGACAAAATCCCCTTCCACCCATACTACACCATCAAAGACGCCCTAGGATTCGTACTAATACTCTCCGTATTAGTCTCACTGGCTCTCTTCTCCCCCAACCTCCTAGGAGACCCAGAAAACTTCACCCCAGCCAACCCCCTTGTCACCCCCCCACACATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATTCTCCGATCCATCCCAAACAAACTCGGAGGCGTACTAGCTTTAGCTGCCTCCATCCTAGTCCTATTCCTTGTCCCCCTACTACACACATCAAAACTACGATCCATAACCTTCCGTCCCCTATCACAAATCCTATTCTGAGCCCTAGTAGCTAACATCCTCATCCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCTTTCATCATCATTGGCCAACTAGCCTCACTCTCATACTTCACAATCATCCTCATTCTATTCCCCCTCGCAGCCATCCTAGAGAACAAATTACTCAAACT----------CTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAGGATTGAAGACTAAACCCCTTCTTAGAGTT Emberiza_tristrami_NC_015234 GTCCCTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-AACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGCATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAGACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAA--T---CCAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAGCTAAGATTAAAAAGCAGCTGAGCTGTCGCAAGCCCAAGATGC-CAATAAAACCACC-ACATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCA--CTGAAAGCCCAACAGTGGGCGCAACAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GT-AGCAATGGGCTACATTTTCTAAACTAGAACA-T-----ACGGCAAAGGGGTGTGAAACAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG-CCCCC--CCCCCCCCATACACTAATAAGCCAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGAACA-CCAAGACGTAGC-TTAAACG-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AAACG-ACA-TG------ACCTAGA-ATAAC--AAAGCTACTTTTT-T-C-CTCCC----AACTAAAGCATT---T--ACCAGT-CCTAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGAAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTCGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGGAAACC-TTACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCT-CGAGCGGATA----AAT--ATTAACCCCTTCCAAC-TGAATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCTCAAAAATACAAG-AACCCTATGACTCCCT-CCCCATTAACAGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCATA-CATTATTAACAAA-CAACCA-ATGTACGA--CAAAT---------TAA---ACAAGCA-CAG-TATTA-AGCATC-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTCTTAT---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTCAAAACCAGCAACCACC--TTAAAT-CACATA----TT-CACCTA--C-C-GGGTTCACTGCC-ACA-TAA-CA-C-CCTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTA-AGAGCAACCTCTCGACGTGCTAATAGTACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGACG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAATCAACTTAATTACAAAAGGCTATCAC-ACCAC---A-TCA-CGTCCAAGAAAAGGA--C-CGGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTACCC---AAACCACCC--CC--A----ATGAC----------CAACTACCCCCTTCTAATTAACTTCATCATAGCCCTCTCCTACGCCCTCCCAATCTTAATCGCAGTAGCCTTTCTAACCCTGGTAGAACGCAAAATCCTAAGCTACATACAAGGCCGAAAAGGCCCAAACATTGTCGGCCCCTTCGGGCTTCTCCAGCCTCTAGCAGATGGTGTAAAACTATTTATTAAAGAACCAATTCGAC---------CATCAACATCCTCCCCCATCCTATTTATTGCAACTCCAATGCTAGCCCTACTCCTGGCAATCTCAATCTGAACCCCACTACCCCTGCCATTTTCCCTAGCAGACCTCAACCTAGGCCTGCTCTTCCTATTGGCTATATCAAGCCTGGCAGTATACTCCATCTTATGGTCGGGTTGAGCCTCCAACTCCAAATATGCTCTAATTGGGGCACTACGAGCCGTAGCCCAAACAATCTCTTATGAAGTCACCCTGGCCATCATCCTCCTCTCCGTCGTCCTACTCAGCGGCAACTATACTCTCAGCACCCTGGCAGTAACACAAGAGCCCCTTTACCTCATCTTCTCCTGCTGGCCCCTCGCCATAATATGATACGTCTCCACACTCGCCGAAACCAACCGTGCCCCCTTCGACCTGACAGAGGGAGAATCCGAACTAGTGTCCGGATTCAACGTAGAATACGCAGCAGGCCCATTCGCACTTTTCTTCCTGGCTGAATACGCCAACATCATACTCATAAACACGCTCACCACAATTCTGTTCTTCAACCCGAGCTTCCTCAACCCTCCCCAAGAACTGTACCCCGTTATCTTAGCCACAAAAGTACTACTCCTGTCAGCAGGGTTCCTATGAATCCGTGCCTCCTACCCACGATTTCGGTACGACCAACTAATACACCTGCTATGAAAAAACTTCCTGCCGCTCACACTAGCCCTGTGCCTCTGACACATCAGCATACCAATCTGCTACGCGGGCCTACCT-----CCCTACCTA-A--GA-GC-----------CCGCTGGAAATGTGCCTGAACCC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-A--ACGC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTCCCTTTATATTACTTTCT----------------AGTAGGGTAAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTAATCTTCATCATCAGCCTCCTCCTAGGAACAACCATCACCATCTCAAGCAACCACTGAATCA---TAGCCTGAGCCGGTCTCGAGATCAACACACTCGCCATTCTTCCACTAATCTCAAAATCCCATCACCCACGAGCTATTGAGGCTGCTACTAAATACTTCCTTACCCAAGCAGCTGCCTCCGCCCTAGTCCTATTCTCCAGCATAACCAACGCATGATGCACAGGGCAATGAGACATCACCCAACTAACCAACCCCACATCCTGCCTAGTTCTCACCTCGGCAATTGCAATAAAATTAGGACTAGTACCATTCCACTTCTGATTTCCAGAAGTGCTTCAAGGCGCCCCCCTCACTACCGGCCTTCTCCTATCCACCCTCATAAAACTCCCCCCAATTGCACTACTCTACATAACCTCCCCCTCACTAAACCCCACCCTCTTAACCACTCTGGCCATCCTTTCAACCGCACTGGGGGGATGAATAGGCCTCAACCAAACACAAATCCGAAAAATCCTGGCCTTCTCCTCTATCTCCCACCTGGGTTGAATGGCAGTCATCATCATCTACAACCCCAAACTCACCTTACTCAACTTCTACCTGTACGCCATAATAACTGCCGCCATTTTCCTCACCCTCAACACAATCAAAGTCTTAAAACTCTCTACACTAATAACTGCATGAACTAAAACCCCACCCTTAAGCGCGATGCTACTGTTAGCCCTACTCTCCCTCGCAGGACTCCCCCCTCTAACAGGATTCCTACCTAAATGACTTATCATCCAAGAACCAACCAAACAAGACATAGCCCCAGTAGCCACACTTA------TCTTCTCCTTACTAAGCCTGTTCTTCTACCTACGACTCGCATACTGCACAGCCATCACACTCCCTCCGCACACTACAAACCACATGAAGCAATGATGCACTAACAAGCCAACCAGCATCATAATTGCCATCTTAACTACCATAACAGTCACACTCCTTCCCATCTCCCCTATAATCCTTACCATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTC-C--CAA-CCCACTAGGCAGATGGGCTTCGATCCCATGAAAG-TATAGTTAACAGCTATATGCCCCAACC-CTCAGGCTTCTGCCT-A-------------AGGCCCCGGTACACAA-CTAATGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTGTGACTTTCGTTAACCGATGATTATTCTCAACCAACCACAAAGACATCGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTGGGAGACGACCAAGTCTACAACGTAGCTGTCACGACCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATTGGAGGGTTCGGAAACTGATTAGTCCCCCTAATAATTGGAGCCCCAGACATGGCGTTCCCACGAATAAACAACATAAGCTTCTGACTGCTCCCCCCATCCTTCCTCCTCCTCCTAGCATCCTCTACTGTCGAGGCAGGTGTCGGAACAGGTTGAACAGTGTACCCACCACTAGCCGGCAACCTGGCCCATGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTACATCTGGCCGGTATCTCTTCAATCCTAGGAGCAATTAACTTCATCACAACAGCAATCAACATAAAACCTCCCGCCCTCTCTCAATACCAAACTCCCCTATTCGTCTGATCAGTCCTAATCACCGCAGTACTCCTACTCCTATCCCTACCAGTTCTTGCCGCAGGGATTACAATGCTACTAACAGACCGCAACCTCAACACTACATTCTTTGACCCCGCAGGAGGAGGAGACCCCGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATCCTCCCAGGATTCGGAATCATCTCCCACGTAGTGACATACTACGCAGGCAAAAAAGAGCCATTCGGCTACATAGGAATAGTATGAGCCATGCTGTCCATTGGGTTCTTAGGCTTCATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTTGACACTCGCGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACCGGAATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGGGACCCCCCAATACTGTGAGCCCTAGGCTTCATCTTCCTGTTTACCATCGGAGGCCTAACAGGAATTATTCTAGCAAACTCCTCACTAGACATCGCCCTACACGACACCTACTATGTAGTAGCACACTTCCACTACGTACTGTCCATGGGAGCGGTCTTTGCCATTCTAGCAGGATTTACTCACTGATTCCCACTGTTCACGGGGTACACACTCCACTCAACATGGGCTAAAACACACTTCGGCGTAATATTCGTAGGTGTAAACCTAACATTCTTCCCCCAACACTTCCTAGGTCTAGCAGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACTATTTCCTCAGTAGGATCACTCATCTCCCTAACAGCCGTAATCATACTAGTCTTCATCATCTGAGAAGCCTTTGCATCAAAACGTAAAGTACTACAACCAGCACTAACAAGCACAAACGTTGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTTGAAGAACCCCCCTTCGTCCAAGTC------CAAGAAAGGAAGGAATCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---ATA---GAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAAGTGAAAACCTTGCACATCTCC-----ACCC--AAATATGGCCAACCACTCACAACTTAACTTCCAAGACGCCTCCTCCCCAATCATAGAAGAACTAATAGGATTCCACGACCACGCCCTAATAGTCGCACTAGCAATCTGCAGTCTAGTCCTCTATCTACTAACCCACACACTTACAGAAAAACTGTCATCCAACACAGTCGACGCGCAAGTAATCGAGCTCGTCTGAACAATCCTTCCCGCCATAGTCCTAGTTACCCTAGCCCTACCATCCCTACGAATCCTCTACATAATAGACGAAATTAACGAACCTGACCTAACCCTAAAAGCCATCGGCCACCAATGATATTGAACCTACGAATACACTGACCTTAAAGAGCTAACATACGACTCCTACATAATTCCAACAGCAGACCTTCCCCTAGGCCACTTCCGCCTACTAGAAGTCGACCACCGCGTTATCGTTCCCATAAACTCCACCATTCGAGTCATCGTCACCGCTGACGATGTCATCCACTCATGAGCCGTCCCCAGCCTAGGTGTAAAAACCGATGCAATCCCAGGACGCCTCAACCAGATCTCCTTCCTTGCCTCCCGACCGGGTGTCTACTACGGACAGTGCTCAGAAATCTGCGGAGCCAACCACAGCTTTATGCCAATCGTAGTGGAATCCACCCCACTCGCCAACTTTGAAAGCTGATCCACTATAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGA---CCCCCCCTCCTTAATGATATGCCTCAACTAAACCCAGGTCCATGATTTTTTATCATGCTCACTTCATGACTTACCTTCTCCCTAATCATCCAGCCCAAACTCCTCTCATTCGTATCAATAAATCCCCCTTCTAACAAAC---CTCCCATCACCCCAAGCACCACCCCTTGAACCTGACCATGAACGTAAGTTTCTTCGACCAATTTTCAAGCCCATCATTCCTAGGAATTCCACTAATCCTCATCTCAATAACATTCCCAGCCCTTCTTCTACCATCCCTAGACAACCGATGAATCACCAACCGACTTTCAACCCTCCAACTGTGATTCGTCAACCTAATCACAAAACAACTAATAATACCCCTAGACAAAAAAGGACACAAATGAGCCCTAATCCTAACATCCCTAATGATCTTTCTCCTACTCATTAACCTCCTAGGCTTATTACCCTACACATTTACCCCAACCACCCAACTATCCATAAACCTAGCCCTGGCCTTCCCCCTATGACTTGCCACCCTACTAACAGGACTACGAAACCAACCCTCCGCCTCACTAGCCCACCTCCTGCCAGAAGGCACCCCCACCCCACTAATCCCAGCCCTCATCCTAATCGAAACAACAAGCTTGCTCATCCGCCCATTAGCCCTCGGCGTACGCCTAACAGCCAACCTGACAGCAGGACATCTACTCATCCAACTCATCTCCACAGCCACAACAGCCCTATTCTCGACAATACCAGTAGTCTCACTACTAACCTTTCTGGTTTTATTCCTACTAACCATCTTAGAAGTGGCCGTAGCAATAATCCAAGCTTACGTCTTCGTCCTCCTACTAAGTCTCTACCTACAAGAAAATATCTAATCC--C-----AATGGCACACCAAGCACACTCCTACCACATAGTTGACCCCAGCCCATGACCCATCCTGGGAGCAGCATCTGCCCTGCTCACTACCTCAGGACTAACAATATGATTCCACTTCAACTCCCCTCGACTCCTAATCCTAGGCCTAATCTCAACTGCCCTTGTCATATTCCAATGATGACGAGATATCGTACGAGAAAGCACATTCCAAGGCCACCACACCCCTACCGTACAAAAAGGACTGCGCTACGGAATAGCCTTATTCATCACATCAGAAGCCTTCTTCTTCCTGGGCTTTTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCCACACCCGAACTAGGAGGACAATGACCACCCGTAGGAATTAAGCCCCTCAACCCCATAGAAGTCCCACTCCTAAATACCGCCATCCTCCTAGCCTCAGGGGTTACCGTCACATGAGCCCATCACAGCATCACAGAGGCTAACCGAAAACAAGCAATCCAAGCCCTCTCCCTAACAGTCCTACTAGGATTCTACTTCACCGCCCTACAAGCCATAGAATACTATGAAGCACCATTCTCCATCGCTGACGGAGTCTACGGCTCAACATTCTTCGTTGCCACCGGATTCCACGGCCTACACGTAATCATTGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTAATTAAATACCACTTCACATCAAACCACCACTTCGGATTCGAGGCAGCTGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTCTACATCTCAATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTGACCCTATCACTCGCCCTAAGCATCCTCTTAACCACATTAAACTTTTGACTCGCCCAAATAAACCCAGACTCAGAGAAACTATCCCCATACGAATGTGGATTCGACCCACTAGGATCCGCCCGACTTCCCTTTTCAATCCGCTTTTTCCTAGTAGCCATCCTCTTCCTTCTGTTCGACCTAGAAATCGCCCTACTCCTACCACTTCCATGAGCCACCCAACTACAATCCCCTACCACCACCCTAACCTGAGCCTCCACCCTCATCTCCCTCCTTACCCTGGGCCTAGTGTACGAATGAATTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTACCTTCACCTAAGCTTCTACTCCGCCTTCACCCTAAGCAGCCTAGGCCTAGCCTTCCACCGTACCCACCTAATCTCAGCCCTACTATGTCTGGAAAGCATAATACTGTCCATATACGTTGCCCTAGCCATATGGCCCATCCAGACCCAATCATCAACCTCCACCATCTTACCCATCTTCATGCTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTGGCCCTCCTAGTAGCTTCAACCCGAACCCACGGGTCCGACCACCTGCACAACTTCAACCTACTACAATGCTAAAAATCATCACCCCAACTGCAATGCTCCTCCCCCTAGCCCTCCTCTCCCCACGCAAACACCTATGAACTAACATTACATTATACAGCCTATTAATTGCCTCCATCAGCCTCCAATGACTCACACCAACCTACTACCCAAACAAAGGCTTAACTCCCTGAACATCCATCGACCAAATCTCCTCCCCCCTGCTCGTCCTCTCATGCTGACTCCTCCCCCTCATGATCATAGCAAGCCAAAACCACCTAGAACCAGAGCCGGCCAGCCGTAAACGAATCTTCGCCTCAACAGTAATCCTAGCTCAACTATTCATTCTAGTTGCCTTCTCAGCCTCAGAGCTCATGCTCTTCTACATTGCATTCGAAGCCACCCTCATCCCCACCCTTATCCTCATCACACGATGAGGCAACCAACCAGAACGACTAAACGCTGGCATCTACCTTCTATTCTACACACTCGCCAGCTCCCTACCACTATTAATCGCTATCCTCCACCTACATAACCAAATCGGCACCCTATACCTCCCGATACTTAAACTCTCACACCCTACTTTAAACTCCTCCTGATCCGGCCTAATAGCAAGCCTAGCCCTCTTACTCGCATTCATAGTCAAAGCCCCCTTATACGGTCTACACCTCTGACTCCCCAAAGCCCATGTAGAAGCACCCATTGCCGGCTCCATACTACTCGCCGCCCTCCTACTAAAACTAGGGGGCTATGGTATCATACGAGTCACAATCCTAGTAAACCCATCATCAAACAACCTACACTACCCCTTCATTACCCTGGCCCTATGAGGAGCACTAATAACCAGCGCCATCTGCCTACGCCAAATTGACCTAAAATCACTAATTGCCTACTCATCCGTCAGCCACATAGGACTAGTTGTAGCCGCAACCATGATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACATGGATTAACATCCTCAATACTATTCTGCTTAGCCAACACCAACTATGAACGAACTCACAGCCGAATCCTCCTGCTCACACGAGGACTCCAACCCCTACTGCCACTTATAGCCACCTGATGACTGCTAGCCAACCTAACAAACATAGCCCTCCCCCCAACAACAAACCTCATGGCAGAACTAACCATTGTAATCGCACTTTTCAACTGATCCGCTTTCACACTCATCCTAACAGGAGCCGCAATCCTACTTACTGCCTCCTATACCCTGTACATATTAACAATAACACAACGCGGCACCCTCCCATCCCACATTACATCCATCCAAAACTCCTCCACACGAGAACACCTCCTCATGGCTCTACACATGATCCCCATGATGCTCCTGATCCTAAAACCCGAGCTAATCTCAGGCATCCCCATAT-GCAGGTATAGTTT-AAA-CCAAAACATTAGACCGTGACTCTAAAAACAGAAGTTAAACTCTTCTTACCTGCCGAGGAG-AGGTA-TAACCAACGAGAACTGCTAACTCTTGCCTCTGAGCATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTGAACACGCTCATACTCCTAACCCTGGCAACACTCTCCACTCCCATCCTATTCCCCCTTCTATCCAACAACCTCAAAAACACCCCCGACACAATCACAAACACAGTCAAAACTTCCTTCCTAATCAGCCTGATCCCCATGACAATCTACCTCCACTCAGGCACAGAAAGCCTCACCTCCCTATGAGAATGAAAATTCATCATAACCTTCAAAATCCCTATCAGCCTAAAAATAGACTTCTACTCCCTCACCTTTTTCCCCATCGCACTATTCGTATCATGATCCATCCTACAATTTGCAACATGATACATAGCCTCAGACCCACACATTACAAAATTCTTCACCTACCTGCTTTTCTTCTTAATCGCCATACTCATTCTAATCGTCGCCAACAACCTATTCGTCCTATTCATTGGCTGAGAAGGGGTCGGAATCATATCCTTCCTCCTAATCAGCTGATGACACGGCCGAGCTGAAGCCAACACCGCCGCCCTCCAAGCCGTGCTCTACAACCGAGTCGGAGACATCGGACTTATCCTCTGCATAGCGTGACTGGCCTCTACCACAAACACCTGAGAAATTCAACAACTTGCCTCCCCATCCCAAACTCCAACACTACCCCTACTAGGTCTCATCCTGGCCGCTACCGGAAAGTCAGCCCAATTCAGCCTCCACCCGTGACTACCAGCCGCGATAGAAGGGCCAACCCCCGTGTCCGCCCTACTTCACTCTAGTACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACTCCCTATTCAACAACAACCAAACCGCCCTAACCCTATGCCTCTGCCTAGGAGCTTTATCCACACTATTTGCAGCCACATGCGCCCTCACCCAAAACGACATCAAAAAAATTATCGCCTTCTCCACTTCAAGCCAACTCGGACTAATAATAGTTACAATCGGACTAAACCTACCAGAACTAGCCTTCTTCCATATCTCAACCCATGCATTTTTCAAAGCCATACTATTCCTCTGCTCAGGGTCCATCATCCACAGCCTAAACGGAGAACAGGACATCCGAAAAATAGGCGGACTCCAAAAAATACTCCCCACAACCACCGCATGCCTCACCATCGGCAACCTAGCCCTAATAGGAACCCCATTCCTGGCAGGATTTTATTCAAAAGACCAGATCATCGAAAGCCTAAATACATCCTACCTAAACGCCTGAGCCCTACTCCTAACCCTCCTAGCCACATCATTCACCGCAGTATATACAACACGCATAACCGTACTAGTACAAACCGGCTTCGTCCGAATTCCCCCCTTAGCCCCAGTAAATGAAAACAACCCAGCAGTAACCTCCCCCATTACCCGCCTTGCACTAGGGAGCATCCTAGCAGGATTTTTCATCTCCTCTTTCGTCATCC---CTACGAAAACCCCTCCAATAACCATACCACTCTCCATTAAAATAACAGCCCTGATCGTAACAGCCTTAGGCATCGCCCTTGCCCTAGAAATTTCAAAAATAACCCAAACACTTATCCTCACAAAACAAAACACCTTCTCAAACTTCTCAACATCCCTAGGATACTATAACCCCCTAATCCACCGCCTAAGCATGACCAACTTCCTCAAAGGAGGACAAAACATCGCATCCCATCTAATCGACCTCTCCTGATACAAAATACTATGCCCAGAAGGACTGGCCAACCTACAACTAATAGCAACTAAAACCGCCACCTCCTTCCACTCAGGCCTAATCAAAACCTACTTAGGATCATTCGCCCTATCCATCATCATCATCCTCA---TATCCACATACAGAAA--CAA-C-C---AATGGCCCTCAACCTTCGTAAAAACCACCGAATCCTCAAAATCATCAATGACGCCTTAATCGACCTCCCAGCACCATCAAACATCTCAACATGATGAAACTTCGGATCCCTACTAGGAGTCTGCCTAATCACCCAAATCATCACAGGCCTCCTACTAGCCATACACTACACAGCAGACACCAACCTAGCCTTCTCCTCCGTTGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATTCGCAACCTCCATGCAAACGGAGCCTCCTTCTTCTTCATTTGCATCTACCTCCACATTGGCCGAGGATTATATTACGGCTCATACCTGTACATGGAAACCTGAAACATTGGAGTAGTCCTACTCCTAGCCCTCATAGCAACCGCCTTCGTAGGCTACGTCCTACCATGAGGCCAAATATCATTTTGAGGGGCCACCGTAATCACAAACCTATTCTCAGCCATTCCCTACATCGGACAAACACTAGTAGAATGGGCTTGAGGCGGGTTCTCCGTCGACAACCCCACACTAACCCGATTCTTTGCCCTCCACTTCCTCCTCCCCTTCATCATCGTAGGAATCACTCCCGTCCACCTCACCTTCCTACATGAAACAGGCTCAAACAACCCACTAGGCATCCCTTCAGATTGCGACAAAATCCCCTTCCACCCATACTACACTATCAAAGACGCCCTAGGATTCGTACTACTACTCTCTGTGCTAGTCTCACTAGCTCTCTTCTCCCCCAACCTCCTAGGAGACCCAGAAAACTTCACTCCAACCAACCCCCTTGTCACCCCTCCACACATCAAACCCGAATGATACTTCCTATTCGCCTACGCTATCCTCCGATCCATCCCAAACAAACTTGGAGGCGTACTAGCCTTGGCCGCCTCTATCCTAGTCCTATTCCTCGTCCCCCTACTACACACATCAAAACTACGATCCATAACTTTCCGACCCCTATCACAAATCCTATTCTGAGCCCTAGTAGCTAATATCCTCATCCTAACTTGAGTCGGCAGCCAGCCAGTAGAACACCCCTTCATCATTATTGGCCAACTAGCCTCACTCTCATACTTCACAATCATCCTCATCCTATTCCCCCTCGCGGCCATCCTAGAGAACAAACTACTCAAACT----------CTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Eopsaltria_australis_NC_019665 GTCCTTGTAGCTTACAACAAAGCATGGCACTGAAGATGCCAAGATGGCCGT--CATAAAACGCCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCTAGGTATATACATGCAAGTATCCGCACTCCAGTG-TAAACGCCCTAAACA-CCT-T-ATCATT-----AAGCCAATAGGAGCTGGCATCAGGCTCA--C------CAC-T--ACCGTAGCCCAAGACGCCTCGCATTTGCCACACCCCCACGGGTACTCAGCAGTAGTTAATATTAAGCAATGAGCGTAAGCTTGACTTAGCCATAGCAAA-----TCAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATCAACCTTAC-T----AACGGCGTAAAGAGTGGTCAG-ATGTTAT-CCAAATAACTAAGATTAAAAAGCAACTGAGCTGTCATAAGCCCAAGATGC-CTATAAGGCCTCC--TCCCAAAGAAGATCTTAGCCT--AACGATTAATTAAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCC-TGC--CTCTACTTAGGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATACTACCTGACCATTCCTTGC-CAA--AG--CAGCCTATATACCGCCGTCGCCAGCCCACCTACC--CTGAAAGCCTAACAGTGGGCGCAATAG-TCCAA-CCACACTAGTAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAATTAGAACA-T----AACGGCAAAGGGACATGAAACTGTCCCTCGAAGGCGGA-TTTAGCAGT-AAAGCGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACACACCGCCCGTCACCCTCCTCAAAAG-CG--ACCCCCCCCCCCCACTACACTAATAAACCAC-CC--AGCTAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGAACAGCCAAGACGTAGCTTTAAACG-AAAGCACTCAGCTTACGCCTGAAAGATATCCGGCA-ACTCCGGATCGTCTTGA-TGCCAAACTCTAGCCC--------AACAT-ACATTG------ACCTTGA-ATAAC--AAAGCTACT--CCCCTA-CACTA----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAG-CACGTACCGTAAGGGAAAGATGAAATAATAATG--AACAAGC--CAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTCTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TGTTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTCCTCCAAGG-AACC---CCAAAACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AGT--AACTAATCT--AGAACTACTAATGTGGGCCCTCAAGCAGCCACCAATAAAGAGTGCGTCAAAGCTCTAA-ACCTCAAAAATATAAG-AACTCCATGACTCCCT-CCCCATTAACAGGCTAACCTATAACCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGTTTACATCCACA-CATTATTAACAAA-TCACCA-AGATACAA--CAAAT---------ACA---ACAAGCA-AAG-TATCA-ATTACC-TTGTTGACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCAGTG--ACCTTAGT---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCGTAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTCAAAATCAGCAGCCACC--CTAAAA--ACCTT----AA-CGCCCA--CTT-GGGCCTACTCAT-TCACCTAAGG-C-GCTGGCC-TGCA-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AGATCCTCCAA-AAATTGGACCATAACTCTAGACTA-AGAGCGACCTCTCAACGTGCTAACAGCATCCAGACCCAATAA--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATTAACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAATGCAACTAAATTACAAAAGGCTATCAC-CCCAC---A-CCA-CGTCCTAGAAAAGGA--C-AAGCTAGCGTGGCAGAGCTCG--GTAAATGCAAAAGGCTTAAGTCCTTTAAACCAGAGGTTCAAATCCTCTCCCTAGC-----TTCCCCCGTCCAATGCACTTC--------GCAAC----------CAACTACCCCTTAATTATTAACCTTATTATAGCCCTGTCCTACATCATCCCCATTTTAATTGCAGTAGCTTTTCTTACATTAGTGGAACGTAAAATCCTAAGCTATATACAAGGTCGGAAAGGCCCAAATGTTGTCGGCCCATTCGGATTGCTGCAGCCACTAGCAGACGGAGTGAAACTATTCATCAAAGAACCAATTCGCC---------CATCAACAGCCTCCCCAATTCTCTTCATCCTCACCCCGATACTAGCACTGCTGCTGGCCATCTCAATCTGAACCCCTCTTCCCCTACCATTCTCCTTAGCCGACCTTAACCTAGGCCTACTGTTCCTACTAGCCATATCAAGCCTAGCAGTGTACTCCATCTTATGATCAGGCTGAGCCTCAAACTCAAAATACGCCCTAATCGGGTCACTACGGGCAGTAGCTCAAACTATCTCTTATGAAGTAACCCTGGCAATCATCCTCTTATCCATTATCCTACTTAGCGGAGGCTACACCCTTAATACTCTAGCAGTCACTCAAGAATCTATTTTTCTCATTTTTCCATGCTGACCGCTCGCCATAATATGATATGTTTCTACACTTGCCGAAACAAACCGCGCCCCATTCGATCTCACAGAAGGGGAATCTGAGCTAGTGTCTGGGTTTAATGTAGAATACGCGGCAGGACCTTTCGCCCTATTCTTCCTAGCCGAATATGCCAACATTATACTCATGAACACACTAACCGCCATCCTATTCTTCAACCCCAGCTTATATAACCTACCCCAAGACTTTTACCCAATAATTCTAGCCACAAAAGTTCTATTGCTATCCGCTGGGTTTTTATGAATCCGTGCCTCGTACCCCCGTTTCCGATATGACCAGCTAATACACCTCCTATGAAAAAACTTCCTACCACTTACACTAGCATTATGCCTATGACACATCAGCATACCAATTTGCTACGCAGGCCTGCCA-----CCATACTTA-A--GA--------------AGGTAGGAAATGTGCCTGAACTTCA--AAGGGTCACTATGATAAAGTGAACATGGAGGTGTACCAACCCTCTCATTTCCTAAAACAGC-------CTAGAAAAGCAGGAATTGAACCCGCACTAGAGAGATCAAAACCCTCCATACTTCCTTTATATTATTTTCT----------------AGTAAGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCTTGCTAAATGAATCCCCAAGCAAAGCTAATCTTCACCATCAGCCTTATCCTAGGGACAACTATTACGATCTCAAGCAATCACTGAATTA---TAGCCTGAGCCGGCCTTGAAATTAACACACTAGCCATCTTGCCCCTAATCTCAAAATCCCATCACCCTCGAGCCATCGAGGCCGCAACTAAATACTTCCTAACCCAAGCAGCTGCCTCCACATTACTATTATTCTCCAGCATGAACAACGCGTGATACACCGGACAATGAGATATTACCCAACTAACACACCCCACTTCATGCCTAGTACTAACCACAGCCATTTCGATAAAACTAGGACTAGTCCCATTCCACTTCTGATTCCCAGAAGTCATACAAGGCACCTCTCTAATTATCGGCTTCCTACTGTCCACAGCCATAAAATTTCCACCAATCACCCTCCTCTATATAACCTCACCATCCCTAAATCCTACACTACTAACCACCCTAGCCATTTTATCCGTAGCCGTAGGCGGTTGAATAGGATTAAATCAAACACAAATCCGAAAAATCATAGCCTTCTCCTCCATCTCCCATCTAGGATGAATGGCTATTGTGATCAGCTACAACCCCAAACTCACTCTACTAAACTTCTACCTATATACCATAATAACCGCAGCTGTATTTCTTACCCTTAATTCAATTAAAGCCCTAAAATTGCCAACATTACTAACCTCATGAACAAAATCACCAGCACTAAACACAGTCCTTCTACTTACACTACTTTCCCTAGCCGGCCTCCCACCACTAACAGGCTTCCTCCCCAAATGATTTATTATCCAAGAGCTAACCAAACAGGACATAGCCCCCGCAGCAACAGTAATCTCCCTACTATCCCTACTAAGCCTATTCTTTTACCTTCGCCTTGCATACTGCGCAACAATCACGCTTCCCCCTCACACTACAAATCATGTAAAACAATGGCGTACCAACAAACCAGTAAACCTCTCCATCGCCATCCTGACCACCCTGTCCCTAGCCTTACTCCCCATATCACCTATAATCCTAACAATCATTCAAACTT----AAGAAACTTAG----GATAGTCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTCAAACCCTCTTAGTTTCTGTTAAAATCCGCAGGATACTACCCTACATCCCCTGGATGCAACCCAGGTGCTTTAA-TTAAGCTAGGATCTC----CAA--CATCTAGGCAGATGGGCTTCGATCCCATAACAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-AAC-------C---AGACCCCGACACACGA-TTAGTGTGCATCAATGAGCTTGCAACTCACTATGAACTTCACTACGGAGCC---GATAAGAAGAGGAATTAAACCTCTGTAAAAAGGACTACAGCCTAACGCCT-ATACACTCGGCCATC--------------TTACCTGTGACTTTCACCAATCGATGACTATTCTCAACCAACCACAAAGATATCGGCACTCTATACCTAATTTTCGGCGCATGAGCCGGGATAGCAGGCACCGCCCTAAGCCTATTAATCCGAGCAGAACTGGGCCAACCAGGAGCCTTACTGGGAGACGACCAGATCTATAATGTAGTCGTTACAGCCCATGCATTCGTGATGATCTTCTTCATAGTAATACCAATTATAATCGGAGGATTTGGAAACTGACTAGTTCCCCTAATAATTGGAGCTCCCGACATAGCATTTCCCCGTATAAACAACATAAGCTTTTGATTACTCCCCCCATCCTTTCTCCTACTACTAGCCTCATCCACAGTAGAAGCAGGGGTAGGAACCGGCTGAACCGTATATCCCCCACTAGCAGGAAACCTAGCCCACGCAGGAGCCTCAGTCGACCTAGCCATTTTTTCGCTGCATCTAGCAGGCATCTCATCAATCCTAGGAGCAATTAATTTTATCACAACAGCAATTAACATAAAACCACCAGCCCTTTCACAATACCAAACACCCCTATTCGTCTGATCCGTACTAATCACCGCAGTCCTTCTCCTTCTGTCTCTCCCAGTCCTCGCTGCCGGAATCACTATACTTCTCACAGACCGTAATCTAAACACCACCTTCTTTGACCCAGCAGGAGGAGGGGATCCCGTGCTATACCAACATCTTTTCTGATTCTTTGGACATCCAGAAGTGTATATCTTGATCCTTCCAGGATTCGGAATCATCTCCCACGTAGTAACCTACTACGCAGGAAAAAAAGAACCATTTGGATACATAGGCATAGTATGAGCCATGCTATCAATCGGATTCCTGGGCTTTATCGTCTGAGCTCATCACATATTTACTGTGGGGATAGACGTGGACACTCGAGCTTACTTTACATCCGCTACCATAATTATTGCCATCCCCACCGGAATTAAAGTATTCAGCTGACTGGCCACTCTACACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGCTTCATCTTCCTATTCACAATCGGAGGACTTACAGGGATCGTCCTAGCAAACTCCTCACTAGACATCGCCCTACACGATACCTACTATGTAGTAGCCCACTTCCACTACGTACTGTCAATAGGAGCAGTATTCGCAATCATAGCAGGCTTCACACACTGATTCCCACTATTCACTGGATTCACTCTCCACTCTACATGAGCTAAAATCCAGTTCGGAGTAATATTTGTAGGAGTAAATCTCACCTTCTTCCCACAACACTTCCTAGGCTTAGCCGGCATACCTCGACGATACTCAGACTACCCGGATGCCTACACGCTATGAAATACAATCTCCTCAATTGGATCAATAATCTCCCTAACAGCCGTAATCATACTAGTATTTATCATCTGAGAAGCATTTGCATCCAAACGTAAAGTACTCCAACCCGAACTAACAAGCACAAACGTTGAATGAATTCACGGCTGCCCACCCCCATACCACACTTTCGAAGAACCGGCCTTTGTACAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATGTGTTGGTTTCAAGCCAACCGC--AT--AAACCATTTATGCTTCTTTCTC---ATC-AAGAAGTGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTACGAGTGAAACTCTCGTACACCTCAT---CACCC--AAATATGGCCAACCACTCACAATTAGGTTTCCAAGACGCATCATCACCAATCATAGAAGAACTTGTAGAATTCCACGACCACGCTCTAATAGTCGCCCTAGCCATCTGCAGCCTGGTCCTCTACCTACTAACCTTAATACTAACAGAAAAACTCTCTTCAAGCACAGTCGACGCACAAGAAATCGAACTAGTATGAACCATCCTCCCAGCCATTGTCCTAATCTTACTCGCCCTACCCTCCTTACAAATCCTGTACATAATAGACGAAATCAACGAACCCGATCTAACCCTAAAAGCTATCGGCCACCAATGATATTGAACCTACGAATATACCGATCTCAAAGACCTAACATTCGACTCCTACATAACACCCACAGCAGACTTACCCCTAGGACATTTCCGACTCCTAGAAGTTGACCATCGTGTAGTTGTCCCAATAGAATCACCCGTCCGAGTTATTGTTACCGCCGACGACGTCCTACACTCATGAGCCGTCCCAAGCCTAGGTGTAAAAACTGACGCAATCCCAGGACGCCTTAACCAGACCTCATTCGTCGCCTCCCGACCTGGAGTATTCTACGGCCAATGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATGCCAATCGTAGTAGAATCCGCCCCGCTTGCTAACTTCGAAAGCTGATCTTCCCTAA---TATCCTCCT----------AATCATTAAGAAGCTATGGAACAGCGCTAGCCTTTTAAGCTAGAAAAAGGGGGT--GCATTCCCCCCTTAATGGTATGCCTCAGCTAAACCCAGGCCCATGATTTTTTATCATGCTAACTTCATGATTCACCTACACTATGATTATCCAACCTAAACTCCTATCATTCCTATCAACAAACCCCCCATCCAACAAAA---TACCTGTCACCACAAGCACTACTCCCTGAACTTGACCATGAACCTAAGTTTCTTTGACCAATTCTCAAGCCCCTCCCTCCTAGGAATCCCCCTAATCCTCATCTCAATAACATTCCCAGCACTACTACTACCTTCCATAGACAACCGATGAGTCACCAACCGACTCTCGACCATTCAACTATGAATTGTTAACCTCATCACAAAACAGCTAATAATGCCCCTGGACAAAAAAGGACACAAATGAGCTCTTATTCTTACATCCCTAATAATCTTCCTCTTACTAATCAACCTCCTAGGCCTTCTACCTTACACATTCACCCCAACCACTCAACTATCCATAAACCTTGCCCTAGCCTTCCCCCTATGACTCGCCACCCTCCTCACAGGCTTACGCAACCAACCCTCGGCATCCCTAAGCCACCTACTCCCAGAGGGCACTCCCACCCCCCTAATCCCCGCCCTAATCTTAATTGAAACCACAAGTCTACTAATCCGTCCCCTAGCCCTGGGGGTCCGACTAACAGCCAACCTAACAGCAGGCCATCTCCTAATCCAATTAATCTCTACAGCCACAGTAACCCTAGCCTCAACAATACCAGTAGTTTCTTTACTTACTTTACTAGTTCTATTCCTACTAACCATTCTAGAAGTAGCAGTAGCCATAATTCAGGCTTACGTATTCGTATTACTGTTAAGCCTTTACCTACAAGAAAACCTCTAACCA------CCAATGACCCACCAAGCACACTCCTACCATATAGTAGACCCCAGCCCATGACCCATTCTCGGAGCCGCCGCCGCCCTCCTTACAACTTCAGGCCTAGCCATGTGATTCCACTACCACTCCCCATTTCTCCTGGCCCTTGGTCTGCTATCCACTGCACTAGTCATGATCCAATGATGACGAGACATTGTGCGAGAAAGCACATTCCAGGGACATCACACACCTACAGTCCAAAAAGGCCTACGATACGGAATGGTCCTATTCATTACATCAGAGGCCTTCTTCTTCCTAGGATTTTTCTGAGCATTCTTTCACTCAAGCCTAGCCCCCACCCCAGAACTAGGAGGTCAATGACCGCCCGTAGGAATTCAACCACTAGACCCAATAGACGTTCCTCTCCTAAACACTGCCATCCTTCTGGCTTCAGGAGTCACAGTCACATGGGCTCACCACAGCATTACAGAAGCTAATCGAAAACAAGCAATCCAAGCTCTAACTATTACAGTCCTCCTAGGACTTTACTTCACTGGCCTACAAGCTATAGAGTATTACGAAGCCCCCTTTACCATTGCTGACGGAGTATACGGTTCCACATTCTTCGTCGCTACAGGATTCCACGGACTACACGTTATCATCGGCTCTACATTCCTATTAGTATGCCTTCTACGCCTAATCAAATTCCATTTTACACCAACTCACCACTTCGGTTTTGAAGCAGCAGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTCTACATATCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTTATGCTAATTCTCTCCACAACCTTAAGCGCTATCCTAACCGCACTTAACTTCTGACTAGCCCAAACAAACCCAGACTCAGAAAAATTATCACCATACGAATGCGGCTTCGACCCCCTAGGATCCGCCCGACTCCCCTTCTCAATCCGCTTCTTCTTAGTAGCCATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTACCACTACCATGAGCAGTCCAGCTCCAATCCCCAACCACCACACTAACATGAGCCTCCACCCTCATCCTTCTCCTTGTTCTGGGGCTGGCTTACGAATGAACCCAAGGAGGCCTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAGATTATAGCCC-CACCCTATAACTTTCTTTATGCCCGCCTTACACATGAGCTTCTACTCAGCCTTCATCCTAAGCGGCCTAGGCCTTGCCTTCCACCGAACACACCTAGTCTCAGCCCTATTATGTCTCGAGAGCATAATGCTATCCATATTTGTAGCTATGACCATGTGACCTATCCACACACAAGCAACATCCCCAACCATCCTACCCATCCTAGTATTAACCTTTTCCGCCTGCGAAGCCAGCACAGGCCTAGCACTACTAGTTGCTTCCACCCGAACCCACGGCTCCGACTACTTACACAACTTCAACCTCCTACGATGCTAAAAATCATCATTCCAACTGCCATACTACTACCCCTGACATTTTGCTCCCCGCGCAAACACCTATGAACCAATATTACAGCCTACAGCCTTTTAATCGCTGCAGCCAGCCTCCAATGACTTACTCCTACCTACTACCCGAACAAAAACCTATCCAGCTGAGCCGCCGTAGACCAAATTTCCTCCCCACTATTAGTCCTATCATGCTGACTACTCCCACTAATAATAATAGCAAGCCAAAACCACCTAGAACAAGAACCAACCATCCGCAAACGAATCTTCATCACAACAGTACTTCTAGCTCAACCCTTTATCCTTATCGCCTTCTCGGCCTCAGAACTAATACTATTTTACATCGCATTCGAAGCCACCCTAATCCCCACCCTAATTTTAATCACACGATGAGGAAGCCAACCAGAACGACTAACCGCTGGTATCTACCTTTTATTCTACACTCTCGCTAGCTCCCTCCCCCTACTCATTGCCATCCTCCACCTGCAAAACCAAATCGGATCATTACTTTTCACACTACTAAAACTAACACATCCAACAATAACCTCCTCCTGAACAAGCTTAGCAACCGGCCTAGCCCTCCTTCTAGCCTTCATAGTGAAAGCACCCCTATATGGCCTGCACCTATGACTACCAAAAGCCCATGTAGAAGCCCCAATCGCCGGCTCCATACTCCTTGCAGCCCTACTTCTAAAATTAGGAGGATACGGAATTATACGAGTTACCGTACTGGTAAGCCCCTCACTAAATAACCTACACTACCCATTCATCACCATAGCCCTATGAGGAGCATTAATAACCAGCACCATCTGCCTACGACAAATTGACCTAAAATCACTAATCGCCTACTCATCCGTCAGCCACATGGGCCTAGTTGTGGCTGCAACTATAATTCAAACTCAATGAGCCTTCTCAGGCGCAATAATATTAATAATCTCACATGGCCTAACTTCCTCAATACTATTCTGCCTAGCCAATACCAACTACGAACGTACACACAGCCGAATTCTCCTACTAACACGAGGAATACAGCCCCTTTTACCCCTCATAGCCACCTGATGACTCCTAGCCAACCTAACAAACATAGCCCTCCCACCAACAACCAACCTCATAGCAGAACTAACCATCACAATCGCCCTATTCAATTGATCATCCCTAACAATTGTTCTAACAGGAGCCGCAATCCTGCTAACCACCTCATACACCCTGTACATACTCACAATAACACAACGAGGAGCTATCCCCTCCCACATGACATCCATCCAAAACTCCTCCACACGAGAACACCTCCTTATAGCCCTACACGTAATCCCAATAGCCCTACTCATCCTCAAACCTGAACTAATCTCAGGCATTCCTATATAGCAAGTATAGTTT-TAA-CAAAAACATTAGTCTGTGACCCTAAAGATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTT-CAACCAACAAGAACTGCTAATTCTTGCATCTGAGTCTAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAACAGCAATCCAATGGTCTTAGGAACCATCCACCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGTCCAAACCTCACTGACACTACTAACCCTAGCAACCCTGTCCCTACCAATCATCCTCCCACTTCTATCAAACAGCCTCAAAAACACCCCAAACGCCATCACAAACACTGTCAAAACCTCCTTCCTAATCAGCCTAATCCCTATAACCATCTACCTCCAATCTGGGATAGAAAGCCAAATCCACATCTGAGAATGAAAATTCATTATAAACTTCAAAATCCCAATCAGTCTTAAGCTAGACTTCTACTCACTCACATTCCTTCCAATCGCCCTATTCGTATCCTGATCTATCCTACAATTTGCAACATGATACATAGCATCAGACCCATACATCACAAAATTCTTCACCTACCTTCTCCTATTCCTAATTGCTATACTAGTCTTAATCACCGCTAACAACCTATTCGTCCTATTCATCGGATGAGAAGGAGTCGGAATCATATCATTCCTCCTAATCAGCTGATGACACGGTCGAGCAGAAGCCAACACCGCCGCCTTACAGGCCGTGCTCTACAACCGAGTAGGCGATATTGGACTAATCCTATGCATAGCATGATTAGCCTACACCATAAACACATGAGAAATCCAACAACTCCCCTCCCCATCCCAAACTCCCACCCTACCCCTCCTAGGACTCATCCTAGCCGCAACAGGCAAATCCGCCCAATTCGGCCTCCACCCATGACTCCCGGCCGCCATAGAAGGCCCCACTCCAGTCTCCGCCCTACTACACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACTCACCCCTTACTAAGCAACAACCAAACTGCCTTAACACTATGCTTATGCCTTGGCGCCCTCTCCACCCTATTTGCAGCCACATGCGCCCTAACCCAAAACGACATCAAAAAAATCATTGCTTTCTCAACATCTAGCCAGCTAGGCCTAATAATAGTCACAATCGGCCTTAACTTACCTCAACTAGCCTTTCTTCACATCTCAACCCACGCTTTCTTCAAAGCCATGCTATTCCTCTGCTCAGGCTCTATCATCCACAACCTAAACGGCGAACAAGATATTCGAAAAATAGGCGGCCTCCAAAAAATACTACCAACAACCACTTCCTGCCTAACCATCGGCAACCTAGCCCTCATAGGAACACCATTCCTAGCGGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCCCTAGTCCTAACCCTAATCGCTACATCATTCACCGCAATCTATACTCTTCGCATAACCATCCTAGTACAAGCCGGATTTGTACGAATTCCAGCATTAACTCCCATAAATGAAAATAACCCAGCAGTAACCTCATCAATCACCCGCCTCGCATTAGGAAGCATCACCGCTGGCTTCCTCATCACCTCATATATCCCTC---CCACATACACACCACCCATAACCATACCCCTATACATCAAAATTACAGCCATAGCAGTAACAGCCCTAGGCATCATCCTAGCCCTAGAACTTTCAAAAATAACCCAAACCCTAATCCTCCCAAAACAAAACCCAATAATAAACTTCTCCACATCCCTAGGATACTTCAACCCACTAACCCACCGTTTCAGCACAATAAGCTTACTAACCGGGGGCCAGAAAATCGCCTCCCACCTAATCGACCTCTCCTGATACAAAATGTTAGGCCCAGAAGGCCTGGCTACCCTACAAGCAACCACAGCCAAAACCATTACCCCCCTCCACTCTGGCTCAATAAAAGCCTACCTAGGAACTTTTGCCCTATCAATCATCATCATCCTAA---TATCTACATACAGAAA--CAA---T---AATGGCCCTCAATCTTCGTAAAAACCATCCCCTACTAAAAACCATCAACAACGCCCTAATCGATCTTCCCACACCATCAAACATCTCAACCTGATGAAACTTTGGATCCCTCCTAGGTATCTGCCTAATCACACAAATCATTACAGGCCTCCTACTAGCTGCACACTATACAGCAGATACTTCTCTCGCCTTCACTTCTGTCGCCCACATATGCCGAAACGTCCAATTCGGCTGACTAATCCGCAACCTCCACGCAAACGGAGCCTCACTCTTCTTTATCTGCATCTACTTCCACATCGGCCGCGGATTCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTCATCCTCCTACTAACCCTAATAGCAACCGCCTTCGTAGGGTACGTCCTTCCTTGAGGACAAATATCCTTCTGAGGAGCTACAGTAATCACCAACCTATTCTCAGCCATCCCCTACATCGGTCAAACACTAGTGGAATGAGCCTGAGGAGGATTCTCCGTAGATAACCCAACACTCACCCGATTCTTCGCCCTCCACTTCCTCCTCCCATTCGTAATCGTAGGAATGACACTAGTCCACCTCACCTTCCTACACGAAACAGGATCAAACAATCCACTAGGAATCCCATCAGACTGCGACAAAATCCCATTCCACCCCTACTACTCAGTAAAAGACATTCTAGGATTTGTACTAATACTAATCCTATTAGTCGCATTAGCACTATTCTCCCCAAACCTACTAGGAGACCCAGAAAATTTCACACCAGCTAACCCCCTAGCCACGCCCCCCCACATCAAACCTGAATGATACTTCCTATTTGCATACGCCATTCTACGATCCATCCCCAACAAACTTGGAGGAGTACTAGCCCTAGCCGCCTCAGTCCTAATCCTATTCCTTATCCCCCTACTTCACACATCCAAACAACGCTCAATAACCTTCCGTCCTCTCTCACAAATTCTATTCTGAACCTTAGTCGCTAACCTCCTCATCCTAACCTGAGTAGGCAGCCAACCAGTCGAACACCCCTTCATCATCATCGGACAACTAGCCTCATTCACCTACTTCGCCATCATTCTAGTCCTATTCCCTCTAGTATCCATCCTAGAAAATAAAATACTCAAACT----------CTA-ATC-----------AACTCTAATAGTTTAACGAAAACATTGGTCTTGTAAACCAAAAACTGAAGACTACACCTCTTCTTAGAGTT Epthianura_albifrons_NC_019664 GTCCTCATAGCTTAAACCAAAGCATGACACTGAAGATGTCAAGATGGATGC--CAAA-TACACCT-GAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTGTCGCTAGGTATATACATGCAAGTATCCGCGCCCCAGTGCAAAAAGCCCTCAGTT-CCTCTCAACC-------AGGTCAGTAGGAGCGGGTATCAGGCTCA---------CACCCACCTAGTAGCCCAAAACGCCTTGCACTTGCCACACCCCCACGGGTATTCAGCAGTAATTGATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCGAA-----ACAGGGGTGGTAAATCTTGTGCCAGCCACCGCGGTCATACAAGAAACCCGAATCAACTTTACTTCACAAGCGGCGTAAAGAGTGGTAAC-ATGTTAT-CAAAACACCTAAGACCAAAAAGCAACTGAGCTGTCATAAGCCAAAGATGC-CCCTAAGGCCTCC--GCCCAAAAAAGATCTTAGCTT--AACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TCA--CACTACCTAAGCATCCGCCAGAGAACTACGAGCGCAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAATCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCCGACCATTCCTTGC-AAA--AA--CAGCCTATATACCGCCGTCGCCAGCTCACCCTGC--CTGAAGGTCCAACAGTGAACGCAATAGTCCTTA-CCACACTAAAAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAGAATAGAACAAC-----ACGGCAAAGGGATATGAAACTATCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGATAATAGAGCCCTCTTTAAACCGGCCCTGGGGCACGTACACACCGCCCGTCACCCTCTTCAAAGG-CG---CCCCCCCCCCCCCAT-AACTAATAAGCCAT-CC--AGCTAAAGAAGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGTACTTAGACTA-CCAAGACGTAGC-TTAAACCCAAAGCATTCAGCTTACACCTGAAAGATTCCTGCTC-ACACCAGGCCGTCTTGA-AGCCAAACCCTAGCCC--------AACT--ACATCA------AACCAAATATGAC--AAAGCCACTCCCC---ATCACTT----AACTAAAACATT---C--ACTAGT-CCCAGTATAGGTGATAGAAAAGACCCCCC-CCGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGGTGAAATAGCAATG-AAA-AACC--TAAGCTA-AAAACAGCAAAGATCAGCCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTGAAGCTTGCCTCCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-AATTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGACGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATTTAAGTTCACTCTTAATTCCCCTCCAAGG-AAGC-CACCAAAACCCCA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AGC--ATCAAA-CCAAAAAAG-ACTATAGTGGGCCCTCAAGCAGCCATCAATGAAGAGTGCGTTAAAGCTCCAC-ACACTAAAAATACACT-AACTTTGCGACTCCCT-CACCACTAACGGGCTAACCTATATTACAATAGGAGAATCAATGCTAGAATGAGTAACTAGGG--T--ACCTCCCTCT----ACAACGCAAGCTTACATCCCTA-CATTATTAACAAA-TACCAA-ATATACAA--CCAAT---------ACA---ACAAGCA-AAG-TATAA-AACAAC-TTGTTAACCCGACAGA-GGAGCGTCCACC-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAGCACGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACC---AT---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACCTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCAGTGAAATTGATCCCCCTGTACAAAAGCAGGGATAAGAACATAAGACGAGAAGACCCTGTGGAACTTTAAAATCAGCAACCACG--CCAAAA-TACATT----TTCCCCCAACACCC-GGGGTCACTTATCAAA-CAA-GC-C-ACTGGTC-TGCA-TTTTTTGGTTGGGGCGACCTCGGAGAAAAAC-AAATCCTCCGA-AAATAGGACCAAAACTCTTGACTA-AGAGCAACCCCTCAAAGTGCCAACAGCAACCAGATCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTTAAGAGTCCATATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCAGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATA-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTAAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAATGCAACT-AATTACAAAAGGCTATCAC-ACCAC---TACTA-CGTCCTAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTCAACCTTCCCCCTTCCACCC-------ATGCA----------CGACCACCCCCTCCTTACTAACCTAATCATAGCTCTCTCCTATGCTCTACCTATCTTAATTGCTGTAGCCTTTTTAACTCTGGTCGAACGCAAAATCCTCAGCTATATGCAAAGCCGAAAAGGCCCTAACGTAGTAGGCCCCTTTGGCCTTCTTCAACCCCTCGCAGATGGTGTAAAACTATTCCTAAAAGAGCCTATCCGCC---------CTTCCACCTCCTCACCTATCCTCTTCGTCACAACCCCTATACTGGCACTTCTCCTAGCTATTTCCATCTGAACCCCCCTACCCCTTCCATTTCCCCTTGCCGACCTCAACCTGGGGCTACTATTCGTGCTCGCCATGTCAAGCCTGGCAGTCTACTCCATTCTATGATCCGGATGAGCCTCCAACTCCAAATATGCCCTAATTGGGGCATTACGAGCAGTCGCCCAGACCATTTCCTATGAGGTCACCCTAGCAATCATCCTCCTCTCAGTCATCTTACTTAGCGGGAACTATACCCTTGGCACCCTTGCAACCACACAAGAACCCCTCTACCTAATCTTCTCATGCTGGCCTCTCGCAATAATATGATATGTGTCCACCCTAGCCGAGACAAATCGTGCCCCCTTTGACCTAACAGAAGGAGAGTCTGAACTAGTCTCCGGGTTTAACGTAGAATATGCAGCAGGTCCATTTGCACTATTCTTTGTAGCTGAATACGCCAACATTATATTCATAAACACACTCACCGCTATTATATTTTTCAACCCCAGCTTCTTTAATCTACCACAAGAGCTCTTCCCAGTAGTACTAGCTACCAAAACCCTACTTCTTTCCGCAGGTTTCCTGTGAGTCCGAGCATCCTACCCCCGATTCCGATACGACCAACTAATACACCTCCTATGAAAAAACTTTCTACCCCTAACGCTAGCCCTATGCTTATGACACACAAGCCTGCCTATCTGCTATGCAGGTCTACCC-----CCATACCTA----TAACC-----------ACAAAGGAAATGTGCCTGAGATC-T--AAGGGTCACTATGATAAAGTGAACACAGAGGCTTACCAACCCTCTCATTTCCT----AAAA-------CTAGAAAAACAGGAGTTGAACCTGTACAAAAGGGATCAAAACCCTCCATACTTCCTTTATATTATTTTCTA-C--C----------AGTAGGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACTCCTTCCCCTATTA-ATGAACCCCCAGGCAAAAATAATCTTCACCATTAGCCTACTCCTAGGAACAACCATCACAATCTCAAGCAACCACTGAGCCC---TGGCCTGAACAGGCCTTGAAATCAACACACTAGCTATCCTCCCGCTAATCTCAAAATCCCACCACCCACGTGCTATCGAAGCAGCAACCAAATACTTTCTAGTCCAAGCAGCCGCCTCCGCTCTAATCCTATTCTCTAGCATAACCAATGCATGACATACCGGACAGTGAGATATTATACAACTAACACATCCAACCTCTTGCCTAGTCCTAACCGCAGCCATTGCAATGAAACTAGGCCTAGCCCCATTTCACTTTTGATTCCCCGAAGTCCTCCAAGGCACCTCACTAACCACTGGCCTCCTACTATCCACGGCCATAAAATTCCCACCAATCACCCTACTTTTCCTAACTTCCCAATCACTAAATCCCACACTACTAACCACCATGGCCATTATATCCGCCGCCCTAGGAGGATGGATAGGTCTCAACCAAACACAAATTCGTAAAATCCTGGCCTTCTCTTCCATCTCCCACCTAGGCTGAATAGCCATTATCATCTGCTACAACCCCAAACTCACCCTACTCAACTTCTACCTATACAGCCTAATAACTGCAGCTGTATTCCTCACCCTAAATACCATAAAAACAATCAAACTCTCAACACTAATAACCGCATGGGCAAAAACCCCATCGCTCAGCACCATACTCATTTTAACATTACTATCTCTGGCTGGCCTCCCCCCTCTAACAGGCTTCCTTCCTAAATGACTCATCATCCAAGAACTAACCAAACAAGAAGTGACCCTAACAGCGATAGTCATCTCCCTGCTATCCCTACTCAGCCTGTTCTTTTACCTACGCCTCGCATATTGTACCGCAATCACACTTCCTCCCCACACAACTAACCACATAAAACAATGACACATCAAAAAACCAACTAATGCCCTAATCGCTATCCTAATCACCCTTTCCATCGTCCTCCTACCCCTCTCCCCCATCCTAACCGCCATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAATCCGCAGGACATTACCCTGCATCCCCTGATTGCAACTCAGATGCTTTAA-TTAAGCTAGGATCTT-ATGCAA--GCACTAGACAGATGGGCTTCGATCCCACAACAA-TATAGTTAACAGCTATATGCCCAAACC-AACAGGCTTCTGCCT-A-------------AGACTCCGGCACATCA-CTAATGCGCATCGATGAGCTTGCAACTCAACATGAACTTCACTACAGAGCCTATGGTAAGAAGAGGAATTGAACCCCTGTAAAAAGGACTACAGCCTAACGCCT-TTACACTCAGCCATCTTACCACACACCTTTTACCCGTGACTTTCATTAACCGATGATTATTCTCAACCAACCACAAAGACATTGGCACCCTGTACCTTATTTTCGGCGCATGAGCCGGAATAGTCGGAACCGCCCTAAGCCTCCTAATCCGAGCAGAACTAGGCCAACCCGGTGCCCTCCTGGGAGACGATCAGATCTACAATGTTATCGTCACAGCCCATGCTTTCGTTATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGATTTGGCAACTGACTAGTCCCACTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCACCCTCATTCCTCCTGCTACTAGCCTCATCAACAGTAGAAGCAGGGGCAGGAACAGGATGAACCGTCTACCCACCCCTAGCTGGCAACTTAGCCCACGCCGGAGCCTCAGTAGACCTAGCTATTTTCTCACTCCACCTGGCAGGAATCTCCTCAATCTTAGGTGCAATCAACTTCATTACAACAGCAATTAACATAAAACCCCCAGCCCTCTCACAATATCAAACACCTCTATTCGTCTGATCCGTCCTAATTACTGCAGTACTACTCCTGCTATCCCTACCAGTCCTCGCCGCCGGTATCACCATACTCCTAACAGATCGCAACCTAAATACTACATTCTTCGATCCAGCAGGAGGAGGGGACCCAATCCTGTACCAACACTTATTCTGATTCTTCGGACATCCAGAAGTTTACATCCTCATCTTACCAGGATTTGGCATCATCTCCCACGTAGTAGCCTACTATGCAGGGAAAAAAGAACCATTCGGATACATAGGAATAGTGTGAGCAATACTTTCTATCGGATTCCTTGGATTTATCGTCTGAGCACATCACATGTTTACAGTAGGAATAGACGTAGACACACGAGCATACTTCACATCCGCCACTATAATCATCGCCATTCCAACCGGAATCAAAGTTTTCAGCTGACTAGCAACGCTTCACGGAGGTACTATCAAATGAGACCCCCCAATACTCTGAGCTCTAGGATTCATCTTCCTCTTCACCATCGGAGGACTGACAGGAATTATCCTAGCAAATTCTTCCCTAGATATCGCACTACACGACACTTACTACGTAGTCGCTCACTTCCACTACGTCCTATCTATAGGAGCAGTATTCGCAATCCTAGCCGGTTTCACACACTGATTCCCCCTATTCACCGGTTACACCCTTCACTCCACATGAGCAAAAATCCACTTCGGAGTAATATTTGTAGGAGTAAACCTCACTTTCTTCCCTCAACACTTCCTAGGACTAGCTGGAATGCCACGACGATACTCCGACTACCCAGACGCTTACACAATATGAAACACCGTATCCTCTGTAGGATCTCTCATCTCCCTAACAGCCGTAATCATGCTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGCCCCACAATCAGAACTAGTCAGCACTAACGTAGAGTGAATCCACGGCTGCCCACCTCCTTACCACACCTTCGAAGAACCAGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCTCATATGTTGGTTTCAAGCCAACCGC--ATACAAACCACTTATGCTTCTTTCTT---ATA-AAGAAGTGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCTAAATTACAGGTGAAAACCCAGTACACTTCAAAATAACCC--TAACATGGCCAACCACTCACAACTCGGTTTCCAAGACGCTTCCTCACCTATCATAGAAGAACTCGTAGAGTTCCACGACCACGCCCTCATAGTTGCCCTAGCCATCTGCACCTTAGTCCTATACCTGCTAACCTTCATACTCACAGAAAAACTCTCATCAAGTACTATCAACGCCCAAGAAATTGAACTTGTATGAACTATCCTCCCTGCTATTGTCTTAATTATACTAGCACTCCCTTCCCTACAAATCCTCTACATAATAGACGAAATTAACGAACCAGACCTAACACTAAAAGCCATCGGCCACCAATGGTACTGAACCTACGAATACACTGACTTCAAAGACTTCACATTCGACTCTTACATAATCCCCACCACAGACCTACCTCTAGGCCACTTCCGACTACTAGAAGTGGACCACCGCGTAATCGTACCCATAGAATCCCCAGTTCGAGTCATTGTTACAGCCGACGACGTACTACACTCCTGAGCGGTCCCAAGCCTAGGAGTCAAAACAGACGCAATCCCAGGACGACTAAACCAAACCTCATTCGTCGCTACTCGCCCCGGAGTCTTCTACGGACAATGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCCATCGTAGTAGAATCCGCCCCACTCACTTACTTCGAACGTTGATCATCCATAA---CTTCATCCT----------AATCATTAAGAAGCTATGAACCAGCACTAGCCTTTTAAGCTAGAGACAGAGGACAAACGCCCCCTCCTTAATGGTATGCCCCAACTGAACCCAAACCCATGACTCTTTACAATGTTAATCTCATGGCTAACATACTCTCTCATCATTCAACCCAAGATCCTAACGTTCGTCACAGCAAACCCACCATCCAATAAAG---CCCCAACAATCCCAAGCACCACCCCTTGAACCTGACCATGAACTTAAGCTTCTTCGACCAATTCTCAAGCCCCTCATTAATAGGAATCCCACTCATTTTAATCGCACTAACATTCCCAGCCCTACTTCTGCCCTCACCAGACAACCGATGAATCACTAATCGCCTCTCAACCCTCCAACTATGGTTCATCAACCTTATCACAAAGCAGCTAATAATACCCCTAGATAAAAAAGGGCACAAATGGGCATTAATCCTAACCTCACTAATAATATTCCTACTAATAATCAACCTCCTAGGCCTACTACCCTACACATTCACCCCCACCACCCAACTATCTATAAACCTGGCACTAGCCTTCCCACTCTGACTTGCAACTCTACTAACAGGACTACGAAACCAACCTTCAGCCTCCCTAGCCCACCTTCTACCAGAAGGCACTCCAACCCCACTTATCCCAGCCCTCATCCTAATCGAAACCACCAGCCTTCTCATCCGTCCCCTAGCACTAGGAGTACGGCTAACAGCAAACCTCACAGCAGGTCACCTCCTAATTCAACTAATTTCCACAGCAACAATTGCCCTATCCTCTACAATACCAGTAATCTCTTTACTGACATTTATAGTACTATTCCTCCTAACCATCCTAGAGGTAGCAGTAGCTATAATTCAAGCCTACGTCTTCGTACTCCTACTAAGCCTGTACCTACAAGAAAACATCTAACCC--------AATGACCCACCAAGCACACTCCTTTCACATAGTAGACCCAAGTCCATGACCTATCTTCGGAGCAGGCGCCGCCCTCCTAACCACCTCCGGACTAACAATATGATTCCACCACCGCTCCCCACAACTCCTGATCATCGGACTAACCTGTACCGCCCTAGTGATAATCCAATGATGACGAGACATCATCCGAGAAAGCACATTCCAAGGACATCATACACCCACAGTACAAAAAGGTCTCCGATACGGAATAATCCTGTTCATCACATCCGAAGCATTCTTCTTCCTAGGCTTCTTCTGAGCATTCTTCCACTCAAGCCTAGCACCCACCCCAGAACTAGGAGGACAATGACCCCCCGTTGGAATCGAACCACTAAACCCAATAGACGTCCCCCTGCTAAACACAGCAATCCTCCTAGCCTCGGGGGTCACCGTCACATGAGCACATCACAGTATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCTCTCACCCTAACCGTACTACTAGGATTCTACTTCACCGCCCTCCAAGCCATAGAATACTACGAAGCTCCATTCTCCATCGCCGATGGAGTTTACGGATCTACCTTCTTTGTAGCCACCGGATTCCATGGCCTCCACGTCATTATTGGCTCAACATTCCTCCTAGTCTGCCTCTTCCGCCTAATCAAATACCACTTCACTTCCAACCACCACTTTGGCTTCGAAGCAGCAGCTTGATACTGACATTTCGTAGACGTCGTATGACTATTCCTCTACATGACTATCTACTGATGAGGATCATACTCTTCTAGTATATCC-ATTACAATGGACTTCCAATCCTTAGAATCTGGTATAAACCCAGAGAAGAGTAATG---AACATAATCACTTTTATAATCACACTATCACTAACCCTAAGCATCATCCTAACCCTACTGAACTTCTGACTAGCCCAAACAAACCCAGACTCGGAAAAACTATCACCATATGAATGCGGATTTGACCCCCTCGGCTCAGCCCGACTTCCATTCTCAATCCGATTTTTCCTAGTAGCCATCCTCTTCCTCCTATTCGACCTGGAAATCGCCCTATTGCTTCCCCTTCCATGAGCCACCCAACTACAATCTCCCATCACCACCCTAATCTGAACCTTTATTATCATCCTACTACTCACTCTAGGACTGATCTACGAATGAATCCAAGGAGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGGCTCAACAGATTATAGCTGCAACCCTATAACTTTCTTTATGTCTCCCCTCCACCTAAGCTTCTACTCAGCCTTCACCCTAAGCAGCCTAGGGCTAGCCTTTCACCGAACTCATCTAATCTCCGCCCTCCTATGTTTAGAAAGCATAATACTCTCCATGTACATCGCCCTAACAATATGACCCATCCAAACACAAACATCCTCAACAACCCTCGTACCCATCCTAATACTATCATTCTCAGCCTGTGAAGCAGGAACAGGACTAGCACTACTAGTCGCTTCCACCCGAACCCACGGCTCCGACCACTTACACAACTTCAACCTCCTAAAATGCTAAAAATTATTACCCCAACCCTCATACTACTCCCCCTAACTCTCCTATCCCCCTCCAAACACCTATGAACCAACATCACCACCCACAGCCTATTAATCGCCTTCTTAAGCCTACAATGATTAGTCCCAACATACTACCCAAACAAAGGCCTAACCCATTGAACCGCCATCGATCAAATCTCATCTCCCCTACTAGTCCTGTCCTGCTGACTACTCCCCCTCATAGTCATAGCAAGCCAAAACCACTTAGAACAAGAACCCCCCGTACGAAAACGAATCTTCATCACAACCCTAATCGCAGTTCAACCCTTTATTCTACTAGCCTTTTCCGCTTCAGAAATCATACTATTCTACATTGCCTTCGAAGCCACCCTAATTCCAACCCTAATCCTAATCACACGCTGAGGAAACCAACCAGAACGACTAAATGCAGGTACCTATCTACTATTTTATACCCTCGCTAGCTCACTCCCCCTACTCATTGCCATCCTACACCTACACAACCAAATCGGAACACTATACCTCCCTATACTAAAACTCGCCCATCCCACAATAACCAACTCCTGATCAAACCTAGCATGCAGCCTAGCCCTACTACTAGCCTTCATAGTAAAAGCCCCCCTATACGGCTTACACCTGTGACTCCCAAAAGCCCATGTAGAAGCCCCTATCGCAGGCTCTATACTACTAGCCGCCCTACTCCTAAAACTAGGAGGATATGGCATTATACGCATCACCATCCTAGTAAACCCCCCATTAAACAACCTACACTACCCATTCATCACCCTAGCCCTGTGAGGAGCACTCATAACCAGCGCCATCTGCTTACGTCAAGTCGACCTAAAATCACTAATCGCCTACTCTTCCGTAAGCCACATAGGATTAGTTGTCGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTCATAATCTCACACGGCCTCACCTCCTCTATACTGTTCTGCTTAGCCAATACAAACTACGAGCGAACACACAGCCGAGTTCTAATCCTCACACGAGGTCTACAACCCCTACTCCCCCTCATGGCCATCTGATGATTACTAGCAAACTTAACAAACATAGCACTCCCCCCCACTACCAACTTAATAGCAGAACTAACCATCGTAATCTCACTATTCAATTGATCCTCCTTCACCCTCATTCTCACAGGAATCACCATATTCCTAACTGCCTCCTACACACTATATATACTTACAATGACACAACGAGGCACACTACCATCCCACATCACATCAATCCAAAACTCCTCCACACGAGAACACCTACTCATAGCCCTTCATATAATCCCCATAATCCTTCTTATCATAAAACCAGAACTTATCTCTGGAGCCCCCATATAGCAAGTATAGTTT-TAA-TCCAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACCCTTCTTACTTGCCGAGGGGAAGGTC-AAACCAGCAAGAACTGCTAACTCTTGTCCCTGAGAATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGCAATCCAATGGTCTTAGGAGCCACCCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGGCCTATCCCTAATCCTAACTACATCAATACTACTCTCCCTAACCACCTTACTAACACCCATCATCCTACCCATAATCTCCGACAAACTAAAAAACACTCCCTCCACCATCACAAACACTGTAAAAACCTCATTCCTAATCAGCCTGATCCCAATAACCATCTACATCCACTCAGGCCTAGAAAACATCACCTCTCTATGACAATGAGAATTCATCATAAGCTTCAAAATCCCCATCAGCTTCAAAATAGACTTCTACTCCCTTACATTCTTCCCAATCGCACTATTCGTATCCTGATCCATCCTCCAATTCGCCTCATGATACATAGCCTCAGACCCCCACATCACAAAATTCTTCACCTACCTACTACTATTCCTAATCGCCATACTCATCCTAATCACCGCCAACAACCTATTTGTCCTATTCATCGGCTGAGAAGGAGTTGGCATCATGTCATTCCTACTAATCAGCTGATGACACGGACGAGCAGACGCCAACACAGCTGCCCTACAAGCCGTACTATACAACCGAATTGGAGACATCGGCCTTATCCTATGCATAGCCTGATTAGCCTCTACAATAAACACCTGAGACCTACAACAAATCTCCTCTTCCACCCAAACCCCCACACTACCCATCCTAGGCCTCATTCTAGCCGCAACAGCCAAATCCGCCCAATTCGGCCTACACCCCTGACTTCCAGCAGCCATAGAGGGCCCCACCCCCGTCTCCGCCCTACTGCACTCCAGCACCATAGTCGTAGCCGGAATCTTCCTACTAATCCGAACCCACCCCATATTCAACAACAACCAGATGGCCCTCACCCTCTGCCTATGCCTAGGAGCCCTATCCACATTATTTGCAGCTACCTGTGCATTAACCCAAAACGACATTAAAAAAATCATCGCATTCTCAACATCAAGCCAACTAGGCCTAATAATAGTCACCATCGGACTTAACCTACCACAACTAGCCTTCCTACACATCTCAACCCATGCATTCTTCAAAGCCATACTTTTCCTATGCTCCGGCTCCATCATTCACAGCCTCAACGGCGAACAAGACATCCGAAAAATAGGAGGCCTTCAAAAAATCCTACCCACAACCACCTCATGCCTCACCATCGGTAACCTAGCCCTAATAGGAACCCCATTCTTAGCAGGCTTCTACTCAAAAGACGCAATCATTGAAAGTCTCAACACATCATACCTCAACACCTGAGCCCTACTCTTAACCCTTCTAGCCACATCCTTCACCGCAGTGTACACCATACGCATAACCCTAATAGTACAAACAGGATTCACCCGCATCCCCCCCCTAACCCCAGTAAACGAAAACAACCCAGCAGTCCTTCGCCCAATCACCCGCCTTGCACTAGGAAGCATCATAGCTGGATTCATCATCACTTCATTCATCCTTC---CCACAAAAACCCCCCCAACAACCATGCCACTATACATCAAAACCACCGCCATCATCGTCACAGCCCTAGGAATCATCCTAGCCCTAGAAATATCAAAACTAACACACAACCTAATTCTCCCTAAACAAAACTCCATTATAAACTTCTCCACCACCCTAGGATATTTCAACCCCCTAATCCACCGCCTGACCTCCACAAAAATCCTCAAAGGAGGACAAAACATTGCCTCACACTTAATCGACCTCTCCTGATATAAAATACTAGGCCCAGAAGGACTAGCCACCCTCCAACTAATAGCCTCAAAAACCACAACCACCCTCCACACAGGCTTAATCAAAGCATATCTAGGATCCTTCGCCCTATCCATCCTTATCATACTCG---CATCCACTTACAGA----CAACCCT---AATGGCCCTCAACCTACGTAAAAATCACCCCCTACTAAAAATCATCAACGATTCCCTAATCGATCTCCCAACCCCATCAAACATCTCAACCTGATGAAACTTCGGATCATTACTAGGCATCTGCTTAACAACCCAAATCATTACAGGATTACTATTAGCCACACACTACACAGCAGACACCAGCTTAGCATTCTCATCTGTGGCCCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGAAACATCCACGCAAACGGAGCCTCATTCTTCTTCATCTGCATCTACATCCACATTGGCCGAGGACTTTATTACGGATCTTACCTGAACAAAGAAACCTGAAACATCGGGATCATCCTCCTCCTAACTCTGATAGCAACCGCCTTCGTGGGATACGTCCTACCCTGAGGACAAATATCCTTCTGAGGAGCCACAGTAATTACCAACCTATTCTCAGCAATCCCCTATATCGGACAAACACTAGTAGAATGAGCCTGAGGAGGCTTCTCAGTGGACAACCCAACCCTAACCCGATTCTTTGCACTGCACTTCCTCCTCCCATTCGTTATCGCAGGATTAACACTAGTCCACCTAACATTCCTACACGAAACCGGATCAAACAACCCCCTAGGAATCCCCTCAGACTGCGACAAAATCCCATTCCATCCATACTACTCAATCAAAGACATCCTAGGATTTGCATTAATAATTACTCCACTCATCGCCCTCGCCCTATTCTCCCCCAACCTACTAGGAGACCCAGAAAACTTCACACCAGCCAATCCACTAGCCACCCCCCCACACATCAAACCTGAATGATACTTCTTATTCGCATATGCCATCCTCCGATCTATCCCAAACAAACTAGGAGGAGTTCTAGCCCTCGCAGCCTCAATCCTAGTACTATTCTTAGTCCCCCTATTACACAAATCAAAACAACGCTCTATAACCTTCCGCCCCCTATCACAAATCCTATTCTGAACCCTAGTAGCCAACCTCCTAGTACTAACATGAGTAGGAAGCCAACCAGTCGAACACCCATTCATCATCATCGGCCAACTAGCCTCCCTCAGCTACTTCACCATCATCCTAGTACTCTTCCCCCTAGCAAGCATGCTAGAGAACAAAATACTAAAACT----------TTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGATTATACCTCTTCTTAGAGTT Euphagus_cyanocephalus_JX516072 GTCCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-C-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTAAGCTGTCACAAGCCCAAGATGT-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCA--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAGACTAGAACA-C----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG-CCCCCCCCCCCCCCCAT-AACTAATAAGCCAC-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTGTTA-C-A-AACTT----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTCAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-CCACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--ATTAA-CTT-CCTAAC-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACCCCATGACTCCCT-CCCCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAA-CCCCCA-ATATACGA--CAAAT---------CAA---ACAAGCA-CAG-TATTA-AGCAAA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAGAA-CACATA----CT-CACCCA--C-T-GGGTTCACTGAC-ACA-TAA-GATT-TCTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTT-AGAGCAACCTCTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TA-----TCTTCA--C----ATGAC----------CAACTACCCCCTCCTAATCAACTTCATCATAGCCCTCTCCTATGCTCTGCCAATCTTAATCGCAGTAGCCTTTCTTACACTAGTAGAACGCAAAATCCTAAGCTATATACAAGGCCGAAAGGGTCCAAACATCGTTGGTCCCTTTGGACTCCTCCAACCCCTGGCAGACGGTGTTAAACTGTTCATCAAAGAACCGATCCGGC---------CATCAACATCTTCCCCAGTTCTATTCATCGCAACCCCAATCCTAGCTCTCCTCCTAGCTATCTCAATCTGAACCCCATTACCCCTCCCATTCTCCCTAGCAGACCTCAACCTAGGACTGCTCTTCCTACTAGCCATGTCAAGCCTAGCAGTATACTCCATCCTATGATCAGGCTGAGCCTCTAATTCTAAATACGCCCTAATTGGAGCACTACGAGCAGTAGCCCAAACAATCTCCTACGAGGTAACCCTAGCCATCATTCTTCTCTCCGTCGTCCTCCTCAGTGGCAATTACACCCTAAGCACTCTCGCTGTCACCCAAGAACCCCTGTACCTTATTTTCTCCTGCTGACCCCTTGCTATAATATGATACGTCTCCACACTAGCTGAAACCAACCGCGCCCCCTTCGACCTAACAGAAGGGGAATCCGAGCTAGTATCAGGATTCAACGTAGAATATGCAGCAGGACCTTTCGCACTTTTCTTTCTAGCTGAATACGCCAATATTATACTCATAAATACACTAACCACAATTTTATTCTTCAACCCAAGCCTCCTAAACCCACCTCAAGAGCTATTTCCCGTTATTCTAGCCACAAAAGTCCTGCTCCTATCAGCAGGATTCCTATGAATTCGAGCCTCCTACCCACGATTCCGATACGACCAGTTAATGCACCTACTATGAAAAAATTTCTTACCACTCACACTAGCCCTATGTCTTTGACACACCAGCATACCAATCTGCTACGCGGGCCTACCT-----CCTTACTTATA--GG-CC-----------TTAACGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-A--ATAA-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATTTTCACCATTAGCCTACTTTTAGGAACAACTATCACTATCTCAAGCAACCACTGAATCA---TAGCCTGAACTGGTCTAGAAATTAACACACTCGCCATCCTCCCATTAATCTCAAAATCCCACCACCCACGAGCCATTGAAGCTGCCACTAAATATTTCCTGACCCAAGCAGCTGCCTCCGCCCTAGTCCTGTTCTCTAGCATAACCAATGCATGACATACCGGACAATGAGACATCACTCAACTTACCCATCCAACATCCTGCCTAATTCTTACCTCAGCAATCGCAATAAAACTAGGACTAGTGCCATTCCACTTCTGATTTCCAGAAGTACTCCAAGGCTCTCCCCTTATCACCGGCCTACTCCTATCCACTGTCATAAAACTCCCTCCAATCGCATTACTCTACATGACTTCCCCCTCACTAAACCCTACACTCTTAACTACCTTAGCAATCCTCTCCGCAGCTCTAGGAGGTTGAATAGGCCTCAACCAGACACAAATCCGAAAAATCCTAGCCTTTTCCTCCATTTCTCACCTGGGCTGAATAGCAATTATCGTCATCTACAACCCCAAACTCACACTCCTCAACTTCTACCTGTACGCCGTAATAACCGCAACCGTCTTCCTCACCTTAAATACAATTAAAGTACTAAAACTATCCACCCTAATAACCGCATGAACTAAAATCCCATCCTTAAACGCAATGTTACTCCTGACCCTGCTTTCCCTAGCAGGACTTCCTCCCCTAACAGGATTCCTACCCAAATGACTCATCATCCAAGAGCTAACTAAACAAGAAATAATCCCAGCAGCCACACTTATTTCCCTCCTTTCCCTACTAAGCCTATTCTTCTACCTCCGACTAGCATACTGTACAACCATTACACTCCCTCCGCATACCACAAACCACATAAAACAGTGACGCACTAACAAACCAACCAACATCATAATTGCCATCTTAACCACTGTATCCGTCATACTCCTTCCTATCTCTCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCATTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-T--CAA-TCTTCTAGGCAGATGGGCTTTGATCCCATGATAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGGCCCCGGTGCATAA-TTAATACACATCGATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGACTATTCTCAACCAACCACAAAGACATCGGTACCCTATACTTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTTGTTACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATTATAATCGGAGGATTCGGGAACTGACTGGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTCCTAGCATCCTCCACAGTTGAAGCAGGTGTGGGTACAGGCTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCACGCCGGAGCTTCAGTCGACCTCGCAATCTTCTCCCTACATCTGGCCGGTATCTCTTCAATCCTAGGGGCAATCAACTTCATCACAACAGCAATCAACATGAAGCCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTACTAATCACTGCAGTACTACTACTCCTATCTCTCCCAGTCCTAGCCGCAGGGATCACAATGCTTCTCACAGACCGCAACCTTAACACCACATTCTTTGACCCGGCCGGAGGAGGAGATCCTGTACTGTACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATCATCTCCCATGTCGTAGCTTACTACGCAGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATGCTGTCCATTGGATTCCTAGGATTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCTACTATAATCATTGCCATCCCAACTGGAATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGTACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACCATCGGAGGTCTAACAGGAATCGTCCTGGCAAACTCCTCACTAGACATCGCCCTGCACGACACTTACTACGTAGTAGCCCATTTCCACTACGTACTGTCAATAGGAGCAGTATTTGCAATCCTAGCAGGCTTCACCCACTGATTCCCTCTATTCACAGGATATACACTCCACTCAACATGAGCTAAAGCACATTTCGGCGTGATATTCGTAGGCGTAAATCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACCATTTCTTCAGTAGGCTCACTCATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAGGCTTTCGCATCAAAACGTAAAGTACTACAACCAGAACTAACAAGTACTAACGTCGAATGAATCCACGGCTGCCCACCTCCATTCCACACCTTCGAAGAGCCCGCCTTCGTGCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACTT--AAACATGGCCAACCACTCACAACTTAACTTCCAAGACGCCGCCTCACCTATTATAGAAGAACTAATAGGATTCCATGATCACGCCCTAATAATTGCACTAGCAATCTGCAGTCTCGTCCTTTACCTATTGACCCACACTCTCACAGAAAAACTGACATCAAACACAGTTAATGCTCAGGTAATCGAACTAGTTTGAACAATCCTCCCTGCCCTAGTCCTAGTCACACTCGCCCTACCATCTCTACGAATCCTCTACATAATGGATGAAATCAATGAACCAGACCTAACCCTAAAAGCCATCGGCCATCAATGATACTGAACCTACGAATATACCGACCTCAAAGACCTAACATTCGACTCCTACATAATCCCAACAACAGACCTACCTCTAGGCCACTTCCGCCTGCTAGAAGTCGACCATCGGGTCGTCGTCCCAATAAGCTCAACCATCCGAGTCATTGTCACTGCCGACGACGTCCTTCACTCATGAGCCGTACCCAGCCTAGGTGTAAAAACCGACGCAATCCCAGGACGGCTTAATCAAACCTCTTTCTTTGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAGATCTGCGGAGCCAACCACAGCTTTATACCAATCGTAGTAGAATCCACCCCACTCGCTAACTTCGAAAGCTGATCCTCTCTAA---TACCATCCT----------AATCATTAAGAAGCTATGAACCAGCGTTAGCCTTTTAAGCTAAAGAAAGAGGGA--TCCCTCCCTCCTTAATGATATGCCCCAACTAAACCCTAACCCCTGATTTTTTATCATGCTCACCTCATGACTCACCTTCTCCCTAATCATCCAACCCAAACTTTTAACATTCGTGTCAATAAACCCCCCATCAAATAAAC---CACCCGTCGCTCCAAGCACCACTCCCTGAACCTGACCATGAACCTAAGTTTCTTCGACCAATTCTCAAGCCCATCCTTCCTAGGAATCCCACTAATCCTCATCTCAATGACATTCCCAGCTCTCCTCCTACCATCCCTCGACAACCGGTGAATCACTAACCGACTATCAACCCTTCAACTTTGATTCATCAACTTAGTCACAAAACAACTAATAATGCCCCTAGACAAAAAAGGACATAAATGAGCACTAATCCTAACATCCCTCATAATCTTCCTCCTCCTCATTAATCTCCTAGGCCTATTACCATACACATTCACCCCAACCACCCAACTATCTATAAACTTAGCCCTAGCCTTTCCCCTATGACTAGCTACACTCCTGACAGGACTGCGAAACCAACCCTCCGCTTCACTAGGCCACCTCCTACCAGAAGGCACACCTACCCCACTAATCCCAGCCCTCATTCTAATCGAAACAACAAGCCTCCTCATCCGACCATTAGCACTAGGAGTGCGCCTAACAGCCAACCTAACAGCAGGCCACCTCCTAATCCAACTCATCTCTACCGCCACAACAGCCCTATTCTCCACAATACCAGTAGTCTCACTCCTAACTTTCGTAGTTCTTTTCCTACTAACAATTCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTCTTCGTACTCCTACTAAGCCTCTACCTCCAAGAAAACATTTAATTC--CA----AATGGCACACCAAGCACATTCCTACCACATAGTCGACCCCAGCCCATGACCTATCCTAGGAGCAGCCGCTGCTCTCCTCACTACCTCAGGACTAACAATATGATTCCACTCCAACTCCCCTCGACTCCTTATCCTAGGCCTACTATCAACCATCCTGGTCATATTCCAGTGATGACGCGACATTGTACGAGAAAGCACGTTCCAAGGCCACCACACCCCTACCGTACAAAAAGGACTACGATACGGAATAGCCCTGTTCATCACATCAGAAGCTTTTTTCTTCCTAGGATTCTTCTGAGCCTTTTTCCACTCAAGCCTAGCCCCCACGCCAGAACTAGGAGGTCAATGACCACCCGTCGGAATTAAACCCCTAAACCCCATGGAAGTACCACTCCTAAACACAGCCATCCTCCTAGCCTCAGGAGTCACCGTCACATGAGCCCACCACAGTATCACAGAAGCCAACCGAAAACAGGCTATCCAAGCTCTCTCCCTAACAGTACTCCTAGGATTCTACTTCACCGCTTTACAAGCCATAGAATACTACGAAGCACCCTTCTCCATCGCTGACGGAATTTACGGCTCAACATTCTTCGTAGCCACCGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCTTGCGCCTAATCAAATACCACTTCACATCAAACCACCACTTTGGATTTGAAGCTGCCGCCTGATACTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAGCCCAGAGAAGAGTAATA---AACATAATCTTATTCATATTAACCCTATCACTAACCCTAAGCATCCTCCTAACTGCGCTAAACTTCTGACTCGCCCAAATAACCCCAGACTCAGAAAAACTATCCCCATACGAATGTGGATTCGACCCCCTAGGATCCGCCCGGCTTCCTTTCTCAATTCGTTTCTTCCTAGTAGCTATCCTATTCCTCCTGTTCGACTTAGAAATTGCCCTACTCCTTCCACTACCCTGAGCCATTCAACTACAATCCCCCATCACCACCCTAACCTGAACTGCCGTACTCCTCATCTTACTCACCCTAGGCTTAGTGTACGAATGAATTCAGGGCGGACTAGAATGAGCAGAATA-A------TAGAAAGTTAGTCTAACTAAGACGGTTGATTTCGACTCAACAAATTATAGCTGTAACCCTATAACTTTCTTTATGTCCTACCTACACCTAAGCTTCTACTCAGCCTTTGCTCTAAGCAGCCTTGGCCTAGCCTTTCACCGAACCCATCTAATCTCCGCCCTACTATGTTTAGAGAGCATAATATTATCCATGTACGTCGCCCTAGCTATATGACCCATCCAAACCCAATCATCAATATCCACTATCCTCCCCATCCTCATGCTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTAGCATTACTAGTAGCCTCAACCCGCACCCACGGGTCCGACCACCTACACAACTTCAACCTCCTAAAATGCTAAAAATCATCATCCCAACCACAATACTCCTCCCCCTAGCCCTCCTCTCCTCACGTAAACATCTATGAACTAACACCACACTATACAGCCTACTAATCGCTACCGCCAGCCTCCAATGACTCACACCCACATACTACCCAAACAAAAGCCTAACTCCATGAACATCAATCGACCAAATCTCCTCTCCCCTACTAGTTCTATCATGCTGACTCCTACCCCTTATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCATCAACCGCAAACGAATCTTCGCCTCAACACTAATCCTAGCCCAACTGTCAATCCTCCTAGCCTTCTCAGCCTCCGAACTAATGCTCTTCTACATTGCATTTGAAGCCACCCTCATCCCCACCCTAATCCTTATCACACGGTGAGGAAGCCAACCAGAACGCCTAAACGCTGGCATCTACCTCCTATTCTACACTCTCGCCAGCTCACTCCCACTATTAATTGCCATCCTCCACTTACAAAACCAAATTGGTTCACTCTACCTACCAATACTCAAACTCTCCCACCCAACATTAAACCACTCTTGATCCAACCTAATTGCAAGCCTAGCCCTCCTATTAGCCTTCATGGTAAAAGCCCCCCTGTACGGCCTGCATCTATGACTACCCAAAGCCCACGTAGAAGCCCCAATCGCTGGCTCCATATTACTAGCCGCCCTACTCCTAAAACTAGGAGGCTACGGTATCATACGAATCACAATCCTAGTAAACCCATCATCAAACAACCTCCACTACCCATTCATTACTCTGGCCTTATGAGGAGCGGTAATAACCAGCGCTATTTGCTTACGCCAAATTGACCTAAAATCATTAATCGCTTACTCATCCGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGGGCAATAATCTTAATGATTTCACATGGCTTAACCTCTTCAATACTGTTCTGCCTAGCCAATACCAACTACGAACGAACCCACAGCCGAATCCTCCTACTTACACGAGGACTCCAACCTCTCCTACCACTTATAGCAATCTGATGACTGCTAGCCAACCTAACAAACATAGCCCTTCCCCCAACAACGAACCTCATAGCAGAACTAACCATTATCGTAGCACTCTTCAACTGATCTGCCCTAACAATCATCCTAACAGGAACCGCCATCTTACTCACCGCCTCATACACCCTATACATACTAATAATAACACAGCGAGGAACCCTTCCGTCCCACATCACATCAATTCAAAACTCCTCCACACGAGAACACCTCCTCATAGCCCTACACATAATCCCCATAATCCTACTAATCTTCAAACCTGAACTGATCTCCGGCATCCCCATAT-GCAAGTATAGTTT-CAA-CTAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAATCCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAGCGAGAACTGCTAACTCTTGTATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCATTAGTCCTAAACACATTCATACTCCTCACCCTAGCAACCCTTTCCACTCCTATCCTATTCCCACTACTGTCCAATAACCTCAAAAACACCCCAAGCACAATCACAAACACAGTCAAAACCTCATTCCTAATCAGCCTGATCCCCATAACAATCTTTATCTACTCCGGAACAGAGAACCTTACTTCCCTCTGAGAATGAAAATTCATCATAACCTTCAAAATCCCAATCAGCTTAAAAATAGACTTCTACACACTCACCTTCTTTCCCATCGCACTATTCGTGTCATGATCCATTCTACAATTCGCAACATGATACATAGCTTCAGACCCTTACATCACAAAATTCTTCACCTACCTTCTATTCTTCCTAATCGCCATACTCATCCTAATTATCGCCAACAACCTATTCGTCCTATTTATCGGCTGAGAAGGAGTCGGAATCATGTCCTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCTTACAAGCCGTCCTCTACAATCGAATCGGCGACGTCGGCCTTATCCTATGCATAGCATGATTAGCCTCCACCATAAACACCTGAGAAATCCAACAACTCTCCACCCCCTCTCAAACCCCCACATTACCACTATTAGGACTCATCCTAGCCGCAACCGGGAAATCCGCCCAATTTGGCCTGCATCCATGACTCCCAGCCGCAATAGAAGGACCAACCCCAGTATCCGCCCTACTACACTCCAGCACAATAGTAGTAGCAGGGATCTTCCTACTCATCCGTACTCACCCCCTATTTAACAACAACCAAACCGCCCTAACTCTATGCCTCTGCCTAGGGGCCATCTCCACCTTATTCGCAGCCACATGTGCCCTAACCCAAAACGACATCAAAAAAATCATTGCCTTCTCCACCTCAAGCCAACTAGGCCTAATAATAGTTACAATCGGATTAAACCTGCCCGAACTAGCTTTCCTCCACATCTCTACCCATGCATTTTTCAAAGCCATGCTTTTCCTATGCTCAGGCTCCATCATCCACAGCCTAAATGGCGAACAGGACATTCGAAAAATAGGAGGAATCCAAAAAATACTCCCCACAACAACTGCATGCCTCACAATCGGAAACCTTGCCCTAATAGGAACACCATTCCTAGCAGGGTTCTACTCAAAAGACCAAATTATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCCCTAATCCTAACCCTACTAGCTACATCATTTACCGCAGTATACACAATCCGCATAACCGTACTAGTGCAAACCGGCTTCACCCGAATCCCTCCCTTAACCCCAATAAATGAAAACAACCCAGCAGTAATCTCCCCCATCACTCGCCTTGCACTAGGAAGCATTCTAGCAGGCTTCCTAATCACTTCATTCATCCTCC---CAACAAAAACCCCTCCAATAACTATACCACTCTACATTAAAATAACCGCCCTAATCGTAACAGCCCTAGGAATCGCTCTAGCCCTAGAAATCTCAAAAATAGCCCAAACACTCATCCTAACAAAACAAACCCATTTCTCAAACTTCTCAACTTCCCTAGGATACTTCAACCCCCTAACCCACCGCCTAAGCATAACCAACTTCCTCAAAGGAGGACAGAACATCGCCTCCCACCTAATCGACCTATCCTGATATAAAATACTAGGCCCAGAAGGACTAGCCAGCCTACAACTGACAGCAACCAAAACCGCCACTACCCTTCACTCAGGCCTAATCAAAGCCTACCTAGGATCATTCGCCCTATCAATCCTAATCATCCTCA---TATCCTCACTCAGAAA--TAA-C-C---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTCAAAATCATCAACGACGCCCTAATCGACCTCCCAGCACCATCAAACATTTCAACATGATGAAACTTCGGGTCCCTACTAGGCGTCTGCCTAATTACCCAAATCGTCACAGGCCTTCTGCTAGCCATACACTACACAGCAGATACCAACCTAGCCTTCTCCTCTGTAGCCCACATATGCCGAGACGTACAATTTGGCTGACTCATCCGCAACCTCCACGCAAATGGAGCCTCTTTCTTCTTTATCTGCATCTACCTACACATCGGCCGAGGTCTCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACGTCGGAGTCATTCTCCTTCTAACCCTAATAGCAACCGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACTTATTCTCAGCCATCCCGTACATCGGACAAACACTAGTAGAATGAGCTTGAGGGGGATTCTCCGTTGATAACCCCACACTAACCCGATTCTTTGCCCTCCACTTCCTCCTCCCTTTCGTCATCGTAGGACTTACCCTCGTCCACCTAACCTTCCTCCACGAAACGGGCTCAAACAACCCACTAGGCATCCCATCAGACTGCGATAAAATCCCCTTCCATCCATACTACACTATCAAAGACATCCTAGGATTTATTCTAATACTTTCCCTGCTTGTCTCACTAGCCCTATTCTCCCCCAACCTCCTAGGAGACCCAGAAAACTTTACCCCAGCCAACCCACTAGTCACTCCCCCACATATCAAACCCGAATGATACTTCCTATTTGCCTATGCCATTCTCCGATCCATCCCAAACAAACTAGGAGGAGTACTAGCCCTAGCCGCCTCAATCCTAGTCCTATTCCTCATTCCACTACTACACACATCAAAACTGCGATCAATGACTTTCCGCCCTCTATCGCAAATCCTATTCTGAACTCTAGTCGCCAACGTCCTCCTCCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATTATTGGCCAACTAGCCTCACTCTCATACTTCACAATCATCCTAATCCTATTCCCCCTCGCGGCTGCCCTGGAGAATAAAATACTAAAACT----------TTA-ATA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Ficedula_zanthopygia_NC_015802 GTCCTCGTAGCTTACAA-AAAGCATGGCACTGAAGATGCCAAGACGGCTGC--CAC--CGCACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTGTTGCTAGGTTTATACATGCAAGTATCCGCGCCCCAGTG-CGTATGCCCTGGACG-CCT-TGAACCCC-----AAGCAGATAGGAGCGGGCATCAGGCTCA--C------CAC-A--TCCGTAGCCCAAGACGCCTAGCAATTGCCACGTCCCCACGGATTCTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAACT---ATAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCGC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAGCAACTGAGCTGTCATAAGCCCAAGATGC-TCATAAGGCCTCTACCTTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATATTGATGTT-CGACCCCCTACCTGAACATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCATTTCTCGC--AATAAG--CAGCCTATATACCGCCGTCGCCAGCTCACCTTCC--CTGACAGCCCAACAGTGAGCGCAATAG-CCCCA-TCCCGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAGCATAGAACA-T----AACGGCAAAGGGACATGAAACTGTCCCTAGAAGGAGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCGCAAG-CG---ACCAACACACCCTAT-ACCTAATAAGCCAT-TC--AGCTAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGATTA-CCAAGACGTAGC-TTTAACG-AAAGCATTCAGCTTACACCTGAAAGATATCTGTCG-ACATCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AACCT-ACATTG------ACCTGGA-ATAAC--AAAGCTACT--TC-CTA-AACCC----AACCAAAGCATT---T--GCTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAATG--AACAAGC--CAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACCCATGAGCAGCTAT-CATTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGTGGGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC--TACG-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA---------AATAACCTACACAAAA-CCTATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCCGT-ACCCAAAAAATATATA-AACTTTATGAATCCCT-CCCCACTAACAGGCTAACCTATAACTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGCA-CATTATTAACAAA-ACCCCA-ATATACGA--ACAAT---------CCA---ACAAGCA-GAG-TATTA-AGCACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGCAAAAGGAACTAGGCAAACCC--CAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCAAAG--CAAGTATTGAAGGTGATGCCTGCCCGGTG--ACAT-GAC---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCAGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTCAAAATCAGCAGCCACC--CCAAAT-TACATA----AA-CACCCA--C-C-GGGCTCACTAAC-ACA-TAA-GC-C-ACTGGCC-TGCATTTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAACTAGACCATACCTCTAAACCA-AGAGCAACATCTCAACGTGCTAATAGCTCCCAGACCCAATAT--AATTGATCAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCGAGAGTCCGTATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AGCTCTTCCCAGTACGAAAGGATAGGAA-AAGCAAGGCCAATACCACTA-GCAAGCCTTC-GCCTTAAGTGATGAAACCAACTTAATCACAAAAGGCTATCAC-ACACC---A-CCA-CACCCTAGAAAAGGG--CACAGCTAGCGTGGCAGAGTCCG--GCAAATGCAAAAGGCTTAAGTCCTTTTACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTCTCT---------------CTCC----ATGAC----------CAACCACCCCCTCCTAATTAACCTTGTGATAGCCCTCTCCTACGCCATCCCTATCCTAATTGCAGTAGCCTTCCTTACACTAGTTGAACGTAAAATCCTGAGCTACATACAAGGGCGAAAAGGGCCAAACATCGTAGGACCCTACGGCCTACTCCAACCCTTAGCAGATGGAGTGAAACTATTTATCAAAGAACCCATCCGAC---------CATCAACATCCTCCCCCATCCTATTTATTGCAACCCCAATGCTAGCACTCCTACTCGCAATCTCCATCTGAACCCCACTTCCTCTGCCATTCCCACTTGCAGACCTCAACTTAGGCTTACTTTTCCTCCTAGCCATGTCAAGCCTCGCAGTGTACTCCATCCTCTGATCCGGATGAGCCTCCAACTCGAAATACGCCCTAATCGGAGCGCTACGGGCAGTAGCCCAGACTATCTCCTACGAGGTAACCCTGGCCATTATCCTCCTGTCCATCATCCTACTTAGTGGCAACTACGCCCTCAGCACTCTTGCAGTCACCCAAGAGCCCCTCTACCTAATCTTCTCCTGCTGACCGCTAGCAATAATGTGATACGTCTCCACACTCGCTGAGACCAACCGAGCCCCATTCGACCTAACAGAGGGCGAATCCGAACTGGTCTCTGGGTTTAACGTAGAGTATGCAGCAGGACCTTTCGCCTTATTCTTTTTAGCTGAATACGCCAACATCATGCTCATAAATACATTAACCGCCATTCTATTCTTCAACCCAAGCGCCTTTAACCCCCCTCAAGAACTATTCCCAGTAATCCTAGCTACGAAAGTCTTACTACTATCAGCAGGCTTCCTGTGAATCCGTGCCTCCTACCCACGATTCCGATATGATCAACTTATACATCTACTATGAAAAAACTTCCTCCCACTTACACTTGCCCTATGCCTGTGACATACCAGCATGCCAATCTGCTACGCAGGCCTACCC-----CCATACCTA-A--GG--------------GCCCAGGAAATGTGCCTGAGAAC-C--AAGGGCCACTATGATAAAGTGAACACAGAGGTATACCAACCCTCTCATTTCCT-A--AAAT-------TTAGAAAAGTAGGAATTGAACCTACACTAGAGAAATCAAAGTCCTCCATACTTCCCTTATATTATTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAGTCTTTACCCTCAGCCTGCTCTTAGGGACCACCATTACCATCTCAAGCAGCCACTGGATTA---TAGCCTGAACCGGACTCGAAATTAACACCCTAGCCATCCTCCCTCTAATTTCAAAGTCACATCACCCCCGGGCTATTGAAGCTGCAACCAAGTACTTCCTAGTTCAAGCGACTGCCTCCGCCCTAATCTTGTTCTCTAGCATGACCAATGCATGACAAACAGGACAATGAGACATTACTCAACTGACTTACCCAACATCCTGCCTAATTCTAACCACTGCTATTGCAATGAAACTAGGACTGGTCCCATTCCACTTCTGATTCCCTGAAGTACTTCAAGGTACTTCACTAGCTACTGGCCTCCTACTATCCACAGCTATGAAGTTCCCCCCAATAACACTATTCTTCATAACCTCCCAATCACTGAACCCGACCCTACTGATCATCCTGGCTATCCTTTCTGCCGCCCTAGGAGGATGAATGGGCCTAAATCAAACACAAATCCGAAAACTCTTAGCCTTTTCATCTATCTCCCACTTAGGGTGAATGGCCATCATCATCCTCTACTCCCCCAAACTAGCCCTACTGAACTTCTACCTATACGCCTTAATGACAGCCACCGTATTTGCCACCCTAAACTCAACTAACACCCTAAAACTCTCCACACTTATAACCACATGAACAAAAACCCCAGCATTAAGCGCAACCTTAATACTTACCCTCCTATCCCTTGCAGGCCTACCCCCTCTAACAGGCTTCCTTCCTAAATGATTAATCATCCAAGAACTAACCAAACAAGAAATAGCCCCAACAGCAACAATCATTGCCCTCCTCTCCCTATTAAGCCTCTTCTTCTACCTCCGTCTTGCATACTGCGCAACAATCACACTTCCCCCACACACTACAAACCACATAAAACAATGACATATTAACAAACCAACTAGCATCCTAGTCGCTGTTCTAGCTTCTATGTCCATTACCCTCCTGCCAATTGCACCCATAATCCTCACCATCAT------CT----AAGAAACTTAG----GATCACCT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAGATTCGCAGGACACTACCCTGCATCTTCTGAATGCAACCCAGACACTTTAA-TTAAGCTAGAACCTT--------AACCCTAGACAGATGGGCTTCGATCCCATAACAC-TATAGTTAACAGCTATATGCCCAAACC-AACAGGCCTCTGCCT-A-------------AGGTCCCGGTGCGGAA-TCAACGCACATCAATGAGCTTGCAACTCACCATGAACTTCACCACAGGACC---GATAAGAAGAGGAATCAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTAATCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTCTACCTAATTTTTGGTGCATGAGCCGGAATGGTAGGTACTGCCCTAAGCCTCCTTATCCGAGCAGAGCTGGGCCAACCAGGCGCCCTACTAGGAGATGATCAGATCTACAACGTAGTCGTCACAGCCCATGCCTTCGTGATAATTTTCTTCATAGTTATACCAATCATGATCGGAGGCTTCGGAAACTGATTGGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTTCCTCGAATAAACAACATAAGCTTCTGATTACTACCTCCATCCTTCTTGCTGCTCCTAGCATCCTCTACAGTCGAAGCAGGGGCAGGAACAGGATGAACAGTGTACCCACCGCTTGCTGGAAATCTAGCCCACGCTGGGGCTTCAGTCGACCTAGCCATCTTCTCCCTTCACTTAGCAGGTATCTCCTCAATCCTAGGTGCCATCAACTTCATCACAACAGCAATTAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCTGTTCTAATTACAGCAGTCCTTCTCCTCCTATCCCTCCCTGTACTCGCTGCTGGCATTACCATGCTCCTCACCGACCGTAACTTAAACACCACCTTTTTCGACCCTGCAGGAGGAGGAGACCCAGTACTTTATCAGCACCTTTTCTGATTCTTTGGCCATCCAGAAGTATATATCCTAATCCTTCCTGGATTTGGCATCATCTCCCACGTCGTAGCCTACTACGCAGGGAAAAAAGAACCATTCGGCTACATAGGGATAGTATGAGCCATACTCTCAATCGGATTCCTTGGATTTATTGTCTGAGCCCACCACATATTCACAGTAGGAATAGACGTAGACACCCGAGCATACTTCACGTCTGCTACCATAATCATCGCCATCCCAACAGGCATTAAAGTGTTCAGCTGACTAGCAACCCTGCATGGGGGCACAATCAAATGAGACCCCCCAATACTATGAGCTCTAGGGTTCATTTTCTTATTCACCATCGGAGGACTAACAGGGATTGTCTTAGCAAACTCCTCACTAGATATCGCCCTACACGACACCTACTACGTAGTAGCTCACTTCCACTACGTCCTATCAATAGGCGCAGTGTTTGCAATCCTAGCAGGCTTCACACACTGATTCCCACTATTCACCGGCTACACCCTTCACTCCACATGAGCCAAAACCCACTTCGGTGTAATATTCGTAGGTGTCAACCTGACCTTCTTCCCACAACACTTTCTAGGCCTAGCCGGCATGCCGCGCCGATACTCAGACTACCCTGACGCCTACACACTGTGAAACACCATTTCATCTATCGGCTCATTAATCTCCCTCACAGCTGTAATTATGTTAGTATTCATTATCCGAGAAGCCTTCGCATCAAAACGTAAAGCCCTCCAACCAGAACTAACAAGCACTAACATTGAATGAATCCATGGCTGCCCACCACCATTCCACACCTTCGAAGAGCCAGCTTTCGTTCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATGTGTTGGTTTCAAGCCAACCGCATAT--AAACCACTTATGCTTCTTTCTC---AT---AGAAGTGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAGTCACAGGTGAAACCCCTGTACACCT------CACTCTCTAAAATGGCCAACCACTCACAATTCGGTTTCCAAGATGCTTCATCACCTATTATAGAAGAACTAGTACAATTCCATGATCATGCCTTAATAGTCGCCTTAGCCATTTGCAGCCTGGTCCTTTACCTCCTAACCCTAATACTTACAGAAAAATTATCATCAAGCACCGTCGACGCCCAAGAAATCGAGCTCGTCTGAACAATCCTCCCAGCTGCAGTCCTAGTCATACTCGCCCTCCCATCCCTACGAATCCTCTACATGATAGACGAGGTAAACGAACCAGACCTAACCCTAAAAGCCATCGGACATCAATGGTATTGATCCTATGAATACACTGACTTCAAAGACCTCACATTCGACTCCTACATAATTCCTACATCAGACCTTCCACTGGGCCACTTTCGCCTACTAGAAGTAGACCACCGTGTCATCGTACCCACAGAATCCAAAGTCCGAGTCATCGTCACCGCTGATGACGTGCTTCACTCATGAGCCGTCCCCAGCCTAGGCGTAAAAACCGACGCAATCCCAGGACGCCTAAACCAAACCTCCTTCCTCGCCTCTCGTCCCGGAGTGTACTATGGACAGTGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCTATCGTAGTCGAATCGACCCCTCTCGCCAACTTCGAAAACTGATCTTCCCTAC---TATCTTCCT----------AATCATTAAGAAGCTATGAAGCAGCGCTAGCCTTTTAAGCTAGAGAAAGAGGACT---GACCCCTCCTTAATGGTATGCCTCAACTGAACCCAAATCCTTGATTTTTTATCATGCTTACTTCATGACTCACCTTCTCCATAATCATTCAGCCTAAACTACTCACATTCATCTCTATAAACCCCCCATCTAGCAAAA---CACCCACAACCCCCAAAACCACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTTTCAAGCCCTTCCCTACTAGGCATTCCCCTAATCCTCATCTCAATGGTATTTCCAGCACTACTCCTACCATCCCCTGGTAACCGATGAATCACCAACCGCCTGTCAACTCTACAACTATGATTCATCAACTCAGTTACAAAACAACTAATAATACCACTACACAGCAAAGGGCACAAATGAGCGCTAATCCTAACATCATTAATAATCTTCCTACTACTAATCAACTTATTAGGACTATTACCCTACACATCCACACCAACTACCCAGCTATCCATAAACCTAGCCCTAGCCTTCCCACTATGACTTGCCACACTCCTAACAGGCCTACGAAACCAACCATCCACCTCCCTAGGTCACCTCCTACCGGAAGGCACCCCCACACCCCTGATCCCCGCCCTCATCATAATCGAAACAACAGGCCTCCTCATCCGCCCTCTAGCCCTAGGCGTACGCCTAACCGCCAATCTAACAGCAGGCCACCTTCTAATCCAACTCATTTCCACCGCCACAGTAGCCCTATTTTCAACAATACCAGCAGTGTCACTACTAACCCTACTAGTCCTACTACTTCTAACCATCCTAGAGGTAGCAGTAGCCATAATCCAAGCCTACGTGTTCGTCCTACTACTAAGCCTCTACCTACAAGAAAACATCTAACTC-------CAATGGCACACCAAGCACACTCTTATCATATAGTAGACCCCAGCCCATGACCCATCCTCGGAGCAGCCGCCGCCCTCCTTACCACTTCAGGCTTAACCATGTGATTCCACTACAACTCTCCCCTGCTCTTAATCATTGGCCTCACCTCAACAGCCCTAGTCATATTCCAATGATGACGCGACATCGTACGCGAAAGCACCTTTCAAGGCCATCACACTCCCACTGTCCAAAAAGGCCTACGATATGGCATAGTCCTATTCATCACATCAGAAGCTTTCTTCTTCCTTGGCTTCTTCTGAGCATTCTTCCACTCAAGCCTAGCCCCCACCCCAGAACTAGGTGGCCAATGACCCCCCGTTGGAATTAAACCCCTAGACCCTATAGACGTCCCTCTCCTAAACACTGCCATCTTACTAGCTTCAGGAGTAACAGTTACATGAGCCCACCACAGCATTACAGAAGCAAACCGCAAACAAGCAATTCAAGCCCTCGCCCTAACAGTACTCCTAGGCTTTTACTTCACCGGTCTTCAAGCCATAGAATACTACGAAGCCCCATTTTCCATCGCAGACGGGGTTTACGGCTCAACTTTCTTCGTCGCTACAGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTATTCCGCCTAATTAAACACCACTTTACATCAAACCATCACTTTGGCTTTGAAGCAGCAGCATGATACTGACACTTCGTAGATGTTGTCTGACTTTTCCTCTATATTTCCATCTACTGATGAGGATCTTGCTCTTCTAGTATACTC-ATTACAATAGACTTCCAATCTCTTAAATCTGGTCTAAACCCAGAGAAGAGCAATGAACAACATAATCACATTCATGCTCACCTTATCCCTAGGACTAAGCATCGCCTTAACCGCCCTAAACTTCTGATTAGCCCAAATAACCCCCGACTCAGAAAAACTTTCCCCATACGAATGCGGATTTGACCCACCAGGAACTGCTCGACTTCCCTTTTCAATCCGATTTTTCCTAGTAGCAATCCTATTCCTACTGTTCGACCTAGAAATCGCCCTTCTTCTACCCCTGCCCTGAGCAACGCAACTTCAATCCCCCACAACTACACTAATCTGAACCTCTGCTCTAATTCTCCTCCTCACCCTAGGTCTCGTATACGAATGAATCCAAGGAGGACTAGAATGGGCAGAATA---------AGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAAATTACAGTACCCACCCCGTAACTTTCTTCATGTCCCACTTACACCTTACCTTCTATGCAGCATTCACCCTAAGCAGCCTGGGCTTAGCCTTCCACCGAACACATCTAATCTCAGCCCTACTCTGCCTAGAGAGCATGATACTATCAATGTATCTCGCCTTAACCATATGACCTATCCAAATACAGGCACCATCCTCCACCATCCTCCCCATCCTCATACTAACATTCTCCGCTTGCGAAGCAGGAGTAGGATTAGCACTACTAGTAGCCTCCACCCGAACCCACGGCTCCGACCACCTCCACAACTTCAACCTACTACAATGCTAAAAATCATCATCCCAACCATCATACTCCTCCCCCTAGCCCTCCTCTCCCCATGTAAACATCTATGAACCAACATCACGGCACACAGCCTCCTAATCGCGACTATTAGCCTTCAATGACTAGTCCCTACATACTACCCCAACAAAACCCTAACTTTCTGAACCTCCATCGACCAAATCTCTTCCCCCCTGCTAGTCCTATCATGCTGACTACTCCCTCTCATAATCATAGCGAGCCAAAACCACCTAGAATCAGAACCAACCATCCGTAAACGAGTCTTCGCCACAACCCTAATCCTAGCTCAACCATCAAGCCTCCTAGCCTTCTCCGCCTCAGAACTAACATTATTCTACATCGCATTTGAAACCACCCTAATCCCAACTCTAATCCTAATCACGCGATGAGGCAACCAACCAGAACGACTAAGCGCAGGCATCTACCTTCTATTTTATACCCTAGCCACCTCACTCCCCTTACTAATCGCTATCCTCCACCTCCACAACCAAATCGGTACCCTCTACTTCCCCATACTCAAACTCTCACACCCTGCCATCTCGACTTCCTGAACAGGACTAATATCAAGCTTAGCCCTACTCCTAGCATTCATGGTCAAAGCACCCCTATACGGCCTACACCTATGACTCCCTAAAGCCCATGTAGAAGCCCCAATCGCCGGGTCCATGCTGCTAGCCGCCCTTCTCCTAAAACTAGGAGGCTACGGAATCATACGAATCACCCTCCTAGTCAACCCGTCTTCAAACAACCTACACTACCCATTCATTACCCTAGCACTATGAGGTGCCCTAATAACCAGTGCCATCTGCCTACGCCAAATAGACCTAAAATCACTAATCGCATACTCATCCGTCAGCCACATAGGCCTCGTAGTCGCCGCAACCATAATCCAAACTCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCCCACGGCCTAACCTCCTCAATACTATTCTGCCTAGCCAACACCAATTACGAACGGACCCATAGCCGAATTCTCCTATTAGCCCGAGGCCTCCAACCCCTCCTGCCCCTTATGGCCACCTGATGACTTCTAGCCAACCTAGCAAACATGGCACTTCCCCCAACAATCAATCTCATAGCAGAACTAACCATTGTAATCGCACTCTTCAACTGATCTTCCCTAACACTCATCCTCACAGGAGCCGCAATCCTACTAACAGCCTCATACACCCTATACATACTCATAATAACACAACGAGGGACCCTGCCATCCCACATTACATCCATCCAAAACTCCTCTACACGAGAACACCTCCTCATGGCCCTACACATAATCCCTATAATCCTTTTAATCTTCAAACCCGAACTTATCTCCGGCACCCCTATAT-GCAAGTATAGTTT-CAACCCAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAACCCTTCTTACCTGCCGAGGG--AGGTTTAAAACAGCAAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCTAAGCCCCCTT--ACTTTCAAAGGATAATAGCAATCCAATGGTCTTAGGAGCCACCCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGTCCTAAATACATTCACACTCTTAACCCTATCAACCCTTTTCACCCCAATCATCTTCCCCCTACTCTCAGACAACCTCAAAAACACCCCCACCATTATCACCAAGACTGTGAAAACCTCCTTCCTAATCAGCTTGGTCCCCATAACAATCTACATTTACTCAGGGACAGAAAGCCTAACTACCCTGTGAGAATGAAAATACATCATAAACTTTAAAATCCCTATCAGCCTAAAAATAGATTTCTACTCCCTTACATTCTTCCCAATCGCCCTATTTGTGTCCTGATCAATTTTACAATTCGCAACATGATACATGGCCTCAGACCCCTATATCACAAAATTTTTCACCTACCTTCTAATCTTCCTAATCATAATACTCATCCTAATCGTTGCCAACAACTTTTTCGTCCTATTCATCGGATGAGAAGGAGTGGGAATCATATCCTTCCTACTAATCAGCTGATGACACGGACGAGCAGAAGCCAACACCGCGGCCTTACAAGCCATCCTATATAACCGAATCGGAGACATTGGCCTCATCCTTTGCATAGCATGACTAGCCTCCACCCTAAACACCTGAGAAATCCAACAAATCTCCACGCCCCACGAAACCCCAACCTTCCCTCTACTAGGCCTCATCCTAGCCGCAACCGGCAAATCCGCTCAATTTGGCCTACACCCATGACTCCCAGCCGCCATAGAAGGTCCAACCCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTTGCCGGAATCTTCCTATTAATCCGAACGCACCCCTTGTTCAACAATAACCAAGTCGCCCTAACCCTCTGCCTATGCCTCGGAGCTCTGTCAACACTATTCGCAGCCACCTGCGCCCTCACCCAAAACGACATCAAAAAAATCATCGCTTTCTCAACCTCAAGCCAATTAGGACTGATAATAGTAACAATCGGACTAAACCTCCCCCAACTAGCCTTCCTTCACATTTCAACACATGCATTCTTCAAAGCCATACTGTTCCTATGTTCTGGTTCAATTATCCACAGCCTCAACGGTGAACAGGACATTCGAAAAATAGGTGGCCTCCAAAAACTCCTACCAACAACCACCTCCTGTCTAACCATTGGCAATCTAGCCCTAATAGGAACCCCATTCCTCGCAGGTTTCAACTCAAAAGACCAAATCATCGAATGCCTCAACACATCCTACCTAAACTCCTGAGCACTTCTCCTCACCCTACTAGCAACAACCTTCACCGCAGTCTATACCATCCGCATAACCGTGCTTGTCCAAGCCGGCTTCGTACGCATCCCCCCTTTAACCCCAATAAACGAAAACAACCCTGCAGTAACCTCCCCAATCACCCGCCTAGCAGTAGGTAGCATTACAGCCGGATTCATCATCACCTCCTTCATCCTAC---CAACAAAAACCCCGCCCATAACAATACCTCTATACATTAAAATCACCGCCCTAATCGTCACAATCCTAGGCATCCTACTCGCCCTAGAAATCTCAAAAATAACCCAAACCATAATCCTCACAAAACTAGGCCCTCTATCAAACTTCTCCACATCACTAGGCTACTTCAACCCTCTAATACACCGCTTCAGCGTGACAAACCTCCTAACCGCAGGCCAAAACACCGCTTCCCACCTAATCGACCTCTCCTGATATAAACTACTAGGCCCAGAAGGACTAGCTGCCCTACAAACAATAGCAGCTAAAACTGCAACCACCCTCCACTCTGGACTGATCAAAGCCTACCTAGGATCCTTCGCCCTATCCACCCTCATCATCCTAT---TATCTATACACAGAAC--TAACT-----AATGGCCCTCAATCTTCGTAAAAACCACCCACTATTCAAAACCACCAACAATGCCCTAATCGACCTCCCCACACCACCAAACATTTCCGCTTGATGAAATTTCGGGTCATTACTAGGCATTTGCTTAATTACACAAATCATCACTGGGCTACTACTAGCCACACACTACACAGCAGACACCTCCCTAGCCTTCAACTCAGTCGCCCACATATGCCGAAACGTACAATTCGGCTGACTAATCCGAAACCTTCACGCAAACGGAGCCTCATTCTTCTTCATCTGCATTTACCTTCATATCGGACGAGGATTCTACTATGGCTCTTACCTAAATAAAGAAACCTGAAACATTGGAGTCATCCTTCTCTTAGCCCTAATAGCAACCGCCTTCGTAGGCTACGTCCTCCCCTGAGGACAAATATCATTCTGAGGGGCTACAGTAATCACCAACCTGTTCTCAGCCATCCCGTACATCGGCCAAACACTAGTAGAATGAGCCTGAGGAGGATTCTCAGTAGACAACCCTACCCTGACCCGATTCTTCGCCCTCCACTTCCTACTCCCCTTCATCATCGCAGGCCTTACACTAGTGCACCTCACATTCCTGCACGAAACAGGCTCAAACAACCCACTAGGAATCCCCGCAGACTGCGACAAAATCCCATTCCACCCATACTACTCTACAAAAGACATCCTAGGGTTCGCACTCATACTTATCCTACTAACCACCCTAGCCTTATTCTCCCCCAACCTCCTTGGGGACCCAGAAAATTTCACCCCAGCCAACCCATTAGCCACACCCCCACACATCAAACCCGAATGATACTTCCTATTCGCATATGCCATCCTACGCTCCATCCCAAACAAACTAGGAGGAGTACTAGCCCTAGCCGCCTCTGTCCTAGTCTTATTCTTAATCCCCTTACTACACACCTCTAAACAACGCTCACTGACCTTCCGACCCATCTCACAAGTCCTATTCTGAATTCTAGTTGCTAACCTACTCATTCTAACCTGAGTCGGAAGCCAACCAGTTGAACACCCCTTCATCATCATCGGCCAACTAGCCTCCCTCTCATACTTCACGATCATCCTAATTCTCTTTCCACTTGCAGCTATGCTAGAGAACAAAATACTAAACCT----------CTA-ACT-----------CACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTCAACCCCTTCTTAGAGTT Fringilla_coelebs GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CATA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACA-CCT-T-GA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--CCCGTAGCCCAAGACGCCTTGCAATTGCCACACCCCCACGGGTACTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGC-AA-T---TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGCGTGGTCAC-ATGTTAT-CCAAGTAACTAAGACTAAAAAGCAACTGAGTTGTCACAAGCCCAAGATGC-CAATAAGGCCACC-TCCTTAAAGAAGGTCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGACCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--CCCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACCTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCTCACCTCCC--CTGAAAGTCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAGTAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GG-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T-----ACGGCAAAGGGGTATGAAATAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCACAAG-CG----CCCCCTACCCCCATAAATTAATAAGCCAT-TC--AGCCGAAGAGGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ATACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTCCCC-AAA-CACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAGCAGTG-AAAC---T--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGTGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-CCACG-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGGACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AGC--ACCAATTCC-CAATAC-CATACTGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-CCTACAAAAATATAAG-AACCATGCGACTCCCT-CATCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--C--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-TAACCA-ATATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATTA-AACATC-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTTCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTCAAAACCAGCAACCACC--TTAAAT-CACCTA----CA-CACCCA--C-C-GGGTTCACTGAC-ATT-TAA-GC-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCATCCCTCTAGACTG-AGAGCAACCCCTCAACGTGCGAATAGCACCCAGACCCAATAT--AATTGATCGATGGACCAAGCTACCCCAGGGATAACAGCGCAATCCCCTCCGAGAGTCCATATCGACGAGGGGGTTTACGACCTCGATGTTGGATCAGGACATCCTGGTGGTGCAGCAGCTGCCAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAAACC--AA-----ATAACC--C----ATGAC----------CAACTACCCCCTACTAATCAACCTAATCATAGCCCTCTCCTATGCCATCCCGATCCTAATCGCAGTAGCCTTCCTCACCCTAGTAGAACGCAAAATCTTAAGCTACATGCAAAGTCGAAAAGGACCAAACATCGTCGGTCCCTTTGGACTCCTACAACCCCTAGCAGACGGAGTAAAACTATTTATCAAAGAGCCCATTCGAC---------CGTCAACATCCTCTCCCATCCTGTTCATTGCGACCCCTATCCTAGCGCTACTTCTGGCAATCTCAATCTGAACACCACTGCCCCTACCCTTCTCCCTGGCAGACCTCAACCTAGGCCTGCTCTTCCTACTAGCTATATCAAGCCTGGCAGTATACTCCATTCTATGATCAGGCTGAGCCTCCAACTCAAAATACGCCCTAATTGGAGCACTCCGAGCAGTAGCCCAAACAATCTCTTATGAAGTAACTTTAGCACTTATTCTACTATCCGTTGTCATCCTAAGCGGTAACTATACCCTCAACACCCTCGCGGTCACCCAAGAGCCCCTGTATCTTATCTTCTCCTGCTGACCCCTCGCTATAATATGATACGTCTCCACACTTGCCGAAACAAACCGCGCCCCATTTGACCTAACAGAAGGGGAATCCGAATTAGTCTCCGGATTCAACGTAGAGTACGCAGCAGGCCCCTTTGCCCTGTTCTTCCTAGCCGAGTACGCCAACATCATACTTATAAACACCCTAACCACCATCCTATTCTTCAACCCAAGCTTCCTAAACCCCCCTCAAGAGCTATTCCCCGTCGTACTAGCCACAAAAGTACTACTCTTATCGGCAGGATTCCTATGAATTCGCGCCTCCTACCCCCGATTCCGATATGACCAGCTAATGCACTTATTATGAAAAAACTTCCTGCCACTCACACTTGCCCTATGCCTCTGACACACCAGCATACCAATTTGCTACGCGGGTCTACCT-----CCTTATATA-A--GA--------------CCCTCGGAAATGTGCCTGAACAC-C--AAGGGTCACTATGATAAAGTGAACATAGAGGTATACCAGTCCTCTCATTTCCT-A--ACGC-------TTAGAAAGGCAGGAGTCGAACCCACACTAGAGGGATCAAAACCCTCCATACTCCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTTATCGCTAGCCTAATGTTAGGAACAACCATCACAATTTCAAGCAACCACTGAATTA---TAGCCTGAGCAGGACTTGAAATCAACACACTCGCCATCCTCCCATTAATTTCTAAGTCACATCACCCACGAGCCATCGAAGCTGCTACCAAATACTTCCTAACTCAAGCAACCGCCTCAGCCCTTCTACTGTTTTCTAGCATAACCAACGCCTGACATACCGGACAATGAGACATTACCCAGCTCTCCCATCCAGTATCTGCCGTCATCCTCACTTCAGCAATTGCAATGAAACTAGGCTTAGCCCCATTCCACTTCTGATTTCCAGAAGTCCTTCAAGGCTCCCCCCTCATCACAGGCCTTCTCCTATCCACCGTTATGAAGCTCCCTCCAATTGCACTGCTATACATAACCTCCCACTCACTAAACCCAACACTCCTAACTGTCATAGCCATTCTTTCAACAGCCCTGGGAGGATGAATAGGACTAAACCAGACACAAATCCGAAAAATCCTAGCCTTCTCCTCTATCTCCCACCTAGGCTGAATAGCAATTATTATCATTTACAACCCAAAACTTACCCTCCTCAACTTCTACTTATACACCATAATGACTGCAGCTGTCTTCCTCTCCCTAAACTCAATCAAAGTGCTAAAACTATCTACCCTAATAACCGCATGAACTAAAATTCCATCGTTAAACGCAATACTACTCCTAACCCTATTATCCCTTGCAGGCCTACCTCCCCTAACAGGGTTCCTGCCTAAATGACTCATCATCCAAGAACTAACCAAACAAGACATAGCCCCAGCAGCCACTCTTATCTCCCTCCTTTCCTTACTAAGCCTATTCTTCTACCTCCGCCTCACATACTGCACAACAATTACACTTCCCCCACACACCACAAACCACATAAAACAATGACGCACTAACAAACCAACCAGCATCCTAATCGCTGTCTTAACCACCATATCCGTCATCCTCCTTCCCATCTCCCCCATACTCATCGCAATCGT------TT----AAGAAACTTAG----GA?CAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACTCTCTTAGTTTCTGCTAAAGTCCGCAGGCCATTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-C--CAG-C-CACTAGACAGATGGGCTTCGATCCCATAACAC-TATAGTTAACAGCTATATGCCCAAACC-AACAGGCTTCTGCCT-A-------------AGACTCCGGTACACGT-TTAATGTACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCGTAAACCGATGATTATTCTCAACTAACCACAAAGATATCGGAACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTCAGCCTCCTCATCCGAGCAGAACTGGGCCAACCCGGAGCTCTTCTAGGAGACGACCAAGTCTACAATGTAGTTGTCACGGCCCATGCTTTCGTAATGATTTTCTTTATAGTTATGCCTATTATAATCGGAGGGTTCGGAAACTGATTAGTTCCCCTGATAATTGGAGCCCCCGACATAGCATTTCCCCGAATAAATAACATAAGCTTCTGACTACTTCCACCATCCTTTCTCCTTCTACTAGCATCCTCCACCGTAGAAGCAGGAGTAGGTACAGGATGAACTGTATATCCCCCACTAGCCGGCAATCTGGCCCACGCTGGAGCCTCAGTAGACCTAGCAATCTTTTCATTACACCTAGCCGGCATCTCTTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCACCTGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTAATCACTGCAGTACTCCTCCTCCTATCTCTGCCAGTTCTCGCTGCAGGGATTACAATGCTTCTCACAGATCGTAACCTCAATACTACTTTCTTTGACCCCGCAGGCGGAGGAGACCCTGTACTATACCAACACCTGTTCTGATTCTTTGGCCACCCCGAAGTATACATCCTAATCCTCCCAGGATTCGGAATCATCTCCCACGTTGTAACCTACTACGCAGGAAAAAAAGAACCATTCGGATATATAGGAATAGTATGAGCCATGCTGTCCATCGGATTCTTAGGCTTCATCGTCTGAGCCCACCACATATTCACAGTAGGAATAGACGTTGACACTCGAGCATACTTCACATCCGCTACCATGATCATCGCCATCCCAACAGGCATCAAAGTGTTCAGCTGACTAGCCACACTTCACGGCGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTTATCTTCCTATTCACCATCGGAGGACTAACAGGAATCGTTCTAGCAAACTCCTCACTAGACATTGCACTACACGACACCTACTACGTAGTAGCTCACTTCCACTACGTGCTATCAATAGGAGCTGTCTTCGCAATTCTAGCCGGATTCACACACTGATTCCCATTATTCACCGGATACACTCTTCACTCAACATGAGCCAAAACACACTTTGGCGTAATATTCGTAGGTGTAAACCTCACTTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCTTACACACTATGAAACACCATCTCCTCAGTAGGATCCCTTATCTCACTAACAGCCGTAATCATGCTAGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTTCAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCTCCCCCATTCCACACCTTTGAAGAACCCGCCTTTGTTCAAGTC------CAAGAAAGGAAGGAATCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGGCCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAAACCCAGCACATCTC-----CACTC--AAATATGGCTAACCACTCACAACTTAACTTCCAGGACGCCTCCTCCCCTATCATAGAAGAACTCATAGGATTCCACGACCACGCCCTAATGGTAGCACTAGCAATTTGCAGCCTAGTCCTCTACCTATTGACTCATATACTAACAGAAAAACTTTCATCAAGCACAGTCGATGCACAAGAAATCGAACTTGTTTGAACCATCCTCCCAGCTATAGTACTGGTAACACTCGCCCTCCCATCCCTGCGGATCCTCTACATAATGGACGAAATCAACGAACCAGACCTCACCCTAAAAGCCATCGGTCACCAATGATACTGAACCTACGAATACACCGACCTCAAAGACCTTACATTTGACTCTTACATGATTCCAACAGCAGACCTACCCCTAGGGCACTTCCGCCTACTAGAAGTTGACCATCGTGTTGTTGTTCCTATAAGCTCCACCATCCGAGTCATCGTCACCGCTGATGACGTCCTACACTCATGAGCCGTTCCAAGCCTGGGCGTAAAAACCGATGCAATCCCAGGACGCCTCAACCAAACTTCATTCCTTGCCTCCCGACCTGGAGTCTTCTACGGACAATGCTCAGAAATCTGCGGAGCCAATCACAGCTTCATACCAATCGTAGTAGAATCCACCCCACTCGCCAACTTCGAAAGCTGATCCTCTCTGA---TTACATCCT----------AATCATTAAGAAGCTATGAATCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGG----AATCCCCTCCTTAATGATATGCCTCAACTAAATCCAAGCCCCTGATTTTTTATCATGCTCACTTCATGACTCACTTTCTCCCTAATCATTCAACCAAAGCTATTAACATTCGTGACAATAAACCCTCCATCCAACAAAC---CTCCCATCGCCCCAAGCACAACCCCCTGAACCTGACCATGAACTTAAGCTTCTTCGACCAATTCTCAAGCCCATCCCTCCTAGGAATTCCCCTAATCCTCATTTCAATAACATTCCCAGCCCTATTACTACCCTCCCTAGATAACCGATGAATCACCAACCGGCTCTCCACCCTCCAACTATGATTCATCAACCTAGTCACAAAACAACTAATAATACCATTAAATAAAAAAGGCCATAAATGAGCCCTAATCCTAACATCACTAATAATCTTCCTCCTACTCATCAACCTTCTAGGCCTACTACCTTACACATTCACCCCAACCACCCAACTCTCCATAAACCTAGCACTAGCCTTCCCCCTGTGACTTGCCACCCTCCTGACAGGCCTACGAAACCAACCCTCCGCCTCACTAGGTCACCTCCTCCCAGAAGGCACCCCCACCCCCCTAATTCCCGCCCTAATCCTAATCGAAACAACAAGCCTACTCATCCGACCCCTAGCCCTAGGAGTACGCCTAACAGCCAACCTAACAGCAGGCCACCTACTCATCCAACTCATCTCCACAGCCACAACAACCCTCTTTACCACAATACCAATGGTTTCCCTCCTAACCCTACTAGTTCTTTTCCTACTAACAATCCTAGAAGTGGCAGTAGCTATGATCCAAGCCTACGTCTTCGTCCTACTACTGAGCCTCTACCTACAAGAAAACATTTAACAC------ACAATGGCACACCAAGCACACTCTTACCATATAGTAGACCCCAGCCCTTGACCTATCCTAGGAGCAGCCGCCGCCCTCCTCACTACCTCAGGACTAACAATATGATTCCACTACAACTCCCCTCGACTCCTAATCCTAGGACTACTCTCCACCCTCCTCGTCATATTCCAATGATGACGTGATATTGTACGAGAAAGTACATTCCAAGGCCACCACACCCCTACCGTACAAAAAGGATTACGCTACGGAATAGCCCTATTCATCACATCCGAAGCCTTTTTCTTCCTAGGATTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCAACACCAGAACTGGGGGGACAATGACCACCCGTAGGAATTAAACCCCTAAACCCCATAGAAGTCCCACTCCTAAATACCGCAATCCTCCTAGCCTCAGGAGTCACCGTCACCTGAGCCCATCACAGCATTACAGAAGCTAGCCGAAAACAAGCAATCCATGCCCTATCCCTGACAGTTCTCCTAGGATTCTACTTCACCGCCCTCCAAGCCATAGAATATTATGAAGCACCCTTCTCCATCGCAGATGGAGTCTACGGATCCACCTTCTTTGTCGCCACTGGATTCCACGGACTGCACGTAATCATTGGTTCCATCTTCCTGCTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACACCAAACCACCACTTCGGGTTTGAGGCTGCTGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTCTACATCTCTATCTACTGATGAGGATCCTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATT---AACATAATCCTGTTCATACTAACCCTATCACTGACCCTAAGCATCCTACTAACTATACTAAACTTCTGACTCGCCCAAATAAACCCCGACCCAGAAAAATTATCCCCATACGAATGCGGATTCGACCCCCTAGGATCTGCCCGACTACCCTTCTCCATCCGCTTCTTCCTAGTAGCCATCCTATTCCTCCTATTCGACCTAGAAATCGCCCTACTCCTCCCACTTCCATGAGCCACCCAACTACAATCCCCCACCACCACTCTAATATGAACTTCCTCCCTCATCCTCATCCTTACATTAGGACTAATCTACGAATGAATCCAAGGCGGACTAGAATGAGCCGAATA-A------AAGAAAGTTAGTCTAATTAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTTATGTCCTACCTACACTTAAGCTTTTACTCAGCCTTCACCCTAAGCGCCCTAGGATTAGCCTTCCACCGAACTCACCTAATCTCAGCCCTACTCTGCCTAGAAAGCATAATACTGTCCATATACGTCGCACTAGCCATATGACCCATCCACATACAAGCACCATCTTCTACCATCTTACCCATCATCATACTAACATTCTCTGCCTGCGAAGCAGGCACAGGACTAGCCCTACTAGTAGCCTCCACCCGAACTCACGGCTCAGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATTCCAACTGTAATACTCCTTCCCCTAACCTTCCTTTCTCCCCTCAAACACCTATGAACTAACATCACACTATATAGCTTACTAATCGCCACCCTCAGCCTACAATGACTCGCACCAACCTACTACCCAAACAAAGGCTTAACCCCCTGAACATCCATCGACCAAATCTCCTCCCCCTTACTAGTCCTCTCGTGCTGACTACTACCTCTCATGATCATAGCAAGCCAGAACCACCTAGAACCAGAACCCCCCATCCGCAAACGAGTATTCGCCACAACAGTAGTCCTAGCCCAACTATTCATCCTCCTAGCCTTCTCAGCCTCAGAACTCATACTATTCTACATCGCATTCGAAGCAACTCTAATCCCCACCCTCATCCTCATCACTCGATGAGGCAACCAACCAGAACGCCTGAACGCTGGCATCTACCTCCTATTCTATACGCTAGCCAGCTCCCTACCCCTTCTAATCGCCATCCTACACTTACAAAATCAAATCGGCACACTCTACCTCCCAATACTAAAGCTAGCACGCCCACCATTAGACTCCTCTTGATCCAATTTAGCAGTAAGCCTAGCCCTAATAATAGCCTTCATAGTCAAAGCCCCCCTATATGGACTACACCTATGACTACCCAAAGCCCATGTAGAAGCCCC?ATTGCTGGCTCCATACTACTAGCTGCCCTACTACTAAAACTAGGAGGATACGGCATCATACGAGTCACCATTCTAGTAAACCCATCATCAAACAACCTACACTATCCATTTATCACCCTAGCCCTCTGAGGAGCACTAATAACCAGCGCTATCTGCCTGCGACAAATCGACCTCAAATCACTAATTGCTTACTCCTCTGTCAGCCACATAGGACTAGTAGTAGCCGCAACCATAATCCAAACTCAATGAGCATTCTCAGGAGCAATAATCCTCATAATCTCGCATGGACTGACCTCCTCAATACTATTTTGCCTAGCCAACACCAACTATGAACGAACTCACAGCCGAATCCTCCTACTCACACGAGGTCTTCAACCCCTCCTACCACTAATAGCCACCTGATGACTCCTTGCCAACCTAACAAACATAGCCCTTCCCCCAACAACAAACCTCATAGCAGAACTAACCATCGTAATCGCACTATTCAACTGATCTGCCTTCACAATCATCCTAACAGGGGCCGCAATCCTACTTACAGCCTCATACACCCTATACATACTCATAATAACACAACGAGGCCCATTACCATCCCACATCACCTCCATCCAAAACTCCTCCACACGAGAACACCTATTAATAGCCCTACACATGATTCCTATAATACTACTAATCCTAAAGCCCGAACTAATTTCTGGCGTACCCATAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTC-AAACCAACGGGAACTGCTAACTCTCGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTT?AAAGGATAACAGTAATCCAATGGTCTTAGGAACC?CTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCAATAGTCCTAAACACATTCATACTCCTAACCCTAATCACACTATCCACCCCTATCCTATTCCCACTCCTATCCTCCCATCTCAAAAACACCCCTGACATCATCACAAATACAGTCAAAGCCTCTTTCTTAATCAGCCTAATCCCCATAACAATCTTCATCCACTCAGGCACAGAAAGCCTAGTTACCCTATGAGAATGAAAGTACATCATAAACTTTAAAATCCCTATCAGCCTAAAAATAGACTTCTACTCCCTCACCTTCTTCCCCATCGCACTATTCGTATCATGATCAATCCTGCAATTCGCAACATGATACATAGCCTCAGACCCATACATCACAAAATTCTTCACCTTCCTACTATTCTTCCTAATCGCAATACTTATCCTAATCATCGCCAACAACCTATTTGTCCTATTTATCGGATGAGAAGGGGTTGGAATCATATCCTTCCTACTTATCAGCTGATGACACGGGCGAGCAGAAGCCAACACTGCAGCCCTACAGGCCGTCCTCTACAACCGAATCGGAGATATCGGCCTCATTCTATGTATAGCCTGACTAGCCTCCACTATAAACACTTGAGAAATCCAACAACTCTCCACCCCATCCCAAACCCCCACACTACCTTTACTAGGCCTAATCCTAGCTGCAACCGGCAAATCAGCCCAATTCGGCCTACACCCATGACTACCTGCCGCCATAGAAGGCCCAACCCCCGTGTCAGCCCTACTCCACTCCAGCACAATAGTAGTAGCTGGAATTTTCCTACTAATTCGAACCCACCCCCTATTCAACAACAACCAGACCGCCCTAAGCCTATGCCTCTGCTTAGGCGCACTATCTACACTATTCGCAGCCACTTGCGCCCTAACCCAAAACGACATCAAAAAAATCATCGCCTTCTCCACTTCAAGCCAACTAGGCCTCATAATAGTCACAATCGGACTAAACCTACCAGAACTAGCCTTCCTCCATATCTCTACTCATGCATTCTTCAAAGCCATACTATTCCTATGCTCAGGCTCAATCATCCACTGCCTAAACGGAGAACAGGACATCCGAAAAATAGGAGGCCTCCAAAAAATATTACCTACAACCACCTCATGCCTTACTATCGGAAACCTAGCCCTAATAGGAACTCCATTCCTAGCCGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAATACTTCCTACCTAAACACCTGAGCCCTCATCCTAACACTGCTCGCCACCTCATTCACCGCAGTCTACACAATCCGCATGACCGTACTAGTTCAAACCGGTTTCACTCGGATTTCACCCCTGACCCCAATAAACGAAAACAACCCCGCAGTAACCTCCCCAATTACCCGTCTTGCACTAGGAAGCATCCTAGCAGGATTCATCCTCACCTCATTCATCATCC---CTACAAAAACCCCCACAATAACCATACCCACCTCCATCAAAATAACCGCCTTAATGGTAACAGCCCTAGGCATTGCCCTAGCACTAGAAATCTCAAAAATAACCCAAACCCTTATCCTAACGAAACAAACCCCATTCTCAAACTTCTCCACATCACTAGGATATTTCAACCCCCTAGTCCACCGCCTCCACATAACCAACTTCCTTAGCGGAGGACAAAACATTGCTTCCCACCTAATCGACCTCTCCTGATACAAAATACTAGGACCAGAAGGACTAGCCCATCTACAACAAATAATAACCAAAGCCACAACCTCCCTCCACTCTGGCCTCATCAAAGCTTATCTAGGGTCATTCGCCCTATCCATCATCATCTTCCTCA---TATCCACCTACAGAAA--TTA-A-C---AATGGCACCCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAACGACGCTCTAATCGATCTCCCCACACCATCGAACATCTCAACATGATGAAACTTCGGATCCCTACTAGGCATCTGCCTAATCACCCAAATCATCACCGGCCTACTACTAGCCACACACTACACGGCAGACACCAACCTAGCCTTCTCCTCCGTTGCCCACATGTGCCGAGACGTCCAATATGGTTGACTAATCCGAAACCTACATGCTAATGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGG?AT?TACTACGGCTCATACCTAAACAAAGAAACTTGAAACGTTGGAGTCATCCTTCTACTAACCCTTATAGCAACCGCCTTCGTAGGTTACGTCCTACCATGAGGACAAATATCCTTCTGAGGGGCCACCGTTATTACAAACCTATTCTCTGCAATCCCCTACATCGGCCAAACACTAGTCGAATGAGCCTGAGGAGGATTCTCCGTAGACAACCCCACCCTAACCCGATTCTTTGCTCTCCATTTCCTCCTCCCTTTCGTAATCGTAGGACTCACACTAGTACACCTCACCTTCCTACACGAAACAGGATCAAACAACCCAATAGGAATCCCCTCAGACTGTGACAAAATCCCGTTCCACCCCTACTACACCATCAAAGACATCCTAGGGTTCGCAATAATACTTGCCCTACTTGTCTCACTAGCCCTATTCTCCCCCAACTCACTAGGAGACCCAGAAAACTTTACACCAGCCAACCCCTTAGTAACACCCCCACATATCAAACCTGAATGATACTTCCTATTCGCATACGCCATCCTCCGATCCATCCCTAACAAACTAGGAGGTGTACTAGCCCTAGCTGCCTCAATCCTCGTACTATTCCTCCTCCCCCTACTCCACACATCTAAACTCCGATCAATAACCTTCCGACCCATCTCACAAATCCTCTTCTGAGCCCTAGTTGCAAACGTCCTAGTATTAACCTGAGTTGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCACTCTCCTACTTCACAATTATCCTAATTCTATTCCCCCTCGCGGCCATCCTAGAGAATAAACTACTAAAGCT----------CTA-ACT-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Garrulax_canorus_NC_020429 GTCCTTGTAGCTTATGC-AAAGCATGGCACTGAAGATGCCAAGATGGCTGT--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTGTTGCCAGATTTATACATGCGAGTATCCGCGATCCAGTG-CGTATGCCCTAGGTACCCT---AATTTT-----AGGTCGATAGGAGCGGGCATCAGGCACACCCA-----CAC-A--AGCGTAGCCCAAGACGCCTAGCAATTGCCACACCCCCACGGGCATTCAGCAGTAATTAATATTAAGCAATGAGTGTAAACTTGACTTAATCATGGCAAT-C---TAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGCGTGGTCGC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGTCGTCACAAGCTAAAGATGC-GTACAAGGCCTCT--ATTCAAAGAAAATCTTAGACT--AACGATCGATTGAAG-CCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TGA--TCTAACCGGAGCATCCGCCTGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCTCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA-AAA--CAGCCTATATACCGCCGTCTCCAGCCCACCCTCC--ATGAAGGCCCAACAGTGGACGCAATAG-CCACA-CCGCGCTAGTAAGACAGGTCAAGGTATAGCCCATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAGATTAGAACA-T----GACGGCAAAGGCACATGAAATTGTACCTAGAAGGCGGA-TTTAGCAGT-AAAGAGGGATTAGCGAGCCCTCTTTAAGCCGGCTCTGGAGTGCGTACATACCGCCCGTCGCCCTCCTCAAAAG-CG---ACCCCCAAACCCCATAAA-TAATAAGTTTC-TC--AGCCAAAGAGGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGACA-CCAAGACGTAGC-TTAAGCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTC-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCC-ACA-TG------ACATGGA-ATAAC--AAAGCTACT---C-ACAACACTT----AACCAAAGCATT---T--GCTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATAAAAATG-AAAAACCC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCGAGCGAGCTACCTATGAGCAGCTAT-T-GTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTAGGTAGAGGTGAAAAGCCAAC-CGAGCCGGGTGATAGCTGGTTGCCTGTGAAACGAACCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC---TCAAAACCCCA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAAAACAATCTCCA-CGAGCGGATA----AGT--AAACACCCCAAATAAA-TACCCTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTGC-ACC-CAAAAATATCGA-ATCCATATGACTCCCT-CCCCACTAACGGGCTAACCTATAGTTCAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--TC-TCCCTCT----TCGACGCAAGCTTACATCAGTA-CATTATTAACAAG-CACCCA-ATATACGA--CAAAT---------CCA---ACAAGCA-GAG-TATTA-TCCACC-TTGTTAACCCGACAAA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCC---AGGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCAAAAGACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACAT--A----GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATGGGGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATATACCCATAAGACGAGAAGACCCTGTGGAACTTCAAAAGCAGCAGCCACC--CCAAAT-TACATA----CC-AACCCA--CCC-GGGCTCACTTAC----CTAACGGGCCACTGGCT-TGCACTTTTTCGGTTGGGGCGACCTTGGAGCAAAGC-AAAACCTCCAA-ATCTTGGACCTCACATCTAGACTA-AGAGCGACCTCTCAACGTGCTAACAGCAACCAGATCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCAAGAGTCCATATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCAGCTACTAAGGGCTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AGCTCTTCCCAGTACGAAAGGATAGGAA-AAGCGAGGCCAATACTACAG-GCAAGCCTCC-GCCTTAAGTAATGAAGTCAACTAAATTACGAAAGGCTATCACCCCCCC---CCCCCCCGTCCTAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTTAAC----------TCACCT--C----ATGAC----------CAAATACCCCCTCCTAATCAACCTCATCATAGCCCTCTCCTATGCCCTGCCCATCCTAATCGCAGTGGCCTTTCTTACACTAGTTGAGCGCAAAATCCTAAGCTACATGCAAAGCCGTAAAGGCCCTAACATCGTCGGCCCATTTGGCCTACCTCAACCATTGGCCGACGGAGTAAAACTGTTCATCAAAGAGCCAATTCGCC---------CCTCAACATCTTCCCCATTCCTATTCATAGCTACCCCAATACTAGCCCTTCTCCTCGCAATCTCTATCTGAACCCCACTCCCCCTACCGTTCCCACTTGCAGACCTCAACCTCGGCCTCCTCTTCCTACTAGCCATGTCCAGCCTAGCAGCCTACTCCATCCTATGATCTGGCTGAGCATCCAACTCAAAATACGCACTAATCGGGGCCTTACGCGCAGTAGCACAGACCATCTCCTATGAAGTCACCCTAGCAATTATCCTCCTATCTATCGTCTTACTGACAGGGAACTACACACTCAGCACCCTTGCAACTGCCCAAGAACCCCTATATCTCATCTTCTCCTGCTGGCCACTAGCAATAATATGATACGTATCAACCTTGGCTGAAACAAACCGAGCCCCATTTGACCTAACAGAAGGAGAGTCCGAACTAGTCTCCGGATTCAACGTAGAATATGCAGCAGGCCCATTCGCCCTCTTCTTCCTAGCCGAATACGCCAACATCATACTAATAAACACACTCATTGCCATCTTGTTCTTCAACCCGAGCCTATTCGACCTCCCCCAAGAGCTCTTTCCCCTGGTACTAGCCACAAAAACCCTACTATTATCAGCAGGCTTCCTATGAATCCGTGCCTCCTATCCACGATTCCGATATGACCAGCTGATACACCTCCTGTGAAAAAACTTCCTTCCACTCACACTAGCCCTGTGCCTATGACACGTCAGCATGCCAATTTCCTACGCAGGCCTGCCG-----CCATACCTA-A--GGCTC-----------ACAGAGGAAATGTGCCTGAACGTCT--AAGGGTCACTATGATAAAGTGAACATAGAGGTACACCAGCCCTCTCATTTCCT-A--CGCC-------TTAGGAAAGCAGGAATTGAACCTGCACTAGAGAGATCAAAACTCTCTATACTTCCTTTATATTATTTCCT----------------AGTAGGGTAAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGGCCCCACAAGCAAAACTAATCTTCGCATTCAGCCTACTCCTAGGCACCACCATCACAATCTCAAGCAACCACTGAATCA---TAGCCTGAGCTGGCCTAGAAATCAACACCCTTGCCATCCTTCCATTAATCTCAAAATCCCACCACCCCCGAGCCATCGAAGCTGCGACCAAATATTTCCTGACTCAAGCAGCCGCCTCCGCCCTAGTGCTATTCTCCAGCATAACCAATGCATGGCACACCGGACAATGAGACATCACCCAGCTAACACACCCAACATCATGCCTCATCCTAACTTCAGCCATCGCAATAAAACTCGGCCTGGCCCCTTTCCACTTCTGATTCCCTGAAGTACTCCAAGGCTCTCCCCTGATCACAGGCCTCCTCCTCTCCACAGCTATAAAATTCCCACCAATCACCCTTTTATTTATAACCGCGCCATCATTAGACCAGACTCTTCTCGTATGTATGGCCATCCTCTCAACAGCCCTAGGGGGCTGAATAGGACTGAACCAAACACAAATTCGGAAAATCCTTGCATTCTCCTCCATCTCGCACCTAGGTTGAATAGTTATCGTCATCTCCTACAACCCCAAACTCACCCTGCTGAACTTCTACCTATACGCCCTGATAACTGCAACCGTGTTCCTAGCCCTAAGCTCAATCAAAACCTTAAAACTATCAACTCTAATAACCACATGAACAAAAACCCCAGCACTAAGCGCTATACTGCTTCTAGCCCTTCTTTCCCTCGCAGGACTACCGCCTCTAACCGGCTTCCTGCCAAAATGACTTATTATCCAAGAACTAACCAAACAAGACATAGCCGCAGCAGCAATTATGATCTCCCTCCTCTCCCTGCTCAGCCTGTTCTTCTACCTCCGCCTAGCGTACTGCGCCACAATCACACTCCCCCCACATACCACAAACCACATAAAACAATGACGAACTAACAGCCCAACCAGCACCATCGTCGCCGTCCTAGCCATCACATCAACCGCACTGCTCCCAATCTCCCCTATCATCCCCACCATCAC------CT----AAGAAACTTAG----GATTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTGAAACCCTCTTAGTTTCTGCTAAGATCCGCAGGACACTACCCTGCATCTTCTGAATGCAACCCAGACACTTTAA-TTAAGCTAGGACCTT-ACTCAC-CACACTAGGCAGATGGGCTTCGATCCCACAATAA-TGTAGTTAACAGCTACATGCCCCAACC-AACAGGCTTCTACCT-AT------------AGACCCCGGCGCAGG--TTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGGGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATTCACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGACTCTTTTCAACCAACCACAAAGACATTGGCACCCTCTACCTAATCTTCGGCGCATGAGCCGGGATGGTAGGCACCGCCCTGAGCCTGCTCATCCGAGCAGAATTAGGGCAGCCAGGCGCCCTCTTGGGAGACGACCAAGTCTATAACGTAATCGTCACAGCCCACGCTTTCGTAATAATCTTCTTCATGGTCATACCAATCATAATCGGAGGATTCGGCAACTGACTAGTCCCCCTAATAATCGGGGCCCCCGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTACTCCCTCCATCCTTCCTACTACTCTTAGCCTCATCCACAGTAGAAGCAGGAGCAGGAACAGGCTGAACAGTATACCCTCCCCTAGCCGGCAACCTAGCCCACGCAGGGGCCTCAGTCGACCTAGCTATCTTCTCCCTACACCTGGCAGGAATCTCATCCATCTTAGGGGCAATCAACTTTATCACAACAGCCATCAACATAAAACCACCCGCCCTCTCACAATACCAAACCCCCCTATTCGTCTGATCAGTACTAATCACTGCAGTCCTCCTCCTACTTTCCCTCCCAGTCCTCGCTGCAGGCATCACAATACTCCTCACAGACCGCAACCTAAACACCACCTTCTTCGACCCAGCAGGGGGAGGCGACCCAGTCCTCTACCAACACCTCTTCTGATTCTTTGGGCACCCCGAAGTGTACATCCTAATCCTACCAGGATTTGGCATCATCTCGCACGTCGTAGCCTACTACGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTGTGAGCTATGCTTTCCATCGGATTCCTAGGCTTTATCGTATGAGCCCACCACATATTTACGGTAGGAATAGACGTAGACACTCGAGCATATTTCACATCCGCTACAATAATTATCGCAATCCCCACAGGCATTAAAGTGTTTAGCTGACTAGCAACACTGCACGGAGGAATTATCAAATGAGATCCCCCTATACTATGAGCCCTAGGCTTCATCTTCCTATTCACCATCGGAGGTCTAACAGGCATCATCCTAGCAAACTCCTCCCTAGACATCGCCCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGCGCAGTATTTGCAATCCTAGCTGGCTTCACACACTGATTCCCATTATTCACTGGATATACACTTCACTCCACATGAGCCAAAGTCCACTTTGGGGTAATATTCGTAGGTGTCAACCTCACTTTCTTCCCACAGCACTTCCTAGGCCTAGCAGGCATGCCACGACGCTACTCTGACTACCCCGACGCCTACACGCTATGAAACACCATCTCTTCAGTAGGATCGCTGATCTCCATAACAGCTGTAATCATGCTAATGTTCATTATTTGAGAAGCCTTTGCATCCAAGCGCAAAGCCCTACAACCAGAACTAACAAGCACAAACGTCGAATGAATTCACGGCTGCCCGCCCCCATTCCACACTTTCGAAGAACCCGCCTTTGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACCTATGCTTCTTTCTC---ATA--AGGGGCGTTAGTAAAAACA-ATTACATAG-CCTTGTCAAGGCTAAATCACAGGTGAAAACCCCGTACGCCCCAA---CACTC--AAACATGGCCAACCACACACAACTCGGTTTCCAAGACGCCTCCTCCCCTATCATAGAAGAGCTCCTCCGATTCCACGACCACGCCCTAATGGTCGCCCTAGCTATCTGCAGCCTAGTTCTCTACCTCCTATTCGTCATACTTACCCAAAAACTATCATCAAGCACAGTAGACGCACAAGCAATTGAACTAATCTGAACAATCCTGCCGGCTGCCGTACTTGTAACCCTTGCTCTCCCATCACTACGAATCCTATATATAATAGACGAAATCAACCAACCAGACCTCACCCTAAAAGCTATTGGTCATCAATGATACTGAAGCTACGAGTACACCGACTTCAAGAACCTCACATTCGACTCCTATATAATCCCCACAACAGACCTCCCGCTAGGACACTTCCGACTCCTAGAGGTAGACCACCGAGTAATAGTTCCAACTGAATCTACCGTCCGAGTCATCGTTACCGCCGACGACGTCCTACACTCATGGGCCGTCCCCAGCTTAGGCGTAAAAACCGACGCAATCCCAGGACGCTTAAACCAAACTTCATTCCTAGCCCCCCGACCTGGCGTATACTACGGCCAATGCTCAGAAATCTGTGGAGCAAACCACAGCTTCATGCCTATCGTAGTAGAAGCTATTCCACTCGCCAGCTTTGAAAATTGATCCTCTCTAA---CATCATCCT-----------AACGTTAAGAAGCTATGAAACAGCGCTAGCCTTTTAAGCTAGAGAAAGAGGGAC-CCACCCCCTCCTTAATGATATGCCACAACTGAACCCTGCTCCTTGATTTTTTATCATAGTCTGCACATGACTAACATTCGCCCTAATCATCCAACCTAAACTTCTGACCTTCGTATCCGCAAACCCACCATCCAGCAAAA---CCACAACAACCCACAGCACTACCCCCTGAAACTGACCATGAACCTAAGCTTCTTTGACCAATTCTCAAGTCCCTCCCTCCTAGGAATCCCCCTAATCCTCATCTCCCTAACATTCCCAGCCCTACTCCTACCATCTCTAGACAACCGATGAGTAACCAATCGACTCTCAACCCTCCAACTATGGCTTGTCAACCTTATCACAAAACAACTGACAACCCCACTAAACAAAAACGGACACAAATGAGCACTAATCCTGACCTCACTAATAATCTTCCTGCTACTAATCAACCTCCTAGGCCTACTACCCTACACTCTCACCCCCACCACCCAGCTATCCATAAACCTAGCCTTAGCCTTCCCCTTATGGCTAGCCACCCTCCTCACTGGCCTACGAAACCAACCCTCTACTTCCCTAGGACACCTACTACCAGAGGGAACCCCAACTCCACTAATCCCCGCCCTCATTCTGATCGAAACTACAAGCCTCCTTATCCGCCCTCTAGCACTAGGAGTACGCCTAACAGCAAACCTCACAGCAGGTCACCTCCTCATTCAACTTATCTCTACAGCCACAGTCGCTCTTTTCACAACAATGCCTATAGTCTCTCTCCTAACCTTCTTGGTCCTCTTCCTACTTACAATCCTAGAAGTCGCCGTAGCCATAATCCAAGCCTACGTCTTCGTACTACTACTAACCCTATACCTCCAAGAAAACATCTAACCA-------CAATGGCACACCAAGCACACTCTTACCACATAGTAGACCCAAGCCCATGACCTATCTTCGGAGCAGCCGCCGCCCTCCTTACCACCTCCGGCCTAACCATGTGATTCCACTACAACTCTCCCAATCTCCTAATCATTGGTCTTCTCTCCACCCTCCTAGTGATGTTCCAATGATGACGGGACGTCGTACGAGAAAGCACGTTCCAAGGCCACCACACCCCAACCGTCCAAAAGGGGCTACGATACGGAATAATCCTATTCATCACCTCCGAAGCTTTCTTCTTCCTAGGGTTCTTCTGGGCATTCTTCCACTCAAGCCTAGCCCCCACCCCAGAACTAGGAGGACAATGACCCCCCGTAGGAATCAAGCCCCTCAACCCCATGGAAGTACCACTACTAAACACCGCCATTCTACTAGCCTCAGGCGTCACCGTCACATGAGCCCACCACAGCATTACAGAAGCACGTCGAAAACAGGCAATCCACGCCCTCACCCTCACAATCCTCCTAGGCTTCTACTTCACCGGACTCCAAGGCATAGAATACTACGAAGCTCCTTTCTCCATCGCAGACAGCGTCTACGGCTCAACCTTCTTTGTCGCCACAGGATTCCACGGACTCCATGTAATCATCGGCTCTACCTTCCTAACAGTATGCCTCCTACGCCTAATTAAATACCACTTTACACCAAACCACCACTTCGGCTTCGAAGCGGCAGCCTGATATTGACACTTTGTAGATGTAGTCTGACTATTCCTCTACATAACCATCTACTGATGAGGATCATACTCTTCTAGTATAGCC-ATTACAATCGACTTCCAATCCTTAAAGTCTGGTGCAACCCCAGAGAAGAGTAATG---AACATAATCACATTCATAATCACCCTATCCCTAACTCTAAGCCTTCTCCTAACCGCACTAAACTTCTGAATTGCCCAAATAAACCCAGACTCAGAAAAACTATCTCCATACGAATGCGGCTTCGACCCACTAGGCTCCGCCCGACTCCCCTTTTCAATCCGATTTTTCTTGGTAGCCATCCTATTCCTGCTATTCGACCTAGAAATCGCCCTCCTACTCCCCCTCCCATGAGCCACCCAGCTCCAAGACCCCATCACCACACTAATCTGGACCTCCATCCTAATCCTCCTCCTCACCCTAGGACTAGTATACGAATGAATTCAAGGGGGACTAGAATGAGCAGAATA---------AGCAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAGATTATAGCTCACACCCTATAACTTTCTTCATGACCCTATTACACTTAAGCTTCTACGCCGCCTTCACCCTAAGCAGCCTAGGCCTAGCCTTTCATCGAACTCACTTAATCTCAGCCTTACTATGCCTAGAGAGCATGATACTATCTATGTACGTTGCCCTATCCATGTGGCCAATCCAAACACAGACACCATCTCCCGCTCTCCTACCCATCTTCATACTCACTTTCTCCGCTTGCGAGGCAGGCACGGGACTTGCTCTACTTGTCGCCTCTACACGGACTCACGGTTCCGACCACCTCCACAACTTCAACCTACTCCAATGCTAAAAATCATCATCCCCACTATCATACTCCTCCCTCTAACCCTCCTCTCCCCCCGCAAACACCTGTGGACCAACACCACAATATACAGCCTACTAATTGCCACCCTCAGCTTACAATGACTAGTGCCTACCTACTACCCATATAAATGCCTATCTCACTGAACCGCTGTCGACCAAATTTCCTCCCCACTACTAGTCCTATCCTGCTGACTCCTTCCCCTCATGCTCATAGCAAGCCAAAACCACCTGGAACAAGAACCAACCACCCGTAAACGAATATTCATCACAACCGTAGTCCTAGCCCAACCGGCCATCCTCCTAGCCTTCTCAGCCTCAGAGCTCATACTCTTTTACATCGCATTTGAAGCCACCTTAATCCCCACCCTAATCCTCATCACCCGATGAGGCAACCAGCCGGAGCGACTAAACGCTGGCATTTACCTCCTATTCTACACACTAGCCAGCTCGCTCCCATTACTAATTGCTATCCTCCACCTACACAACCAAATCGGCACTCTGTACTTCCCAATACTAAAACTCTCTCACCCAGCAGTAGCAACATCCTGGTCAAGCCTAGTAGCCAGCTCAGCCCTACTCATCGCCTTCATAGTCAAAGCCCCCCTATACGGCCTACACCTATGACTACCAAAAGCTCACGTAGAGGCCCCAATCGCCGGCTCTATACTTCTAGCCGCCCTCCTCCTAAAACTCGGGGGCTACGGCATTATACGATTCACCACCCTAGTAAACCCCACACTGAATAACCTTCACCACCCATTCATTACCCTCGCTCTGTGAGGAGCACTAATAACCAGTGCCATCTGCCTGCGACAAATCGACCTAAAATCTCTAATTGCCTACTCATCCGTCAGCCACATAGGCCTGGTCATCGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCGCACATGGCCTAACTTCATCAATACTATTCTGCCTAGCAAACACCAACTACGAACGAACACACAGCCGAATTTTACTACTAACCCGAGGCCTTCAGCCCATTCTCCCCCTCATAGCCACCTGATGACTACTAGCTAACCTAACAAACATAGCCCTCCCCCCAACAACCAACCTCATAGCAGAACTAACTATCATTACTGCACTCTTCAACTGGTCATCAATGACAATCCTCCTCACAGGAACTGCAATCCTACTAACTGCCTCATACACCCTGTACATGCTAATAATAACTCAACGAGGAGCCCTCCCATCCCACATCACATCCATCCAAAACTCCTCTACACGAGAGCACCTCCTCATGTCCTTACACATAATCCCAATGATCCTTCTCATTCTCAAACCAGACCTTATCTCCGGCGTCCCCATAT-GCAGGTATAGTTT-CAA-CCCAAACATTAGATTGTGATTCTAAAAATAGAAGTTAAAATCTTCTTACCTGCCGAGGGG-AGGTT-TAACCAACAGGAACTGCTAATTCTTGCATCTGAGTATAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAGTAGTAATCCAATGGTCTTAGGAGCCACTCACCTTGGTGCAAATCCAAGTGAAAGT--AATGGATCTATCCCTAATCCTGATCTCCTCCATACTACTCACCCTAACCGTCCTTATTTCTCCCATCATCCTCCCCCTCCTATCAGACAAACTGAAAAACACCCCTGCCATCATCACAAAAACAGTAAAAACCTCCTTCTTAATCAGCCTGATCCCAATAACAATCCACATCTACTCGGGCACAGAATGCCTCCTGACCCTATGAGAATGAAAGTTTATCATAAACTTCAAAATCCCCATCAGCCTAAAGATGGACTTCTACTCCCTCACTTTCTTCCCAATTGCCCTATTCGTATCATGGTCCATCCTACAATTTGCAATATGATACATAGCTTCAGACCCCCACATCACAAAATTCTTCACCTACCTCCTACTCTTCCTAATCGCAATGCTCATCTTAATTCTCGCCAACAATCTGTTTATCCTCTTCATCGGCTGAGAAGGAGTAGGAATCATATCCTTCCTCTTAATCAGCTGATGACACGGCCGGGCAGAAGCTAATACTGCAGCCCTCCAAGCCGTACTTTACAACCGAGTCGGCGACGTGGGCCTCATCCTCTGCATAGCTTGATTAGCCTACACCACAAACACCTGAGAAATCCACCAACTCACCTCTCCACAACAAACCCCAACCCTCCCCCTCCTAGGCCTCATCCTGGCCGCAACAGGCAAATCCGCCCAATTCGGCCTACACCCCTGACTACCAGCTGCCATAGAAGGACCAACCCCTGTATCCGCCCTACTCCACTCCAGCACCATAGTGGTCGCCGGAATTTTTCTACTCATCCGAACCCACCCACTACTCAACAACAACCAAACTGCCTTAACCCTCTGCCTATGCCTTGGTGCTCTCTCAACCCTGTTTGCAGCCACATGCGCTCTAACACAGAATGACATTAAAAAAATCATTGCCTTCTCCACATCAAGCCAACTGGGCCTAATAATAGTTACAATCGGACTAAACCTACCACAACTAGCCTTCCTGCACATCTCAACCCACGCATTCTTCAAAGCCATACTATTCTTATGCTCCGGTTCCATCATCCACAGCCTAAACGGTGAACAAGACATCCGAAAAATAGGCGGCCTGCAAAAAATACTACCAACAACCACCGCATGCCTTACCATCGGCAACCTAGCCCTGATAGGAACCCCCTTCCTTGCAGGCTTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACCTCCTACCTAAACACATGAGCCCTAACCCTAACTTTACTAGCCACATCATTCACCGCAGTCTACACAATCCGCATAACTGTGCTAGTACAAGCCGGCTCCGTACGAATCCCTCCTCTTACCCCAATAAACGAAAACAACCCCATAGTAACCTCTCCAATCACTCGACTCGCCCTAGGAAGCATCACAGCAGGATTTTTCATTACCTCCTACATCCCCC---CTGCAAAAACACCGCCCATAACCATACCACTCTCAATCAAAATTACAGCTTTGGCAGTTACAGCCCTCGGCATTGCTATCGCGCTAGAACTATCAAAAATGTCCCAAACCCATATCCTCACGAAACAAAACCCGCTATACAACTTCTCCATCTCACTAGGATACTTCAACCCCCTAACCCACCGCCTCACCATAACAAACCTCCTGGCCGGGGGCCAAAACATTGCCTCACACTTAGTAGATCTTTCTTGATTAAAGCTCCTAGGACCAGAAGGACTAGCCAGCTCACAACTAACAATAACCAAAGCTGCAACCTCCCTACACTCTGGCCAAATTAAAGCCTACCTAGGAACCTTCGCCCTATCCATTCTCCTCCTCCTGA---TATCCACATACAGAAC--CCACC-----AATGGCCCCAAATCTTCGTAAAAACCACCCATTACTAAAAATCATCAACGATGCTCTAATCGACCTCCCAACACCATCCAACATCTCAACCTGATGAAACTTCGGCTCCCTACTAGGCATCTGTCTAATCACACAAATCGTCACAGGCCTACTACTTGCCATACACTACACAGCAGACACCAACCTAGCCTTCGAATCTGTCGCTCACATATGCCGAAACGTTCAATTCGGCTGACTAATCCGGAACCTACACGCAAATGGAGCTTCATTCTTCTTCATCTGCATCTATTTCCACATCGGCCGAGGATTTTACTACGGCTCCTACCTAAACAAAGAGACATGAAACGTCGGAGTCCTCCTCCTACTAGCCCTCATAGCCACTGCCTTCGTAGGCTACGTCCTACCCTGAGGCCAAATATCATTCTGAGGTGCCACAGTAATCACAAACCTATTCTCAGCAATCCCATACATCGGACAAACCCTAGTAGAATGACTATGAGGTGGATTCTCGGTAGACAACCCCACCCTAACTCGATTCTTCGCCATTCACTTCCTCCTCCCATTCGTCATCGCAGGACTCACATTAGTCCACCTCACCTTCCTACACGAAACAGGGTCAAACAACCCCCTAGGAATCCCTTCAGACTGCGACAAAATCCCATTCCACCCCTACTACTCCATCAAGGACCTCCTAGGATTCGTGCTAATATTCATCCCCCTAGCCTCTCTGGCCCTGTTCGCCCCCAACCTCCTAGGAGACCCAGAAAACTTCACACCAGCTAACCCTCTAGCAACACCACCACACATCAAACCCGAGTGATACTTCCTATTCGCCTACGCCATCCTCCGATCTATCCCAAACAAACTAGGAGGCGTCCTCGCCCTAGCCGCCTCAGTCCTAGTCCTATTCCTCATCCCCCTTTTACACACATCAAAATTACGCTCAATGACTTTCCGCCCTCTCTCACAAATTCTCTTTTGAACCCTAGTAACCAACCTCCTCATCCTCACTTGAGTAGGGAGCCAACCAGTAGAGCACCCCTTCATCATCATTGGCCAATTAGCCTCAATCTCCTATTTCACAATCATTCTAGTCCTCTTCCCCCTCGTATCAATCCTAGAGAACAAAATATTAAAACT----------ATA-A-------------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTACGCCCCTTCTTAGAGTT Garrulus_glandarius_NC_015810 GTCCATGTAGCTTACAACAAAGCATGACACTGAAGATGTCAAGACGGCTGC--CACA-AACACCC-ATGGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCTAGACATATACATGCAAGTATCCGCGTTCCAGTG-TAAATGCCCTAGGCA-CCCTTTAACC-------AAGTCGATAGGAGCGGGCATCAGGCACA---------CAC-A--ATTGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTACTCAGCAGTAGTTAACATTAAGCAATGAGTGTAAACTTGACTTAGTCATAGCAATTC---TAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGGGTGGTAAC-ATGCTAT-CTAAGTAACTAAGATTAAAAAGCAACTGAGCTGTAGCAAGCCCAAGATGC-TCATAAGGCCAAC--TACCAAAGAAGATCTTAGGCT--GACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGACACT-CTA--TGCTACCTGAGTGTCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCATTCCTCGC-CCG--AT--CAGCCTACATACCGCCGTCGCCAGCCCACCCCCC--CTGATGGTTCAACAGTGAGCGCAATAGTCCCTA--CCCACTAGTAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAGATTAGAACA-T----TACGGCAAAGAGGTCTGAAACGGCCTCTAGAAGGCGGA-TTTAGCAGT-AAAGAGAGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGACACGTACATACCGCCCGTCACCCTCCTCACAAG-CG---ACCAAACCCCTTAATACATTAATACGCTAC-TC--AGCTAAAGAGGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGTACTTAGACAA-CCAAGACGTAGC-TTAAACA-AAAGCACTCAGCTTACACCTGAGAGATACCTGCTA-ACAACAGATCGTCTTGA-TGCCAAATTCTAGCCC--------AACAT-ACATTG------ACCTGGA-ATAAC--AAAGCTACT--CC-ATA-CACCA----AACTAAAGCATT---T--ACTAGT-CTTAGTATAGGCGATAGAAAAGACACCCA-TTGGC-GCGATAGAGAT-TACGTACCGTAAGGGAAAGATGAAATAATAGTG-AAA-AAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTGTGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTACTAGTAGAGGTGAAACGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-CAACAGAACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA---------AATAATCTTTAGAAAGATCTACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTCT-ACCTAAAAAATATATA-AACTACATGACTCCCT-CATCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAA-TCACCA-AGATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATCA-AGTATA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACACATCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACAACAA-ACAAGTATTGAAGGTGATGCCTGCCCTGTG--ACTT-CGT---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCTCATAAATCGAGACCTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAACAACATAAGACGAGAAGACCCTGTGGAGCTTAAAAATCAGCAGCCACC--CCACAA-CACA---------CACCCA--C-T-GGGTTCACGCTTTATA-----AG-CTACTGGCC-TGCA-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AGATCCTCCAA-AAATTAGACCAAAACTCTAGACTG-AGAGCGACCACTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGTTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGACG-AACTCTTCCCAGTACGAAAGGACAGGAA-AAGTGAGGCCAATACTTCAA-GCAAGCCTTC-GCCTTAAGTAATGAATTCAACTAAATTACGAAAGGCTATCAC-ACCAT---TACCA-CGTCCTAGAAAAGGACAC-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAAAT----------ATAA---------ATGGC----------CAACCACCCCATATTAGTAAACCTCATTATAGCCCTCTCTTATGCTGTCCCCATCCTAATTGCCGTAGCCTTCTTAACCCTAGTAGAGCGAAAAATCCTAAGTTACATACAAGGTCGAAAAGGACCTAATATTGTAGGCCCATTTGGGCTCCTTCAACCCGTAGCAGATGGAGTAAAACTATTCATCAAGGAACCCATCCGCC---------CATCAACATCCTCTCCAATCCTATTCACCATTACTCCAATACTAGCCCTCCTGCTAGCAATCTCCATCTGAACCCCCCTCCCAATACCATTTCCCCTAGCAGACCTCAACCTCGGACTACTATTCATACTGACTATGTCAAGCCTAGCAGTATACTCCATCTTATGATCTGGCTGAGCTTCTAACTCAAAATATGCCCTAATTGGAGCGTTACGAGCAGTAGCTCAAACAATCTCCTACGAAGTAACTCTAGCAATTATCCTACTATCCATTATTCTCCTTAGCGGAAACTACACTCTAAGTACCCTAGCAACTACCCAAGAACCTCTATATCTGATTTTCTCCTGCTGACCCCTTGCTATAATGTGATACGTATCCACATTAGCCGAAACAAATCGCGCCCCATTTGACCTCACAGAAGGAGAATCAGAACTAGTCTCAGGGTTTAACGTAGAATATGCAGCAGGACCATTTGCCCTATTCTTCCTAGCAGAATACGCAAACATCATACTTATAAACACACTGACCGTCATCCTATTCTTTAACCCAAGCCTATTCAACCCCCCTCAGGAGCTCTTCCCCATCATCCTAGCAACAAAAGTTCTACTGCTATCTGCAGGATTCCTATGAATCCGTGCTTCCTACCCACGATTTCGATATGACCAACTAATACACCTATTATGAAAAAACTTTCTTCCCCTAACACTTGCTCTATGCCTATGGCACATTAGCATGCCAATTTCCTACGCAGGTCTACCC-----CCCTACCTA-AGAAA--------------CCCCAGGAAATGTGCCTGAATGT-CAAAAGGGTCACTATGATAAAGTGAACATAGAGGTACACCAGCCCTCTCATTTCCT-A--GGCC-------TTAGAAAAGCAGGAATCGAACCTACACAGAAGGGATCAAAACCCTTCATACTCCCTTTATATTATTTTCT----------------AGTAGGGTCAGCTAATTAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACCCCTTCCCCTACTA-ATGAACCCCCAAGCAAAGCTAATCTTCATTACTAGCCTAATCTTAGGAACAACCATCACAATCTCAAGTAACCACTGAGTCA---TAGCCTGAACCGGCCTTGAAATTAACACACTCGCTATCCTACCCTTAATCTCAAAATCCCATCATCCCCGAGCCGTAGAAGCAGCAACTAAATACTTCCTAGTCCAAGCAACTGCTTCAACCCTAGTACTATTCTCCAGCATAACCAACGCATGATATACTGGACAGTGAGATATCACTCAAATAACCCACCCAACCTCTTCCTTAATCCTAACTGCAGCCATTTCAATGAAACTAGGACTAGTGCCCTTCCACTTCTGATTCCCAGAAGTACTACAAGGCTCCCCCCTCATTACTGGCCTTCTCCTATCCACAGTCATAAAATTCCCACCAATCACTCTACTCTTTATAACCTCCCAATCACTTAACCCCACACTACTAACTACTATAGCCCTTCTTTCCGTAGCCCTAGGAGGATGAATGGGGCTCAATCAGACGCAGACCCGAAAAATCATAGCCTTCTCCTCCATTGCTCACCTAGGCTGAATAGCCATTATTCTAGTCTACCACCCTAAACTCACCCTACTCAACTTCTACCTATACGCTATAATAACCGCTGCTGTATTCCTAACTCTAAATTCAATAAAAGTCCTAAACCTATCAACATTAATAACTGCATGAACAAAAGCACCTTCACTTAGCACAATCCTCCTACTAACCCTTCTATCGCTAGCCGGCCTCCCCCCTCTGACCGGCTTCCTCCCAAAATGACTCATCATCCAAGAACTGACCAAACAAAATATAGCCCCTGCAGCAATGATCATCTCGCTCCTATCCCTGCTTGGACTTTTCTTCTACCTCCGCCTCGCGTACTGCGCAACAATCACACTCCCACCCCACACGACAAACCACATAAAACAATGACGTGTCAACAAACCAATTAACTCCTCAATCGCCATTCTTACTACTCTATCTATTATACTCCTACCAATTTCCCCCATACTCACCACCATCGT------CT--AAAAGAAACTTAG----GTTCACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAGACCCGCAGGACATTACCCTGCATCATCTGAATGCAACTCAAATGCTTTAA-TTAAGCTAGGATCTT-----GCATCTCCTAGGCAGATGGGCTTCGATCCCATAAAAC-TATAGTTAACAGCTATATGCCCCAAACCAACAGGCTTCTGCCT-AAC-----------AGGCCCCGGTGCACAG-CTAGTGCACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATCAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACTTTCATTAACCGATGACTATTCTCAACCAACCACAAAGACATTGGCACCCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTAATCCGAGCAGAACTAGGCCAGCCTGGCGCTCTTCTAGGAGACGACCAAATCTATAATGTCATTGTTACAGCCCATGCCTTCGTCATGATTTTCTTCATAGTAATGCCAATCATAATCGGGGGATTCGGAAACTGACTAGTCCCTCTAATAATTGGTGCCCCGGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTTCTCCCTCCCTCATTCCTCCTTCTTCTAGCCTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTTTACCCCCCACTAGCCGGTAACCTAGCCCATGCTGGAGCATCAGTCGACCTGGCTATTTTCTCACTACATCTGGCAGGTATTTCATCCATCCTAGGGGCAATTAACTTCATCACTACCGCAATTAACATAAAACCTCCAGCTCTATCACAATACCAAACTCCTCTATTCGTATGATCAGTTCTAATCACCGCAGTGCTCCTCCTCCTATCCCTTCCTGTCCTTGCCGCAGGAATCACTATGCTCCTAACAGATCGCAACCTCAACACCACATTCTTCGACCCAGCAGGAGGAGGAGACCCAATTCTATATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATTCTACCAGGATTTGGTATTATCTCCCACGTCGTAGCATACTACGCGGGTAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCGATACTATCCATCGGATTCCTAGGCTTTATTGTTTGAGCACACCACATGTTTACAGTCGGAATAGACGTAGACACTCGAGCATACTTTACATCAGCCACCATGATCATCGCCATTCCAACTGGAATTAAAGTATTTAGCTGACTAGCGACACTGCATGGAGGAACAATTAAATGAGACCCACCAATGCTATGAGCCCTAGGCTTCATCTTCCTCTTTACCATCGGTGGACTAACAGGAATCGTCCTAGCAAATTCTTCCCTGGACATTGCCCTACATGACACCTACTATGTAGTAGCCCACTTCCACTACGTACTATCCATGGGTGCAGTATTCGCAATCCTAGCAGGCTTTACCCACTGATTCCCCCTATTCACTGGATACACTCTTCACTCTACGTGAGCCAAAATCCACTTCGGAGTAATATTTGTGGGAGTAAACCTTACCTTCTTCCCCCAACACTTCCTAGGACTAGCCGGTATACCACGACGTTACTCAGACTACCCAGACGCTTACACACTATGAAATACTATCTCTTCAGTAGGATCACTAATCTCCCTAACTGCCGTGATTATGCTGATGTTTATTATCTGAGAGGCATTCGCATCTAAACGCAAAGTCCTTCAACCAGAACTAGTCAGCACAAATGTTGAATGAATCCACGGCTGCCCACCCCCATTCCACACATTTGAAGAGCCAGCCTTCGTTCAAGTC------CAAGAAAGGAAGGAGTCGAACCTCCACATGTTGGTTTCAAGCCAACCGC--AT---AACCATCTATGCTTCTTTCTC---ATT--AGAGGTGTTAGT-AAAATC-ATTACATAG-CCTTGTCAAGGCTAAATAACAGGTGAAACCCCAGTACACCTCAA---CAT----AAATATGGCCAACCACATACAATTCGGTTTTCAAGACGCTTCATCCCCTATCATGGAAGAACTAGTAGAATTCCATGATCACGCCCTAATAACCGCTCTAGCCATCTGCAGTCTAGTACTATACCTGCTAACCATAATACTCACTGAAAAACTATCATCTAATACAGTCGACGCACAAGAAATCGAACTCGTATGAACAATCCTTCCTGCAATCGTCCTAATCATACTCGCCCTACCATCCCTACAAATCCTCTACATAATGGATGAAGTCAATGAACCAGACCTAACACTGAAAGCTATCGGACATCAATGATACTGATCCTACGAATACACCGACTTCAAAGACCTAACATTTGACTCTTACATAACACCAACCACAGACCTACCACTAGGACATTTTCGACTACTAGAAGTAGACCACCGTGTAATTGTCCCAATGGAATCATTAGTCCGAGTCATTGTTACTGCTGACGACGTACTTCACTCATGAGCCGTCCCAAGTCTAGGCGTGAAAACTGACGCGATTCCAGGACGACTGAACCAAACCTCATTCACCGCCACTCGACCTGGAGTCTTTTACGGCCAATGCTCAGAAATCTGCGGAGCAAACCACAGCTTCATACCTATTGTAGTCGAATCTGCCCCCCTTGCTAACTTCGAGAGCTGATCCTCCCTAC---TATCATCTT----------AATCATTAAGAAGCTATGAATTAGCACTAGCCTTTTAAGCTAGAGAAAGAGGACT-ACCAATCCTCCTTAATGATATGCCTCAACTAAACCCAAATCCATGATTTTTTATCATGCTAACTTCATGAATCACCTACTCCATAATCATTCAACCCAAACTACTATCCTTTATCTCTATAAACCCCCCATCCAATAAAA---TGCATACAACCCCTGCTAGCACCCCCTGAACCTGACCATGAACCTAAGCTTTTTTGATCAATTCTCAAGCCCATCCCTACTAGGCATTCCCCTAATCCTAATCGCAATGACATTCCCAGCTCTCCTATTGCCATCTCAAAGTAACCGATGAATTACTAGCCGTTTATCGACCCTACAACTATGACTCATTAACCTAATTACAAAACAACTAATAATACCCCTAAACAAAAAAGGACATAAATGAGCCCTAATTCTAACATCCCTAATAATCTTTCTCCTACTTACTAACCTACTAGGCCTACTACCCTACACATTCACCCCAACTACCCAACTCTCTATAAACCTAGCTTTAGCTATCCCCCTATGACTTGCTACCCTACTTACAGGCCTACGAAACCAACCCTCAGTATCTCTAGGACATCTCCTACCAGAGGGCACTCCAACTCCACTAATCCCAGCCCTCATCCTTATCGAAACAACCAGCCTTCTAATCCGCCCTCTAGCCCTAGGTGTTCGCCTAACAGCCAACCTTACAGCAGGCCACCTACTAATCCAACTTATTTCAACAGCTACCACCGTCCTACTCTCAACAATACCAGTAATCTCACTACTAACATTATTAATTCTCTTCCTACTCACAATCCTAGAAGCAGCAGTAGCTATAATTCAAGCCTATGTCTTTGTGCTACTACTAAGCCTATATCTACAAGAAAACATCTAAACT-----ACCAATGACCCACCAAGCACACTCTTATCATATAGTCGACCCCAGCCCATGACCTATTCTAGGAGCAGCCGCCGCCCTCCTCACCACATCCGGCCTAACCATGTGATTCCACTACAACTCGCCTTATCTACTAGTCATCGGACTCACTTCAACCATCCTAGTTATGTTCCAATGATGACGAGACATTGTCCGAGAAAGTACATTCCAAGGCCACCACACGCCTACGGTACAAAAAGGTCTACGATATGGAATAGTCCTATTTATCACATCAGAAGCATTCTTCTTCCTAGGCTTTTTCTGAGCATTCTTCCACTCCAGCCTAGCCCCAACGCCGGAACTAGGGGGGCAGTGACCACCAGTCGGAATTAAACCCCTAGACCCAATAGACGTCCCTCTTCTAAACACTGCAATTCTCCTAGCCTCAGGAGTCACAGTCACATGAGCTCACCACAGCATCATAGAGGCCAACCGAAAACAAGCAATCCACGCCCTCACCCTTACTGTCCTCCTAGGCTTCTACTTCACCGCCCTACAAGCTATAGAATACTACGAAGCCCCCTTCTCCATTGCTGATGGAGTCTACGGCTCTACCTTCTTCGTAGCAACCGGATTCCATGGCCTCCACGTAATCATTGGCTCTACATTCCTCCTAGTATGCCTTCTACGCCTAATCAAATACCACTTCACACCAAAACATCACTTCGGCTTCGAAGCAGCAGCTTGATACTGACACTTCGTAGATGTTGTATGACTGTTCCTTTATATAACAATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAACCCCAGAGAAGAGTAATG---AATATAATCCTATTCATAATTATCTCGTCCCTCACTCTAAGTATCATTCTCACTGCATTAAACTTCTGACTAGCACAAATAAACCCAGATTCAGAGAAACTATCCCCCTACGAATGCGGATTTGACCCATTAGGGTCCGCCCGGCTGCCATTTTCAATTCGATTCTTCCTAGTAGCAATCCTTTTCCTGCTATTCGACCTAGAAATCGCCCTACTACTCCCACTACCATGAGCAATCCAACTACAAACCCCTACCACCACTCTAGTATGAGCCTCCGTCCTCATCCTTCTACTAACCCTAGGTTTAATCTACGAATGAATCCAAGGAGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAAATTATAGTT-AAACCCTATAACTTTCTCAATGTCTGCTCTACACCTAAGTTTTTTCTCTGCATTCACCCTAAGCAGTCTAGGCCTAGCCTTTCATCGCACACATCTAATCTCAGCCCTACTATGCCTAGAAAGCATAATACTATCCATATATGTCGCCCTTTCTATGTGGCCCATTCAAACCCAAACAGCATCTGCTACTCTTCTACCTCTCCTCATACTAGCATTCTCTGCCTGCGAAGCAGCAACGGGACTGGCCCTACTAGTCGCCTCCACCCGAACCCATGGCTCTGACCACCTACATAACTTCAATCTACTGCAATGCTAAAAATTATCGTTCCAACCATCATACTTCTACCACTAACACTGCTCTCCCCCCACAAACACCTATGAACCAATGCTACAACGCATAGCCTCCTAATTGCCACCATCAGCCTACAATGATTAGTCCCTACATATTACCCAAGCAAAGGACTAACTCACTGAACCTCAATTGACCAAATCTCTTCCCCTCTACTCGTTCTATCGTGCTGACTACTCCCTCTCATACTTATAGCAAGCCAAAACCACCTAGAACAAGAACCTACCGTTCGCAAACGAATCTTTATCGCAACTACAATTACAGTCCAGCCATTTATTCTGCTTGCCTTCTCAGCCTCAGAGCTGATACTATTCTATATTGCATTTGAAGCAACCCTCATTCCAACCCTAATCCTCATTACACGATGAGGAAACCAACCCGAACGACTAAACGCAGGTATTTATCTACTATTCTACACACTCATTAGCTCCCTGCCACTCCTAATTACAATCCTACACTTACATAACCAAATCGGTACACTATACTTCCCCATACTCAAACTTTCACACCCAACTATAAACAACTCTTGAACAGGCCTAATCGCAAGCCTAGCACTTCTACTAGCCTTCATAGTAAAAGCCCCACTATATGGCCTGCACCTATGACTCCCCAAAGCCCATGTAGAAGCCCCAATTGCCGGGTCAATACTACTAGCCGCTCTTCTACTAAAACTAGGAGGTTACGGCATCATACGAATTACTATCCTAGTAAATCCATCAGTAAATAATCTTCATTACCCATTCATTACCCTAGCATTATGAGGAGCAGTAATGACAAGTGCTATCTGCGTACGACAAATTGACCTAAAATCATTAATCGCTTATTCCTCCGTAAGCCATATAGGCCTAGTTATTGCCGCAACCATAATTCAAACCCAATGAGCTTTCTCAGGAGCAATAATCCTAATAATTTCACACGGACTAACCTCCTCAATACTATTCTGCCTAGCCAACACAAACTACGAACGAACCCATAGCCGAATTCTCCTCCTCACCCGAGGCCTGCAACCACTCCTACCACTGATAGCCACCTGATGACTTCTAGCAAACCTAACAAATATAGCACTACCCCCAACAACCAACCTTATAGCAGAACTAACCATTGTAGTAGCCCTATTCAATTGATCCCCACTAACAATCATTTTAACAGGCACTACAATCGTCCTAACCGCTTCCTATACCCTCTACATACTAATAATAACCCAACGAGGAATACTGCCGTCTCATATCACTTCAATCCAAAATTCCTCTACGCGAGAACATCTCCTAATAGCACTACATATAATCCCTATAATCCTACTCATCCTTAAACCCGAGCTCATCTCAGGAGTCCCCATAT-GCAGGTATAGTTT--AA-CCCAAACATTAGATTGTGATTCTAAAGATAGAAGTTAGACCCTTCTTACCTACCGAGGGGAAGGTT-AAACCAACAAGAACTGCTAATTCTTGCATCTGAGTCTAAGAGCCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCAGTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCAAACACTCATCCTAAATACGTTCATACTACTCACCCTGGCAGTACTCTGCACCCCAATTATTTTCCCCCTCCTATCAAATAACCTAAAAAACACCCCAGCCACCATCACAAATACCGTTAAAGCTTCATTCCTAATTAGCTTAATTCCCATAACCATCCATATTCATTCAGGAACAGAAAGCCTAACCTCCCTCTGAGAATGAAAATTCATCACAAACTTTAAAATCCCTATCAGCCTGACAATAGACTTCTACTCACTAACCTTTTTCCCGATCGCTCTATTTGTCTCCTGATCAATCCTACAATTCGCAACGTGATATATAGCCTCAGACCCGTACATTACAAAATTCTTTACCTTCCTTCTACTATTCCTAATTGCCATACTCATCCTTATCATCTCTAACAACCTATTTCTACTCTTCATTGGGTGAGAAGGAGTAGGAATCATATCCTTCCTACTAATTAGCTGATGACACGGCCGAGCAGAAGCCAACACTGCCGCCTTACAAGCCGTACTATACAACCGAGTAGGAGATGTAGGACTAATCCTATGCATAGCATGACTAGCTTCTACCATAAATACATGAGAAATCCAACAAATTTCCTCCCAAGACCAAACTCCAACCCTCCCATTACTAGGCCTAATCCTAGCTGCAGCAGGTAAGTCCGCTCAATTTGGTCTCCACCCCTGACTACCAGCGGCAATAGAAGGCCCTACTCCAGTATCCGCCCTACTTCACTCTAGTACCATAGTAGTAGCCGGGATCTTCCTACTCATTCGAACCCATCCCCTTTTTGAAAACAACCCCACCGCTCTATCCCTATGCCTATGCCTAGGAGCCATCTCCACACTATTTGCAGCCACATGTGCCTTAACCCAAAACGACATTAAAAAAATTATCGCTTTTTCCACATCCAGCCAACTAGGCCTAATAATAGTTACAATCGGACTAAATCTACCTCATTTAGCCTTCCTGCACATCTCAACCCACGCATTCTTCAAAGCCATACTATTCCTATGCTCCGGATCAATCATTCACAGCCTAAATGGCGAACAAGATATTCGAAAAATAGGAGGACTTCAAAAAATACTACCAACAACCACCTCATGCCTAACCATTGGAAATCTAGCTCTAATAGGAACTCCCTTTTTAGCAGGATTCTACTCAAAAGACCAAATCATTGAAAGCCTCAATACATCATACCTAAACACCTGGGCTCTAATCTTAACCCTCTTAGCTACATCATTCACCGCAGTTTACACCATTCGAATAACTGTACTAGTCCAATCAGGCTACGTTCGAATTCCTCCTCTAACTCCCATCAATGAAAACAACCCAGCCGTCCTTTCCTCAATTACCCGCCTTGCATTAGGAAGCATCACAGCAGGATTCCTAATCACCTCATACATTCCAC---CTGCAAAAACCCCACCAATAACTATACCACTCTCTATTAAAATTACAGCCATCGTAATCACACTTCTAGGAGTGGCCCTAGCCCTAGAATTATCAAAAATAACCCAGACCTTAATCCTCCCTAAACAGAATCGCTTCTCGAACTTCTCTACAACCCTAGGTTACTTTAATCCCCTGGCTCATCGCTTCATTACAACAAAAGTACTAAGCGGCGGACAGAATATTGCCTCCCACCTAATTGACCTTTCCTGATACAAACTACTAGGCCCCGAAGGACTAGCTAACCTACAAATAATAGCATCAAAAACCATTACCACCTTCCACACTGGCCTAATTAAAGCCTACCTAGGATCATTTGCCCTATCAATCTTTATCATTCTTT---TATCAATGTACAGAAT--CAACC-T---AATGGCCCTAAACCTACGTAAAAATCACCCTCTACTAAAAATCATCAACGACTCCCTAATTGATCTTCCTACCCCATCAAACATCTCAATCTGATGAAACTTCGGATCTCTACTAGGCATCTGCCTTATTATCCAAATCGTCACAGGCCTACTACTAGCTATACACTACACAGCAGACACATCTCTAGCCTTCTCCTCCGTAGCCCATATATGCCGAGATGTACAATTCGGATGACTAATTCGTAACCTCCACGCAAATGGAGCCTCCTTTTTCTTTATCTGCATCTACCTACACATCGGCCGAGGATTCTACTACGGATCATACCTAAACAAAGAAACTTGAAACATTGGAGTAATCCTCCTTCTAACCCTGATAGCAACCGCCTTCGTAGGATATGTTCTACCCTGAGGTCAAATATCATTCTGAGGGGCTACAGTTATCACTAACCTTTTCTCAGCAATCCCATATATTGGACAAACACTAGTAGAATGACTCTGAGGCGGATTCTCAGTAGACAACCCTACCCTAACCCGATTTTTCGCCTTCCATTTCCTCCTTCCTTTTGTAATCGCAGGACTAACACTAGTCCATCTGACCTTCCTACACGAGACAGGATCAAACAACCCATTAGGAATCCCTTCAGACTGCGACAAAATCCCATTCCACCCTTACTACACTATCAAAGACATCCTAGGCTTCATACTAATACTCACCCCACTAGTTGCCCTAGCACTATTCACCCCTAACCTCCTAGGAGACCCAGAAAATTTCACCCCCGCCAACCCCCTAGCTACACCTCCCCATATCAAACCCGAATGATACTTCCTATTTGCATACGCCATTCTTCGATCCATTCCTAACAAACTAGGAGGAGTTCTAGCCCTAGCCGCTTCAGTCCTAGTCCTATTTCTAATCCCCCTGCTCCATGTCTCCAAACAACGATCTATAACCTTTCGACCCCTATCACAAATCCTATTCTGAACCCTAGTTGCCGATCTCCTCATCCTAACATGAGTAGGAAGCCAACCAGTCGAACATCCATTCATTATCATTGGCCAACTAGCCTCCTTTACATACTTCACAATTATCCTAGTCCTATTCCCCATTGTAAGTGCGCTAGAAAACAAGCTGCTCAACCT----------CTA-ATT-----------AACTCTAATAGTTTAGATAAAACATTGGTCTTGTAAACCAAAGATTGAAGGCTAAACACCTTCTTAGAGTT Gnorimopsar_chopi_JX516055 GTCCTTGTAGCTTATAACAAAGCATGACACTGAAGATGTCAAGATGGCTGC--CAC---ACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ATCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAGCATCTAAGCTGTCGCAAGCCCAAGATGC-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGACCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGGGAACTACGAGCACTAACGCTTAAAACCCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-CACCTGACCATTCCTTGC-CAG--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTACA--CTAAAAGCCCAACAGTGGACGCAACAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAGACTAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGCGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG-CCCCCCCCCCCCCCCAT-AACTAATAAGTTAC-TC--AGCTGGAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGAACA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-C-A-AACCC----AACTAAAGCATT---T--ACTAGT-CCAAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAGCAGTG-AAA---CCTATAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACCTATGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTGGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-CCACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGGACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--ATTAA-CCC-CCTAAC-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACCTTATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACAACGCAAGCTTACATCCGTA-CATTATTAACAAACCCCCCC-ATATACGA--CAAAT---------CAA---ACAAGCA-TAG-TATTA-AACATA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAATCAACGACCACC--TTAAAT-CACACA----TC-CACCCA--C-T-GGGTTCACTGAC-ACA-CAA-GA-C-TCTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCGACCTCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTGATCCAGGTCGGTTTCTATCTATGATG-AGCTCTTCCCCGTACGAAAGGATAGGAA-AAGCGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAATCAACTTAATTACAAAAGGCTATCAC-ACTCC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC----G-----CC---C--C----ATGAC----------CAACTACCCCCTCCTGATCAACCTCATCATAGCCCTCTCCTATGCCCTCCCCATCCTAATCGCAGTAGCCTTTCTCACACTAGTAGAACGCAAAATCCTAAGTTACATGCAAGGCCGAAAAGGCCCAAACATTGTCGGCCCTTTTGGACTTCTCCAACCCCTAGCAGACGGTGTCAAACTGTTTATCAAAGAGCCCATCCGAC---------CTTCAACATCTTCCCCGATCTTATTCATTGCAACCCCGGTCCTAGCTCTTCTCCTAGCCATTTCAATCTGAACCCCATTACCCCTCCCATTCTCCCTAGCAGACCTCAACTTAGGGCTTCTTTTCCTGCTAGCCATGTCAAGCCTGATAGTATACTCCATCCTATGATCAGGCTGAGCATCCAATTCCAAATACGCCCTAATTGGGGCACTACGAGCAGTGGCCCAGACTATCTCCTACGAAGTGACTCTAGCTATCATCCTCCTCTCCGTTGTCCTCCTTAGCGGCAACTATACTCTAAGCACTCTCGCAGTCACCCAAGAACCCTTATACCTCATTTTCTCCTGCTGGCCCCTTGCTATAATGTGATACGTCTCCACACTGGCTGAGACCAACCGTGCCCCCTTTGACCTGACAGAGGGAGAGTCTGAACTAGTATCCGGATTCAACGTAGAATACGCAGCTGGTCCTTTTGCACTCTTCTTTCTAGCCGAATACGCCAACATTATACTCATAAATACACTAACCACAATCTTATTCTTTAACCCAAGCTTCCTTAACCCACCTCAAGAGCTATTCCCAGTCATTCTAGCCACAAAGGTCCTGCTTTTGTCAGCAGGATTCCTATGAATTCGCGCTTCCTACCCACGATTCCGATACGACCAATTAATGCACTTACTATGAAAAAATTTCCTACCACTCACACTAGCCCTATGTCTCTGACACACCAGCATACCAATTTCCTACGCGGGCCTACCC-----CCTTACCTA-A--GG-CC-----------TTGTCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-T--ATAG-------TTAGAAAAGCAGGAATCGAACCCGCACTAGAGGAATCAAAATCCTCCATACTCCCATTATATTACTTCCT----------------AGTAGGGTAAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATTTTCACCACTAGCCTACTTCTAGGGACAACTATCACCATCTCAAGCAACCACTGAGTCA---TAGCCTGAGCCGGCCTTGAAATTAACACACTTGCCATCCTCCCATTAATCTCTAAATCCCACCACCCACGAGCCATCGAAGCTGCCACTAAATACTTCCTGACCCAAGCAGCTGCCTCTGCCCTCGTCTTATTCTCCAGCATAACCAATGCATGACACACCGGACAATGAGACATCACCCAACTTACCCATCCAACATCCTGCCTGATTCTCACCTCAGCGATCGCAATAAAACTAGGACTAGTGCCATTCCATTTCTGGTTTCCAGAAGTACTCCAAGGCTCTCCCCTCATCACTGGCCTACTCCTATCTACTATTATAAAACTCCCCCCGATAACACTGCTCTACATAACCTCTCCCTCACTAAACCCTACACTATTAACTACCTTATCCATTTTCTCTGTAGCCCTAGGAGGCTGAATAGGCCTCAACCAAACACAAATCCGAAAAATCTTAGCCTTTTCCTCTATCTCCCACCTAGGCTGAATAGCAATCATTATCATCTACAACCCCAAACTCACACTCCTCAACTTCTATCTGTACGCCATAATAACTGCAACTGTCTTCCTCACTCTGAACACAATTAAAGTACTAAAACTATCCACTCTGATAACCGCATGATCTAAAACCCCATCCTTAAACACGATACTACTTCTAACTCTGCTCTCCCTCGCAGGACTTCCCCCTCTGACAGGATTCCTGCCTAAATGACTTATCATCCAAGAACTAACTAAACAAGAAATAATCCCAGCAGCTACACTTATCTCTCTACTCTCCCTACTAAGCCTGTTCTTCTACCTCCGATTAGCATACTGTGCAACCATCACACTCCCCCCACATACTACAAACCACATAAAACAATGACGCACTAACAAACCTACCAACATCACAATTGCCATCCTAATCACTGTATCCATCATACTCCTTCCTATCTCCCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-A--CAACTTTCCTAGACAGATGGGCTTCGATCCCACGATAC-TATAGTTAACAGCTATATGCCCTAACC-AACGGGCTTCTGCCT-A-------------AGGCCCCGGCGCATGA-CT-ATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACGGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTTATCGACCGATGATTATTCTCAACCAACCACAAAGACATTGGGACCCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGCCAACCTGGAGCTCTTCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGGTTCGGGAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGATATGGCATTCCCACGAATAAACAATATAAGCTTCTGACTACTCCCCCCATCCTTCCTCCTTCTCATAGCATCTTCCACAGTTGAAGCAGGTGTAGGGACGGGCTGAACAGTGTACCCCCCACTAGCAGGCAACTTAGCCCACGCCGGAGCCTCAGTCGACCTAGCAATTTTCTCCCTACATCTAGCCGGTATCTCTTCAATCCTAGGAGCAATCAATTTTATTACAACAGCAATCAACATAAAACCTCCCGCCCTATCGCAATACCAAACTCCCCTATTCGTTTGATCAGTCTTAATCACTGCAGTGCTACTACTCCTATCTCTTCCAGTTCTAGCTGCAGGAATTACAATGCTTCTTACAGACCGTAACCTCAACACCACATTCTTTGATCCAGCTGGAGGAGGAGACCCTGTACTATATCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTTCCAGGATTCGGAATCATCTCCCACGTCGTAACCTACTACTCAGGCAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCCATGCTATCTATCGGGTTCCTAGGCTTTATCGTCTGAGCCCACCACATATTCACAGTCGGAATGGATGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCTATCCCAACCGGAATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGTACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTTATCTTCCTATTTACTATTGGAGGACTGACAGGAATCGTCTTAGCAAACTCCTCACTAGACATCGCCCTACATGACACCTACTACGTAGTAGCCCACTTCCACTACGTATTATCCATAGGAGCAGTATTCGCAATTCTAGCAGGCTTCACCCACTGATTCCCCCTATTCACCGGATATACACTCCATTCAACATGAGCTAAAACACACTTTGGCGTAATATTCGTGGGCGTAAATCTAACATTCTTCCCTCAACATTTTCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGATGCCTATACACTATGAAACACCATCTCCTCAGTAGGCTCACTCATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCGCACAACCAGAGCTAACAAGCACTAACGTCGAATGAATCTACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCTGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ACA-AGGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGTGAAAGCCCAGCACATCTCT-----ACCT---AACATGGCCAACCACTCACAACTTAACTTCCAAGATGCCGCCTCACCTATCATAGAAGAACTAATAGGATTCCACGACCACGCCTTAATAATCGCACTAGCAATCTGCAGCCTAGTACTCTATCTGTTAACCCACACTCTCACAGAAAAACTAACATCAAACACAACCAACGCACAAGTAATCGAACTAGTCTGAACAATCCTCCCTGCCCTGGTCCTAGTCACACTTGCCCTACCATCCCTACGAATCCTCTACATAATAGACGAAATCAACGAACCAGACCTAACCCTGAAAGCTATCGGCCACCAATGATACTGAACCTACGAATACACTGATTCCAAAGACCTAACATTCGACTCCTACATAATCCAAACAGCAGACCTGCCTCTAGGCCATTTCCGCCTACTAGAAGTCGACCATCGTGTTGTCGTCCCCATAAACTCAACCATCCGGGTCATCGTCACCGCCGACGACGTCCTCCACTCATGAGCTGTCCCAAGCCTAGGTGTAAAAACTGACGCAATCCCAGGACGTCTTAACCAAATTTCCTTCCTTGCCTCTCGACCAGGTGTGTTCTACGGACAATGCTCAGAAATCTGTGGGGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCACTCGCTAACTTCGAAAGCTGATATTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGAA-CCCCCCCCTCCTTAATGATATGCCTCAACTAAACCCCAACCCCTGATTTTTTATCATGCTCACTTCATGGCTCACTTTCTCCCTTATCATCCAACCCAAAATCCTGACATTCGTATCAATAAACCCCCCATCTAAAAAAC---CGCCCGCCGCTCCAAGCACCACCCCCTGAACCTGACCATGAACCTAAACTTCTTTGACCAATTCTCAAGCCCATCATTCCTAGGAATCCCACTAATCCTTATCTCAATAACGTTCCCTGCCCTTCTCCTACCAGCCCTCGACAACCGATGACTCACTAACCGGCTATCAACCCTCCAACTCTGACTCGTTAACCTAATTACAAAACAACTAATAATACCCCTAGATAAAAAAGGACATAAATGAGCCCTAATCCTAACATCCCTCATAATCTTCCTCCTCCTCATCAACCTCCTAGGCCTATTACCGTACACATTCACTCCAACCACCCAACTATCTATAAACCTAGCCCTAGCCTTCCCCCTATGACTAGCCACACTTCTAACAGGACTACGAAATCAACCCTCTGTCTCGCTAGGCCACCTTCTGCCAGAAGGCACACCCACTCCACTAATCCCAGCCCTCATCCTAATTGAAACGACAAGCCTTCTCATCCGCCCATTAGCACTGGGCGTGCGCCTAACAGCCAACTTAACAGCAGGCCACCTCCTCATCCAACTCATCTCCACCGCCACAACAGCCCTATTCTCCACAATACCACTAGTTTCACTCCTAACCTTCGCAGTCCTCTTCCTACTGACAATCCTAGAAGTAGCAGTAGCAATAATCCAAGCTTACGTCTTCGTACTCCTACTAAGCCTTTATCTCCAAGAAAACATCTAACCC--TA----AATGGCACACCAAGCACATTCTTACCACATAGTTGACCCCAGCCCATGACCCATCCTAGGAGCAACCGCTGCCTTCCTCACTACCTCAGGACTAACAATATGATTCCACTGAAACTCCCCTAAACTCCTCATCCTAGGCCTACTATCAACCATCCTTGTCATATTCCAATGATGACGTGACATTGTACGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTGCAGAAAGGACTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTTTTCTTCCTAGGGTTTTTCTGAGCTTTCTTCCACTCAAGTCTAGCCCCCACACCAGAACTAGGAGGCCAATGACCCCCCGTAGGAATTAAACCCCTCAACCCCATAGAAGTTCCACTCCTAAACACTGCCATCCTCCTAGCCTCAGGAGTCACTGTCACATGAGCCCATCACAGCATCACGGAGGCCAACCGAAAACAAGCAATCCAAGCCCTATCCCTAACAGTACTCCTCGGCTTCTACTTCACCGCCCTACAAGCCATAGAATATTACGAAGCACCATTCTCCATCGCCGACGGAGTTTACGGCTCAACATTCTTCGTCGCCACTGGATTCCACGGACTGCATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAATCACCACCTCGGATTTGAAGCAGCCGCATGATACTGACACTTCGTAGACGTTGTATGATTACTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATAATA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATTCTATTCATACTGGCCCTATCACTGACCCTAAGCACCCTCCTAACCATATTAAACTTCTGAATTGCCCAAATAACCCCAGACTCAGAAAAACTATCCCCCTACGAATGCGGATTCGACCCCCTAGGATCTGCTCGACTCCCTTTCTCAATCCGCTTCTTCCTAGTAGCCATCTTATTCCTCTTATTCGACCTAGAAATCGCCCTACTCCTTCCACTACCCTGAGCCGTCCAACTACAATCCCCCACCACTACCCTAACTTGAACCGCCACACTAATCTTCCTACTCACTCTAGGCCTAGTATACGAATGGATTCAAGGAGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCAACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCGGCCTTTGCTCTAAGCAGCCTCGGCCTAGCCTTCCACCGAACCCACTTAATCTCCGCCCTACTATGCTTAGAGAGCATAATACTATCCATATACGTCGCCCTAGCCATATGACCAATCCAAATCCAATCATCAGTATCCACTATCCTACCCATCCTCATACTAACATTTTCCGCCTGCGAAGCAGGCACAGGCCTAGCACTACTAGTAGCCTCAACCCGCACCCACGGATCCGACCACCTACACAACTTTAACCTCCTACAATGCTAAAAATCATCATCCCAACCACAACGCTCCTCCCCTTAGCCCTCCTCTCCCCATGCAAGCACCTATGAACTAACATTACACTATACAGCCTACTAATCGCCACTGTTAGCCTCCAATGACTCACACCCACATATTACCCAAACAAAGGCCTAACCCTATGAACGTCAATCGACCAAATCTCCTCCCCCCTACTAGTCCTCTCATGCTGACTCCTCCCCCTCATAGTCATAGCAAGCCAAAACCACTTAGAACAAGAACCCATCAACCGAAAACGAATCTTTGCCTCAACACTAATCCTAGCCCAACTATCCATCCTTCTAGCCTTCTCAGCTTCCGAACTAATACTTTTCTACATCGCATTTGAAGCTACCCTCATCCCCACCCTAATCCTCATCACACGATGAGGAAGCCAACCAGAACGTTTAAACGCTGGCATTTACCTCCTATTCTACACTCTCGCCAGCTCACTCCCACTATTAATTGCCATCCTCCACCTACAAAACCAAATCGGCTCACTCTACCTGCCGATACTCAAACTCTCACACCCAACATTAAATTCCTCTTGATCCAGCTTAGCCGCTAGCCTAGCCCTCCTGCTAGCCTTCATAGTCAAAGCTCCCCTATACGGCTTACACCTATGACTCCCCAAAGCTCACGTAGAAGCTCCAATTGCCGGCTCCATGCTACTAGCAGCCCTACTACTAAAACTTGGAGGCTACGGCATCATACGAATCACAATCTTAGTAAACCCATCATCAAACAACCTTCATTACCCATTCATCACCCTAGCCCTATGAGGAGCAGTAATAACCAGCGCTATCTGCCTACGCCAAATCGACCTGAAATCACTAATCGCTTACTCATCCGTAAGCCACATAGGACTAGTTGTAGCTGCAACCATAATCCAAACCCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCACACGGCCTAACCTCCTCAATACTGTTCTGCCTAGCCAACACCAACTACGAACGAACCCATAGCCGAATTCTCCTACTCACACGAGGACTCCAACCCCTCCTACCACTTATAGCCACCTGATGACTACTAGCCAACCTAACAAACATAGCCCTCCCCCCAACAACAAACCTCATAGCAGAACTAACCATTGTAGTAGCACTCTTCAACTGATCTGCCCTAACAATCATCCTAACGGGAACTACCATCCTACTCACCGCCTCATACACCCTATACATACTAATCATAACACAACGAAGCACTCTCCCATCCCACATCACATCAATCCAAAACTCCTCCACACGAGAGCATCTCCTTATAGCCCTGCACATAATCCCCATAATCCTACTAATCTTCAAACCCGAACTGATCTCCGGCATCCCCACAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACTGTGACTCTAAAAATAGAAGTTAGACCCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAGCGAGAACTGCTAACTCTCACATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAATACATTTATACTCCTAACCCTAACAACCCTCTCCACCCCCATTCTACTCCCACTACTATCTGACAACCTCAAAAACACTCCTAACACAATTACGAACACAGTCAAGGCCTCATTTCTAATCAGCCTAATCCCCATAACAATTTTCATCTACTCCGGAACAGAAAGCCTCATTTCCCTCTGAGAATGAAAATTTATTATAACCTTCAAAATCCCAATTAGCCTAAAAATAGACTTCTATACACTCACATTCTTTCCCATCGCACTATTCGTATCATGATCCATCCTTCAATTTGCAGCGTGATACATAGCTTCAGACCCTTACATCACAAAATTCTTCACCTACCTTCTATTCTTCCTAATCGCCATACTCATCCTAATTGTCGCCAACAACCTATTTGTCCTATTCATCGGCTGAGAGGGAGTCGGAATCATATCTTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTACAGGCCGTCCTCTACAACCGAATCGGTGACATTGGTCTTATCCTATGCATAGCATGACTAGCCTCTGCCACAAACACCTGAGAAATCCAACAACTCCCTACCCCCTCCCAAACCCCCACATTACCCCTACTAGGCCTCATCCTAGCTGCAACCGGAAAATCCGCCCAATTCGGCCTTCATCCATGACTCCCAGCCGCAATAGAAGGACCAACTCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCAGGAATCTTCCTACTCATCCGAACCCACCCCCTATTCAGCAACAACCAGACCGCCCTAACTCTATGCCTCTGCCTAGGAGCCATCTCCACCCTATTTGCAGCTACATGCGCTCTAACCCAAAACGACATTAAAAAAATCATTGCTTTCTCCACCTCCAGCCAACTAGGCCTAATAATAGTCACAATCGGATTAAACCTACCTGAATTAGCCTTCCTCCATATCTCCACCCACGCATTCTTCAAAGCCATGCTCTTCCTATGCTCAGGCTCCATCATCCACAACCTAAATGGTGAACAAGACATCCGAAAAATAGGAGGACTCCAAAAAATACTCCCCACAACAACCGCATGCCTCACAATCGGCAACCTAGCTCTAATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCTTAAACACATCCTACCTAAACACCTGAGCCCTAGTCCTAACCCTCCTAGCTACATCATTCACCGCAGTATACACAATCCGCATAACCGTACTAGTACAAACCGGCTTCGTCCGAATTCCCCCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCCCCCATCACCCGCCTCGCGCTAGGAAGCATCCTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACAAAAACCCCTCCAATAACTATACCACTCTACATTAAAACAACCGCCCTAGTCGTAACAGCCCTGGGAATCGCCCTAGCCCTGGAAATTACAAAAATAGCCCAAACACTCATTCTCACAAAACAAACCCCACTCTCAAATTTCTCAACCTCCCTAGGATACTTCAACCCCCTAACCCATCGCCTAAGCACAACCAACTTCCTCAAAGGAGGACAGAACATCGCCTCCCACTTAATCGACTTATCCTGATACAAAATACTAGGTCCAGAAGGACTAGCCAACCTACAACTATCAGCAACCAAGACCGCTACCACCCTTCACTCAGGCCTAATCAAAGCCTACCTAGGGTCATTCGCCCTATCCATTCTCATCATCCTCA---TATCCACACTCAGAAA--CAA-C-T---AATGGCCCCTAACATTCGAAAAAACCACCAAATCCTCAAAATCATCAATGACGCCTTAATCGATCTCCCAGCTCCATCAAACATCTCAACATGATGAAACTTCGGATCCCTACTAGGCGTCTGCCTAATCACTCAAATCATTACAGGTCTTCTGTTAGCTATACACTACACAGCAGACACCAACCTAGCCTTCTCCTCCGTAGCCCATGTATGCCGAGACGTACAATTCGGTTGACTTATCCGCAACCTACATGCAAACGGAGCCTCCTTCTTCTTTATCTGCATCTACCTACACATCGGACGAGGCCTCTACTACGGCTCATACCTAAACAAAGAGACCTGAAACGTCGGAGTCATTCTTCTCATTACCCTAATAGCAACCGCCTTTGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACCTATTCTCAGCCATCCCATACATCGGACAGACACTAGTCGAATGAGCTTGAGGAGGATTCTCTGTCGACAACCCCACACTAACCCGATTCTTCGCTCTCCATTTCCTCCTACCCTTCGTCATCGTAGGCCTCACTGTCGTCCATCTAACCCTCCTCCACGAAACAGGATCTAACAACCCACTAGGCATCCCGCCAGACTGTGACAAAATCCCCTTCCACCCCTACTACACCATCAAAGACATCCTAGGATTTGTCCTAATACTCTCCCTACTCGTCTCACTAGCCCTATTCTCCCCCAACCTCCTAGGAGACCCAGAAAACTTCACCCCAGCCAACCCACTAGTCACCCCTCCACATATCAAACCTGAATGATACTTCCTATTTGCCTACGCCATCCTCCGATCCATCCCAAACAAATTAGGAGGCGTACTAGCCCTAGCCGCTTCAATCCTAGTCCTATTCCTCATTCCATTCCTACACACATCAAAACTACGATCAATGACCTTCCGCCCTCTATCACAAATCCTATTCTGAACCTTAGTCGCTAACATCCTCCTCCTAACCTGAGTAGGCAGCCAACCAGTGGAACACCCATTCATCATCATTGGACAACTAGCCTCAATCTCATATTTCACAATCATCTTAATCCTATTCCCCCTCGCGGCCGCCCTGGAGAATAAAATCCTCAAACT----------TTA-ATC-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Gracula_religiosa_NC_015898 GTCCTTGTAGCTTACAA-AAAGCATGACACTGAAGATGTCAAGACGGCTGA--CCAAACACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTATTGCTGGGTTTATACATGCGAGTATCCGCACTCCAGTG-TAGATGCCCTGGACA-CCT---AAACCCTC---AGGTAGATAGGAGCGGGTATCAGGCTCA---------CCTTT--ACTGTAGCCCAAGACGCCTAGCAATTGCCACGCCCCCACGGGTCCTCAGCAGTAGTCAATATTAAGCAATGAGTGTAAACTTGACTTAGCCACAGCAAC-----TCAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--C----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAGCTAAGATTAAAAAGCAACTGAGCTGTCATAAGCCCAAGATGC-CCATAAGGCCTCCGTCCTCAAAGAAGATCTTAGAAT--AACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTCGATGCT-CGA--TATTACCTGAGCGTCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATATTACCTGACCATCCCTTGC-CCA--AAT-CAGCCTATATACCGCCGTCGCCAGCTCACCTTTC--ATGACGGCCCAACAGTGAGCGCAATAG-CCCTAACCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGGATG----------------------GA-AGCAATGGGCTACATTTTCTAAACTAGAACA-T-----ACGGCAAAGGGATATGAAACTATCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCAAAAG-CG--AACCAACCCCCACCAT-ACCTAATAAGCCAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGACA-CCAAGACGTAGC-TTTAACG-AAAGCATTCAGCTTACACCTGAAAGATATCTGCTC-AAACCAGATCGTCTTGA-TGCCAAATTCTAGCCC--------AACAT-ACATTG------ACCTGGA-ATAAC--AAAGCTACT--CC-CTA-AACTC----AACTAAAGCATT---T--TTCAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAGTG-AAATAAGC--CAAGCTA-AAAAAAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACCTATGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGACGACTTGTAGGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC--AACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAGTACAATCTCCA-CGAGCGGATA----AAT--AACCTCTATACGAACC---TATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCCGT-ACCTCAAAAATATCCC-AACCATATGAATCCCT-CCTCACTAACAGGCTAACCTATACTCAAATAGGAGAATTTATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCATA-CATTATTAACAAA-TCCCTA-ATATACGA--ACAAT---------CCA---ACAAGCA-GAG-TATTACCCCACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGCAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCAAA--ACAAGTATTGAAGGTGATGCCTGCCCAGTG--ACTC-AAT---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCAGGCAATCGGTGAAATTGATCTCCCTGTGCGAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAACGGCCACC--CCAAAA-TACATA----AA-CCCCCA--C-T-GGGCACACTTAC-ATCCCAA-GC-C-ACTGGCC-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-ATATTAGACCATCCCTCCAGACCA-AGAGCAACCCCTCGACGTGCTAACAGCAACCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCTCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTGATGAAATCAACTTAATCACAAAAGGCTATCAC-ACTCC---A-CCA-CACCCTAGAAAAGGG--C-CAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTCCCC-----------------------ATGAC----------CAACTACCCCCTCTTAATCAACCTTATCATAGCCCTTTCCTATGCTCTCCCAATCCTAATTGCAGTAGCCTTCCTAACACTAGTTGAACGCAAAATCTTAAGCTACATGCAAGGTCGAAAGGGCCCAAACATTGTCGGCCCATTCGGACTCCTCCAACCCCTAGCGGATGGGATTAAGCTATTCATCAAAGAACCCATCCGTC---------CCTCAACATCCTCCCCAATCCTATTTCTTGCAACTCCTGTCCTAGCCCTTCTCCTCGCAATCTCTATCTGGATCCCACTTCCCATGCCCTTCTCCCTTGCAGACCTCAACCTAGGCCTACTATTCCTACTAACTATATCAAGCCTAGCAGTCTACTCTATCCTCTGATCCGGCTGAGCCTCTAACTCAAAATATGCCCTAATTGGAGCGCTACGAGCAGTAGCTCAGACCATCTCCTATGAAGTAACCCTGGCCATCATCCTCCTATCCGTAATCCTACTCAGCGGAAACTACACTCTAAGCACCCTGGCAGTTACCCAAGAACCCCTATACCTCATTTTCGCCTGCTGACCCCTAGCCATAATATGATATGTCTCTACACTCGCCGAGACAAATCGTGCCCCATTTGACCTCACAGAGGGAGAATCTGAACTAGTCTCAGGATTCAATGTCGAATACTCAGCAGGCCCCTTCGCCCTATTCTTCCTGGCTGAATATGCCAACATTATACTTATAAATACACTAACCGCTATCCTATTCTTCAACCCTAGCGTCTTCAACCCACCCCAAGAGCTATTCCCGGTCATTCTAGCCACAAAAGTCCTACTCCTGTCAGCGGGCTTCCTATGAATCCGTGCCTCCTACCCACGGTTCCGATACGACCAACTAATGCACCTACTATGAAAAAACTTCCTCCCACTCACACTAGCCCTATGCTTATGACATACCAGCATACCAATCTGCTACGCAGGCCTACCT-----CCTTACATATA--GAC-------------CTAAAGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATAGAGGTATACTAACCCTCTCATTTCCTAC--TAAC-------TTAGAAAAGCAGGAATTGAACCTGCACTAAAGGGATCAAAGCCCTCCATACTTCCCTTATATTATTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAGGCAAAACTAATCTTCGCCACCAGCCTACTCCTAGGGTCAACCATCACAATCTCAAGCAACCACTGAATCA---TAGCCTGAGCCGGACTTGAACTCAATACCCTAGCAATCCTCCCCCTAATCTCAAAATCCCACCACCCCCGAGCCATCGAGGCAGCAACTAAATACTTTTTAGTACAAGCAGCCGCCTCCACTCTGGTCCTATTCTCTAGCATGACCAACGCATGACAAACCGGGCAGTGAGATATTACCCAACTAACCTGTCCAACATCCTGCGTTATTCTAACCGCAGCCATCGCAATAAAACTAGGACTGGCCCCATTCCACTTTTGATTCCCCGAAGTCCTTCAAGGCTGCTCCCTTACCACTGGCCTTGTGCTATCCACAGCCATAAAATTCCCACCAATCACGCTCCTTTTCATAACCTCACAATCCCTAAACCCCATCCTTCTGACTTCCATGGCCATCCTCTCTGCAGCCCTAGGTGGATGAGTAGGCCTAAATCAAACCCAAACCCGAAAAATCCTAGCCTTCTCATCCATTTCCCACCTAGGCTGAATGGCTATTATCATCATCTATAGCCCCAAACTAGCTCTGTTCAACTTCTACCTATACGCTATAATAACCGCTGCTGTATTCCTCACCCTAAACTCAATCAAGACCTTAAAACTCTCCACACTAATAACTACCTGAACAAAAACCCCAGCACTAAGCGCAATACTGATACTAACCCTACTCTCCCTAGCAGGCCTCCCACCCCTGACAGGCTTCCTCCCCAAGTGACTCATCATCCAAGAACTAACCAAACAGGAAATAGCCCCAGTAGCAACAATCATCGCCCTCCTCTCCCTCCTAAGCCTGTTCTTCTACCTCCGTCTCGCATACTGCGCAACAATCACACTCCCCCCACACACCACAAACCACATAAAACAGTGGTACACCAACAAACCCGTTAACACATCAGTATCCATTCTAGTCACAATGTCTATCACCCTCCTCCCCCTATCCCCCCTAATCCTGACCATCGT------CT----AAGAAACTTAG----GATCACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAGATTCGCAGGACATTTCCCTGCATCTTCTGAATGCAACCCAGATGCTTTAA-TTAAGCTAGAACCTT----CAA---CACTAGACAGGTGGGCTTTGATCCCACAATAA-TATAGTTAACAGCTATATGCCTAAACC-AACTGGCTTCCGTCT-A-------------AGGCCCCGGCACGCAG-TCAACGCACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGGGCC---GATAAGAAGAGGAATTGAACCTCTGTCAAAAGGGCTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGACATTGGTACACTGTACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCTCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGTGCCCTACTAGGCGACGACCAAATCTACAACGTAGTCGTCACGGCCCACGCCTTCGTAATAATCTTCTTTATAGTTATACCGATCATGATTGGAGGCTTCGGAAACTGACTAGTTCCACTAATAATCGGAGCCCCAGACATGGCATTCCCCCGAATGAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTACTCCTCCTAGCCTCCTCCACAGTCGAAGCAGGAGCAGGAACAGGTTGAACCGTGTACCCACCCCTGGCTGGCAACCTAGCCCACGCTGGAGCTTCAGTAGACCTAGCCATTTTCTCCCTTCATCTAGCAGGCATTTCCTCAATCCTTGGAGCCATCAACTTCATTACAACAGCAATCAACATAAAACCTCCAGCCCTATCACAATACCAAACCCCTCTATTCGTCTGATCCGTACTTATCACTGCAGTCCTACTCCTCCTATCTCTCCCCGTCCTTGCCGCTGGCATCACTATGCTCCTCACCGACCGAAACCTCAACACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCCGTACTGTACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATCATCTCCCACGTTGTAGCCTACTACGCAGGGAAAAAAGAGCCATTCGGTTATATAGGAATGGTATGAGCCATGCTATCCATCGGATTCCTCGGATTCATCGTCTGAGCCCACCACATATTCACAGTAGGAATAGACGTAGACACCCGAGCATACTTCACATCCGCCACCATAATCATTGCCATCCCAACAGGAATCAAAGTATTCAGCTGACTAGCAACGCTACACGGAGGTACAATCAAATGAGACCCTCCTATACTATGAGCCCTCGGATTCATCTTCCTCTTTACAATCGGAGGACTAACAGGAATTGTGCTAGCAAATTCTTCACTAGATATCGCTCTGCACGACACCTACTACGTAGTAGCTCACTTCCATTATGTACTCTCAATAGGCGCAGTATTCGCAATCATAGCAGGCTTCACCCACTGATTCCCACTATTCACCGGATACACCCTACACTCCACATGAGCCAAAACCCAATTTGGGGTAATGTTTGTAGGTGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTCGCCGGTATGCCACGACGATACTCAGACTACCCAGACGCTTACACTCTATGAAATACCATCTCCTCAGTAGGCTCTCTAATCTCCCTAACAGCCGTAATCATGCTGGTATTTATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGCTACCCAACCTGAGCTAACAAGCACAAACATCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCTGCCTTTGTTCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATAATAGAGGTGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCTAAATCACAGGTGAAACCCCAGTACACCTCAC-----CCCAAAACTATGGCCAACCACTCACAATTCGGTTTCCAAGACGCTTCATCACCCATCATAGAAGAACTGATACAATTCCACGACCATGCTCTAATAGTAGCCCTAGCCATTTGCAGCCTAGTCCTATACCTACTAGCCCTAATACTTACAGGAAAACTATCATCAAGCTCTGTAGACGCCCAAGAAATTGAACTCGTTTGAACAATCCTCCCAGCCGCAGTCCTAATTATACTTGCCCTCCCATCCCTACGAATCCTATACATAATAGACGAAATTAACGAACCAGACCTAACCCTAAAAGCCATCGGCCACCAATGATACTGAACCTACGAATACACCGACTTCAAAGAACTGACATTTGACTCCTACATAATCCCTACATCAGACCTACCACTAGGCCACTTCCGCCTGCTAGAAGTAGACCACCGAGTCATTGTCCCCACAGAATCTAAAGTCCGAGTCATCGTCACTGCCGACGACGTACTCCACTCATGAGCCGTACCAAGCCTAGGTGTGAAAACCGACGCAATCCCTGGACGCCTCAACCAAACTGCTTTCCTCGCCTCTCGTCCCGGAGTCTACTACGGACAATGCTCAGAAATTTGCGGCGCTAACCACAGCTTCATACCAATCGTAGTTGAAGCCACCCCCCTCGCCAATTTCGAAAGCTGATCTTCTACAT---TACCTTCCT----------AATCATTAAGAAGCTATGGAACAGCGCTAGCCTTTTAAGCTGGAGAAAGAGGA---TCCACCCCTCCTTAATGGTATGCCCCAACTAAACCCAAGCCCATGATTTTTTATCATGCTCGCTTCATGACTCACCTTCTCCCTAATCATCCAACCAAAACTACTCGCATTCATCACTATAAACCCTCCATCCAACAAAA---CACCCGAAACCCCTAAAGCAACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGTCCATCCCTACTAGGAATCCCCCTAATCCTCATCGCCCTAACATTCCCAGCCCTCCTAATCTCCTCCCCAGGCAACCGATGAATCACTGACCGACTCTCCACACTCCAACTATGATTTATTAATCTAGTTACAAAACAACTGATAATACCGCTGAACAAAAAAGGCCACAAATGAGCCCTAATCCTAACATCACTAATAATCTTCCTATTACTAATCAACCTTCTAGGCTTACTACCCTACACATTCACACCAACCACACAACTATCCATAAATCTAGCCCTAGCCTTCCCCCTATGACTTGCTACCCTTCTCACAGGACTTCGAAATCAGCCTTCCACCTCATTAGGGCACTTACTGCCAGAAGGCACTCCCACCCCACTAATCCCTGCCTTAGTCCTAATTGAAACAACAAGCCTTCTTATCCGCCCCCTAGCACTAGGCGTACGCCTAACAGCCAACCTGACAGCAGGCCACCTCCTCATTCAACTGATCTCTACCGCCACCACCGCCCTACTCTCAACAATACCTGTAGTATCCCTACTAACACTGTTAGTCCTTTTCCTCCTGACCATCCTAGAAGTAGCAGTAGCCATGATCCAAGCCTATGTCTTCGTGCTCCTACTCAGCCTCTACCTACAAGAAAACATCTAACAC------CCAATGGCACACCAAGCACACTCTTACCACATAGTAGACCCCAGCCCATGACCTATCCTAGGAGCCGCCGCCGCCCTCCTAACTACTTCAGGACTCACCATGTGATTTCACTACAACTCCCCCTACCTCCTAATCATCGGCCTAACCTGCACCCTTCTAGTCATATTCCAATGATGACGCGACATTATTCGAGAAAGCACATTCCAAGGCCACCACACCCCCACCGTCCAAAAAGGCCTACGATACGGCATAGTACTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGTTTCTTCTGAGCATTCTTCCACTCAAGCCTAGCCCCCACCCCAGAACTAGGAGGCCAATGACCCCCTGTAGGAATCACTCCCCTAAACCCCATAGAAGTCCCCCTACTAAACACTGCTATCCTCCTCGCCTCAGGAGTCACTGTCACATGAGCCCACCACAGCATCACAGAAGCTCGCCGAAAACAAGCAATCCATGCCCTCACCCTAACAGTCCTCCTAGGCTTCTACTTCACCGCCCTCCAAGCCATGGAATACTACGAAGCCCCTTTCACTATCGCCGACGGAGTCTACGGCTCAACATTCTTCGTAGCCACAGGGTTCCACGGCCTGCATGTAATCATCGGCTCAACATTCCTCCTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAACCACCACTTCGGCTTTGAAGCAGCAGCCTGATACTGACACTTCGTAGACGTAGTATGACTCTTCCTTTACATTTCTATCTACTGATGAGGATCCTGCTCTTCTAGTATAATT-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAACCCCAGAGAAGAGCAATG---AACATAATCCTCTTCATACTCACTATATCTCTAACCCTAAGCATTCTCCTAACTGCCCTAAACTTCTGACTAGCCCAAATAAACCCAGACTCAGAAAAACTATCCCCCTACGAATGTGGGTTTGACCCACTAGGATCCGCCCGCCTCCCTTTTTCAATTCGATTCTTCCTAGTAGCAATCCTATTCCTTCTCTTCGACCTAGAAATCGCCCTCCTACTCCCCCTACCATGAGCAGTCCAACTCCAATCCCCCACTACCACACTAACCTGAGCCTCCATCCTCATCCTCCTCCTCACATTAGGCCTAATCTACGAATGGAACCAAGGAGGCCTAGAATGGGCAGAATA----------GAAAGTTAGTCTAACTAAGACAGTTGATTTCGGCTCAACAGATTATAGCTCACACCCTATAACTTTCTTCATGTCCCACCTACACTTCAGCTTCTACGCAGCCTTCACCCTGAGTACTCTAGGCCTAGCCTTCCACCGGACCCACCTAATCTCCGCCCTACTATGCTTAGAAAGCATGATACTATCAATGTACGTCGCCCTCACTATATGACCCATCCAAACACAAACACCATCATCCTCCATCCTACCCATCCTCATACTAACATTCTCCGCCTGCGAAGCAGGAACAGGACTAGCCCTACTAGTCGCCTCCACCCGGACCCACGGCTCCGACCACCTACATAACTTTAACCTACTACAATGCTAAAAATCATCATCCCAACCGCCATACTCCTACCCCTAACCCTCCTATCCCCATGCAAGCACCTATGAACTAACATTACAACACATAGCCTCCTAATCGCCGCCATCAGCCTCCAATGACTAACCCCCACATACTACCCAGGCAAAACCCTAAACCCCTGAGCCTCTGTCGACCAAATCTCCTCCCCCCTACTAGTCCTATCGTGCTGACTGCTCCCCCTCATAATCATAGCAAGCCAACATCACCTAGAACAAGAACCCACCATCCGTAAACGCATCTTTGCCGCTACTTTAGTCCTAGCCCAACCATTCATCCTACTAGCCTTCTCCGCCTCAGAACTAATACTATTCTACATCGCATTTGAAGCCACCCTAATCCCCACCCTAATCCTCATCACACGATGAGGTAACCAACCTGAACGACTGGGCGCCGGCATCTACCTCCTATTCTACACCCTAGCCAGCTCCCTCCCCCTACTAATCGCCATCCTGCACCTCCACAACCAAGTAGGCACACTATACTTCCCCCTGCTTAAACTCTCACACCCCACAACCCCAGCCTCCTGAACAGGCCTGATATCAGGCCTAGCCCTCCTACTAGCCTTCATGGTCAAAGCCCCCCTATACGGCCTACACCTCTGACTCCCCAAAGCCCACGTAGAAGCCCCAATTGCTGGATCCATACTACTAGCTGCCCTGCTCCTAAAACTAGGAGGCTACGGCATCATACGCATCACCCTACTGGTGAACCCATCAACAAACAACCTTCACTACCCCTTCATCACCCTAGCCCTATGAGGAGCCCTAATGACCAGCGCCATCTGCCTACGACAAATCGACCTAAAGTCGCTAATCGCGTACTCATCTGTCAGCCACATAGGCCTAGTTGTAGCCGCAACCATAATCCAAACTCAATGAGCATTCTCAGGGGCCATAATCCTAATAATCTCCCACGGCCTAACCTCCTCCATACTATTCTGCCTAGCCAACACCAACTACGAACGAACCCACAGCCGCATCCTCCTCCTCGCCCGAGGCCTCCAACCACTCCTACCCCTAATAGCCATCTGATGACTGTTAGCAAACCTAGCGAACATAGCCCTCCCCCCAACAACAAACCTCATAGCAGAACTAACCATCATCATCGCTCTCTTTAACTGATCCTCCCTAACACTCATCCTTACAGGGGCCGCAATCCTACTAACCGCCTCATACACCCTGCACATACTCATAACAACGCAACGAGGCACCCTACCCTCACACATCACATCCATCCAAAACACCTCCACACGAGAGCACCTCCTAATAGCACTACACACAATCCCCATATTCCTACTAATCCTCAAGCCCGAACTCATCTCAGGAGTTCCCATAT-GCAAGTATAGTTT-CAA-CCCAAACATTAGACTGTGACTCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGGG-AGGTTTCAAACAGCAGGAACTGCTAACTCTTGCATCTGAGTCTAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCCCTAGTCCTAAGCACATCAATATTATTAACTCTAGCAACCCTCCTCACCCCTATTATCTTTCCCCTCCTCTCAGATAACCTAAAAAACACTCCCACCACCATCACAAACACAGTAAAAGCATCCTTCCTAATCAGCCTAATCCCCATAACAATCTTCATCCACTCAGGGACAGAGGCCCTAATCTCCTTCTGAGAATGAAAATTCATTACAAACTTCAAAATCCCCATCAGCCTAAAAATAGACTTTTACTCCCTCACATTCTTCCCAATCGCCCTATTCGTGTCCTGATCCATCCTACAATTCGCAACCTGATACATAGCATCAGACCCCTACATCACAAAATTCTTTACCTACCTCCTATTCTTCCTAGTAGCAATACTCATCCTAATCATCGCTAACAACTTCTTTGTCCTCTTCATCGGCTGAGAAGGAGTCGGAATCATATCATTCCTCCTAATCAGCTGATGGCACGGACGAGCAGAAGCCAACACCGCCGCCCTACAAGCCGTACTATACAACCGAGTCGGAGACATTGGCCTCATCCTCTGCATAGCATGACTTGCCTCCTCCATAAACACCTGAGAAATCCAACAAGTCACCATACCCGCACAAACTCCCACACTCCCCCTCTTAGGCCTCATTCTAGCTGCAACAGGCAAATCTGCCCAATTCGGACTGCACCCATGACTCCCCGCAGCCATGGAAGGCCCAACTCCCGTATCCGCACTACTCCACTCCAGTACAATAGTGGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCCCTATTCAGCAACAACCAAACCGCCCTGACCCTATGCCTATGCCTGGGAGCCCTGTCAACACTATTTGCAGCCACATGTGCCCTCACTCAAAACGACATCAAAAAAATCATCGCCTTCTCCACCTCCAGCCAACTAGGCCTAATAATAGTAACAATCGGACTGAACCTCCCACAACTAGCCTTCCTGCACATTTCAACCCATGCATTCTTCAAAGCCATACTATTCCTATGTTCGGGCTCCATCATCCACAGCCTCAACGGCGAACAAGATATCCGAAAAATAGGAGGACTCCAAAAAATACTACCAACAACCACTTCATGCTTAACCATCGGCAACCTAGCCCTAATAGGAACACCATTCCTCGCAGGATTCTACTCAAAGGACCAGATCATCGAATGCTTAAACACATCCTACCTAAACACCTGAGCCCTACTCCTAACCCTCCTAGCCACATCCTTCGCCGCAGTATACACAATCCGCATAACCATTCTAGTCCAATCCGGGTTCGTCCGAATTCCTCCCCTCACCTCAATAAACGAAAACAACCCCGCAGTAATCTCCTCAATCACCCGCCTAGCACTAGGAAGCATTACCGCTGGATTCATCATCACCTCATTTATCCTCC---CCATAAAAACCCCACCCACCACCATACCCCTATACATCAAAATAACAGCCATACTCGTCACCGCCCTAGGAATCCTCCTAGCCCTAGAAATTTCAAAAATGACCCAAACCATAATCCTCACAAAACAAGGACGTTTCTCAAACTTCTCCACATCACTAGGCTACTTCAACCCCCTAGCACACCGCTTCACCACAACAACCCTCCTGAGCGGCGGCCAAAATATTGCCTCCCACCTAATCGACCTTTCCTGATACAAAAAACTAGGCCCAGAAGGCCTAGCCAACCTACAGACAATAGCAGCCAAAACTGCTACCACCCTCCACTCCGGCCTAATTAAAGCCTACCTAGGATCTTTCGCCCTCTCCATCCTCATCGTCCTCA---TATCCACATACAGAAC------C-CTCTAATGGCCCTCAATCTACGTAAAAATCACCCACTTCTCAAAACCATCAACAACGCTCTAATCGATCTCCCTACACCATCAAACATTTCATCCTGATGAAACTTCGGATCACTCCTAGGTATTTGCCTAATCACACAAATTGTCACCGGCCTACTACTAGCAACTCACTACACAGCGGACACCTCCCTAGCCTTCAACTCAGTAGCCCACATATGCCGAAACGTTCAATTTGGCTGACTAATCCGAAACCTCCACGCAAACGGAGCCTCATTATTCTTCATCTGCATCTATCTCCACATCGGCCGAGGGTTTTACTACGGATCATACCTCAACAAAGAAACCTGAAACATCGGAGTAATCCTACTGCTAACCCTAATAGCCACTGCTTTCGTAGGCTACGTACTGCCCTGAGGACAAATATCATTCTGAGGGGCCACAGTAATCACCAACCTATTCTCAGCTATCCCCTACATTGGCCAAACACTAGTAGAATGAGCCTGAGGCGGATTCTCAGTCGACAACCCTACACTAACACGATTCTTCGCCCTACACTTCCTCCTGCCCTTCCTCATTGCAGGCCTAACACTAGTCCACCTCACCCTCCTCCATGAAACAGGATCAAACAACCCCCTAGGAATCCCCTCAGACTGTGACAAAATCCCATTCCACCCATACTACTCCGTAAAAGACATTCTAGGCTTTGCACTAATACTGATCCTGCTTGTCTCACTAGCCCTATTCTCCCCAAATCTACTAGGCGACCCAGAAAACTTCACACCAGCCAACCCCCTAGCTACACCTCCCCACATCAAACCCGAATGATATTTCCTATTCGCGTACGCCATTCTCCGCTCTATTCCAAACAAACTAGGAGGCGTACTCGCCCTAGCCGCCTCCGTCCTAGTCCTATTCCTCATCCCACTCCTCCACACTTCCAAACTACGCTCAATGACCTTCCGACCCCTATCACAAATCCTATTCTGAACTCTAGTAGCTAACCTCCTCATCCTAACCTGAGTCGGGAGCCAACCTGTCGAACATCCATTCATCATCATCGGCCAATTAGCCTCCCTCTCCTACTTCACAATCATTCTAGTCCTATTCCCCCTCGCAGCCGTACTAGAAAACAAAATACTAAAACT----------CTA-ACC-----------CACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTCAACCCCTTCTTAGAGTT Gymnomystax_mexicanus_JX516075 GTCTTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CAAA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCGATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTGAGCCGTCGCAAGCCCAAGATGT-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGACCCAAACTGGGATTAGATACCCCACTATGCCCGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCCACA--CTGAAGGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGCAATGGGCTACATTTTCTAAGCTAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACATGTACATACCGCCCGTCACCCTCCTCGCAGG-CG--CCCCCCCCCCCCCCATAAAATAATAAGCTAT-CC--AGCTGAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATATCTGCTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AACCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-A-A-AACCC----AACTAAAGCATT---T--ATTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAGCAGTG-AAA---AAACTAAGCTA-CAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTCACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAA-CCTAA-AACCCTA--ATGAAGT---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCAA-CGAGCGGATA----AAT--ACCAACCCC-CCTAAC-TGAATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACCTCATGACTCCCT-CCCCATTAACAGGCCAACCTATATTCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-CCCCCA-GTATACGA--CAAAT---------CAA---ACAAGCA-CAG-TATTA-AACATA-TTGTTAACCCGACAGA-GGAGCGTCCGTT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCGGCCACC--TTAAAA-CACACA----CT-CACCCA--C-T-GGGTTCACTGAC-ACA-TAA-GA-T-TTTGGCC-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAAACCTCCAA-AAATTGGACCACACCTCTAGACTG-AGAGCGACCTCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--T-TAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---AA-----CT--AC--C----ATGAC----------CAACTACCCACTTCTGATCAACTTCATCATAGCCCTATCCTATGCCCTACCAATCTTAATCGCAGTAGCTTTCCTTACACTAGTAGAGCGTAAAATCTTGAGTTACATGCAAGGCCGAAAGGGCCCAAACATTGTCGGCCCCTTTGGACTCCTCCAACCCCTGGCAGACGGTGTCAAACTGTTCATCAAAGAGCCCATCCGAC---------CATCAACGTCCTCCCCGATTCTATTCGTTGCAACCCCAGTCCTAGCTCTTCTCCTGGCCATCTCAATCTGAACCCCATTACCCCTCCCATTCTCTCTAGCAGACCTCAATCTGGGACTCCTTTTCCTACTAGCCATATCAAGCCTAGCAGTATACTCTATCCTATGATCAGGCTGAGCCTCCAATTCCAAATACGCCCTGATTGGAGCATTACGAGCAGTAGCCCAGACAATTTCCTACGAGGTAACTCTAGCTATCATCCTTCTCTCTGTTGTCCTCCTTAGTGGCAACTACACCCTGAACACCCTCGCAGTAACCCAAGAACCTTTATACCTTATCTTCTCCTGCTGACCCCTCGCTATAATGTGATACGTCTCCACACTAGCTGAAACCAACCGTGCCCCTTTTGACCTGACAGAAGGAGAGTCTGAACTGGTGTCCGGATTCAACGTAGAATACGCAGCAGGTCCTTTTGCACTATTCTTTCTAGCCGAGTACGCCAATATTATACTCATAAACACACTAACCGTAATCCTATTCTTCAACCCTAGCCTATTCAACCCACCTCAAGAACTGTTCCCCGTCATCCTAGCCACAAAAGTCCTGCTTTTATCGGCAGGATTCCTATGAATTCGTGCCTCCTATCCACGATTCCGATACGACCAATTAATGCACTTACTATGAAAAAATTTCTTACCTCTCACACTAGCCCTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGTCTGCCC-----CCCTACCTG-A--GG-CC-----------TTGTTGGAAATGTGCCTGAACAT-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-A--CTAA-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAACCCTCCATACTCCCTTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTAATTTTTGTCGCTAGCCTACTCCTAGGGACAACTATCACCATCTCAAGTAACCACTGAATCA---TAGCTTGAACCGGCCTTGAAATTAATACACTTGCCATCCTCCCATTAATCTCCAAATCCCACCACCCACGAGCCATTGAGGCCGCCACTAAATACTTCCTAACCCAAGCAGCTGCCTCTGCCCTCGTCTTATTCTCCAGCATAACCAATGCATGACACACCGGACAATGAGACATCACCCAACTTACCCATCCAATATCCTGCCTGATTCTTACCTCGGCAATCGCAATAAAACTAGGACTAGTGCCATTCCACTTCTGATTCCCAGAAGTGCTCCAAGGCTCTCCCCTCACCACTGGCCTACTCCTATCTACTGCCATAAAACTACCCCCAATCACATTACTCTACATAACCTCCCAATCACTAAACCCCACACTATTAACCACCTTAGCCATCCTATCTGCAGCCCTCGGGGGCTGAATGGGCCTCAACCAGACACAAATCCGAAAAATCCTGGCTTTCTCCTCCATTTCCCACTTAGGCTGAATAGCAATCATCATCATCTACAACCCCAAACTCACACTCCTCAATTTCTACCTGTATGCCGTAATAACCGCAACCGTCTTCCTCACCCTAAACACAATTAAAGTGCTAAAACTATCTACCCTAATAACCGCATGAACTAAAACCCCATTCTTAAACGCAATGCTACTCCTAACTCTGCTTTCACTAGCAGGACTGCCCCCTCTAACAGGATTCCTGCCCAAATGACTTATCATCCAAGAACTAACTAAACAAGAAATAATCCCAGCAGCCACACTCATCTCCCTACTCTCCCTGCTAAGCTTATTCTTCTACCTCCGACTAGCATACTGTGCAACCATCACACTCCCCCCACATACTACGAATCACATGAAACAATGACGCACTAACAAACCAACTAACATCGCAATCGCCATCCTAACCACTATGTCCGTCATACTCCTCCCTATCTCTCCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-A--CAAC-CCCCTAGGCAGATGGGCTTCGATCCCATGATAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACCCCGGCGCATGA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGTC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCAGTGACATTCATTAACCGATGATTATTCTCAACTAACCACAAAGACATTGGGACCCTATACTTAATTTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATCTTTTTCATAGTCATGCCAATTATAATCGGAGGGTTCGGGAACTGACTAGTACCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGGATAAACAACATAAGCTTCTGACTACTTCCACCATCCTTCCTCCTCCTCCTAGCATCCTCCACAGTTGAAGCAGGAGTAGGAACAGGCTGAACAGTGTACCCTCCACTAGCAGGTAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCAATTTTCTCCCTACATCTGGCCGGTATCTCCTCAATCCTAGGAGCAATCAATTTCATTACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTATTACTCCTATCTCTCCCAGTTCTCGCTGCAGGAATCACAATACTTCTCACAGACCGAAACCTTAACACCACATTCTTTGACCCTGCCGGAGGAGGAGACCCTGTACTGTACCAACACCTATTCTGATTTTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTCGGGATCATCTCCCACGTTGTAGCCTACTACTCGGGCAAAAAAGAACCATTCGGATATATAGGAATAGTATGAGCCATGCTATCCATCGGATTCCTAGGCTTCATTGTCTGAGCCCACCACATATTCACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACGTCTGCCACTATAATTATTGCTATCCCAACCGGAATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCCCTAGGATTTATCTTCCTATTTACTATCGGAGGACTTACAGGAATCGTCTTAGCAAACTCCTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTGCTATCCATAGGAGCAGTATTCGCAATTCTAGCAGGATTCACCCACTGATTCCCCCTATTCACCGGATACACACTCCACTCAACATGAGCCAAAACACATTTCGGCGTAATGTTCGTAGGTGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGGAACACTATTTCCTCAGTGGGCTCACTCATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGGGAGGCCTTCGCATCAAAACGTAAAGTCCTACGACCAGAGCTAATAAGCACTAACGTAGAATGAATACACGGCTGCCCACCCCCATTCCACACCTTCGAAGAGCCCGCCTTCGTCCAAACC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCC-----ACCC--AAACATGGCCAACCACTCACAACTTAACTTCCAAGACGCCGCCTCACCCATTATAGAAGAACTAATAGGATTCCACGACCACGCCCTAATAATCGCACTAGCAATCTGTAGCCTCGTACTCTACCTACTAACCCATACCCTCACAGAAAAACTGACATCAAACACAGTCAACGCACAAGTAATCGAGCTAATCTGAACAATTATCCCTGCCCTAGTCCTAGTCACACTCGCCCTACCATCCCTACGAATTCTTTACATGATAGACGAAATCAACGAACCAGACCTAACTCTAAAAGCCATCGGCCACCAATGATACTGAACCTACGAGTATACTGACAACAAAGACCTAACATTCGACTCCTACATAATCCAAACAGCAGACCTACCCCTAGGACACTTCCGCCTACTAGAAGTCGACCATCGAGTTGTCGTCCCCATAAACTCAACCATCCGAGTCATCGCTACCGCTGACGACGTTCTACACTCATGAGCTGTCCCAAGCCTAGGTGTAAAAATCGACGCAATCCCAGGACGCCTCAACCAAACTTCCTTCCTAGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGTGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAGTCCACCCCCCTCGCCAACTTCGAAAGCTGATTCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGA--TCCATCCCTCCTTAATGATATGCCTCAACTAAACCCAAACCCCTGATTTTTTATCATGATCACTTCGTGAATCACTTTCTCCCTAATCATCCAACCCAAAATCTTAACGTTCGTGTCAATAAATCCCCCATCTAACAAAC---CGCCAGCCGCTCCAAGCACTACTCCTTGAACCTGACCATGAGCCTAAACTTCTTCGATCAATTCTCAAGCCCATCATTCCTAGGAATCCCACTAATCCTAATTTCAATAACATTCCCAGCCCTTCTCCTACCATCCCTTGACAACCGATGAATCACTAACCGACTATCAACCCTCCAACTTTGATTCATCAATCTAGTCACAAAACAATTAATAACACCCCTAGACAAAAAAGGACATAAATGAGCCCTAATCTTAACATCCCTCATAATCTTTCTCCTCCTTATCAACCTCCTAGGCCTGCTACCATACACATTCACCCCAACCACCCAACTATCTATAAACTTAGCCCTGGCCTTCCCTCTATGACTAGCCACACTCCTAACAGGACTGCGAAACCAACCCTCCATCTCGCTAGGCCACCTCCTACCAGAGGGCACACCCACCCCACTAATCCCAGCCCTCATCCTAATCGAAACAACAAGCCTCCTCATCCGCCCACTAGCACTGGGCGTGCGCCTAACAGCCAACCTAACAGCAGGCCACCTACTCATCCAACTAATCTCCACCGCCACAATAACCCTATCCTCCACAATACCAATAGTTTCCCTCCTAACCTTTGTAGTCCTCTTCCTACTAACAATCCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTCTTCGTGCTTCTACTAAGCCTATACCTCCAAGAAAACATCTAAGTA--CA----AATGGCACACCAAGCACATTCCTACCACATAGTTGACCCCAGCCCATGACCTATCCTAGGAGCAGCCGCTGCTTTCCTTACTACCTCAGGACTAACCATATGATTCCACTGAAACTCCCCCCAACTCCTCATCCTAGGCCTACTATCAACCATCCTCGTCATATTCCAATGATGACGTGACATTGTACGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGACTACGATACGGAATAGCCTTATTCATCACATCAGAAGCTTTCTTCTTCCTAGGCTTTTTCTGAGCCTTCTTCCACTCAAGCCTGGCCCCCACACCAGAACTGGGGGGTCAATGACCACCCGTTGGAATTAAACCCCTCAACCCCATAGAAGTTCCACTCCTAAACACTGCCATCCTCCTAGCCTCAGGAGTCACCGTCACATGAGCCCACCACAGTATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTATCCCTGACAGTCCTCCTAGGCTTCTACTTCACAGCCCTACAAGCCATAGAGTACTATGAAGCACCATTCTCCATCGCTGACGGAGTTTACGGTTCAACCTTCTTCGTAGCCACCGGATTCCACGGCCTGCATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCTTAATCAAATACCACTTCACGTCAAACCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTTGTATGATTACTCCTCTACATCTCTATCTACTGATGAGGATCTTGCTCTTCTAGTATATCA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTAACCCTATCACTAACCCTAAGCATCCTCCTAACCATACTAAACTTCTGACTTGCCCAAATAACCCCAGACTCAGAAAAACTATCACCATACGAATGCGGGTTCGACCCATTAGGTTCCGCTCGACTACCCTTCTCAATCCGCTTCTTCCTAGTAGCCATCCTATTCCTCCTATTCGACCTAGAAATCGCCCTACTCCTCCCGCTACCCTGAGCCACCCAACTACAATCTCCCACTACCACCCTAACCTGAGCTGCCACACTCATCCTTCTACTCACCCTAGGCCTAGTGTACGAATGAATTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCAACCCTATAACTTTCTTTATGTCCTACCTCCACCTAAGCTTCTACTCAGCCTTCGTCCTAAGCAGCCTTGGCCTAGCCTTCCACCGAACCCACCTAATTTCCGCCCTACTATGTTTAGAGAGCATAATACTATCCATGTACGTCGCTCTAGCCATATGACCCATCCAAACCCAATCATCAGTATCCACTATCCTACCAATCCTCATACTAACATTTTCCGCCTGCGAAGCAGCCACAGGCCTAGCATTACTAGTAGCCTCAACCCGCACCCACGGATCCGACCACCTACACAACTTTAACCTCCTACGATGCTAAAAATCATCATCCCAACCACAACACTACTCCCCTTAGCCCTCCTCTCCCCATGCAAACACCTATGAACTAACATCACACTGTATAGCCTACTAATCGCTACCATCAGCCTTCAATGATTTACCCCCACATACTACCCAAGCAAAAGCCTAACCCCCTGAACATCAATCGACCAAATCTCCTCACCCTTACTAGTCCTCTCATGCTGACTCCTCCCCCTCATAATCATAGCAAGCCAAAACCATCTAGAACAAGAACCCTCCAGCCGCAAACGAATCTTTGCCTCAACACTAATCCTAGCCCAACTATCCCTCCTCCTAGCCTTCTCAGCCTCTGAACTAATACTCTTCTACATCGCATTCGAAGCCACCCTCATTCCCACCCTAATCCTCATCACACGATGAGGAAGCCAACCAGAACGTCTAAAAGCTGGCATTTACCTCCTATTCTACACCCTCGCCAGCTCACTACCACTATTAATTGCTATCCTCCACCTACAAAACCAAATTGGCTCACTCTACCTACCAATACTCAAACTTTCACACCCAACATTAACCCCATCCTGATCAAGCCTAGCTGCAAGCCTAGCCCTCATGCTAGCCTTCATAGTCAAAGCCCCACTATACGGCCTACACCTATGACTCCCCAAAGCCCACGTAGAAGCCCCAATTGCCGGCTCCATACTACTAGCAGCCCTACTACTAAAACTCGGGGGCTACGGCATTATACGAATAACAATCCTAGTAAACCCATCATCAAACAACCTCCACTACCCATTCATCACCCTGGCCCTATGAGGAGCAGTAATAACCAGCGCCATTTGCCTACGCCAAATTGACCTAAAATCACTAATTGCTTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGGGCAATAATACTAATAATCTCCCACGGCCTAACATCCTCAATACTATTCTGCCTAGCCAATACTAACTACGAACGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCTCTCCTACCACTTATAGCCATCTGATGACTACTAGCTAACCTAACAAACATAGCCCTCCCCCCAACAACAAACCTCATAGCAGAATTAACCATTGTAGTAGCGCTTTTCAACTGATCCGCCCTAACAATGATTCTAACAGGAACTGCCATCCTACTCACCGCCTCATACACCCTATATATACTAATTATAACACAACGAGGTACCCTCCCATCCCACATCACATCAATCCAAAACTCCTCCACACGAGAGCATCTCCTCATAGCCCTACACATAATCCCCATAGTCCTACTAATCTTCAAACCCGAACTGATCTCCGGCATCCCCGCAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAGCGAGAACTGCTAACTCTTGCATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTAACCCTAGCAACCCTTTCCACCCCCATCCTACTTCCACTACTATCCAACAACCTCAAAAACACCCCCATCACAATCACAAACACAGTAAAAACCTCATTCCTAATCAGTTTAGTCCCCATAACAATTTTCATCTACTCCGGAACAGAAAACCTCACTTTCCTATGAGAATGAAAATTCATCATAACCTTCAAAATCCCAGTCAGCCTAAAAATAGACTTCTACACACTCACCTTCTTCCCCATCGCACTATTCGTATCATGATCCATCCTACAATTTGCAACATGATACATAGCCTCAGATCCTTACATCACAAAATTCTTCACCTACCTCCTATTCTTCCTAATCGCCATACTCATCCTAATCATCGCCAACAACCTATTTGTCCTATTCATTGGTTGAGAAGGGGTTGGGATTATATCTTTCCTCCTAATCAGCTGATGGCACGGCCGAGCAGAAGCTAACACCGCTGCCCTACAAGCCGTCCTCTACAACCGAATCGGTGACATTGGCCTTATCCTATGCATAGCATGACTAGCCTCCACCACAAACACCTGAGAAATCCAACAACTCCCCACCTCCTCCCAAACCCCGACATTACCCTTGCTAGGCCTCATCTTAGCCGCAGCCGGAAAATCCGCCCAATTCGGCCTGCACCCATGACTTCCAGCTGCAATAGAAGGACCAACCCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCAGGGATCTTCCTACTGATCCGAACCCACCCCCTATTCAACAACAACCAAACCGCCCTAACCCTATGCCTCTGCCTAGGAGCCATCTCCACCTTATTCGCAGCCACATGCGCCCTCACCCAAAACGACATTAAAAAAATCATTGCCTTCTCCACCTCCAGCCAACTAGGCCTAATAATAGTAACAATCGGACTAAATCTACCCGAACTAGCCTTCCTCCATATCTCCACCCACGCATTCTTCAAAGCCATACTCTTCCTGTGCTCAGGTTCCATCATCCACAACCTAAATGGCGAACAAGACATCCGAAAAATAGGAGGACTCCAAAAAATACTACCTACAACAACCGCATGCCTCACAATCGGCAACCTTGCCCTAATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCTTAAACACATCCTACCTAAACACCTGAGCCCTGGTCCTAACCCTCCTAGCCACATCATTCACCGCAGTATACACAATCCGCATGACCGTACTAGTACAAACCGGCTTCGTCCGAATTCCCCCTCTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCCCCCATCACCCGCCTTGCACTAGGAAGCATCCTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACAAAAACCCCTCCAATAACTATGCCCCTCCACATTAAAATAACCGCTTTAGTAGTAACAGCCTTAGGAATCGCCCTAGCCCTAGAAATCACAAAAATAGCCCAAACACTCATCCTCACAAAACAAACCCCTTTCTCGAACTTCTCAACCTCCCTAGGATACTTCAACCCCCTAGCCCATCGCCTAACCATGACCAACTCCCTCAAAGGAGGACAGAACATCGCCTCCCACTTAATCGACCTATCCTGATACAAAATGCTAGGCCCAGAAGGGTTAGCCAGCCTACAACTAGCGGCAACCAAAACCGCCACTACCCTCCACTCGGGCCTAATCAAAGCCTACTTAGGGTCATTCGCCCTATCCATTCTCATCATCCTCA---TATCCACACTCAGAAA--CAA-C-C---AATGGCCCTCAACCTTCGTAAAAACCACCAAATCCTCAAAATCATCAACAACGCCTTAATTGATCTCCCAGCTCCATCAAACATTTCAACATGATGAAACTTCGGATCACTACTAGGCGTTTGCTTAATTACTCAAATCGTTACAGGTCTTCTGCTATCCATACACTACACAGCAGACATCAACCTAGCCTTCTCCTCAGTAGCCCACATATGCCGAGACGTACAATTTGGCTGACTCATCCGTAACCTCCATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGTCTCTATTACGGCTCATACCTGAACAAAGAGACCTGAAACATCGGAATCATTCTACTCCTAGCCCTAATAGCAACCGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATTACAAACCTATTTTCAGCCATCCCATACATCGGACAAACACTAGTAGAGTGAGCTTGAGGAGGGTTCTCCGTTGATAACCCCACACTAACTCGATTCTTCGCCCTCCACTTCTTACTTCCCTTCGTCATCGTAGGATTCACCCTAGTCCATCTAACTCTCCTCCACGAAACTGGATCAAACAACCCACTAGGCATCCCATCAGACTGCGACAAAATCCCCTTCCACCCATATTACACCATCAAAGACATCCTAGGATTCGTCCTAATACTCTCCCTACTCGTCTCACTAGCCCTATTCTCCCCAAACCTTCTAGGAGACCCAGAAAACTTCACCCCAGCCAACCCACTAGTCACCCCTCCACACATCAAACCTGAATGATACTTCCTGTTTGCCTACGCTATCCTCCGATCCATCCCAAACAAACTAGGAGGTGTACTAGCCCTGGCCGCCTCAATCCTAGTCCTATTCCTCGTTCCACTCCTACACACATCAAAACTACGATCAATGACCTTCCGCCCTCTATCACAAATCCTATTCTGAACCCTAGTAGCCAACATCCTCATCCTAACCTGAGTGGGCAGCCAACCAGTAGAACACCCATTCATCATCATTGGCCAACTAGCCTCACTCTCATACTTCACAATCATCCTAGTCCTATTCCCCCTTGCGGCTCTCTTAGAGAACAAAATCCTCAAACT----------TTA-ATA-----------TACTCTAATAGTTTATG-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Hemignathus_flavus GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCGCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAGACGCCTCGCACTTGCCACGCCCCCACGGGTATTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-----TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TCATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCAAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CC--GCCCCCCCCCCC??ATAAATTAATAAGCCAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAATCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ATACCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCCACT--TC-ATA-CACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCTAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AAGGAC-TT-ACCAAT-TATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAT-TTCACAAAAATATAAA-AACAATATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--CTAAT---------CAA---ACAAGCA-AAG-TATTA-AGCACA-TTGTTAACCCGACAAA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTTCAAAAGCAGGGATAAGCACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACTTA----CT-CACCCA--C-C-GGGTTCACTGTT-ACA-TAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AGAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAGACAACTAAATTACAAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---CA-----ACAACC--C----ATGAC----------TAACCACCCCCTACTAATTAACCTAATCATATCCCTTTCCTACGCCCTCCCAATCTTGATTGCAGTAGCCTTCCTAACACTAGTAGAGCGCAAAATCTTAAGTTACATACAGAATCGAAAAGGCCCTAACATTGTAGGACCATACGGCCTCCTGCAGCCCCTAGCAGACGGAGTGAAACTATTCATTAAAGAGCCCATCCGAC---------CTTCAACATCCTCCCCAATTCTATTCCTTGCAACTCCAATACTAGCCCTTCTCCTGGCAATTTCAATCTGAGCCCCCCTACCCTTACCCTTTTCATTAGCAGACCTTAATCTAGGCCTACTATTCTTACTGGCCATATCAAGCCTAGCAGTGTACTCTATCCTCTGATCTGGTTGAGCCTCTAACTCAAAATACGCACTAATTGGCGCACTACGAGCAGTAGCCCAAACAATCTCATATGAAGTAACCCTAGCCATTATCCTCCTATCTGTTGTACTCCTTAGCGGCAACTACGCCCTAAGCACTCTTGCAGTCACTCAGGAGCCCTTATATCTTATTTTCTCATGCTGGCCCCTCGCTATAATATGATACGTCTCCACGCTTGCTGAGACCAATCGTGCTCCCTTTGACCTAACAGAAGGAGAGTCCGAACTAGTGTCTGGGTTCAACGTAGAATATGCAGCTGGCCCTTTCGCACTCTTTTTCTTAGCTGAATACGCCAATATTATACTTATAAACACTATCACCACAATCCTCTTCTTCAATCCAAGCCTCCTTAACCTCCCCCAAGAACTATTCCCCGTAGTGCTAGCCACAAAAGTCCTACTACTATCAGCAGGGTTTCTATGAATTCGTGCCTCCTACCCACGATTCCGATACGACCAGCTAATGCACCTACTATGAAAAAACTTCCTACCACTTACACTTGCTCTATGTCTCTGGCACACCAGCATGCCAATTTGCTATGCGGGATTACCC-----CCCTATCTA-A--GA--------------CCACCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-A--CAAC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACTCCTTCCCCTGCTA-ATGAATCCCCAAGCAAAACTAATCTTCATAATTAGCCTCCTCCTGGGGACTGCCATCACAATCTCGAGCAACCACTGAATCA---TAGCTTGAGCCGGCCTCGAGATCAACACACTTGCCGTCCTACCATTAATCTCAAAATCTCACCACCCACGATCCATTGAAGCAGCTACTAAGTACTTCCTAACCCAAGCAGCTGCCTCCGCCCTAGTCTTATTCTCCAGCATGACCAATGCATGGCACACCGGACAATGAGACATTACCCAACTAACCCATCCAACATCTAGCCTAATCCTGACTTCGGCAATTGCAATGAAATTAGGCCTAGTCCCATTCCACTTCTGATTCCCAGAAGTACTACAAGGTTCCCCTCTCCCCACCGGTCTCCTGCTATCTACTATCATAAAACTACCCCCAATTACTCTCCTGTACATAACTTCTCCATCACTAAACCCCACACTCCTGACTACCCTGGCTGTCCTCTCAGCAGCCATCGGAGGGTGAATAGGCCTCAATCAAACACAAATTCGAAAGATCCTAGCCTTCTCCTCCATCTCACATCTTGGCTGAATAGCAATTATCATCATCTACAACCCCAAACTTACCCTCCTTAACTTCTACCTATACACTATAATGACTGCAACCATCTTCCTCACCTTAAATTCAATTAAAGTAATAAAACTATCTACCCTAATGACTATATGAACCAAAGTCCCCTCATTAAATTCAATACTACTCTTAACTTTACTTTCCCTTGCAGGACTTCCCCCCTTAACAGGATTTCTACCCAAATGACTCATCATCCAAGAACTGACCAAACAAGAAATAATCCCCGCAGCCACACTCATATCCCTCCTCTCACTGCTAAGCCTATTCTTCTACCTTCGCCTTGCATACTGCACAACAATCACACTCCCACCACACACCACAAACCATATAAAACAATGACGCACCAGCAAATCAACCAACATTGTGATTGCTGTCCTAACTACAATATCCCTCATCCTTCTCCCTATCTCGCCTATAATCCTCTCCATTAT------TT----AAGGAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTGTTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAG-CACACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACATGA-TCAATGTACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTATGACATTCATTAATCGATGATTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTCCTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCCTTTGTAATAATTTTCTTCATAGTCATGCCTATTATAATCGGAGGGTTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGTTTCTGACTACTTCCTCCATCATTCCTCCTCCTACTGGCCTCTTCCACTGTCGAAGCAGGAGTTGGTACAGGCTGAACAGTATACCCCCCACTAGCTGGTAACCTCGCCCACGCCGGAGCCTCAGTTGATCTCGCAATCTTCTCCCTACATCTGGCCGGCATCTCCTCAATCCTAGGGGCAATCAATTTCATCACAACAGCCCTCAACATAAAACCCCCAGCCCTATCACAATACCAAACTCCCCTATTCGTATGGTCCGTATTAATCACCGCAGTACTTCTGCTCCTCTCCCTTCCTGTACTTGCCGCTGGAATCACAATGCTTCTAACAGACCGCAACCTCAACACTACATTCTTCGACCCAGCAGGAGGAGGTGACCCAGTCCTGTATCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATTCTACCAGGATTCGGGATCATTTCTCACGTCGTAACCTACTACGCAGGAAAAAAAGAACCATTCGGTTACATAGGAATAGTATGAGCCATGCTATCCATCGGGTTCCTAGGATTCATCGTTTGAGCCCACCACATATTCACAGTCGGAATAGACGTTGACACTCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACTGGCATTAAAGTATTCAGCTGACTAGCCACACTTCATGGAGGCGTAATCAAATGAGACCCACCAATACTATGAGCCCTAGGATTTATCTTCCTATTTACCATTGGAGGACTGACTGGAATTGTCCTAGCAAACTCCTCACTAGACATCGCACTACACGATACCTACTACGTAGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCAGTGTTTGCAATCCTAGCTGGTTTCACACACTGATTCCCCCTATTCACTGGATACACTCTCCACTCAACATGAGCCAAAGCTCACTTCGGCGTAATATTCGTAGGAGTCAACTTAACCTTCTTCCCTCAACATTTCCTAGGCCTAGCCGGTATACCACGTCGATACTCAGACTACCCTGACGCCTACACCCTATGAAACACTATCTCCTCAGTAGGATCACTCATCTCCCTAACAGCCGTAATCATACTAGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--GAACCACTTATGCTTCTTTCTC---AT---AGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAAGTGAAACCCCTGCACATCTCTT---CATCC--AAACATGGCTAACCACTCACAACTCAACTTTCAAGACGCTTCCTCCCCAATCATAGAAGAACTGATAGGATTCCACGACCACGCTATAATAATCGCATTAGCAATCTGCAGCCTAGTGCTTTACCTTCTAACTCATATAATAACAGGAAAACTCTCATCCAACACAGTAGACGCACAAGAAATTGAACTTGTCTGAACAATTCTCCCAGCCATAGTTCTAATTACACTTGCCTTACCATCCCTACGAATTCTATATATGATAGACGAAATCAACGAACCTGATCTAACCCTAAAAGCCATCGGCCACCAATGATATTGAACATATGAATACACCGACCTCAAAGACTTTACATTCGACTCCTACATAATCCCAACATCGGACCTACCTCTAGGACACTTCCGACTACTAGAAGTCGACCACCGCGTTGTAGTTCCAATAAGCTCTACAGTCCGAGTAATTGTCACCGCCGATGACGTACTTCACTCATGAGCAGTCCCAAGCCTAGGAGTAAAAACCGACGCAATCCCAGGACGCTTAAACCAAACTTCCTTCCTTGCCTCTCGACCTGGAGTTTTCTACGGACAGTGCTCAGAGATCTGTGGGGCTAACCACAGCTTCATACCAATCGTAGTAGAATCAACTCCTCTCGCTAACTTCGAAAGCTGATCCTCCCTAA---CAGCCTCCT----------CATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-ACT-CCCCTCCTTAATGATATGCCTCAACTAAACCCCGCGCCTTGATTTTTTATCATGATCATTTCATGACTGACCTTCTCCCTCATCATTCAACCCAAACTCCTCTCATTCGTATCAATAAACCCTCCATCCAACAAAC---CACCTATTGCTCCAAGCACTACCCCCTGAACTTGACCATGAACTTAAGTTTCTTCGACCAATTTTCAAGCCCATCCTTCCTAGGAATCCCACTCATCCTCATCTCAATAACATTTCCAGCCCTCTTAATCCCTTCGCTAGACAACCGATGAATCACCAACCGACTCTCAACTCTTCAACTATGGTTCGTCAACCTAGTTACAAAACAACTAATAATACCCTTAGACAAAAAAGGACACAAATGAGCCCTGATCCTAACATCCTTAATAATCTTCCTACTACTAATCAACCTCCTAGGCCTACTCCCATATACATTCACCCCAACCACCCAACTATCTATAAACCTAGCCCTAGCCTTCCCCCTATGACTTGCTACCCTACTAACAGGCCTGCGGAACCAACCTTCCATCTCGCTAGGTCATCTACTTCCAGAAGGAACCCCAACCCCACTAATCCCTGCTTTAATCTTAATCGAAACAACAAGCCTACTAATCCGACCCCTAGCCCTAGGCGTACGCCTAACAGCCAACCTTACAGCAGGACACCTGCTAATCCAACTCATCTCCACAGCCACAACAGCCCTGCTCCCTACAATACCAGCAGTCTCACTTCTAACCCTATTAGTCCTATTCTTACTGACTATCCTAGAAGTAGCAGTGGCAATAATTCAAGCCTACGTCTTCGTACTCCTACTAAGCCTCTACCTACAAGAAAACATCTAACAC--CC--ACAATGGCACACCAAGCACATTCTTACCACATAGTAGACCCCAGCCCATGACCTATTCTAGGAGCCGCCGCCGCCCTCCTAACCACCTCAGGACTCACAATGTGATTCCACTGAAATTCACCTCAACTCCTCATCCTAGGCTTACTCTCCACTTCCCTAGTTATATTCCAATGATGACGTGACATTGTCCGAGAAAGCACATTCCAAGGACACCACACCCCCACTGTACAAAAAGGCCTACGATACGGTATAGTCCTATTCATCACATCTGAAGCATTCTTCTTTCTTGGCTTTTTCTGAGCATTCTTCCACTCAAGCTTAGCCCCTACCCCAGAACTAGGAGGGCAATGACCACCTGTAGGAATCAAACCCCTAAACCCCATAGACGTACCACTACTAAACACTGCCATCCTCCTAGCTTCCGGAGTTACCGTAACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCACTCACCCTAACCGTTCTCCTAGGCTTCTACTTCACTGCACTACAAGCCATAGAATACTACGAAGCACCATTCTCCATTGCAGACGGAGTCTACGGCTCTACATTCTTTGTCGCCACCGGATTCCATGGCCTACATGTAATCATCGGTTCTACATTCCTGTTAGTATGCCTATTACGCCTAATCAAATACCACTTCACATCAGGACACCACTTTGGATTCGAAGCAGCTGCCTGATACTGACATTTCGTAGACGTCGTATGGCTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTT-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTTATACTAACTCTGTCACTCACCCTAAGCGTCCTACTAACCGCACTAAACTTCTGACTAGCACAAATAAACCCAGACTCAGAAAAACTATCCCCCTACGAATGTGGATTCGACCCCCTAGGATCTGCTCGACTTCCATTCTCAATCCGATTCTTCCTGGTGGCTATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTCCCACTCCCATGAGCCATCCAACTAGAATCCCCCACCACTACCCTAATCTGAACCTCCTTCCTCCTCTTTTTACTAACACTAGGACTGATCTACGAATGAATCCAAGGGGGACTAGAATGAGCAGAATA-G------TAGAAAGTTAGTCTAACCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTTATGTCCTACCTCCACCTTAGTTTCTACTCAGCCTTCACTCTAAGCAGCCTAGGCCTAGCTTTCCATCGTACCCACCTAATTTCAGCCCTACTATGTCTAGAAAGCATAATACTATCCATATATGTAGCACTCGCCATATGACCCATCCAAATACAATCATCATCCTCTACCATCCTACCAATTATTATACTAACCTTCTCCGCCTGCGAAGCCGGCACAGGCCTGGCCCTACTAGTAGCTTCCACCCGAACTCACGGCTCAGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATTATCATTCCAACTGCAACGCTCCTACCCCTAGTCCTCGTATCTCCACTCAAACACCTATGAACTAACATTACACTCCACAGCTTACTCATTGCTACCATCAGCCTACAATGACTAGCACCTACATACTACCCAAGCAAAAGCCTAACCCCCTGAACCTCAATCGACCAAATCTCCTCCCCCCTACTAGTCCTCTCATGCTGACTCCTACCCCTCATGATTATAGCAAGCCAAAACCATTTAGAACAAGAACCCGCTATCCGCAAACGAATTTTCACCACAACAGTAATCTTAGCTCAACTGTTCATTCTCCTAGCCTTCTCAGCCTCAGAACTAATACTCTTCTACATTGCATTCGAAGCAACCCTCATCCCTACCCTTATTCTCATTACACGATGAGGAAACCAACCAGAACGACTAAACGCTGGCATTTACCTCCTATTCTATACACTAGCCAGCTCACTTCCCCTACTAATCGCTATCCTGCACCTACAAAACCAAATCGGCACACTCTACCTCCCCATACTAAAACTATCACACCCAACATTAAACTCCTCTTGATCCGGACTCATCGCAAGCCTCGCACTCCTTCTAGCCTTCATAGTTAAAGCCCCCCTATACGGCCTACATCTATGACTCCCCAAAGCTCACGTAGAAGCCCCCATTGCCGGATCCATACTACTAGCTGCCCTACTACTGAAACTAGGAGGCTACGGCATTATACGAATCACAATCCTGGTAAACCCAACATCAAACAACCTACACTACCCATTCATCACTCTAGCCTTATGAGGGGCACTAATAACCAGCGCAATCTGCCTACGACAAATCGACCTAAAATCACTAATCGCCTACTCTTCTGTCAGCCACATAGGATTAGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTTTCAGGAGCAATAATCCTAATGATCTCACACGGCCTAACCTCCTCAATACTATTCTGTCTAGCCAACACCAACTACGAACGAACTCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCCCTACTACCGCTTATAGCAACCTGATGACTCCTAGCAAACCTAACAAACATAGCCCTCCCCCCAACAACTAACCTCATAGCAGAACTAACCATCGTCATCGCACTATTCAACTGATCCGCCTTCACAATCCTCCTGACAGGGACAGCAATCCTCCTCACCGCCTCATATACCCTGTACATACTAGCAATGACACAGCGAGGCATACTCCCATCCCACATCACTTCCATCCAAAATTCCACTACCCGGGAACACCTACTCATGGCCCTTCACATGATCCCAATACTACTCCTAATTCTCAAACCCGAACTAATCTCCGGTACTCCTATAT-GCAAGTATAGTTT-TAA-TCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACGAGAACTGCTAACTCTTGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATACCTAATCCTAAACACACTCATACTCCTAACCCTAGCAACCCTCTTTACTCCCATCCTATTCCCACTACTCTCCCCCAAATTTAAAAATACCCCTAACTCCATCATAAACACAGTTAAAACCTCATTTCTAATCAGCTTAATCCCCATGACAATCCACATCTACTCAGGGGCAGAAAGCCTAATCTCCCTATGAGAATGAAAATTCATTATAAACTTCAAAATCCCCATCAGCCTCAAAATAGACTTCTACTCCCTCACCTTCTTCCCAATCGCACTATTCGTCTCATGATCAATTCTACAATTCGCAACATGATATATAGCCTCAGACCCCTACATTACAAAATTCTTCACCTACCTACTATTCTTCCTAATAGCAATACTTATCCTAATCATCGCTAACAACCTATTCGTCCTATTCATTGGCTGAGAAGGAGTCGGAATCATATCTTTCCTACTAATCAGCTGATGACACGGACGAGCAGAAGCTAACACTGCCGCCCTGCAAGCCGTACTATACAACCGAGTCGGTGATATTGGCCTCATCCTTTGCATAGCATGATTAGCATCCACCATAAACACCTGAGAAATCCAACAACTACCATCCCCCTCCCAAACCCCAACACTCCCCCTCCTAGGCCTAATCCTAGCTGCAACCGGAAAATCCGCCCAATTCGGCCTACACCCTTGACTCCCAGCTGCCATAGAAGGACCTACCCCCGTATCCGCTCTACTCCACTCCAGCACAATAGTAGTAGCCGGGATCTTCCTATTAATCCGAACCCACCCCCTATTCAACAACAACCAAACCGCCCTAACTCTCTGCCTCTGCCTAGGAGCCCTATCCACTTTATTCGCAGCTACATGCGCCCTCACCCAAAACGATATCAAAAAAATCATTGCCTTCTCCACCTCAAGCCAACTAGGCCTAATAATAGTCACAATCGGACTAAACCTTCCCGAACTTGCCTTCCTCCATATCTCAACCCACGCATTCTTCAAAGCCATACTCTTTCTATGTTCAGGATCCATCATCCACAACCTAAACGGCGAACAAGACATTCGAAAAATAGGAGGACTCCAAAAAATAATACCCACTACCACCTCATGCCTGACCATCGGAAACCTAGCCCTAATAGGAACGCCCTTCCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACCTCCTACCTAAATACCTGAGCCCTACTACTAACCCTATTAGCCACATCCTTTACCGCAGTTTACACAATTCGCATAACCGTACTCGTACAAACCGGCTTCACCCGAATTTCCCCCCTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCACCTATCACCCGACTTGCTCTAGGAAGCATCATAGCAGGCTTTCTCATTACCTCATTCATCATCC---CAACAAAAACACCTACAATAACCATGCCCCTCTCCATCAAAATAACCGCTCTAACAGTAACCGCCCTAGGAATTGCCCTAGCCCTAGAAATCTCAAAAATAACCCAAACCCTCCTCCCCACAAAACAAACCACTTTCTCAAACTTCTCTACCTCTCTAGGATACTTCAACCCCCTAATCCACCGCCTAAGCACATCCAACCTCCTCAACGGAGGACAAAACATCGCCTCCCACCTAATTGACTTATCCTGATACAAGACCCTAGGACCAGAAGGACTAGCCAGCCTACAACTAGCAGCAACCAAAACCGCTACCTCCCTCCACTCAGGCCTAATCAAAGCCTACCTAGGAACATTTGCCCTCTCTATTATCATCATCCTCA---TATCCTCATACAGAA----AC-C-C---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAACAACGCCCTGATTGACCTACCCACACCACCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGTATCTGCCTAATTACTCAAATTGTTACCGGTCTTCTGCTAGCCACACACTACACAGCAGACACCAACCTAGCTTTCTCCTCTGTAGCCCACATATGCCGCGACGTACAATTCGGCTGACTAATCCGCAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATTTGCATCTACCTACATATCGGCCGAGGAATTTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTAATCCTCCTCCTAACCCTCATAGCAACTGCCTTCGTAGGCTACGTACTACCATGAGGACAAATATCTTTCTGAGGAGCTACAGTAATTACAAACCTATTCTCAGCAATCCCCTACATTGGACAAACACTAGTAGAATGAGCCTGAGGAGGATTCTCTGTCGACAATCCAACACTCACCCGATTCTTCGCCCTTCACTTCCTCCTCCCCTTTGTAATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTTCACGAAACAGGATCCAACAACCCAACAGGAGTCCCCTCGGACTGTGACAAGATCCCATTCCATCCGTACTACACCGTAAAAGACATCCTAGGCTTCGCACTAATAATCTCCCTACTCGTCTCCCTAGCTCTATTCTCCCCTAACCTACTAGGAGACCCAGAAAACTTCACACCAGCCAACCCCCTAGTAACACCCCCTCACATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATCTTACGGTCTATCCCCAACAAACTCGGAGGTGTCCTGGCCCTAGCTGCCTCAATCCTCGTACTATTCCTAATACCTCTACTCCACACATCAAAACTTCGATCAATAACCTTCCGCCCTATCTCCCAAGTCCTATTCTGAGCCCTAGTTGCAAATGTCCTCATCCTAACGTGAGTGGGAAGCCAACCAGTAGAGCACCCGTTCATTATCATCGGTCAACTAGCCTCATTCTCCTACTTCACCATCATTCTAGTCCTATTCCCCATCGCGGCCGCACTAGAAAATAAATTACTAAAACT----------TTA-ATT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Hemignathus_stejnegeri GTTCTTGTAGCTTATAG-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCGCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCACA--C------CAT-A--ATCGTAGCCCAAGACGCCTAGCACTTGCCACGCCCCCACGGGTATTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-----TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCAAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG--CCCCCCCCCCCCCCATAAATTAATAAGCTAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAATCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AACCG-ACA-TG------ACCTGGA-ATAAC--AAAGTCACT--TC-ATA-CACCC----AACTAAAGCATT---T--ATTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAT-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAACAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AAGGAC-TT-ACTAAT-CATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAT-TCTACAAAAATATAGA-AACAATATGACTCCCT-CCCCATTAACAGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--CTAAT---------CAA---ACAAGCA-GAG-TATTA-AGCACA-TTGTTAACCCGACAAA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCAGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCGTAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTTCAAAAGCAGGGATGAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACTTA----CT-CACCCA--C-C-GGGTTCACTGTC-ACA-TAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AGAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGACCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAAGCAACTAAATTACAAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---CA-----ACAACC--C----ATGAC----------TAACTACCCCCTACTAATTAATCTAATCATATCCCTTTCCTACGCCCTCCCAATCTTAATTGCAGTAGCCTTCCTAACACTAGTAGAGCGCAAAATCTTAAGTTATATACAAAACCGAAAAGGCCCTAACATTGTAGGACCGTACGGCCTCCTGCAACCCCTAGCAGACGGAGTGAAGCTATTCATTAAAGAGCCCATCCGAC---------CTTCAACATCCTCCCCAATTCTGTTCCTTGCAACCCCAATACTAGCCCTCCTCCTAGCAATTTCAATCTGAGCCCCCCTGCCCCTACCCTTTTCATTAGCAGACCTTAATCTAGGCCTACTATTCCTACTAGCCATATCAAGCCTAGCAGTGTACTCTATCCTCTGGTCCGGCTGAGCCTCTAACTCAAAATACGCACTTATTGGCGCACTGCGAGCGGTAGCCCAGACAATCTCATATGAAGTAACCCTAGCCATTATCCTCCTATCTGTTGTGCTCCTCAGCGGCAACTACGCCCTAAGCACTCTTGCAGTCACTCAGGAACCTCTATACCTTATTTTCTCATGCTGGCCCCTCGCTATAATATGATACGTCTCCACACTTGCTGAGACCAATCGTGCTCCCTTTGATCTGACAGAAGGAGAATCCGAACTAGTCTCTGGGTTCAACGTAGAATATGCAGCTGGCCCTTTCGCACTCTTCTTCTTAGCTGAATACGCCAATATCATACTTATAAACACTATTACCACAATCCTCTTCTTCAATCCAAGCCTACTTAACCTCCCCCAAGAACTATTCCCCGTAGTACTAGCCACAAAAGTCCTACTATTATCAGCAGGATTTCTATGAATTCGTGCCTCCTACCCACGATTCCGATACGACCAGCTAATACACTTACTATGAAAAAACTTCCTACCACTTACACTTGCTCTATGTCTCTGACACACCAGCATGCCAATTTGCTATGCGGGGTTACCC-----CCTTATCTA-A--GA--------------CCACCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-A--CAAC-------TTAGAAAAGCAGGAATCGAACCTGCACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTCATAATTAGCCTCCTCCTGGGGACTGCCATCACGATCTCAAGCAACCACTGAATCA---TGGCATGAGCCGGCCTCGAGATCAACACACTTGCCGTCCTACCATTAATCTCAAAATCTCACCATCCACGATCCATTGAAGCAGCTACTAAATACTTTCTAACCCAAGCAGCCGCCTCTGCCCTAGTCTTATTCTCCAGCATGACCAATGCATGACACACCGGACAATGAGACATTACCCAACTAACCCACCCTGCATCTAGCTTAATCTTGACTTCAGCAATTGCAATGAAATTGGGCCTAGTCCCATTCCACTTCTGATTCCCAGAAGTGCTACAAGGTTCCCCTCTCTCCACAGGTCTCCTGCTATCCACTATCATAAAACTACCCCCAATTACCCTCCTGTACATAACTTCCCCATCACTAAACCCCACACTCCTGACTACCCTGGCTATCCTCTCAGCAGCCATCGGAGGATGAATAGGCCTCAACCAAACACAAATTCGAAAGATCCTAGCCTTCTCCTTCATCTCACATCTTGGCTGAATAGCAATCATCATCATCTACAACCCTAAGCTCACCCTCCTCAACTTCTACCTATACACTATGATAACTGCAACTGTCTTCCTCACCTTAAATTCAATTAAAGTAATAAAACTATCTACCCTAATAACTATATGAACAAAAGTCCCCTCACTGAATTCAATACTACTCTTAACCTTACTTTCCCTTGCAGGACTTCCCCCCTTAACAGGATTTCTGCCTAAATGACTCATCATCCAAGAACTAACCAAACAAGAAATAATCCCCGCAGCCACACTCATATCCCTCCTCTCACTACTAAGCCTGTTCTTCTACCTCCGCCTTGCATACTGCACAACAATCACACTCCCACCGCACACCACAAACCATATAAAACAATGACGCACCAGCAAATCAACCAACATTGTGATTGCTGTCCTAACCACAATATCCCTCATCCTTCTCCCTATCTCACCCATAATCCTCTCCATCAT------TT----AAGGAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTGTTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAA-CACACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGCACATGA-TCAATGTACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGACTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCCTTTGTAATAATTTTCTTCATAGTTATGCCTATTATAATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGTTTCTGACTACTCCCTCCATCATTCCTCCTCCTGCTAGCCTCTTCCACTGTCGAAGCAGGAGTTGGCACGGGCTGAACAGTATACCCCCCACTAGCTGGTAACCTCGCCCACGCCGGAGCCTCAGTTGACCTTGCAATCTTCTCCCTACATCTGGCCGGTATCTCCTCAATCCTAGGGGCAATCAATTTCATCACAACAGCCCTCAACATAAAACCCCCAGCCCTGTCACAATACCAAACTCCCCTATTCGTATGATCCGTGTTAATCACCGCAGTACTTCTGCTCCTCTCCCTTCCTGTACTTGCCGCAGGAATCACAATGCTTCTAACAGACCGCAACCTAAACACTACATTTTTCGACCCAGCAGGAGGAGGTGACCCAGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATTCTGCCAGGATTTGGAATCATTTCCCATGTCGTAACCTACTACGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCTATGCTATCCATCGGATTCCTAGGATTCATCGTTTGAGCCCACCACATATTCACAGTCGGAATAGACGTTGATACCCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACTGGCATTAAAGTGTTCAGCTGACTAGCCACACTCCACGGAGGCGTAATCAAATGAGACCCACCAATACTATGAGCCCTAGGATTTATCTTCCTATTCACCATTGGAGGACTGACCGGAATTATCCTAGCCAACTCCTCACTAGACATCGCACTACACGATACCTACTACGTAGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCAGTGTTTGCAATCCTAGCTGGTTTCACACACTGATTCCCCCTATTCACCGGATATACCCTCCACTCAACATGAGCCAAAGCTCACTTCGGTGTAATATTCGTAGGAGTCAACTTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGTATACCACGTCGATACTCAGACTACCCCGACGCCTACACCCTATGAAACACCATCTCCTCAGTAGGATCACTCATCTCCCTAACAGCCGTAATCATGCTAGTCTTCATCATCTGAGAAGCCTTTGCATCTAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCGCCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--GAACCACTTATGCTTCTTTCTC---AT---AGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCGAGACTAAATTGCAAGTGAAACCCCTGCACATCTCTT---CACCC--AAATATGGCTAACCACTCACAACTCAACTTTCAAGACGCTTCCTCTCCCATTATAGAAGAACTTATAGGATTCCACGACCACGCTATAATAATCGCATTAGCAATCTGCAGCCTAGTGCTTTACCTTCTAACCCATATAATAACAGGAAAACTCTCATCCAACACAGTAGACGCACAAGAAATTGAACTTGTCTGAACAATTCTCCCAGCCATAGTTCTAATCACACTTGCCTTACCATCCCTACGAATTCTATATATGATAGACGAAATCAACGAACCTGATCTAACCCTAAAAGCCATCGGCCACCAATGATATTGAACATATGAATACACCGACCTCAAAGACCTTACATTCGACTCTTACATAATCCCAACATCGGACCTACCTCTAGGACACTTCCGACTACTAGAAGTCGACCACCGCGTTGTAGTTCCAATAAGCTCTACAATCCGAGTAATTGTCACCGCCGATGACGTACTTCACTCATGAGCAGTCCCAAGCCTAGGAGTAAAAACTGACGCAATCCCAGGACGCTTAAACCAAACTTCCTTCCTTGCTTCCCGACCTGGAGTCTTCTACGGACAATGCTCAGAAATCTGCGGAGCTAATCACAGCTTCATACCAATTGTAGTAGAATCAACTCCCCTCGCCAACTTCGAAAGCTGATCCTCTCTAG---CAGCCTCCT----------CATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-ACT-CTCCTCCTTAATGATATGCCTCAACTAAACCCTGCACCTTGATTTTTTATCATGATCATTTCATGACTGACCTTCTCCTTTATCATTCAACCCAAACTCCTCTCATTTGTGTCAATAAACCCTCCATCCAGCAAAC---CACCCATTGCCCCAAGCACTACCCCTTGAACCTGACCATGAACTTAAGCTTCTTCGACCAATTCTCAAGCCCATCCTTCCTAGGAATCCCACTCATCCTCATCTCAATAACATTCCCAGCCCTCTTAATCCCCTCACTAGACAACCGATGAATCACCAACCGGCTCTCAACCCTTCAACTATGATTCGTCAACCTAATCACAAAACAACTAATAATACCCTTAGATAAAAAAGGACATAAATGAGCCCTGATCCTAACATCCTTAATAGTCTTCCTACTACTAATCAACCTCCTAGGCCTACTACCATACACATTCACCCCAACCACCCAACTATCTATAAATCTAGCTCTAGCCTTCCCCCTATGACTTGCCACCTTACTAACAGGCCTGCGAAACCAACCTTCTATCTCCCTAGGACATCTCCTCCCAGAAGGGACCCCAACCCCACTAATCCCTGCTTTAATCCTGATCGAAACAACAAGTCTACTAATCCGACCCCTAGCTCTAGGCGTACGCTTAACAGCCAACCTCACAGCAGGACACCTACTCATCCAACTCATCTCCACAGCCACAACAGCCCTACTCCCTACAATACCAGCAGTCTCACTTCTAACCCTGTTAGTCCTGTTCTTACTGACTATCCTAGAAGTAGCAGTAGCAATAATTCAAGCCTACGTCTTCGTACTTCTACTAAGCCTCTACCTACAAGAGAACATCTAACAC--CC--ACAATGGCACACCAAGCACATTCTTACCACATAGTAGACCCCAGCCCATGACCTATTCTAGGAGCCGCCGCCGCCCTCCTAACCACCTCAGGACTCACAATGTGATTCCACTGAAACTCACCTCAACTCCTCATCCTAGGCTTACTCTCCACTTCCCTAGTTATATTCCAATGATGACGTGACATTATCCGAGAAAGCACATTCCAAGGGCACCACACCCCCACCGTACAAAAAGGCCTGCGATACGGCATAGTCTTATTCATCACATCCGAAGCATTCTTTTTTCTTGGCTTTTTCTGAGCATTCTTCCACTCAAGCTTAGCCCCCACCCCAGAACTAGGAGGACAATGACCACCTGTAGGAATCAAACCCCTAAACCCCATAGACGTACCACTACTAAACACTGCCATCCTCCTAGCTTCTGGAGTTACCGTAACATGAGCCCATCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAGGCACTTACCCTGACCGTTCTCCTAGGCTTCTACTTCACTGCACTACAAGCTATAGAATACTACGAAGCACCATTCTCCATTGCAGATGGAGTCTACGGCTCTACATTCTTTGTCGCCACCGGATTCCATGGCCTACATGTAATCATCGGCTCCACATTCCTGTTAGTATGCCTACTACGCCTAATCAAATACCACTTTACATCAGGACACCACTTTGGATTCGAAGCAGCTGCCTGATACTGACATTTCGTAGACGTCGTATGGCTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTCAAACCCAGAGAAGAGTAATG---AACATAATCCTATTTATACTAACCCTATCACTCACCCTAAGCATTCTACTAACCGCACTAAACTTTTGATTAGCACAAATAAACCCAGACTCAGAAAAACTATCCCCCTACGAATGTGGATTCGACCCCCTAGGATCTGCTCGACTTCCATTCTCAATCCGATTCTTCCTAGTAGCCATCCTATTCCTCCTATTCGACCTAGAAATTGCCCTACTCCTTCCACTCCCATGAGCCATCCAACTAGAATCCCCCACCACCACCCTAATCTGAACCTCCTTCCTCCTCCTTTTACTAACACTAGGGCTAATCTACGAATGAATCCAAGGAGGCCTAGAATGAGCAGAGTA-G------TAGAAAGTTAGTCTAACCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTTATGTCCTACCTCCACCTCAGTTTCTACTCAGCCTTCACTCTAAGCAGCCTAGGCCTAGCCTTCCATCGTACCCATCTAATTTCAGCCTTACTATGCCTAGAAAGCATAATACTATCCATGTATGTAGCACTTGCCATATGACCCATCCAAATACAATCCTCATCCTCTACCATCCTACCGATTATCATACTAACCTTCTCCGCCTGCGAAGCCGGTACAGGCCTGGCCCTACTAGTAGCCTCCACCCGAACTCACGGCTCAGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATTCCTACTGCAACACTCCTACCCCTAACCCTCATATCCCCACTCAAACACCTATGAACTAACATCACACTCCACAGCTTACTCATTGCCACTATCAGCTTACAATGACTAACACCCACGTACTACCCAAGCAAAAGCTTAACCCCCTGAACCTCAATCGACCAAATTTCCTCTCCCCTACTAGTCCTCTCATGCTGACTCCTACCCCTCATGATTATAGCAAGCCAAAACCACTTAGAACAAGAACCCGCTATCCGCAAACGAGTTTTCACTACAACAGTAATCTTGGCTCAACTATTCATCCTTTTAGCCTTCTCAGCCTCAGAGCTAATGCTCTTCTACATTGCATTCGAAGCAACTCTCATCCCCACTCTTATTCTCATCACACGATGAGGAAACCAACCAGAACGACTAAACGCTGGCATTTACCTCCTATTCTATACACTAGCCAGCTCACTTCCCCTACTAATCGCCATCCTACATCTACAAAACCAAATCGGCACCCTCTACCTTCCTATGCTAAAACTATCACACCCAACATTAAACTCCTCTTGGTCCGGACTAATCGCAAGCCTCGCACTCCTCCTAGCCTTCATGGTCAAAGCCCCTCTATACGGCCTACACCTATGACTCCCCAAAGCTCACGTAGAAGCCCCCATTGCCGGATCTATATTACTAGCTGCCCTGCTACTAAAACTAGGAGGCTACGGCATTATACGAATCACAATCCTGGTAAACCCAGCATCAAACAACCTACACTACCCATTCATTACCCTAGCCTTATGAGGAGCACTAATAACCAGCGCAATCTGCTTACGACAAATCGACCTAAAATCACTAATCGCCTACTCTTCTGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATGATCCAGACCCAATGAGCATTTTCAGGAGCAATAATTCTAATGATCTCACACGGCCTAACCTCCTCAATACTATTCTGCCTAGCCAACACCAACTATGAACGAACCCACAGCCGAATCCTCCTACTTACACGAGGACTCCAACCCCTACTACCACTTATAGCAACCTGATGACTTCTAGCAAACCTAACAAACATAGCCCTCCCCCCAACAACTAACCTCATAGCAGAACTAACCATCGTCATCGCACTATTCAACTGATCCGCCTTCACAATCCTCCTGACAGGAGCAGCAATCCTCCTTACCGCCTCATACACCTTATACATGCTAGCAATAACACAACGAGGCACACTTCCATCCCACATCACTTCCATTCAAAACTCTTCTACCCGAGAACACCTCCTCATGGCCCTTCACATGATCCCAATACTACTCCTGATTCTCAAACCCGAACTAATCTCCGGTACCCCTATAT-GCAAGTATAGTTT-TAA-TCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACGAGAACTGCTAACTCTTGAATCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATACCTAATCCTAAACACACTCATACTCCTAACCCTGGCAACCCTCTTCACTCCCATTCTATTCCCACTACTCTCCCCTAAATTCAAAAACACCCCTAACTCCATCACAAACACAGTTAAAACCTCATTTATAATCAGCCTAATCCCCATGACAATCCACATCTACTCAGGAGCAGAAAGCCTAATCTCTCTATGAGAATGAAAATTCATTATAAACTTCAAGATCCCCATCAGCCTCAAAATAGACTTCTACTCCCTCACCTTCTTCCCAATCGCACTATTCGTCTCATGATCAATTCTACAATTCGCAACATGATATATAGCCTCAGACCCCTACATCACAAAATTCTTCACCTACCTACTATTCTTCCTAATAGCTATACTTATCCTAATCGTCGCTAACAACCTATTCGTCCTATTCATCGGCTGAGAAGGAGTTGGAATCATATCCTTCCTACTAATCAGCTGATGACATGGACGAGCAGAAGCTAACACCGCCGCTCTACAAGCCGTACTATACAACCGAATCGGCGATATTGGCCTCATCCTCTGCATGGCATGATTAGCATCTACCATAAACACCTGAGAAATTCAACAACTACCATCCCCCTCCCAAACCCCAACACTTCCCCTTCTAGGCCTAATTCTAGCTGCAACCGGGAAATCCGCCCAATTCGGCCTACACCCTTGACTCCCAGCCGCCATAGAAGGACCTACTCCCGTATCAGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGGATCTTCCTACTAATCCGAACCCACCCCCTGTTCAACAACAACCAAACCGCCCTAACCCTATGCCTCTGCCTAGGAGCCCTATCCACCCTGTTTGCAGCTACATGCGCCCTTACCCAAAACGATATCAAAAAAATCATTGCCTTCTCCACCTCAAGTCAACTAGGCCTAATAATAGTTACAATCGGACTAAACCTCCCCGAACTTGCCTTCCTCCATATCTCAACTCACGCATTCTTTAAAGCCATACTCTTCCTATGCTCAGGATCCATCATCCACAACCTAAACGGCGAACAAGACATTCGAAAAATAGGAGGGCTCCAAAAAATAATACCCACTACCACCTCATGCCTAACCATCGGAAACCTAGCCCTAATAGGAACACCCTTCCTAGCAGGATTCTACTCAAAAGATCAAATCATCGAAAACCTAAACACCTCCTACCTAAACACCTGAGCCCTACTACTAACCCTATTAGCTACATCCTTCACCGCAGTTTACACGACTCGTATAACCGTACTCGTACAAACCGGCTTCACCCGAATCTCTCCCCTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCACCTATCACCCGACTTGCTCTAGGAAGCATCACAGCAGGCTTCCTCATCACCTCATTCATCATCC---CAACAAAAACACCTACAATAACTATACCCCTCTCTATCAAAATAACCGCTCTAATAGTTACCGCTCTAGGAATTGCCCTAGCCCTAGAAATCTCAAAAATAACTCAAACCCTTCTTCCCACAAAACAAACCACCTTCTCAAACTTCTCCACCTCCCTAGGATACTTCAACCCCCTAATCCACCGCCTAAGCACATCCAACCTCCTCAACGGAGGACAAAACATCGCTTCTCACCTAATTGACTTATCCTGATACAAGACCCTAGGACCAGAAGGACTAGCCAGCCTACAACTAGCAGCAACCAAAACCGCCACCTCCCTCCACTCGGGCCTAATCAAAGCCTACCTAGGAACATTTGCCCTCTCCATCATCATCATCCTCA---TATCCTCATATAGAA----AC-C-C---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAATAACGCCCTGATTGACCTACCCACTCCACCGAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGCATTTGCTTAATTACTCAAATTGTTACCGGTCTTCTGCTAGCCACACACTACACAGCAGATACCAACCTAGCCTTCTCCTCTGTAGCCCACATATGCCGCGACGTACAATTCGGCTGACTAATCCGCAATCTCCACGCAAACGGAGCCTCCTTCTTCTTCATTTGCATCTACCTACATATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTAATCCTCCTCCTAACCCTCATAGCAACTGCCTTCGTAGGCTACGTACTACCATGAGGACAAATATCCTTCTGAGGAGCTACAGTAATCACAAACTTATTCTCAGCAATCCCCTACATTGGACAAACACTAGTAGAATGAGCCTGAGGAGGGTTCTCCGTCGACAACCCAACACTCACCCGATTCTTCGCCCTCCACTTCCTCCTCCCCTTTGTAATCGTAGGCCTCACACTAGTTCACCTCACCTTCCTCCACGAAACAGGATCCAACAACCCAACAGGAGTCCCCTCAGACTGTGACAAAATCCCATTCCATCCATACTACACCGTAAAAGACATCCTAGGCTTCGCACTAATAATCTCCCTACTCGTCTCCCTAGCCCTATTCTCCCCTAACCTACTAGGAGATCCAGAAAACTTCACACCAGCCAACCCCCTAGTAACACCCCCTCATATTAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCCATCCCCAACAAACTTGGAGGCGTCCTAGCCCTAGCTGCTTCAATCCTCGTACTATTCCTAATACCTCTACTTCACACATCAAAACTACGATCAATAACTTTCCGCCCCATCTCCCAAGTCCTATTCTGAGCCCTAGTTGCAAACGTTCTCATCCTAACATGAGTGGGAAGCCAACCAGTAGAGCACCCGTTCATTATCATCGGCCAACTAGCCTCATTCTCCTATTTCACCATCATTCTGGTCCTATTCCCCATCGCGGCCGCACTAGAAAATAAATTACTAAAACT----------TTA-ATT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Hemignathus_virens GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCGCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-G--ATCGTAGCCCAAGACGCCTCGCACTTGCCACGCCCCCACGGGTATTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-----TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCTAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG--CCCCCCCCCCCC-CATAAATTAATAAGCCAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGACA-CCAAGACGTAGC-TTAATCA-AAAGCATTCAGCTTACACCTGAAAAATATCTGCTA-GCACCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGTCACT--TC-ACA-AACCT----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAACAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AAGGAC-TT-ACCAAT-CACACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAT-CCTACAAAAATATAAA-AACTATATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCATCA-ATATACGA--CTAAT---------CAA---ACAAGCA-GAG-TATTA-AGCACA-TTGTTAACCCGACAAA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTTCAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACTTA----CC-CACCCA--C-C-GGGTTCACTGTT-ACA-TAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AGAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACTCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAAACAACTAAATTACAAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---CA-----ACAACC--C----ATGAC----------TAACTACCCCCTACTGATCAATCTAATCATATCCCTTTCCTACGCCCTCCCGATCTTAATTGCAGTAGCCTTCCTAACACTAGTAGAGCGCAAAATCTTAAGCTACATACAAAATCGAAAAGGCCCTAACATTGTGGGACCATACGGCCTCCTGCAACCCCTAGCAGACGGAGTGAAACTATTCATTAAAGAGCCTATCCGGC---------CTTCAACATCCTCTCCAATCCTGTTCCTTGCAACTCCAATACTAGCCCTTCTCCTAGCAATTTCAATCTGAGCCCCCCTACCCCTACCTTTTTCACTAGCAGACCTTAACCTAGGCCTACTATTCCTGCTGGCCATATCAAGCCTAGCAGTATACTCTATCCTCTGATCTGGTTGGGCCTCCAACTCAAAATACGCACTAATTGGCGCACTGCGAGCGGTAGCCCAAACAATCTCATATGAAGTAACCCTAGCCATTATCCTCCTATCGGTTGTACTCCTTAGCGGCAACTACGCCCTAAGCACCCTTGCAGTCACTCAGGAGCCCCTATATCTTATCTTCTCATGCTGGCCCCTCGCTATGATATGATATGTCTCCACACTCGCTGAGACCAATCGTGCCCCCTTTGACCTAACAGAAGGAGAGTCCGAACTAGTCTCTGGGTTTAACGTAGAATATGCAGCTGGCCCTTTCGCACTCTTCTTCTTAGCTGAATACGCCAATATTATACTTATAAACACTATCACTACAATCCTCTTCTTCAACCCAAGCCTGTTTAACCTCCCCCAAGAACTATTCCCCGTAGTGCTAGCCACAAAAGTCCTACTACTATCAGCAGGGTTTCTATGAATTCGTGCCTCCTACCCACGATTCCGATACGACCAGCTAATACACCTACTATGAAAGAATTTCCTACCGCTCACACTCGCTCTATGTCTCTGACACACCAGCATGCCAATTTGCTACGCGGGATTACCC-----CCTTACCTA-A--GG--------------CTACCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAACCCTCTCATTTCCT-A--CAAC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTCATAATCAGCCTCCTCCTGGGGACTGCCATCACGATCTCGAGCAACCACTGAATCA---TAGCTTGAGCCGGCCTCGAGATCAACACACTTGCTGTCCTACCATTGATCTCAAAATCTCACCACCCACGATCTATTGAAGCAGCTACTAAATACTTCCTAACCCAAGCAGCCGCCTCTGCCCTAGTCTTATTCTCCAGCATGACCAATGCATGACACACCGGACAATGAGACATTACCCAACTAACCCACCCTGCATCTAGCCTAATCCTGACTTCGGCAATTGCAATGAAATTGGGCCTAGTCCCATTCCACTTCTGATTCCCAGAAGTGCTACAAGGTTCCCCTCTCTCCACTGGTCTCCTACTATCTACTATCATAAAACTACCCCCAATCACTCTCCTATATATAACTTCCCCATCACTAAACCCCACACTCCTGACTACCCTGGCTGTCCTCTCAGCAGCCATCGGAGGATGAATAGGACTCAACCAGACACAAATCCGAAAGATCCTAGCCTTCTCCTCTATCTCACATCTTGGCTGAATAGCAATTATCATCATCTACAACCCTAAGCTTACCCTCCTTAACTTCTACCTGTACACTATGATAACTGCAACTGTCTTCCTCACCCTAAATTCAATCAAAGTAGTGAAACTATCCACCCTAATGACTATATGAACCAAAGTCCCCTCACTAAATGCAATACTACTCTTAACCTTACTTTCCCTTGCAGGACTTCCCCCCTTAACAGGATTTCTGCCTAAATGACTCATCATCCAAGAACTGACCAAACAAGAAATAATCCCCGCAGCTACACTCATATCCCTCCTCTCACTACTAAGCCTATTCTTCTACCTCCGCCTTGCATACTGCACAACAATCACACTCCCACCACACACCACAAACCATATAAAACAATGACGCACCAACAAATCAACCAACATTGTGATTGCTGTCCTGGCTACAATATCCCTCATCCTTCTCCCCATCTCACCCATAATCCTCTCCATCAT------TT----AAGGAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTGAATGCAACCCAGGTGCTTTAA-TTAAGCTAGGACCTT-A--CAA-TACACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACATGG-TCAATGTACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAATTAGGCCAACCCGGAGCCCTCCTAGGGGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCCTTTGTAATAATTTTCTTCATAGTCATGCCTATTATAATTGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGTTTCTGACTACTTCCTCCATCATTCCTTCTCCTACTAGCCTCCTCCACTGTCGAAGCAGGAGTTGGTACAGGCTGAACAGTATACCCCCCACTAGCTGGTAACCTCGCCCACGCCGGAGCCTCAGTTGACCTTGCAATCTTCTCCCTACATCTGGCCGGTATCTCCTCAATCCTAGGGGCAATCAACTTCATCACAACAGCCCTCAACATAAAACCCCCAGCCCTATCACAATATCAAACTCCCCTATTCGTATGATCCGTATTAATCACCGCAGTACTTCTACTCCTCTCCCTTCCTGTACTCGCCGCAGGAATCACAATGCTTCTAACAGACCGCAACCTCAACACTACATTCTTCGACCCGGCAGGGGGAGGTGACCCAGTCCTGTACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATTCTACCAGGATTTGGAATCATTTCTCATGTCGTAACCTACTACGCAGGAAAAAAAGAACCATTCGGTTACATAGGAATAGTATGAGCCATGCTATCCATCGGATTCCTAGGATTCATCGTCTGAGCCCACCACATGTTCACAGTCGGAATAGACGTTGATACCCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACTGGCATTAAAGTATTCAGCTGACTAGCCACACTCCATGGAGGCGTAATCAAATGAGACCCACCAATACTATGAGCCCTAGGATTTATCTTCCTATTCACCATCGGAGGACTGACTGGAATCGTTCTAGCAAACTCCTCACTAGACATTGCACTACACGATACCTACTACGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTATTTGCAATCTTAGCTGGTTTCACACACTGATTCCCCCTATTCACCGGATATACTCTCCACTCAACATGAGCCAAAGCCCACTTCGGTGTAATGTTCGTAGGAGTCAACTTAACCTTCTTCCCTCAACATTTCCTAGGCCTAGCCGGTATGCCACGTCGATACTCAGACTACCCCGACGCCTACACCCTATGAAACACTATCTCCTCAGTAGGATCGCTCATCTCCCTAACAGCCGTAATCATACTAGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTGCAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--GAACCACTTATGCTTCTTTCTC---AT---AGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAAGTGAAACCCCTGCACATCTCTC---CACCC--AAACATGGCTAACCACTCACAACTCAACTTTCAAGACGCTTCCTCTCCCATCATAGAAGAACTAATAGGATTCCACGATCACGCTATAATAATCGCATTAGCAATCTGCAGCCTAGTGCTTTACCTTCTAACTCATATAATAACAGGAAAACTCTCATCCAGCACAGTAGACGCACAAGAAATCGAACTTGTCTGAACAATTCTCCCAGCCATAGTTCTAATCACACTCGCCTTACCATCCCTACGAATCCTATATATGATAGACGAAATCAACGAACCTGATCTAACCCTAAAAGCCATCGGCCACCAATGATATTGAACATATGAATACACCGACCTCAAAGACCTTACATTCGACTCTTACATAATCCCAACATCAGACCTACCTCTAGGGCACTTCCGACTACTAGAAGTCGACCACCGCGTTGTAGTTCCAATAAGCTCTACAATCCGAGTAATCGTCACCGCCGATGACGTACTTCACTCATGAGCAGTCCCAAGCCTAGGAGTAAAAACCGACGCAATCCCAGGACGCTTAAACCAAACTTCCTTCCTTGCCTCCCGACCTGGAGTTTTCTACGGACAATGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATACCAATCGTAGTAGAATCAACTCCTCTCGCCAACTTCGAAAGCTGATCCTCTCTAG---CAGCCTCCT----------CATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-ACT-CTCCTCCTTAATGATATGCCTCAACTAAACCCCGCACCTTGATTTTTTATCATGATCATTTCATGACTAACCTTCTCCCTTATCATTCAACCCAAACTCCTCTCATTCGTATCAATAAACCCCCCATCCAACAAAC---CTCCCATTGCCCCAAGCACTACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTTTCAAGCCCATCCTTCCTAGGAATCCCACTCATCCTCATCTCAATAACATTCCCAGCCCTTTTAATCCCCTCATTAGACAACCGATGAATCACCAACCGACTCTCGACTCTTCAACTATGATTCGTCAACCTAGTTACAAAACAACTAATAATACCCTTAGATAAAAAAGGACATAAATGAGCCCTAATCCTAACATCCCTAATAATCTTCCTACTACTAATCAACCTCCTAGGCCTACTACCATATACATTCACCCCAACCACCCAACTATCTATAAACCTAGCCCTAGCCTTCCCCCTATGACTTGCCACCCTGCTAACAGGCCTGCGAAACCAACCTTCTATCTCGCTAGGACATCTCCTCCCAGAAGGAACCCCAACCCCACTAATTCCCGCCCTAATTCTAATCGAAACAACAAGCCTATTAATCCGACCCCTAGCCCTAGGCGTACGCCTAACAGCTAACCTTACAGCAGGGCACCTACTTATCCAACTCATCTCCACAGCCACAACAGCCCTACTCCCTACAATACCAGCAGTCTCACTTCTAACCCTGTTAGTGCTATTCTTACTGACCATCCTAGAAGTGGCAGTAGCAATGATTCAAGCCTACGTCTTCGTACTTCTACTAAGCCTCTACCTACAAGAGAATATCTAACAC--CC--ACAATGGCACACCAAGCACATTCTTACCATATAGTAGACCCAAGCCCATGACCTATTTTAGGAGCCGCCGCCGCCCTCCTAACCACCTCAGGACTCACAATGTGATTCCACTGAAATTCACCTCAACTCCTCATCCTAGGCCTACTTTCCACTTCCCTAGTTATGTTCCAATGATGACGCGACATTGTCCGAGAAAGCACATTCCAAGGACACCACACCCCCACTGTGCAAAAAGGCCTACGATACGGCATAGTCCTATTCATCACATCCGAAGCATTCTTCTTTCTTGGGTTTTTCTGAGCATTCTTCCACTCAAGTCTAGCTCCTACCCCAGAACTAGGAGGACAATGACCACCCGTAGGAATCAAACCCCTAAACCCCATAGACGTACCACTACTAAACACTGCCATCCTCCTAGCTTCCGGAGTTACCGTAACATGAGCTCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCACTTACCCTAACCGTTCTCCTAGGCTTCTACTTCACTGCACTACAAGCCATAGAGTACTACGAAGCACCATTCTCTATTGCAGACGGAGTCTACGGTTCTACATTCTTTGTCGCCACTGGATTCCATGGCCTACATGTAATCATCGGTTCTACATTCCTGTTAGTATGCCTACTACGCTTAATCAAATACCACTTCACATCAGGACACCACTTCGGATTTGAAGCAGCTGCCTGATACTGACATTTCGTAGACGTCGTATGGCTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAGCCCAGAGAAGAGTAATG---AACATAATCCTATTTATGCTAACCCTCTCACTCACCCTAAGCATCCTACTAACCGCACTAAACTTCTGACTTGCACAAATAAACCCAGACTCAGAAAAACTATCCCCCTACGAATGTGGATTCGATCCTCTAGGATCTGCTCGACTTCCATTTTCAATCCGATTCTTCCTGGTAGCCATCCTATTCCTCTTATTTGACCTAGAAATTGCCCTACTCCTTCCACTCCCATGAGCCATCCAACTAGAATCCCCCACCACCACCCTAATCTGAACCTCCTTCCTTCTTCTTTTACTAACACTAGGGCTAATCTACGAATGAATCCAAGGGGGACTAGAATGAGCAGAATA-G------CAGAAAGTTAGTCTAACCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTCATGTCCTACCTCCACCTTAGTTTCTACTCAGCCTTCACCCTAAGCAGCCTAGGCCTAGCCTTCCATCGTACCCATCTAATTTCAGCCCTACTATGTCTAGAAAGCATAATACTATCCATATACGTAGCACTCGCCATATGACCTATCCAAATACAATCATCATCCTCTACCATCCTACCAATTATCATATTAACCTTCTCCGCCTGCGAAGCCGGCACAGGCCTGGCCCTACTAGTAGCCTCCACCCGAACTCACGGCTCAGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATTCCAACCGCAACACTCCTACCCCTAGCCCTCATATCTCCACTCAAACACTTATGAACTAACATTACACTCCACAGCTTACTCATTGCCACTATCAGCCTACAATGACTAACACCCACATACTACCCAAGCAAAAGCTTAACCCCCTGAACCTCAATCGACCAAATCTCCTCTCCCCTACTAGTCCTCTCATGCTGACTCCTACCCCTTATAATCATAGCAAGCCAAAACCATCTAGAACAAGAACCCACTATCCGTAAACGAGTTTTCACTACAACAGTAATCTTAGCTCAACTATTTATCCTCCTAGCCTTCTCAGCCTCAGAATTAATACTCTTCTACATTGCATTCGAAGCAACCCTCATCCCTACCCTCATTCTCATCACACGATGAGGGAACCAACCAGAACGACTAAACGCTGGCATTTACCTCCTATTCTATACACTAGCCAGCTCACTTCCCCTACTAATCGCTATCCTACACCTACAAAACCAAATCGGCACACTCTACCTTCCTATACTGAAACTATCACACCCAACGTTAAACTCCTCTTGATCCGGACTAATCGCAAGCCTCGCACTCCTCCTAGCCTTCATGGTCAAAGCCCCCCTGTACGGCCTACACCTATGACTCCCCAAAGCTCACGTAGAAGCCCCCATTGCCGGATCCATGCTACTAGCTGCCCTACTGCTAAAACTAGGAGGCTACGGCATTATACGAATCACAATCCTAGTAAACCCAGCATCAAACAACCTACACTACCCATTCATCACCCTAGCCCTATGAGGAGCACTAATAACCAGCGCAATCTGCCTACGACAAATCGACCTAAAATCACTAATCGCCTACTCTTCTGTCAGCCACATAGGACTGGTCGTAGCCGCAACCATGATCCAAACCCAATGAGCATTTTCAGGGGCAATAATCCTAATAATCTCACATGGCCTAACCTCCTCAATACTATTCTGTCTAGCCAACACCAATTACGAACGAACCCACAGCCGAATCCTCCTACTAACACGAGGACTCCAACCCCTACTACCACTTATAGCAACCTGATGACTTCTAGCAAACCTAACAAACATAGCCCTCCCCCCAACAACCAACCTCATAGCAGAACTAACTATCGTCATCGCACTATTCAACTGATCCGCCTTCACAATCCTCCTAACAGGAACAGCAATCCTCCTCACCGCCTCATACACCCTATACATACTAGCAATAACACAACGAGGCACACTCCCATCCCACATCACCTCCATCCAAAACTCCTCTACCCGAGAACACCTCCTCATGGCCCTTCACATAATCCCAATTCTACTCCTGATTCTTAAACCCGAACTGATCTCCGGTACCCCTATAT-GCAAGTATAGTTT-TAA-CCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACGAGAACTGCTAACTCTTGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATACCTAATCCTAAACACACTCATACTCCTAACCCTAGCAACCCTCTCCACCCCCATTCTATTCCCACTACTCTCCCCCAAATTCAAAAACACCCCCAACTCCATCACAAACACAGTTAAAACCTCATTTCTAATCAGTTTAATCCCCATAACAATCCACATCTACTCAGGAACAGAAAGCCTAATCTCCCTATGAGAATGAAAATTCATTATAAACTTCAAGATCCCCATCAGCCTCAAAATAGACTTCTACTCCCTCACCTTCTTCCCAATCGCACTATTCGTCTCATGATCAATCCTACAATTCGCAACATGATATATGGCCTCAGACCCCTACATTACAAAATTCTTCACCTACCTACTACTCTTCCTAATAGCAATACTCATCCTAATTGTAGCCAACAACCTATTCGTCCTATTCATTGGCTGAGAAGGAGTCGGAATCATATCTTTCCTACTAATCAGCTGATGACACGGACGAGCAGAAGCTAACACCGCCGCCCTACAAGCCGTACTATACAACCGAGTCGGTGATATCGGCCTCATCCTCTGCATAGCATGACTAGCATCCGCCATGAACACCTGAGAAATCCAACAACTACCATCCCCCTCCCAAACCCCAACACTTCCCCTCCTAGGCCTAATTCTAGCTGCAACCGGGAAATCCGCCCAATTCGGCCTACACCCTTGACTCCCAGCTGCCATAGAAGGACCTACCCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGGATCTTCCTATTAATCCGAACTCACCCCCTATTCAACAACAATCAGACCGCCCTAACCCTCTGCCTCTGCCTAGGAGCCCTATCCACTCTATTTGCAGCTACATGCGCTCTCACCCAAAACGATATCAAAAAAATTATTGCCTTCTCCACCTCAAGTCAACTAGGCCTAATAATAGTTACAATCGGACTAAACCTCCCCGAACTTGCCTTCCTTCATATCTCAACCCACGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGATCCATTATCCACAGCCTAAACGGCGAACAAGACATTCGAAAAATAGGAGGACTCCAAAAAATAATACCCACTACCACCTCATGCCTAACCATCGGAAACCTAGCCCTAATAGGAACACCTTTCCTAGCAGGATTCTACTCAAAAGATCAAATCATCGAAAGCCTAAGCACCTCCTACCTAAACACCTGAGCCTTACTACTGACCCTACTAGCCACATCCTTTACCGCAGTTTACACAATTCGCATGACCGTACTCGTACAAACCGGCTTCACCCGAATTTCCCCCCTAACTCCAATAAATGAAAACAACCCCGCAGTAACCTCACCCATCACCCGACTTGCTCTAGGGAGCATCATAGCAGGCTTCCTCATTACCTCATTCACCATCC---CAACAAAAACACCTACAATGACCATGCCCCTCTCCATCAAAATAACCGCTCTAGTAGTAACCGCTCTAGGAATCGCCCTAGCCCTAGAAATCTCAAAAATAGCCCAAACCCTTCTCCCTACAAAACAAACCACCTTCTCAAACTTCTCTACCTCCCTAGGATATTTCAACCCCCTAATCCACCGCCTAAGCACATCCAACCTCCTCAACGGAGGACAAAACATCGCTTCTCACCTGATCGACTTATCCTGATACAAGACCCTAGGACCAGAAGGACTAGCTAGCCTACAACTAGCAGCAACCAAAACCGCTACCTCCCTTCACTCAGGCCTAATCAAAGCCTACCTAGGAACATTCGCCCTTTCCATCATCATCATTCTCA---TATCCGCATACAGGA----AC-C-T---AATGGCCCTCAACCTTCGTAAAAACCACCAAATCCTAAAAATCATCAATAACGCCCTGATTGACCTACCTACACCACCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGTATTTGCTTAATTACTCAAATTGTTACCGGTCTTCTGCTAGCCACACACTACACAGCAGACACCAACCTAGCTTTCTCCTCTGTAGCCCATATATGCCGCGACGTACAATTCGGCTGACTAATCCGCAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATTTGCATCTACCTACACATCGGCCGAGGAATCTACTACGGATCATATCTAAACAAAGAAACCTGAAACATCGGAGTAATCCTCCTCCTAACCCTCATAGCAACTGCCTTCGTAGGCTACGTACTGCCATGAGGACAAATGTCCTTCTGAGGAGCTACAGTAATTACAAACCTATTCTCAGCAATCCCCTACATTGGACAAACACTAGTAGAATGAGCCTGAGGAGGATTCTCTGTCGATAACCCAACACTCACCCGATTCTTCGCCCTCCACTTCCTCCTCCCCTTTGTAATCGTAGGTCTCACACTAGTCCACCTCACCTTCCTTCACGAAACAGGATCCAACAACCCAACAGGAGTCCCCTCAGACTGCGACAAAATCCCATTCCACCCATACTACACCGTAAAAGACATCCTAGGCTTCGCACTAATAATCTCCTTACTCGTCTCCCTAGCTCTATTCTCCCCTAACCTACTAGGAGACCCAGAAAACTTCACGCCAGCCAACCCCCTAGTAACACCCCCTCACATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCAATCCCCAACAAACTCGGAGGTGTCCTAGCCCTAGCCGCTTCCATCCTAGTACTATTCCTAATACCTCTTCTTCACACATCAAAACTACGATCAATAACCTTCCGCCCCATTTCTCAAGTCCTATTTTGAGCCCTAGTTGCAAACGTCCTCATCCTAACATGAGTGGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCATTCTCCTACTTCACCATCATTCTAGTCCTATTCCCCATCGCGGCCGCGCTAGAAAATAAATTACTAAAACT----------TTA-ATT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Hemignathus_virens_wilsoni GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCCAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGC?CC?GTG--------------------------------------------------------------------------------------------------------------------------------------------TAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-----TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCTAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGGATATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG---CCCCCCCCCCC-CATAAATTAATAAGCCAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAATCA-AAAGCATTCAGCTTACACCTGAAAAATATCTGCTA-GCACCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGTCACT--TC-ACA-AACCC----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAACAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AAGGAC-TT-ACCAAT-CACACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAT-TCTACAAAAATATAAA-AACAATATGACTCCCT-CCCCATTAACAGGCTAACCTATATCCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--CTAAT---------CAA---ACAAGCA-GAG-TATTA-AGCACA-TTGTTAACCCGACAAA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTTCAAAAGCAGGGATAAACACATAAGACAAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACTTA----CC-TACCCA--C-C-GGGTTCACTGTT-ACA-TAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AGAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACTCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAAACAACTAAATTACAAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---CA-----ACAACC--C----ATGAC----------TAACTACCCCCTACTAATCAGTCTAATCATATCCCTTTCCTACGCCCTCCCAATCTTAATTGCAGTAGCCTTCCTAACACTAGTAGAGCGCAAAATCTTAAGCTACATACAAAATCGAAAAGGCCCTAACATTGTGGGACCATACGGCCTCCTGCAACCCCTAGCAGACGGAGTGAAACTATTCATTAAAGAGCCTATCCGAC---------CTTCAACATCCTCTCCAATCCTGTTCCTTGCAACTCCAATACTAGCCCTTCTCCTAGCAATTTCAATCTGAGCCCCCCTACCCCTACCTTTTTCATTAGCAGACCTTAACCTAGGCCTACTATTCCTGCTGGCCATATCAAGCCTAGCAGTATACTCTATCCTCTGATCTGGTTGGGCCTCCAACTCAAAATACGCACTAATTGGCGCACTGCGAGCGGTAGCCCAAACAATCTCATATGAAGTAACCCTAGCCATTATCCTCCTGTCGGTTGTACTCCTTAGCGGCAACTACGCCCTAACCACCCTTGCAGTCACTCAGGAGCCCCTATATCTTATCTTCTCATGCTGGCCCCTCGCTATGATATGATATGTCTCCACACTCGCTGAGACCAATCGTGCTCCCTTTGACCTAACAGAAGGAGAGTCCGAACTAGTCTCTGGGTTTAACGTAGAATATGCAGCTGGCCCTTTCGCACTCTTCTTCTTAGCTGAATACGCCAATATTATACTTATAAACACTATCACTACAATCCTCTTCTTCAACCCAAGCCTGTTTAACCTCCCCCAAGAACTATTCCCCGTAGTGCTAGCCACAAAAGTCCTACTACTATCAGCAGGGTTTCTATGAATTCGTGCCTCCTACCCACGATTCCGATACGACCAGCTAATGCATCTACTATGAAAGAACTTCCTACCGCTCACACTCGCTCTATGTCTCTGACACACCAGCATGCCAATTTGCTACGCGGGATTACCC-----CCTTACCTA-A--GG--------------CTACCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAACCCTCTCATTTCCT-A--CAAC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTCATAATCAGCCTCCTCCTGGGGACTGCCATCACGATCTCGAGCAACCACTGAATCA---TAGCTTGAGCCGGCCTCGAGATCAACACACTTGCCGTCCTACCATTGATCTCAAAATCTCACCACCCACGATCTATTGAAGCAGCTACTAAATACTTCCTAACCCAAGCAGCCGCCTCCGCCCTAGTCTTATTCTCCAGCATGACCAATGCATGACACACTGGACAGTGAGACATTACCCAACTAACCCACCCTGCATCTAGCCTAATCCTGACTTCGGCAATTGCAATGAAATTAGGCCTAGTCCCATTCCACTTCTGATTCCCAGAAGTACTACAAGGTTCCCCTCTCTCCACTGGTCTCCTGCTATCTACTATCATAAAACTACCCCCAATCACTCTCCTATATATAACTTCCCCATCATTAAACCCCACACTCCTGACTACCCTGGCTGTCCTCTCAGCAGCCATCGGAGGATGAATAGGCCTCAACCAGACACAAATCCGAAAGATCCTAGCCTTCTCCTCCATCTCACATCTTGGCTGAATAGCAATTATCATCATCTACAACCCTAAGCTTACCCTCCTTAACTTCTACCTGTACACTATAATAACTGCAACTGTCTTCCTCACCCTAAATTCAATCAAAGTAGTGAAACTATCCACCCTAATGACTATATGAACCAAAGTCCCCTCACTAAATGCAATACTACTCTTAACCTTACTTTCCCTTGCGGGACTTCCCCCCTTAACAGGATTTCTGCCTAAATGACTCATCATCCAAGAACTGACCAAACAAGAAATAATCCCCGCAGCTACACTCATATCCCTCCTCTCACTACTAAGCCTATTCTTCTACCTCCGCCTTGCATACTGCACAACAATCACACTCCCACCGCACACCACAAACCATATAAAACAATGACGCACCAGCAAATCAACCAACATTATGATTGCTGTCCTGGCTACGATATCCCTCGTCCTTCTCCCCATCTCACCCATAATCCTCTCCATCAT------TT----AAGGAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAA-TACACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACATGG-TCAATGTACATCAATGAGCTTGCAACTCACTATGAACTTCACCACAGAGCC---GATAAGAAGAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCGGAGCCCTCCTAGGGGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCCTTTGTAATAATTTTCTTCATAGTCATGCCTATTATAATTGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGTTTCTGACTACTTCCTCCATCATTCCTTCTCCTACTAGCCTCCTCCACTGTCGAAGCAGGAGTTGGTACAGGCTGAACAGTATACCCCCCACTAGCTGGTAACCTCGCCCACGCCGGAGCCTCAGTTGACCTTGCAATCTTCTCCCTGCATCTAGCCGGTATTTCCTCAATCCTAGGGGCAATCAACTTCATCACAACAGCCCTCAACATAAAACCCCCAGCCCTGTCACAATACCAAACTCCCCTATTCGTATGATCCGTATTAATCACCGCAGTACTTCTGCTCCTCTCTCTCCCTGTACTCGCTGCAGGAATCACAATGCTTCTAACAGACCGCAACCTCAACACTACATTCTTCGACCCGGCAGGGGGAGGTGACCCAGTCCTGTACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATTCTACCAGGATTTGGAATCATTTCTCATGTCGTAACCTACTACGCAGGAAAAAAAGAACCATTCGGTTACATAGGAATAGTATGAGCCATGCTATCCATCGGATTCCTAGGATTCATCGTCTGAGCCCACCACATGTTCACAGTCGGAATAGACGTTGATACCCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACTGGCATTAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCGTAATCAAATGAGACCCACCAATACTATGAGCCCTAGGATTCATCTTCCTATTCACCATCGGAGGACTGACTGGAATTGTTCTAGCAAACTCCTCACTAGACATTGCACTACACGATACCTACTACGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTATTTGCAATCCTAGCTGGTTTCACACACTGATTCCCCCTATTCACCGGATACACTCTCCACTCAACATGAGCCAAAGCCCACTTCGGTGTAATATTCGTAGGAGTCAACTTAACCTTCTTCCCCCAACATTTCCTAGGCCTAGCCGGCATGCCACGTCGATACTCAGACTACCCCGACGCCTACACCCTATGAAACACTATCTCCTCAGTAGGATCGCTCATCTCCCTAACAGCCGTAATCATACTAGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTGCAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTTGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--GAACCACTTATGCTTCTTTCTC---AT---AGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAAGTGAAACCCCTGCACATCTCTC---CATCC--AAACATGGCTAACCACTCACAACTCAACTTTCAAGACGCTTCCTCTCCCATCATAGAAGAACTAATAGGATTCCACGATCACGCTATAATAATCGCATTAGCAATCTGCAGCCTAGTGCTTTACCTTCTAACTCATATAATAACAGGAAAACTCTCATCCAGCACAGTAGACGCACAAGAAATCGAACTTGTCTGAACAATTCTCCCAGCCATAGTTCTAATCACACTCGCCTTACCATCCCTACGAATCCTATATATGATAGACGAAATCAACGAACCTGATCTAACCCTAAAAGCCATCGGCCACCAATGATATTGAACATATGAATACACTGACCTCAAAGACCTTACATTCGACTCCTACATAATCCCAACATCAGACCTACCTCTAGGACACTTCCGACTACTAGAAGTCGACCACCGCGTTGTAGTTCCAATAAGCTCTACAGTCCGAGTAATCGTCACCGCCGATGACGTACTTCACTCATGAGCAGTCCCAAGCCTAGGAGTAAAAACCGACGCAATCCCAGGACGCTTAAACCAAACTTCCTTCCTTGCCTCCCGACCTGGAGTTTTCTACGGACAATGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATACCAATCGTAGTAGAATCAACTCCTCTCGCCAACTTCGAAAGCTGATCCTCTCTAG---CAGCCTCCT----------CATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-ACT-CTCCTCCTTAATGATATGCCTCAACTAAACCCCGCACCTTGATTTTTTATCATGATCATTTCATGACTAACCTTCTCCCTTATCATTCAACCCAAACTCCTCTCATTCGTATCAATAAACCCCCCATCCAACAAAC---CTCCCATTGCCCCAAGCACTACCCCTTGAACTTGACCATGAACCTAAGCTTTTTCGACCAATTTTCAAGCCCATCCTTCCTAGGAATCCCACTCATCCTCATCTCAATAACATTTCCAGCCCTTTTAATCCCCTCATTAGACAACCGATGAATCACCAACCGACTCTCGACTCTTCAACTATGATTCGTCAACCTAGTTACAAAACAACTAATAATACCCTTAGATAAAAAAGGACATAAATGAGCCCTAATCCTAACATCCTTAATAATCTTCCTACTACTAATCAACCTCCTAGGCCTACTACCATATACATTCACCCCAACCACCCAACTATCTATAAACCTAGCCCTAGCCTTCCCCCTATGACTTGCCACCCTGCTAACAGGCCTGCGAAACCAACCTTCTATCTCGCTAGGACATCTCCTCCCAGAAGGAACCCCAACCCCACTAATTCCCGCCCTAATTCTAATCGAAACAACAAGCCTATTAATCCGACCCCTAGCCCTAGGCGTACGCCTAACAGCTAACCTTACAGCAGGACACCTACTTATCCAACTCATCTCCACAGCTACAACAGCCCTACTCCCTACAATACCAGCAGTCTCACTTCTAACCCTGTTAGTGCTATTCTTACTGACCATCCTAGAAGTGGCAGTAGCAATGATTCAAGCCTACGTCTTCGTACTTCTACTAAGCCTCTACCTACAAGAGAATATCTAACAC--CC--ACAATGGCACACCAAGCACATTCTTACCACATAGTAGACCCCAGCCCATGACCTATTTTAGGAGCCGCCGCCGCCCTCCTAACCACCTCAGGACTCACAATGTGATTCCACTGAAATTCACCTCAACTCCTCATCCTAGGCCTACTTTCCACTTCCCTAGTTATATTCCAATGATGACGCGACATTGTCCGAGAAAGCACATTCCAAGGACACCACACCCCCACCGTACAAAAAGGCCTACGATACGGCATAGTCCTATTCATCACATCCGAAGCATTCTTCTTT-TTGGGTTTTTCTGAGCATTCTTCCACTCAAGCCTAGCTCCTACCCCAGAACTAGGAGGACAATGACCACCCGTAGGAATCAAACCCCTAAACCCCATAGACGTACCACTACTAAACACTGCCATCCTCCTAGCTTCCGGAGTTACCGTAACATGAGCTCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCACTTACCCTAACCGTTCTCCTAGGCTTCTACTTCACTGCACTACAAGCCATAGAATACTACGAAGCACCATTCTCTATTGCAGACGGAGTCTACGGTTCTACATTCTTTGTCGCCACTGGATTCCATGGCCTACATGTAATCATCGGTTCTACATTCCTGTTAGTATGCCTACTACGCTTAATCAAATACCACTTCACATCAGGACACCACTTTGGATTCGAAGCAGCTGCCTGATACTGACATTTCGTAGACGTCGTATGGCTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTTATGCTAACCCTCTCACTCACCCTAAGCATCCTACTAACCGCACTAAACTTCTGACTAGCACAAATAAACCCAGACTCAGAAAAACTATCCCCCTATGAATGTGGATTCGATCCTCTAGGATCTGCTCGACTTCCATTTTCAATCCGATTCTTCCTGGTAGCCATCCTATTCCTCTTATTTGACCTAGAAATTGCCCTACTCCTTCCACTCCCATGAGCCATCCAACTAGAATCCCCCACCACCACCCTAATCTGAACCTCCTTCCTTCTTCTTTTACTAACACTAGGGCTAATCTACGAATGAATTCAAGGAGGACTAGAATGAGCAGAATA-G------CAGAAAGTTAGTCTAACCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTCATGTCCTACCTCCACCTTAGTTTCTACTCAGCCTTCACCCTAAGCAGCCTAGGCCTAGCCTTCCATCGTACCCATCTAATCTCAGCCCTACTATGTCTAGAAAGCATAATACTATCCATATACGTAGCGCTCGCCATATGACCCATCCAAATACAATCATCATCCTCTACCATCCTACCAATTATCATATTAACCTTCTCCGCCTGCGAAGCCGGCACAGGCCTGGCCCTACTAGTAGCCTCCACCCGAACTCACGGCTCAGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATTCCAACCGCAACACTCCTACCCCTAGCCCTCATATCCCCACTCAAACACTTATGAACTAACATTACACTCCACAGCTTACTCATTGCCACTATCAGCCTACAATGACTAACACCCACATACTACCCAAGCAAAAGCTTAACCCCCTGAACCTCAATCGACCAAATCTCCTCTCCCCTACTAGTCCTCTCATGCTGACTCCTACCCCTTATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCACTATCCGTAAACGAATTTTCACTACAACAGTAATCTTAGCTCAACTGTTTATCCTCCTAGCCTTCTCAGCCTCAGAATTAATACTCTTCTACATTGCATTCGAAGCAACCCTCATCCCTACTCTCATTCTCATCACACGATGAGGGAACCAACCAGAACGACTAAACGCTGGCATTTACCTCCTATTCTATACACTAGCCAGCTCACTTCCCCTACTAATCGCTATCCTACACCTACAAAACCAAATCGGCACACTCTACCTTCCTATGCTGAAACTATCACACCCAACGTTAAACTCCTCTTGATCCGGACTAATCGCAAGCCTCGCACTCCTCCTAGCCTTCATGGTCAAAGCCCCCCTGTACGGCCTACACCTATGACTCCCCAAAGCTCACGTAGAAGCCCCCATTGCCGGATCCATGCTACTAGCTGCCCTACTGCTAAAACTAGGAGGCTACGGCATTATACGAATCACAATCCTAGTAAACCCAGCATCAAACAACCTACACTACCCATTCATCACCCTAGCCCTATGAGGAGCACTAATAACCAGCGCAATCTGCCTACGACAAATCGACCTAAAATCACTAATCGCCTACTCTTCTGTCAGCCACATAGGACTGGTCGTAGCCGCAACCATGATCCAAACCCAATGAGCATTTTCAGGAGCAATAATCCTAATGATCTCACACGGCCTAACCTCCTCAATACTATTCTGTCTAGCCAACACCAATTACGAACGAACCCACAGCCGAATCCTCCTACTAACACGAGGACTCCAACCCCTACTACCACTTATAGCAACCTGATGACTTCTAGCAAACCTAACAAACATAGCCCTCCCCCCAACAACCAACCTCATAGCAGAACTAACTATCGTCATCGCACTATTCAACTGATCCGCCTTCACAATCCTCCTAACAGGAACAGCAATCCTCCTCACCGCCTCATACACCCTATACATACTAGCAATAACACAACGAGGCACACTCCCATCCCACATCACCTCCATCCAAAACTCCTCTACCCGAGAACACCTCCTCATGGCCCTTCACATAATCCCAATTCTACTCCTGATTCTTAAACCCGAACTGATCTCCGGTACCCCTATAT-GCAAGTATAGTTT-TAA-CCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACGAGAACTGCTAACTCTTGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATACCTAACCCTAAACACACTCATACTCCTAACCCTAGCAACCCTCTTCACTCCCATTCTATTCCCACTACTCTCCCCCAAATTCAAAAACACCCCCAACTCCATCACAAACACAGTTAAAACCTCATTTCTAATCAGTTTAATCCCCATAACAATCCACATCTACTCGGGAACAGAAAGCCTAATCTCCCTATGAGAATGAAAATTCATCATAAACTTCAAGATCCCCATCAGCCTCAAAATAGACTTCTACTCCCTCACCTTCTTCCCAATCGCACTATTCGTCTCATGATCAATCCTACAATTCGCAACATGATATATAGCCTCAGACCCCTACATTACAAAATTCTTCACCTACCTACTACTCTTCCTAATAGCAATACTCATCCTAATTGTAGCCAACAACCTATTCGTCCTATTCATTGGCTGAGAAGGAGTCGGAATCATATCTTTCCTGCTAATCAGCTGATGACACGGACGAGCAGAAGCTAACACCGCCGCCCTACAAGCTGTACTATACAACCGAGTCGGTGATATTGGCCTCATCCTCTGCATAGCATGACTAGCATCCGCCATGAACACCTGAGAAATCCAACAACTACCATCCCCCTCCCAAACCCCAACACTTCCCCTCCTAGGCCTAATTCTAGCTGCAACCGGGAAATCCGCCCAATTCGGCCTACACCCTTGACTCCCAGCTGCCATAGAAGGACCTACCCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGGATCTTCCTATTAATCCGAACTCACCCCCTATTCAACAACAACCAGACCGCCCTAACCCTCTGCCTCTGCCTAGGAGCCCTATCCACTCTATTTGCAGCTACATGCGCTCTCACCCAAAACGATATCAAAAAAATTATTGCCTTCTCCACCTCAAGTCAACTAGGCCTAATAATAGTTACAATCGGACTAAACCTCCCCGAACTTGCCTTCCTTCATATCTCAACCCACGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGATCCATCATCCACAACCTAAACGGCGAACAAGACATTCGAAAAATAGGAGGACTCCAAAAAATAATACCCACTACCACCTCATGCCTAACCATCGGAAACCTAGCCCTAATAGGAACACCTTTCCTAGCAGGATTCTACTCAAAAGATCAAATCATCGAAAGCCTAAGCACCTCCTACCTAAACACCTGAGCCTTACTACTAACCCTACTAGCCACATCCTTCACCGCAGTTTACACAATTCGCATGACCATACTCGTACAAACCGGCTTCACCCGAATTTCCCCCCTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCACCCATCACCCGACTTGCTCTAGGAAGCATCATAGCAGGCTTCCTCATTACCTCATTCACCATCC---CAACAAAAACACCTACAATAACCATGCCCCTCTCCATCAAAATAACCGCTCTAGTGGTAACCGCCCTAGGAATCGCCCTAGCCCTAGAAATCTCAAAAATAGCCCAAACCCTTCTCCCTACAAAACAAACCACCTTCTCAAACTTCTCTACCTCCCTAGGGTACTTCAACCCCCTAATCCACCGCCTAAGCACATCCAACCTCCTCAACGGAGGACAAAACATCGCTTCTCACCTGATCGACTTATCCTGATACAAAACCCTAGGACCAGAAGGACTAGCTAGCCTACAACTAGCAGCAACCAAAACCGCTACCTCCCTCCACTCAGGCCTAATCAAAGCCTACCTAGGAACATTCGCCCTCTCCATCATCATCATTCTCA---TATCCTCATACAGAA----AC-C-T---AATGGCCCTCAACCTTCGTAAAAACCACCAAATCCTAAAAATCATCAATAACGCCCTGATTGACCTACCCACACCACCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGTATTTGCTTAATTACTCAAATTGTTACCGGTCTTCTGCTAGCCACACACTACACAGCAGACACCAACCTAGCTTTCTCCTCTGTAGCTCATATATGCCGCGACGTACAATTCGGCTGACTAATCCGCAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATTTGCATCTATCTACACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTAATCCTCCTCCTAACCCTCATAGCAACTGCCTTCGTAGGCTACGTACTACCATGAGGACAAATATCCTTCTGAGGAGCTACAGTAATTACAAACCTATTCTCAGCAATCCCCTACATTGGACAAACACTAGTAGAATGAGCCTGAGGAGGATTCTCTGTCGATAACCCAACACTCACCCGATTCTTCGCCCTCCACTTCCTCCTCCCCTTTGTAATCGTAGGTCTCACACTAGTCCACCTCACCTTCCTTCACGAAACAGGATCCAACAACCCAACAGGAGTCCCCTCAGACTGCGACAAAATCCCATTCCATCCATACTACACCGTAAAAGACATCCTAGGCTTCGCACTAATAATCTCCTTACTCGTCTCCCTAGCTCTATTCTCCCCTAACCTACTAGGAGACCCAGAAAACTTCACGCCGGCCAACCCCCTAGTAACACCCCCTCACATTAAACCCGAATGATACTTCCTATTCGCCTACGCCATTCTACGATCAATCCCCAACAAACTCGGAGGTGTCCTAGCCCTAGCCGCTTCCATCCTAGTACTATTCCTAATACCTCTTCTTCACACATCAAAACTACGATCAATAACCTTCCGCCCTATTTCCCAAGTCCTATTCTGAGCCCTAGTTGCAAACGTCCTCATCCTAACATGAGTGGGGAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCATTCTCCTACTTCACCATCATTCTAGTCCTATTCCCCATCGCGGCCGCACTAGAAAATAAATTACTAAAACT----------TTA-ATT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAGCCCCTTCTTAGAGTT Himatione_sanguinea GTTCTTGTAGCTTATAG-A{AG}AGCATGACACTGAAGATGTCAAGATGGCTGC--TACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCGCCAGTG-TAGATGCCCTGGACA-CCT-T-GA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTAGCACTTGCCACGCCCCCACGGGTCTTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-----TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-TAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATCAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCCAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T-----ACGGCAAAGGGGTATGAAATAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-C----GCCCCCCCCCC-CATAAATTAATAAGTTAC-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAACTA-AAAGCCTTCAGCTTACACCTGAAAAATGTCTGCTA-ATATCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGTCACT--TA-ATA-CACCT----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACATA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AAGGAC-TT-ACCATA-CATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-CCTACAAAAATATAAA-AACAACATGACTCCCT-CCCCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-CCACTA-ATATACGA--CTAAT---------CAA---ACAAGCA-GAG-TATTA-AGCACA-TTGTTAACCCGACAAA-GGAGCGTCCTCT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTTAACCAAAAACATAGCCTTCAGCAAACCACAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTTCAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAGAT-CACCTA----CT-CACCCA--C-T-GGGTTCACTGTC-GCA-TAA-GA-C-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AGAACCTCCAA-AAATTAGACCATACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAAGCAACTAAATTACAAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---TG-----ACAGCC--C----ATGAC----------CAACCACCCCTTACTAATTAACCTGATCATATCCATCTCCTACGCCCTCCCAATCTTGATTGCAGTAGCCTTTCTAACACTAGTAGAGCGCAAAATCTTAAGTTACATACAAAATCGAAAAGGCCCTAACATTGTAGGCCCATACGGCCTCCTACAGCCCCTAGCAGACGGAGTGAAACTGTTCATCAAAGAACCTATCCGACC{CT}CATAAAACTTCAACGTCCTCACCAGTCTTATTTCTTGCAACCCCAATATTGGCCCTTCTCCTAGCAATTTCAATCTGAGCCCCCCTGCCCCTCCCCTTTTCATTAGCAGACCTAAACCTAGGCCTACTATTCCTACTAGCCATGTCAAGCCTAGCGGTGTACTCTATTCTCTGATCTGGCTGAGCTTCCAACTCAAAATACGCATTAATTGGTGCACTACGAGCAGTAGCTCAAACAATCTCATACGAAGTGACCTTAGCCATTATTCTCCTATCTGTTATTCTCCTTAGCGGCAACTACACCCTAAGCACCCTTGCAGTTACTCAGGAGCCTCTCTATCTTATTTTCTCATGCTGACCCCTCGCCATAATATGATATGTCTCCACACTTGCTGAGACTAACCGTGCCCCCTTCGATCTAACAGAAGGAGAATCCGAATTAGTCTCTGGATTTAACGTAGAGTATGCGGCCGGCCCCTTTGCACTCTTCTTCTTGGCTGAATACGCTAATATTATGCTTATAAACACTATCACCACAATCCTCTTCTTCAACCCAAGCCTGCTTAACCTCCCCCAAGAACTATTCCCCGTAGTGCTAGCCACAAAAGTTTTACTACTATCCGCAGGATTTTTATGAATTCGTGCTTCCTACCCTCGATTCCGATACGACCAGCTAATGCACTTACTATGAAAGAATTTCCTACCACTTACACTTGCCCTATGCCTCTGACACACCAGCATGCCAATTTGCTACGCGGGTTTACCC-----CCTTATCTA-A--GA--------------CCACCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAACCCTCTCATTTCCT-A--CAAC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAGTCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTGACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTCATGACTAGCCTCCTCCTGGGGACTACCATCACAATCTCAAGCAACCACTGGATCA---TAGCCTGAGCCGGCCTTGAGATCAACACACTTGCCGTCCTACCATTAATTTCAAAATCTCACCACCCACGATCCATTGAAGCAGCCACTAAGTACTTCCTGACCCAAGCAGCTGCCTCTGCCCTAGTTCTATTCTCCAGCATGACCAATGCATGACACACCGGACAGTGAGACATCACCCAACTAACCCACCCCACATCTAGTCTTATTCTAACTTCAGCAATTGCAATAAAATTAGGCCTAGTCCCATTCCACTTCTGATTCCCAGAAGTACTACAAGGCTCCCCTCTCCTCACTGGCCTCCTGTTGTCCACTATCATAAAACTACCCCCAATTACCCTCCTATACATAACATCCCCATCACTAAACCCTACACTCCTAACTACCCTAGCTGTCCTCTCAGCAGCCATCGGAGGATGAATAGGCCTCAACCAGACACAAATTCGAAAAATCTTAGCTTTCTCCTCCATCTCGCACCTTGGCTGAATAGCAATCATCATCGTCTATAACCCCAAGCTCACTCTCCTTAACTTCTACCTGTATACTATGATGACTGCAACTGTCTTTCTTACTCTAAACTCAATTAAAGTAATAAAACTATCCACCCTGATGACTATATGAACCAAAGTCCCTTCACTAAATACAATGCTACTCTTAACCTTACTTTCTCTTGCAGGACTTCCTCCCTTAACAGGATTTCTACCTAAATGACTTATCATTCAAGAACTAACTAAACAAGAAATAATCCCCGCAGCCACACTCATATCTCTCCTTTCGCTGCTAAGCCTATTCTTCTACCTTCGCCTTGCATACTGCACAACAATCACACTCCCCCCACACACCACGAACCACATAAAACAATGACGCACCAGCAAATCAACCAATATTATGATTGCTGTCTTAGCCACAATATCCCTCATTCTCCTCCCCATCTCGCCCATGATCCTCTCCATTAT------CT----AAGAAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCTGAATGCAACTCAAGTACTTTAA-TTAAGCTAGGACCTT-A--CAT-TACACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACACGA-TCAATGTACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATTTTCGGCGCATGAGCCGGGATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCCTTTGTAATAATTTTCTTCATAGTCATGCCTATTATAATCGGAGGGTTTGGAAACTGACTAGTTCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCGCGAATAAACAATATAAGCTTCTGACTACTTCCCCCATCATTCCTTCTCCTACTAGCCTCTTCTACTGTCGAAGCAGGGGTTGGTACAGGCTGAACAGTTTACCCCCCACTAGCTGGCAATCTCGCCCACGCCGGAGCCTCCGTCGACCTAGCAATCTTCTCCCTACACCTAGCTGGTATCTCTTCAATTCTAGGAGCAATTAATTTCATCACAACAGCTATCAATATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCTGTATTAATCACCGCAGTACTTCTTCTCCTTTCCCTTCCCGTACTTGCCGCAGGAATCACAATGCTTCTAACAGACCGTAACCTCAATACTACATTCTTCGACCCGGCAGGAGGAGGCGACCCAGTTCTATACCAACATCTCTTCTGATTCTTTGGTCATCCAGAAGTTTACATTCTGATCCTGCCAGGATTTGGAATCATCTCTCATGTTGTAACCTACTACGCAGGGAAAAAAGAACCATTCGGCTACATAGGGATAGTATGGGCCATGCTGTCCATCGGATTCCTAGGGTTCATCGTATGAGCCCACCACATGTTCACAGTCGGAATGGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATTATTGCCATCCCAACCGGCATTAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGCGTAATCAAATGAGACCCACCAATACTATGAGCTCTAGGGTTCATCTTCCTATTCACCATCGGAGGACTGACAGGAATCGTCCTAGCAAACTCCTCACTGGACATCGCACTGCATGACACCTACTACGTAGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCAGTGTTTGCAATCCTAGCCGGTTTCACACACTGATTCCCCCTATTTACTGGGTATACTCTCCACTCAACATGAGCCAAAGCCCATTTCGGTGTAATATTCGTAGGAGTCAACCTAACCTTCTTCCCTCAACACTTCCTAGGCCTAGCTGGTATACCACGTCGATACTCAGACTATCCTGATGCCTACACCCTATGAAACACTATCTCCTCAGTAGGATCACTCATCTCTCTAACATCCGTAATCATGCTAGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAGCTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCG??CTTTGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--GAACCACTTATGCTTCTTTCTC---AT---AGAGACGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAACCCCTGCACATCTCTT---CATTC--AAACATGGCCAACCACTCACAAATTAACTTTCAAGACGCTTCCTCTCCCATCATAGAAGAACTAATAGGATTCCACGACCATGCCATAATAATCGCATTAGCAATCTGCAGCCTAGTGCTTTATCTTCTAACCCACATAATAACAGGAAAACTCTCGTCCAGCACAGTAGACGCACAAGAAATTGAACTAGTCTGAACAATTCTCCCAGCCATAGTTCTAATTACACTCGCCCTACCATCCCTGCGAATTCTATACATGATAGACGAAATCAACGAACCTGACCTAACCCTAAAAGCCATCGGCCACCAATGATACTGAACATACGAATACACCGACCTTAAAGACCTCACATTCGACTCTTACATAATCCCAACATCAGACCTGCCCCTAGGCCACTTCCGTCTATTAGAAGTCGACCACCGCGTTGTAGTCCCAATAAGCTCTACAATCCGAGTAATCGTCACCGCCGATGACGTGCTTCATTCATGAGCAGTCCCAAGCCTAGGAGTAAAAACTGATGCAATCCCAGGACGCTTAAACCAAACTTCCTTCCTCGCCTCCCGACCCGGGGTCTTCTACGGACAGTGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATGCCAATCGTAGTAGAATCAACTCCCCTCGCTAACTTCGAAAGCTGATCCTCTCTAG---CAGCCTCCT----------CATCATTAAGAAGCTATGGACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGATT-ACA-CCCCTCCTTAATGATATGCCTCAACTAAACCCTGCACCTTGATTTTTTATCATGATCATTTCATGACTGACCTTCTCCCTCATTATCCAACCCAAACTTCTCTCATTCGTGTCAATAAACCCTCCATCCAACAAAC---GACCTGTCGCCCCAAGCACCACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCCTTCCTAGGAATCCCACTCATCCTCATCTCAATGACATTTCCAGCCCTCCTAATCCCCTCACTAGACAACCGATGAATCACTAACCGACTCTCAACCCTCCAACTATGATTTGTCAATCTAGTCACAAAACAACTAATAATGCCCTTAGACAAAAAAGGTCATAAATGAGCCCTAATCTTAACATCCCTAATAATCTTCCTGCTACTAATCAACCTCCTAGGCCTACTACCATATACATTCACCCCAACTACCCAATTATCTATAAACTTAGCCCTAGCTTTCCCCCTATGACTTGCTACCCTACTAACAGGCCTGCGAAACCAACCCTCCATCTCGCTAGGACACCTCCTCCCAGAAGGCACTCCAACCCCACTAATCCCTGCCCTAATTTTAATCGAAACGACAAGCCTACTAATCCGACCCCTAGCCCTAGGCGTACGCCTGACAGCTAACCTAACAGCAGGCCACCTGCTTATTCAACTCATCTCCACAGCCACAACAGCCCTACTCCCTACAATACCAGCAGTCTCACTTCTAACCCTATTAGTTCTATTCTTACTGACTATCCTAGAAGTAGCAGTAGCAATGATTCAAGCTTACGTCTTCGTACTCCTACTCAGCCTCTACCTACAAGAGAACATCTAACAC--CC--TCAATGGCACACCAAGCACACTCTTACCACATAGTAGACCCCAGCCCATGACCTATCCTAGGAGCCGCCGCCGCCCTCCTAACCACCTCCGGACTCACAATGTGATTCCACTGAAATTCACCTCAACTCCTTATCTTAGGCCTACTCTCCACTTCTCTAGTCATATTCCAATGATGACGCGACATTGTACGAGAAAGCACATTCCAAGGCCATCACACCCCCACCGTACAAAAAGGCCTGCGATATGGCATGGTCCTATTCATCACATCTGAGGCATTCTTTTTCCTTGGCTTCTTCTGAGCATTCTTCCACTCAAGCCTAGCCCCGACCCCTGAACTAGGAGGGCAATGACCACCCGTTGGAATCAAACCCCTAAACCCTATAGACGTACCACTACTGAACACCGCCATTCTCCTAGCCTCCGGAGTCACTGTGACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAGGCAATCCAGGCACTTACCCTAACCGTTCTCCTAGGCTTCTACTTCACCACTCTACAAGCCATAGAATACTACGAAGCACCATTCTCCATCGCAGACGGAGTCTACGGCTCTACATTCTTTGTCGCCACCGGGTTCCATGGCCTACATGTAATCATCGGTTCCACATTCCTACTAGTATGTCTACTACGTCTAATTAAATACCACTTCACATCAGGACATCACTTCGGATTCGAAGCAGCCGCCTGATATTGACATTTCGTAGACGTCGTATGACTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTTATACTAACCCTATCACTTGCCCTAAGCATCTTACTAACCGCACTAAACTTTTGACTAGCCCAAATAAACCCAGACTCAGAAAAACTATCCCCCTACGAATGTGGATTTGACCCCCTAGGATCCGCTCGACTTCCATTCTCAATCCGATTCTTCCTAGTAGCTATCCTATTTCTCCTATTCGACCTAGAAATTGCCCTTCTCCTCCCACTTCCATGAGCCATCCAACTAGAATCCCCCACTACCACTTTAATATGAACCTCCTTCCTCCTCCTCCTACTAACGCTAGGACTAATTTACGAATGAATCCAAGGGGGATTAGAATGGGCAGAATA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGGCTCAACAAATTATAGCTCACGCCCTATAACTTTCTTCATGTCCTACCTCCACCTCAGTTTCTACTCAGCCTTCACCTTAAGCAGCCTAGGATTGGCTTTCCACCGCACTCACCTAATTTCAGCCCTACTATGTCTAGAAAGCATGATGCTATCCATATACGTAGCACTTGCCATATGACCCATCCAAATACAATCATCATCCTCTACCGTCCTGCCAATTATCATACTGACATTCTCCGCCTGCGAGGCCGGCACAGGCCTAGCCCTACTAGTAGCCTCCACCCGGACCCACGGCTCAGACCACCTGCACAACTTCAACCTTCTACAATGCTAAAAATCATCATTCCAACTGCTACCCTTCTACCCTTAGTCTTCGTGTCCCCACTCAAACACCTATGAACTAACATCACACTGCACAGCCTACTCATTGCCACTATCAGCCTACAATGACTAACGCCCACATACTACCCAAACAAAGGCCTAACCCCATGAACTTCAATTGACCAAATCTCCTCTCCCCTATTAGTCCTCTCATGCTGACTCCTACCCCTCATAATCATAGCAAGCCAAAACCACTTAGAACAAGAACCCACTATCCGTAAACGAATCTTCGCCACAACAGTAGTCCTAGCTCAACTATTCATTCTTTTAGCCTTCTCAGCCTCAGAATTAATACTCTTCTACATCGCATTCGAAGCAACCCTCATCCCTACCCTCATCCTCATTACACGATGAGGAAACCAACCAGAACGACTAAACGCTGGCATTTACCTCCTATTCTATACACTAGCCAGCTCACTACCTCTACTAATCGCTATCCTACACCTACAAAACCAAATCGGTACACTCTACCTTCCCATACTAAAATTATCACATCCAACATTAAACTCCTCCTGATCCGGGCTAATCGCAAGCCTCGCACTCCTCCTAGCCTTCATGGTCAAAGCCCCCCTGTACGGCCTACACCTATGACTCCCCAAAGCCCATGTAGAAGCTCCCATTGCCGGCTCCATACTACTTGCCGCCCTATTACTAAAACTAGGGGGCTACGGCATTATACGAATCACAATCCTGGTGAACCCAGCATCAAACAACCTACACTACCCATTCATCACCCTAGCCCTATGAGGAGCACTAATAACCAGCGCAATCTGCCTACGACAAATCGACTTAAAATCACTAATTGCCTACTCCTCTGTCAGCCACATAGGACTAGTCGTAGCTGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACACGGCCTAACCTCCTCAATACTATTCTGCCTAGCCAACACCAACTACGAACGAACCCACAGCCGAATCCTCCTACTTACACGGGGACTCCAACCCCTACTACCTCTCATGGCAACCTGATGACTCCTAGCAAACCTAACCAACATAGCTCTCCCCCCAACAACTAACCTCATAGCAGAACTAACCATCGTCATCGCACTATTCAACTGATCCGCCTTCACAATCCTCCTAACAGGAGCAGCAATCCTCCTCACCGCCTCATACACCCTATACATACTAACAATAACACAACGAGGCGGACTTCCATCCCACATCACCTCCATCCAAAACTCCTCCACTCGGGAACATCTCCTCATAGCCCTACACATGATCCCAATACTACTCCTGATCCTCAAACCTGAACTAATCTCCGGTACTCCTATAT-GCAAGTATAGTTT-CAA-TCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAGCGAGAACTGCTAACTCTTGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCCCTAACTCTAAGCACATTCATACTCCTAACCTTAGCAATCCTCTCTACCCCCATTCTATTCCCACTACTCTCGCCTAAATTCAAAAACACCCCCATCTCCATCACAAACACAGTTAAAACTTCATTCCTAATCAGCCTAATCCCTATAACAATTCACATCTACTCAGGAACGGAGAGCCTAATCTCTCTATGAGAATGAAAATTCATCATAAACTTCAAAATCCCTATCAGCCTAAAAATAGACTTCTACTCCCTCACTTTCTTCCCAATCGCACTATTCGTCTCATGATCAATCCTACAATTCGCAACATGGTACATAGCCTCAGACCCCTATATTACAAAATTCTTCACCTACCTGCTGTTCTTCCTAATAGCAATACTTATCCTAATTATCGCTAACAACCTATTCGTCCTATTCATCGGCTGAGAAGGAGTCGGAATCATATCCTTCCTCCTAATTAGCTGATGACACGGACGAGCAGAAGCTAATACCGCTGCCCTACAAGCCGTACTATACAACCGAGTCGGTGACATTGGCCTTATCCTCTGCATAGCATGACTAGCATCCGCCACAAACACCTGAGAAATTCAACAACTACCATCCCCTTCCCAAACCCCAACACTTCCCCTCCTAGGCCTAATTCTAGCTGCAACCGGAAAATCCGCCCAATTCGGCCTACACCCTTGGCTTCCAGCCGCCATAGAAGGACCTACTCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCTGGAATCTTCCTACTAATTCGAACTCACCCCTTATTTAACAACAACCAAACTGCCCTAACTCTCTGCCTCTGCCTAGGAGCCCTATCCACCCTATTCGCAGCCACATGCGCCCTCACCCAAAATGACATCAAAAAAATTATCGCCTTCTCCACCTCAAGCCAGTTAGGCCTAATAATAGTTACAATTGGACTAAACCTCCCCGAACTCGCCTTCCTTCACATCTCAACCCATGCATTCTTCAAAGCCATACTTTTCCTGTGCTCAGGATCCATCATCCACAACCTAAACGGCGAACAAGACATTCGAAAAATAGGAGGACTCCAAAAAATAATACCCACTACCACCTCATGCCTAACCATCGGGAATCTGGCCCTAATAGGAACACCCTTCCTGGCAGGATTCTACTCAAAGGACCAAATCATCGAAAGCCTAAACACCTCCTATCTAAACACTTGAGCCCTACTACTAACCCTACTAGCCACATCTTTCACCGCAGTGTACACAATCCGTATAACCGTACTCGTACAAACCGGCTTCGTCCGAATTTCCCCCCTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCACCCATCACCCGACTTGCATTAGGAAGCATCACAGCAGGCTTCCTCATCACTTCATTCATCATCC---CAACAAAAACACCCACAATAACCATACCCCTATCCATCAAAATAACAGCCTTAGTAGTAACCGCCCTAGGAATTGCCCTAGCCCTAGAAATCTCAAAAATAGCCCAAACCCTCCTCCCCACAAAACAAACTACCTTCTCAAACTTCTCTACATCCCTAGGATACTTCAATCCCCTAATCCACCGCCTAAGCATGTCTAACCTCCTCAGCGGAGGACAAAACATCGCCTCCCACCTAATTGACTTATCCTGATACAAAATCCTAGGACCAGAAGGACTGGCTAGTCTACAACTAACAGCAACCAAAACCGCCACTTCCCTCCACTCAGGCCTAATCAAAGCCTACCTAGGAACATTCGCCCTTTCCATCATCATCATCCTTA---TATCCTCATACAGAA----AC-C-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAGTCATCAATAACGCCCTGATTGACCTGCCCACACCACCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGTATCTGCCTAATTACTCAAATTGTTACCGGTCTTCTGCTGGCCACACACTACACAGCAGACACCAACCTAGCTTTCTCCTCTGTAGCCCATATATGCCGCGACGTACAATTCGGCTGACTAATCCGCAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTAATCCTCCTCCTAACCCTCATAGCAACCGCATTCGTAGGCTACGTACTACCATGAGGACAAATA{CT}CATTCTGAGGAGCTACAGTAATTACAAACCTATTCTCAGCAATCCCATACATTGGACAAACACTAGTAGAATGAGCCTGAGGAGGGTTCTCTGTCGACAACCCAACACTCACTCGATTCTTCGCCCTCCACTTCCTCCTCCCCTTCGTGATCGTAGGCCTCACACTAGTTCACCTCACCTTCCTCCACGAAACTGGGTCCAACAATCCAACAGGAGTCCCCTCAGACTGTGACAAAATCCCATTCCACCCTTACTACACCGTAAAAGATATCCTAGGCTTCGCACTGATAATCTCCCTGCTCGTCTCCCTAGCTCTATTCTCCCCCAACCTACTAGGAGACCCAGAAAATTTCACGCCAGCCAACCCCCTAGTAACACCCCCTCACATCAAACCCGAATGATACTTCCTATTCGCTTACGCCATCCTACGATCTATCCCTAACAAACTTGGAGGTGTTCTAGCCCTAGCTGCTTCAATCCTCGTACTATTCCTAATACCTCTGCTCCACACATCCAAACTACGATCAATAACCTTCCGCCCCATCTCCCAAGTCCTATTCTGAGCCCTAGTTGCAAACGTCCTCATTCTAACATGAGTGGGAAGCCAACCAGTAGAACACCCATTCATCATCATTGGCCAACTAGCCTCACTCTCCTACTTCACCATCATTCTAGTCCTATTCCCCATCGCGGCCGCGCTAGAAAATAAACTACTAAATCT----------CTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Hyliota_flavigaster GTCCTTGTAGCTTATAC-AAAGCATGACTCTGAAGATGTCAAGATGGCTGC--CATA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTGTTGCTAAATATATACATGCGAGTATCCGCGCCCCAGTG-TAGATGCCCTAGGTA-CCC-T-GAACTC-----AGGTCGATAGGAGCGGGTATCAGGCACA--C------CAATG----TGTAGCCCAAGACGCCTTGCAATTGCCACACCCCCACGGGCATTCAGCAGTAGTTAATATTAAGCAATGAGTGAAAACTTGACTTAGTTATAGCAAA-T---CTAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATCAACATTAC-T----AACGGCGTAAAGCGTGGTCAC-ATGTTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCGCAAGCCCAAGATGC-CCATAAGGCCGC--TATTCAAAGAAAATCTTAGACT--AACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCGTAAATCTTGATGCT-CTA--CCCTACTTGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTGAAACTCTAAGGACTTGGCGGTGCTTCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCCTACCACCCCTTGC-CAA--AA--CAGCCTATATACCGCCGTCGCCAGCCCACCCCCC--CTGAAGGCCTCACAGTGGACGCAATAG-CCCCA-GTACGCTAGTAAGACAGGTCAAGGTATAGCCTATGGAGTG----------------------GC-AGTAATGGGCTACATTTTCTAGCTTAGAACA-T----TACGG-AAAGGGGCATGAAATTGCCTCTCGAAGGAGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGAAGCACGTACATACCGCCCGTCACCCTCCTCGAAAG-CG-----ACCCATCACCTATAAATTAATAAGCCAT-CC--AGCTGAAGAGGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGTACTTAGACAA-CCAAGACGTAGC-TTTAACA-AAAGCATTCAGCTTACGCCTGAAAGATATCTGCTC-AAACCAGATCGTCTTGA-TGCCAGACTCTAGCCC--------AATCT-ACATTG------ACCTGGA-ATAAC--AAAGCTACT--CA-TAA-TACCC----AACTAAAGCATT---T--ATTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCACCTGGA-GCGATAGAGAG-CACGTACCGTAAGGGAAAGATGAAATAATAATG-AAATAAGC--CAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTCTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTTAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTCGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAGCGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AACC--CTCA-AACCCCA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AGT--AAACAATTT-ACAAAA-CTTACTGTGGGCCCTTAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAA-ACT--AAAAATATAAG-AACATTATGACTCCCT-CCCCATTAACAGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG-CT--AC-GCCCTCT----ACGACGCAAACTTACATCCACA-CATTATTAACAAT-TCCCCA-ATATACGA--ACAAT---------CCA---ACAAGCA-GAG-TATTA-AACATA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTCAGCAAACCC---AGGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACACAAG-ACAAGTATTGAAGGTGACGCCTGCCCGGTG--ACCC-GAT---GTTAAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATGGGGGCCCGTATGAATGGCTAAACGAGGTCCTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTGCGAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCGACCACC--CCTAAC-TACATA----CA-CACCCA--C-C-GGGCTCACTTAT-ACC-TAAAGGGCTACTGGTC-CGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-ATATAGGACCACACCTCCAGACTA-AGAGCGACCTCTCAACGTGCGAACAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCAAGAGTCCATATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCAGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTAAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-TTCCC-----CCA-CACCCTAGAAAAGGGCAT-AAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAATT------------------A----ATGAC----------ACTACACCCAATGCTAATTAACCTTATTATAGCCCTCTCCTACGCTATCCCCATCCTAATTGCAGTTGCTTTCCTAACACTAGTAGAACGCAAAATCCTAAGTTATATACAAAACCGAAAAGGCCCCAACATTGTAGGCCCCTATGGCCTACTCCAACCCATGGCAGACGGAATCAAACTATTCGTTAAAGAGCCAATCCGCC---------CATCAACATCCTCACCAATCCTTTTCACCATAACCCCTATCCTAGCCCTAACCCTGGCAATCTCAATCTGAATCCCACTTCCTCTGCCATTCCCCCTTGCAGACCTTAACCTAGGTTTACTATTTATCTTAGCCATATCAAGCCTGATAGTTTATTCTATCCTGTGATCAGGATGGGCCTCCAACTCAAAATACGCTCTAATCGGAGCCCTTCGAGCAGTTGCCCAAACTATCTCGTATGAAGTCACATTAGCAATTATCCTGCTATCAGTCATCCTCCTCAGCGGAGGCTACACCCTAAGCGCTCTTGCAGTAACCCAAGAACCCCTATATCTTATCTTCGCCTGCTGACCTCTTGCCATAATATGATATGTCTCTACACTTGCCGAAACAAATCGCGCCCCATTCGACCTGACAGAAGGGGAGTCAGAATTAGTTTCGGGATTTAATGTAGAATACTCAGCAGGACCCTTCGCCCTTTTCTTCCTAGCAGAATATGCGAACATTATGCTGATGAACACACTAACCGTCCTTCTATTCCTAAACCCAAGCTTCCTCAACCCACCCCAAGAGCTCTACCCAGTAATCCTGGCTACAAAAGTCTTACTTCTATCAGCGGGATTCTTATGAATCCGAGCCTCATACCCACGATTCCGATACGACCAACTAATGCACCTACTATGAAAGAACTTCCTTCCGCTCACACTAGCTCTATGTCTGTGACACACAAGCATACCAATCTGCTACGCAGGCCTGCCT-----CCGTTCCTA-A--GA--------------CCCCTGGAAATGTGCCTGAAGCCCA--AAGGGTCACTATGATAAAGTGAACATAGAGGTGCACCAACCCTCTCATTTCCTGA--CCA--------TTAGAAAAGCAGGAATTGAACCTGCACTAAAGAGATCAAAACCCTCCATACTTCCATTATATTATTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAAGTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAGTCTTTACTATCAGCCTGCTACTAGGGACAACCATTGCAATCTCAAGCAACCACTGGATCA---TAGCCTGAACTGGACTTGAAATCAATACACTAGCTATCCTACCCCTAATCTCAAAATCACACCATCCTCGAGCCATCGAAGCCGCAACCAAATATTTCCTGGTCCAAGCAGCTGCTTCAACCCTAATCCTATTCTCCAGCATGACCAACGCATGATCAACCGGTCAATGAGACATCACCCAAATATCCGACCCAACGTCATGCCTAATCCTAACTTCAGCCATTGCAATAAAACTAGGCCTAGTTCCATTCCACTTCTGATTCCCTGAAGTCCTTCAAGGTTCACCCCTCACTACTGGCCTACTCCTATCTACAATCATAAAATTCCCCCCAATTACCATACTCTTCATAACTTCCCACTCCCTAAACCCTGCTCTACTAACTACCATGGCCATCCTCTCTACAGCCCTAGGAGGATGAATAGGACTGAACCAGACACAAACCCGAAAAATTATAGCTTACTCCTCCATTTCTCATCTAGGATGAATAGCTGCCATTATTGTCTACGACCCAAAACTCACACTATTAAACTTCTACCTCTACACCTTAATAACCGCAACCGTCTTCCTCACTTTAAACTCAATCAAAGTCCTGAAACTATCCACACTAATGACTGCATGAACAAAAACTCCAATACTTAACACCATGCTCCTACTAGCCCTTCTCTCACTGGCAGGCCTTCCACCACTAACAGGCTTCCTGCCTAAATGACTCATCATCCAAGAACTAACTAAACAGGATATGGCCCTTACAGCTACCATCCTCTCCCTCCTCTCCCTACTAAGCCTATTCTTCTACCTACGCCTTGCATATTGCGCAACAATCACACTCCCCCCACACACCACAAACCACATGAAACAATGACACACAAACAAGCCCACCAATACCTCCATTGCCGTCCTAATAACCCTATCCACTATACTCCTTCCCATCTCCCCCATAATCTCTTCTATCAT------CT----AAGAAACTTAG----GATAGCCC-CAAACCGAAGGCCTTCAAAGCCTTAGACAAGAGTTAGACTCTCTTAGTTTCTGATAAGACCCGCAGGACACTACCCTGCATCACCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGATCTT-CCACAA-CACTCTAGACAGATGGGCTTCGATCCCATGAAAC-TATAGTTAACAGCTATATGCCCAAACC-AACAGGCCTCTGCCTAC---------A---AGACTCCGGCACATAA-TTAACGTGCATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGTC---GATAAGAAGAGGAATTCAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGACTTTTTTCAACAAACCACAAAGATATTGGTACTCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGAACCTCCCTAAGCCTTCTTATTCGAGCGGAATTAGGCCAACCCGGAGCCCTACTCGGAGACGACCAAATCTACAACGTAATTGTCACAGCCCATGCTTTCGTCATAATTTTCTTCATGGTCATACCAATTATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTTCCACGAATAAATAACATAAGCTTCTGACTCCTACCACCATCCTTCCTCCTTCTACTAGCCTCTTCCACAGTCGAATCCGGAGCTGGAACAGGATGAACAGTATACCCCCCTCTAGCTGGCAACCTAGCACACGCTGGAGCCTCAGTAGACCTGGCCATCTTCTCACTACACCTGGCAGGCATCTCATCAATCCTCGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCACCAGCCCTCTCACAATATCAAACCCCTCTATTCGTGTGATCAGTACTAATCACCGCAGTCCTTCTTCTCCTGTCTCTTCCCGTCCTTGCAGCTGGCATCACTATGCTATTAACTGATCGCAACCTAAACACTACCTTCTTCGACCCCGCAGGAGGAGGAGACCCAGTACTTTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTGCCAGGATTCGGAATCATTTCTCACGTCGTAGCCTACTACTCAGGAAAAAAAGAACCGTTCGGATACATAGGAATAGTGTGAGCCATACTATCCATTGGATTCCTTGGCTTCATTGTATGAGCACACCACATATTCACTGTTGGAATAGACGTAGACACCCGAGCATACTTCACATCCGCCACTATAATCATCGCTATCCCCACCGGTATCAAAGTATTCAGCTGACTAGCTACCCTACACGGCGGAACAATTAAATGAGACCCACCAATACTATGAGCACTAGGCTTTATCTTCCTATTCACCATTGGAGGTCTGACAGGAATCGTCCTAGCAAACTCCTCACTTGACATTGCTCTACATGACACCTACTACGTTGTAGCTCACTTCCACTACGTCCTGTCAATAGGAGCAGTATTCGCAATTCTAGCAGGATTCACCCACTGATTCCCACTATTCACCGGATATACACTCCACTCTACATGAGCCAAAATCCACTTCGGAGTAATATTCGTGGGAGTCAATCTAACTTTCTTCCCCCAACACTTCCTAGGACTCGCAGGAATACCACGACGCTACTCAGACTACCCAGACGCCTATACCCTATGAAACACCATTTCTTCAGTAGGCTCCCTTATCTCAATGACAGCCGTAATCATGCTAGTGTTCATTATCTGAGAAGCTTTAGCATCTAAACGTAAAGCCTTCCAGCCAGAACTGACAAGCACAAACATCGAATGAATTCACGGCTGCCCACCCCCATTCCACACTTTCGAAGAACCAGCATTTGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGCATAT--AAACCACTTATGCTTCTTTCTC---ATCCAAGAGGTGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTACAGGAGAAAAACCAGTACACCTCAA---CAC----TAATATGGCCAACCACTCACAACTAGGTTTCCAAGACGCATCATCCCCTATCATAGAAGAACTTGTACAATTCCACGACCACGCATTAATAGTTGCCCTAACCATTTGCAGCTTAGTCCTCTACCTCCTCACCTTCATACTTGCAGAAAAATTAACATCAAGCACAGTAGACGCACAGGCAGTTGAACTTATCTGAACAATCCTACCAGCTGCAGTACTGATTATGCTTGCTCTCCCATCACTACGAATCCTTTACATAATAGACGAAATCAATGAACCCAGCCTCACCCTCAAAGCCATCGGCCATCAGTGATACTGATCCTACGAATACACTGACCTCAAAGATATCACATTTGACTCCTACATAATCCCTACTGCAGACCTCCCTCTCGGACATTTCCGCCTCCTAGAAGTCGACCATCGTGTAATCGTCCCTACAGGGTCAACCGTTCGAGTCATTGTCACCGCAGATGACGTCCTCCACTCATGAGCCGTTCCAAGCCTAGGTGTAAAAACCGATGCAATTCCAGGACGACTAAACCAAACCGCCTTCCTTGCCAACCGACCCGGAATTTTCTACGGCCAATGCTCAGAAATCTGCGGAGCCAATCACAGCTTCATGCCAATCGTAGTAGAAGCCGTCCCACTAGCTGTCTTTGAAAACTGATCTTCTAACA---TATCCTCCT----------AATCATTAAGAAGCTATGAACCAGCGCTAGCCTTTTAAGCTAGAGAAAGAGGGC---ACACCCCTCCTTAATGATATGCCTCAGCTAAACCCAAACCCTTGATTTTTTATCATGTTAACCTCATGATTAACTTTCTCTCTGCTAATCCAACCTAAACTCCTATCATTTGTATCCATAAACCCTCCCTCCAGCAAAG---CACCAGAAACTCCAAGCACCACCCCTTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTTTCTAGCCCTTCACTACTGGGGATCCCCCTAGTTCTCATCGCATTAACATTCCCAGCTCTACTACTACCCTCCCAGGGTAACCGATGAATCACCAACCGTCTCTCAACACTACAACTATGATTCATCAACCTAACTGCAAAACAACTCATAACCCCTCTAGACAAAAAAGGTCATAAATGAGCATTAATTCTAACCTCACTAATAATCTTTCTACTGTTAATCAACCTATTAGGCCTACTACCCTACACCTTTACCCCAACAACTCAACTATCCATAAACCTAGCCTTAGCATTCCCCCTATGACTAGCAACTCTCTTAACAGGCTTACGAAACCAACCATCCGCCTCCCTAGGCCATCTCTTACCAGAAGGAACCCCAACACCACTAATCCCAGCCCTAATCTTAATTGAAACAACAAGCCTCCTCATCCGACCACTAGCCCTAGGCGTACGCCTAACAGCCAACCTAACAGCAGGTCACCTTCTTATCCAACTAATCTCCACCGCCACAGTAACCTTATTCTCAACAATACCAGCAGTATCAGTTCTAACCTTACTGATCCTATTTTTACTGACCATCCTAGAGGTAGCAGTAGCCATAATCCAAGCCTACGTATTCGTACTCCTATTAAGCCTGTACCTACAAGAAAACATTTAACCC--------AATGGCACACCAAGCACACTCTTACCATATAGTAGACCCTAGCCCATGACCTATTTTAGGAGCAACCGCCGCCCTTCTTACTGCATCTGGCCTAACCGTATGATTCCACTACAACACTCCTTACCTCCTAATTATTGGCCTGCTCTCTACCGCCCTAGTCATGTTCCAATGATGACGTGACATCGTACGAGAAAGCACTTTCCAAGGTCACCACACCCCAGCAGTTCAAAAAGGCCTACGTTACGGTATAGCTCTCTTCATTACATCAGAAGCTTTCTTCTTCCTAGGATTCTTCTGAGCATTCTTCCACTCCAGCCTAGCCCCTACCCCCGAACTAGGAGGCCAATGACCACCAGTTGGGATTAAACCCCTAGACCCTATAGACGTCCCCCTATTAAATACCGCCATTCTACTGGCTTCAGGTGTAACCGTCACATGAGCCCACCACAGCATTACAGAAGCCAACCGAAAACAAGCTATCCAAGCCCTAACCCTTACAGTACTACTAGGCTTCTACTTCACCGCCCTCCAAGCTATAGAATACTACGAAGCACCCTTCTCCATTGCTGACGGAGTTTACGGCTCCACCTTCTTTGTCGCTACCGGTTTCCACGGACTTCACGTAATTATCGGTTCTATCTTCCTACTTGTAGGTCTCCTACGCCTAATCAAATACCACTTCACATCAGGCCATCACTTTGGCTTCGAGGCAGCAGCCTGATACTGACACTTTGTAGACGTAGTATGACTGTTCCTTTACGTATCTATCTACTGATGAGGTTCTTGCTCTCCTAGTATACTT-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAGCCCAGAGGAGAGCAATT---AACATAATCCTGTTCATATTTACCATATCCCTTACCCTAAGCCTAGCCCTAACTGCCCTAAACTTCTGATTAGCCCAAATCAACCCAGACCCAGAAAAGCTATCCCCATACGAATGTGGATTCGACCCTCTAGGATCCGCCCGTCTTCCCTTTTCTATTCGATTCTTCATAGTAGCAATCCTATTCCTGCTATTCGACCTAGAAATCGCCCTCCTACTGCCCCTCCCATGAGCTGTCCAACTCCAAGATCCCACTACCACACTAATATGAGCCTCAGCCCTCATCCTTCTCCTTATCCTAGGACTAATCTATGAATGAACCCAAGGAGGCCTAGAATGAGCAGAATA-A-------AGAAAGTTAGTCTAACCAAGACAGTTGATTTCGGCTCAACAGATTATAGCTCCAACCCTATAACTTTCTTTATGACCCACCTCCACTTAAGTTTTTACTGTGCCTTCACCCTAAGCGGCTTAGGCCTGGCCTTTCACCGAACCCATTTAATCTCTGCCCTACTATGTCTAGAAAGCATAATACTATCCATGTATGTTGCCCTGGCCATATGACCCATCCAGACACAATCATCATCCTCAACCATCCTACCCATCCTCATGCTAGTCTTCTCCGCCTGCGAAGCAGGAACAGGCCTAGCACTCCTAGTCGCCTCTACCCGAACTCACGGCTCAGACCTCCTACACAACTTCAACCTCCTACGATGCTAAAAATTATCATCCCAACCATCATACTACTTCCACTAACCTTCCTATCCCCATGCAAACATCTATGAACTAACATCACAACGCACAGCCTACTAATCGCTGCCATCAGCCTACAATGACTTATTCCTACGTACTACCCAAACAAAGGACTAACCCCTTGAACAGCCATCGATCAAATTTCCTCCCCACTACTAGTCCTATCCTGCTGACTCCTTCCCCTCATGATTATAGCAAGCCAAAACCATCTAGATCAAGAACCCCCCATTCGCAAACGAATTTTCGCCACAACAGTAATCCTAGTACAACCCTTCATCCTATTAGCCTTCTCAGCCTCAGAGCTAATACTATTCTATATCGCCTTTGAAGCCACCTTAATCCCCACCCTAATCCTAATCACACGATGAGGAAGCCAACCAGAACGACTAAACGCAGGAATCTACCTATTATTCTACACACTCGCCAGCTCTCTCCCATTACTAATTGCCATCCTACACCTTCAAAACATAACCGGCACATTATACTTACCCATACTAAAACTAACAAACCCCACAGTCACCACCTCTTGAGCAGGCCTAGTCTGCAGCACCGCTCTACTCTTAGCCTTCATAGTCAAAGCCCCCCTTTACGGACTACACCTATGACTCCCCAAAGCCCATGTAGAAGCCCCTATCGCCGGGTCAATACTACTCGCCGCCCTGCTCTTAAAACTAGGCGGATACGGAATCATGCGAGTTACTATCCTAATAAACCCATCAACTAGCAACCTACACTACCCATTTATTACCCTTGCACTATGAGGTGCATTAATAACTAGCGCCATCTGCCTTCGACAAATTGACCTAAAAGCATTAATTGCCTACTCATCCGTCAGCCACATAGGCCTAGTCGTAGCTGCAACCATAATCCAGACCCAATGAGCATTCTCCGGAGCAATAATCCTAATAATCTCACATGGACTAACCTCCTCCATACTATTCTGCCTAGCCAACACCAACTACGAGCGCACTCACAGCCGAATCCTCCTACTCACACGAGGACTCCAGCCCCTCTTACCCCTCATAGCCATCTGATGACTCCTAGCTAACATAACAAACATAGCACTTCCACCAACAATTAACCTAATAGCAGAACTAACCATTGTAATTGCCCTATTCAACTGATCATCCTTTACACTTCTATTAACAGGCTCTGCAATCCTACTAACCGCCTCATACACACTATACATACTCATCACCACACAACGAGGAACCCTCCCATCCCACATCACTTCCATTCAAAACTCCTCCACACGAGAACATCTCCTCATAGCCCTCCACTTAATCCCCATGATCCTACTAATCTTCAAACCCGAACTCATTTCCGGAGTCCCAATAT-GCAGATATAGTTT--AA-CCAAAACATTAGACTGTGATTCTAAAAACAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AAGTT-CAACCAGCAAGAACTGCTAATCCTTGCATCTGAGTATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAGCCACTTATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTGATCTTAAGTACATCCATTCTACTCACCCTAACAATTCTCTCCACCCCCATTATCTTCCCCTTACTATCAGATAATCTCAAAAATTCCCCTAGCATCATCACAAACACAGTTAAAACCGCTTTCGCCATCAGCCTAATCCCCATAACAATCCACATCTACTCAGGAACAGAAAGCCTGCTCTCCATCTGGGAATGAAAATTCATCATAAACTTCAAAATCCCAATTAGCCTAAAACTAGACTTTTACTCACTCACATTCTTCCCAATCGCCCTATTCGTATCATGATCCATCCTACAATTCGCAACATGATACATAGCCTCAGACCCTTACATTACAAAATTCTTTACCTACCTTCTACTCTTCCTAATTGCCATACTCATCCTAATCGTCGCCAACAACCTATTCGTACTATTCATCGGCTGAGAAGGAGTAGGAATAATATCATTTCTCCTAATCAGCTGATGGCACGGCCGAGCAGAAGCTAACACCGCCGCTCTTCAAGCTATTCTTTACAACCGAGTAGGAGATATCGGACTCATCCTATGCATGGCATGACTAGCCTGCACTATAAACACATGAGAAATCCAACAACTTCCCTCCCCAGACCAAACCCCCACACTCCCATTATTAGGACTTATCCTAGCTGCAACAGGAAAATCCGCCCAATTCGGCCTACACCCATGACTTCCCGCTGCCATAGAAGGCCCAACCCCTGTATCCGCCTTACTCCACTCCAGCACAATAGTCGTTGCTGGCATTTTCCTACTCATCCGAACCCATCCCTTGTTCAGCAACAATCAAACCGCTCTTACCCTGTGCCTATGTCTAGGAGCCCTATCTTCCCTATTTGCAGCCACATGTGCCCTCACCCAAAACGATATTAAAAAAATCATTGCTTTCTCAACCTCTAGCCAACTAGGGCTAATAATAGTCACAATCGGCCTAAACCTACCCCAACTAGCCTTCCTCCACATTTCTACACACGCATTCTTTAAAGCAATGCTATTCCTATGCTCCGGATCTATTATCCACAGCCTAAATGGTGAACAGGACATCCGAAAAATGGGAGGCCTTCAAAAAACACTACCAACAACCACTGCATGCCTCACTATCGGCAACCTAGCCCTCATAGGAACACCATTTCTTGCAGGATTCTACTCAAAAGACCAAATCATTGAAAGCCTAACCACCTCTTACTTAAATTCCTGAGCACTCCTATTAACACTTCTAGCAACATCTTTCACTGCAGTATATACAATCCGCATAACAATACTAGTTCAAGCTGGCTACGTCCGAATCCCCCCTCTCACCTCAATGAACGAAAACAACCCTGCAGTAGTCTCCCCTATCACCCGCCTTGCACTAGGAAGCATCACTGCTGGCTTCCTCATTACCTCTTACATCCCAC---CCACAAAAACTCCACCCATAACCATGCCCCTATCCATTAAAATCACAGCCCTAGTAGTCACAGCCCTAGGAATCGCCATCGCCCTAGAACTGTCAAAAATAGCTCAAACTCTAATTCTCACAAAACAGACCACCCTATCAAACTTTTCCACTTCCCTAGGCTACTTCAACCCCCTAGTCCACCGCTTCACCACAACCAACCTCCTAAGCGGAGGACAAAACATCGCATCCCACCTCATTGACCTCTCCTGATATAAAATAATTGGGCCAGAAGGACTAGCCAACCTACAACTACTAGCAACCAAAGCCATTACCCCCTACCACCCAGGACTAATCAAAGCTTACCTAGGGTCTTTCGCCTTCTCAATTCTAATCATCCTCC---TGTCATCATACAGAAT--CCC-C-----AATGGCACCCAATCTTCGTAAAAACCACCCCCTACTAAAAGTCATCAACGACGCTCTAATCGACCTTCCTACTCCACCCAACATCTCAATCTGATGAAACTTCGGATCCCTACTAGGCATCTGCCTCATCACACAGATCATCACCGGCCTACTGCTAGCTATACACTACACAGCAGACACCAGCCTAGCCTTTAATTCTGTAGCCCACATGTGCCGAGACGTCCAATTCGGATGACTAATCCGAAACCTACACGCAAATGGAGCTTCCTTTTTCTTTATCTGCATCTACTTCCACATCGGCCGAGGACTATACTACGGCTCCTACCTCAACAAAGAAACCTGAAATGTCGGAGTCGTTCTCCTACTGGCTCTCATAGCAACTGCCTTCGTAGGCTACGTCCTTCCTTGAGGACAAATATCATTCTGAGGAGCCACAGTAATCACCAACCTATTCTCAGCAATCCCATACATCGGTCAAACACTAGTAGAATGAATATGAGGCGGGTTCTCAGTAGACAACCCCACACTAACCCGATTCTTCGCCCTACACTTCCTCCTACCATTTGTTATCGCAGGCCTCACCCTAGTTCATCTTACTTTCCTTCACGAAACCGGATCAAACAACCCTCTGGGCATCCCATCAGACTGTGACAAAATCCCATTCCACCCCTACTACTCCACAAAGGACATTCTAGGCTTCGCACTCATATTCATCGCCCTAGCCTCCCTAGCCCTATTCTCCCCTAACCTCCTGGGTGATCCAGAAAACTTCACGCCAGCCAACCCGCTATCTACACCACCTCATATCAAACCCGAATGATACTTCCTATTTGCATACGCCATCCTACGATCCATCCCGAACAAACTAGGAGGAGTCCTAGCCCTAGCTGCCTCCGTTCTAGTCCTATTCCTCGTCCCACTCCTCCACAAATCCAAACAACGCTCAATAACCTTCCGACCACTATCACAAATTCTATTCTGAGCCCTAGTAGCCAACCTCCTCATCCTAACCTGAGTCGGCAGCCAACCAGTCGAACATCCCTTTATCATCATTGGCCAGCTAGCTTCACTATCCTACTTCACCATCATTCTAGTCCTATTCCCCCTCGCAGCAATCCTAGAAAATAAAATCCTAAAACT----------CTA-AT------------AACTCTAATAGTTTATA-AAAACATTGGCCTTGTAAGCCAAAGATTGAAGACTACACCTCTTCTTAGAGTT Icterus_mesomelas_JX516068 GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCGGTG-TAGATGCCCTGGACA-CCT-C-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGACTAAAAAGCAACTGAGCTGTCACAAGCCAAAGATGC-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATTGATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--AGCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCCAACCATTCCTTGC-CAG--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCTCCC--CTGAAAGCCTAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGTAATGGGCTACATTTTCTAAGCTAGAACA-T----GACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG-ACCCCCCCCCCCCCCATAAACTAATAAGCTAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGCTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACATCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGTCACTACAT---A-CACCC----AACTAAAGCATT---T--ACCAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTCACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGGAAAAC-TCACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--ACTAC-TTC-CACAAC-CGCATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-ACTACAAAAATATAAG-AACCCAATGACTCCCT-CCCCATTAACGGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCATA-CATTATTAACAAA-CCACCA-ATATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATTA-AGTATC-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAGCCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CT-CACCCA--C-C-GGGTTTACTGTC-AAA-CAA-GA-T-TTTGGTT-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTGGACCATAACTCTAGACTA-AGAGCGACCTCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCTCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---CAAAC--CCTCCC--C----ATGAT----------CAACTACCCCCTCCTAATTAACTTCATCATAGCCCTCTCCTATGCCCTCCCAATCCTAATCGCAGTAGCCTTCCTTACGCTAGTAGAGCGCAAAATCCTAAGCTACATGCAAGGCCGAAAGGGCCCAAACATTGTAGGTCCCTTCGGACTTCTCCAACCTCTGGCAGACGGCATCAAACTATTCATCAAAGAGCCCATCCGTC---------CCTCAACATCCTCCCCAATATTATTCGTCGCAACCCCGATACTAGCCTTACTCCTAGCCATCTCAATCTGAACTCCACTACCCCTCCCATTCTCTCTGGCAGACCTCAACCTGGGACTGCTCTTCCTACTAGCCATATCAAGTCTGGCAGTATACTCCATCTTATGATCGGGTTGAGCCTCCAACTCTAAATACGCCCTAATTGGAGCACTGCGGGCGGTGGCCCAAACAATTTCTTATGAAGTTACCCTAGCCATTATCCTCCTCTCCATCGTCCTTCTCAGCGGCAACTACACTCTAAATACTCTCGCGGTTACACAAGAACCCCTATACCTTATCTTCTCCTGCTGACCTCTTGCTATAATATGATACGTCTCCACACTCGCTGAAACCAACCGTGCCCCCTTCGACCTCACGGAAGGAGAATCTGAACTAGTGTCCGGATTCAATGTAGAATACGCAGCAGGTCCCTTTGCACTTTTCTTTCTAGCCGAATACGCCAACATTATACTCATAAACACATTAACTACAATTCTATTCTTTAACCCAAGCTTTCTCAATCCCCCTCAAGAGCTATTCCCTGTCATTCTAGCCACAAAGGTCCTACTTTTATCAGCGGGGTTCCTATGAATTCGTGCTTCCTACCCACGATTCCGATACGACCAGCTAATACACCTACTATGAAAAAACTTCTTACCACTCACACTAGCTTTATGCCTCTGACACATCAGTATACCAATTTGCTATGCAGGCCTGCCT-----CCTTATCTA-A--GA-CC-----------CTACTGGAAATGTGCCTGAATAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTGCACCAGTCCTCTCATTTCCT-A--ACAC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCTTTATATTACTTCCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCTAGCAAACCTGATCTTCGCCACTAGCCTACTCCTAGGGACAACCATCACTATCTCAAGCAACCACTGGGTTA---TAGCTTGAACCGGCCTTGAAATTAACACACTCGCCATTCTCCCATTAATCTCAAAATCCCACCACCCACGAGCCATTGAAGCTGCCACTAAATATTTCCTAACCCAAGCAGCTGCCTCTGCCCTCGTCCTATTTTCTAGCATAACCAATGCATGGCACACCGGACAATGGGACATCACCCAACTCACTCACCCAACGTCCTGCTTAATCTTTACTTCAGCGATCGCAATAAAACTAGGCCTAGTACCATTCCACTTCTGATTCCCAGAAGTCCTCCAAGGTTCTCCCCTAATTACTGGCCTACTCTTATCCACCATCATAAAACTTCCACCAATCACATTACTTTACATAACCTCCTCCTCACTAAACCCTACACTCTTAACCACCCTAGCTATCCTCTCAACAGCCCTAGGAGGATGAATAGGCCTCAACCAAACACAAATCCGAAAGATCCTAGCCTTCTCCTCCATCTCCCACTTAGGTTGAATAGCAATTATCATCATCTACAACCCCAAACTCGCTCTCCTTAACTTCTACCTGTACACCGTAATAACCGCAACTGTCTTCCTTACTCTAAACACAATCAAAGTTCTAAAACTATCTACCTTAATAACCGCATGAACCAAAATCCCATCCCTAAGCACAATACTCCTCCTAACTCTACTTTCTCTCGCAGGCCTCCCCCCTCTAACAGGATTCCTGCCCAAATGACTCATCATCCAAGAACTGACTAAACAAGACATAGCCCCAGCAGCCACGCTTATCTCCCTTCTCTCCCTACTAAGCCTCTTCTTCTACCTCCGACTCGCATACTGTGCAACCATTACGCTCCCCCCACACACCACAAACCATATAAAACAATGACGGACTAACAAACCAACCAACATCATAATTGCCATCCTAACCACTGTATCCATCGTACTTCTTCCTGTCTCTCCTATGATCCTCACCATCAT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTACTACCCTGCATCCCCCAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-C--CAA-CCCACTAGGCAGATGGGCTTTGATCCCATGATAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTGCCT-A-------------AGACTCCGGTACACGG-TTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTTATCGACCGATGATTATTCTCAACCAACCACAAAGACATTGGGACCCTATACTTAATCTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGGGACGACCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTCGTGATAATCTTCTTCATAGTTATACCAATTATAATCGGGGGATTCGGCAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTCCTCCTCCTAGCGTCCGCCACAGTCGAAGCAGGTGTAGGCACAGGCTGAACAGTATACCCACCCCTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTTGATCTTGCAATCTTCTCCCTACACTTAGCTGGCATCTCTTCAATCCTAGGAGCAATCAACTTCATTACAACCGCAGTCAACATAAAACCCCCTGCCCTCTCACAATACCAGACCCCCCTATTCGTATGATCCGTCTTAATCACCGCAGTACTCCTACTCCTATCTCTCCCAGTCCTTGCCGCAGGAATTACAATACTCCTCACAGACCGCAACCTCAACACCACATTCTTTGACCCTGCCGGAGGAGGAGACCCCGTACTATACCAGCATCTCTTCTGATTCTTTGGCCACCCAGAAGTCTACATCTTAATCCTTCCAGGATTCGGAATCATTTCCCACGTTGTAGCCTACTACGCAGGCAAAAAAGAACCATTTGGCTACATGGGAATAGTATGAGCCATATTATCTATCGGATTCCTAGGCTTTATCGTCTGGGCCCACCATATATTCACAGTGGGAATGGACGTTGACACCCGAGCATACTTCACATCCGCCACCATAATCATCGCCATTCCAACTGGAATCAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGTACAATCAAATGAGACCCCCCAATACTATGAGCACTAGGATTCATCTTCCTATTCACCATTGGAGGACTAACAGGAATTGTACTAGCAAACTCTTCACTGGACATCGCCCTACATGATACCTACTATGTAGTAGCCCACTTCCACTACGTACTATCCATAGGAGCAGTATTTGCAATCCTAGCGGGCTTCACTCACTGATTCCCTCTATTCACAGGATATACACTCCACTCAACATGAGCCAAAGCACATTTCGGCGTCATGTTCGTAGGCGTGAACTTAACCTTCTTCCCTCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACCATTTCCTCAGTAGGCTCACTCATCTCCCTAACAGCCGTAATCATACTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTACTACAACCAGAACTAACAAGCACTAATGTTGAGTGAATCCACGGCTGCCCGCCCCCATTCCATACATTTGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AGACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCC-----ACCC--AAATATGGCCAACCACTCACAACTTAACTTCCAAGACGCCGCCTCACCCATTATAGAAGAACTGATAGGATTCCACGACCACGCCCTAATGATCGCATTAGCCATCTGTACCCTCGTCCTATACCTACTAACCCACATACTCACAGAAAAACTGTCATCAAACACAATCAATGCACAAGTAATCGAACTCGTCTGAACAATCCTTCCTGCCCTAGTTCTAATCACACTCGCCCTACCTTCCCTACGAATCCTCTACATAATAGACGAAATCAACGAACCAGACCTGACCCTAAAAGCCATCGGCCACCAATGATATTGAACCTACGAATATACCGATCTTAAAGACTTAACATTCGACTCCTACATAATCCCAACAGCGGACCTACCCCTAGGCCACTTTCGCCTACTGGAAGTCGACCACCGTGTTATTGTCCCCATAAACTCAACTATCCGAGTAATCGTCACCGCCGATGATGTCCTCCACTCATGAGCCGTTCCTAGCCTAGGTGTAAAAACCGACGCAATTCCAGGACGCCTCAACCAAACTTCCTTCCTTGCTTCCCGACCAGGCGTGTTCTACGGACAATGCTCAGAAATCTGTGGGGCTAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCCCTCGCCAACTTCGAAAGCTGATCCACTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAATCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGA--CCTCCCCCTCCTTAATGGTATGCCTCAACTAAACCCCAACCCCTGATTTTTTATCATGCTCACTTCATGACTCACCTTCTCCTTAATCATCCAGCCCAAACTCCTATCATTCGTATCAATAAACCCGCCATCTAACAAAC---CACCCGCCGCTCCAAGCACCACCCCCTGAACCTGACCATGAACTTAAGCTTCTTCGATCAATTTTCAAGTCCATCCTTCCTAGGAATCCCATTAATCCTCATCTCAATAACATTCCCGGCCCTCCTTCTACCATCCCTAGACAACCGATGAATCACCAACCGACTCTCAACCCTCCAACTATGATTCATCAATCTAGTCACAAAACAACTAATAATACCCTTAGATAAAAAAGGCCACAAATGAGCCCTAATCCTCACATCCCTAATAATTTTCCTCCTCCTCATCAACCTCCTAGGCCTATTACCCTACACATTCACCCCAACCACCCAACTATCTATAAACTTAGCCCTAGCCTTCCCCCTATGATTTGCCACCCTCCTAACAGGACTACGAAATCAACCTTCTACTTCACTCGGCCACCTCCTGCCAGAAGGCACCCCCACCCCACTAATCCCAGCCCTTATCCTAATCGAAACAACAAGTCTCCTCATCCGCCCACTAGCACTAGGCGTACGCCTAACAGCCAACCTCACAGCAGGTCACCTTCTCATCCAACTCATCTCCACAGCTACAGTAGCCCTATCCTCCACAATACCAGTAGTCTCACTCCTCACTTTCCTAATCCTATTCCTATTGACAATCCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTCTTCGTCCTCTTACTCAGCCTCTACCTTCAAGAAAACATCTAACCC--C-----AATGGCACACCAAGCACATTCCTACCACATAGTCGACCCCAGCCCTTGACCTATCTTAGGAGCAGCTGCTGCCCTCCTAACTACCTCAGGACTAACAATATGATTCCACTACAACTCCCCCCGACTTCTCATCCTAGGCCTACTCTCAACCATCCTCGTCATATTCCAATGATGACGTGACATCGTACGAGAAAGCACATTCCAAGGCCACCACACTCCTACCGTGCAGAAAGGACTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTCTTCTTCCTAGGCTTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCACCCACACCTGAACTAGGAGGACAATGACCACCCGTTGGAATCAAACCCCTTAACCCAATAGAAGTCCCACTCCTAAACACTGCCATCCTCCTAGCCTCAGGAGTCACCGTCACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCTCTATCCCTAACAGTCCTGCTAGGATTTTACTTCACCGCCCTACAAGCTATAGAATACTACGAAGCCCCCTTCTCTATCGCCGACGGAATCTACGGCTCAACATTCTTTGTTGCTACCGGATTCCATGGCCTACACGTAATTATTGGCTCCACATTCCTACTAGTATGCCTCCTGCGATTAATTAAATACCATTTCACATCAAACCACCACTTCGGATTTGAAGCAGCCGCCTGATATTGACACTTCGTAGACGTCGTATGATTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTACATTACAATCGACTTCCAATCCTTAAAATCCGGTTCAACCCCGGAGAAGAGTAATA---AACATAATCCTATTTATACTGACCCTATCACTAACCTTAAGCATCCTCCTAACCGCACTAAACTTTTGACTTGCCCAAATAATCCCAGACTCAGAAAAGCTGTCCCCATACGAATGCGGATTCGACCCCCTAGGGTCCGCTCGGCTTCCATTCTCAATCCGCTTCTTCCTAGTAGCTATCCTATTCCTTCTGTTCGACCTAGAAATCGCCCTACTCCTACCACTACCTTGAGCCACCCAACTACAATCTCCTATCACTACCCTAGCCTGAGCCACTATTCTCATTCTCCTCCTCACCCTAGGGCTAGTATACGAATGAATTCAAGGAGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACGGTTGATTTCGACTCAACAAATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTACTTACACCTAAGCTTCTATTCAGCCTTCACCCTAAGCAGCCTAGGCCTAGCCTTTCACCGAACTCATCTAATCTCCGCCCTACTATGTCTAGAAAGTATAATACTATCCATATACGTCGCCCTAGCCATATGACCCATCCAAACCCAATCATCAACTTCCACTATCCTACCCATCCTCATACTAACATTCTCCGCCTGCGAAGCAGGCACAGGCCTAGCACTGCTAGTAGCCTCAACCCGCACCCATGGTTCTGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCGCAACACTCCTCCCCCTAAGCCTCCTCTCCCCACACAAACACCTATGAACCAATACTACACTGTACAGCCTACTAATCGCTACTATCAGTCTCCAATGACTCACACCAACATATTTCCCAAACAAAGGTTCAACCCCCTGAACATCCATCGACCAAATTTCCTCCCCCCTCCTAGTCCTCTCATGCTGACTCCTGCCCCTCATAATCATAGCAAGCCAAAATCACCTAGAACAAGAACCCATCAACCGCAAACGAATCTTCGCCTCAACACTAATCCTAGCCCAACTCTCCATCCTCCTAGCCTTCTCAGCTTCAGAACTAATACTCTTCTACATCGCATTTGAAGCCACCCTAATTCCCACCCTCATCCTCATCACACGATGAGGAAGCCAACCAGAACGCCTAAACGCTGGCATCTACCTCCTATTCTACACACTCGCCAGCTCACTCCCACTACTAATCGCTATCCTCCACTTGCAGAACCAAATCGGCACACTATACCTCCCAATATTCAAACTCTCACATCCCACACTAAACTCTTCTTGATCGGGCCTGATCGCCAGCCTCGCCCTCCTACTAGCCTTTATAGTAAAAGCCCCCCTGTACGGCCTACACCTATGACTCCCAAAAGCCCACGTAGAAGCTCCTATCGCTGGCTCCATACTACTAGCCGCCTTACTTCTAAAACTCGGAGGCTACGGCATCATGCGAATCACAATCCTAGTAAACCCATCATCAAACAACCTTCACTACCCCTTCATCACCCTGGCCCTATGAGGAGCAGTAATAACCAGTGCCATCTGCCTACGCCAAATTGACCTAAAATCATTAATCGCCTACTCATCTGTCAGCCACATAGGATTAGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACATGGCCTAACCTCATCAATACTATTCTGCCTAGCCAACACCAACTATGAACGAACCCACAGCCGAATCCTCTTACTCACGCGAGGACTCCAGCCTCTACTACCACTTATGGCCACCTGATGACTACTAGCTAACCTAACAAACATGGCTCTCCCTCCAACAACAAACCTCATAGCAGAGCTAACCATCGTAGTCGCACTCTTCAACTGATCCGCCTTCACAATCATCCTAACAGGAACCGCTATTCTACTCACCGCCTCATATACCTTATACATACTAATAATAACACAACGAGGTGCCCTCCCATCCCACATCACATCAATCCAAAACTCCTCCACACGAGAACACCTCCTCATGGCCATACACATAATCCCCATAATCCTCCTAATCCTCAAACCCGAACTAATCTCCGGTATCCCCACAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAAATAGAAGTTAAACTCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAACGAGAACTGCTAACTCTTGTATCTGAGTATAA-AACCTCAGTCTCCTT--GCTTTCAAAGGATAATAGTAATCCACTGGTCTTAGGAACCATTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTTTCACTAGTCCTAAACACATTCATACTCCTAACCCTAACAATCCTCTCCACCCCTATCCTACTCCCCCTCCTATCCGATAACCTTAAAAACACCCCCAATACAATCACAAACACAGTCAAAACCTCGTTCCTAATCAGCTTAGTCCCAATAACAATCTACATCTACTCCGGAACAGAAAGCCTCGTCTCCCTCTGAGAATGAAAATTCATCATAACCTTTAAAATCCCTATCAGTCTAAAAATAGACTTCTACACACTCACCTTCTTCCCCATCGCACTATTCGTATCATGATCCATCCTACAATTCGCAACATGATACATGGCCTCAGACCCCTACATTACAAAATTCTTCACCTACCTACTATTCTTCCTAATTGCCATACTCATTCTAATCATCGCCAACAACCTATTCGTCCTATTCATTGGCTGAGAGGGAGTCGGAATCATATCCTTCCTACTAATCAGCTGATGACACGGTCGAGCAGAAGCCAATACCGCCGCCCTCCAAGCCGTCCTCTACAACCGAATCGGAGATATTGGCCTTATCCTCTGCATAGCATGACTAGCCTCCACCACCAACACCTGAGAAATCCAACAACTCCCTACCCCCTCCCAAACTCCAACTCTACCCCTACTGGGCCTTATCCTAGCCGCAACCGGAAAATCCGCCCAATTCGGCCTCCACCCTTGACTCCCAGCTGCAATAGAAGGACCAACCCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATTTTCCTACTCATCCGAACTCATCCCCTATTCAACAACAACCAAACCGCCCTAACCCTATGCCTTTGCCTAGGAGCCCTCTCCACGCTATTCGCAGCCACATGCGCCCTAACCCAAAATGACATCAAAAAAATCATCGCATTCTCCACTTCCAGCCAACTAGGACTAATAATAGTTACAATCGGACTAAACCTACCCGAACTAGCCTTCCTACACATCTCAACCCACGCATTCTTCAAAGCCATGCTCTTCCTCTGCTCAGGTTCCATCATCCACAGCCTAAACGGCGAACAAGACATCCGAAAAATAGGAGGGCTCCAAAAAATACTCCCCACAACAACCACATGCCTCACAATCGGCAATCTCGCCCTAATAGGAACACCCTTCCTAGCAGGATTCTACTCAAAAGATCAAATCATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCCCTAATCCTAACTCTCCTAGCCACGTCATTCACTGCAGTATACACAATCCGTATAACCGTACTAGTACAAACCGGCTTCGTCCGAATTCCCCCCTTAACCCCAATAAACGAAAACAACCCCGCAGTAATCTCCCCCATCACCCGCCTTGCACTAGGAAGCATTCTAGCAGGCTTCCTCATTACCTCATTCATCATTC---CCGCAAAAACTCCCCCAATAACTATGCCACCCCACATCAAAATAACCGCCCTAATCGTAACAGCCCTAGGCATCGCCCTAGCCCTAGAAATCTCAAAAATAGCCCAAACACTCCTCCTCACAAAACAAACCCCACTCTCAAACTTCTCAACTTCCCTAGGATATTTCAACCCCCTAATCCACCGCCTGAGCATAACCAATTCCCTCAAAGGAGGACAAAACATCGCCTCCCACCTAATTGACCTATCCTGATATAAAATACTAGGCCCAGAGGGACTCGCCAGTCTACAACTAACAGCAACCAAAACCGCCACTACCCTCCACTCCGGCCTAATCAAAGCCTACCTAGGGTCATTCGCCCTATCCATCCTCATCATCCTTA---CATCCTCACTCAGAAA--AAA-C-C---AATGGCCCCCAACCTTCGTAAAAACCACCAAATCCTCAAAATCATCAACGACGCCCTAATCGACCTCCCAGCACCATCAAACATCTCAACATGATGAAACTTCGGGTCCCTCCTGGGCGTGTGCCTAATCACTCAAATTGTCACAGGTCTCCTGCTAGCCATACACTACACAGCAGACACCAACCTGGCTTTCTCTTCCGTCGCCCATATATGCCGAGACGTACAATTCGGCTGACTCATCCGCAACCTCCATGCAAACGGAGCTTCCTTTTTCTTCATCTGCATCTACCTTCACATCGGCCGAGGCATCTACTACGGCTCATACTTGTACAAAGAAACCTGAAACATCGGAGTTATCCTTCTCTTAGCCCTCATAGCAACTGCCTTCGTAGGATACGTACTGCCATGAGGCCAAATATCATTCTGAGGCGCCACCGTCATCACAAACCTATTCTCAGCTATCCCCTACATCGGACAGACACTAGTCGAATGAGCCTGGGGCGGCTTCTCCGTTGACAACCCCACACTAACCCGATTCTTCGCCCTTCACTTCCTTCTCCCCTTTCTCATCGTAGGACTTACCCTTGTCCACCTCACCTTCCTGCATGAAACAGGCTCAAACAACCCCCTAGGCATCCCATCAGACTGCGACAAAATCCCCTTCCACCCATACTACACCATCAAAGACATCCTAGGATTTGTCCTAATACTCTCCCTGCTTGTCTCACTAGCCTTATTCTCCCCCAACCTCCTAGGCGACCCAGAAAACTTCACCCCAGCCAACCCCCTAGTCACCCCTCCCCATATCAAGCCCGAGTGATACTTCCTATTTGCATACGCCATCCTCCGATCCATCCCAAACAAACTAGGAGGCGTATTAGCCCTAGCTGCCTCAATCCTAGTCTTATTCCTCATACCACTACTTCACACATCAAAACTACGATCAATAACCTTTCGCCCCCTATCACAGATCCTATTCTGAACTCTAGTCGCCAACGTCCTTATCCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAATTAGCCTCACTCTCATACTTCACAATCATCCTAATTCTATTCCCCCTCGCGGCCGCTTTAGAGAATAAGCTGCTCAAACT----------CTA-ATA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Lampropsar_tanagrinus_JX516057 GTCCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCGGTG-TAGATGCCCTGGACA-CCT-T-AA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAAACGCCTTGCAATTGCCACACCCCCACGGGTCATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-C---CCAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTAAGCCGTCACAAGCCCAAGATGC-CAATAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGACTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGGGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGATA-TACCTGACCATCCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCGCCAGCCCACCCACA--CTGAAAGCCCAACAGTGGACGCAATAG-CCCCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCCATGGGATG----------------------GT-AGTAATGGGCTACATTTTCTAGACTAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACACGTACATACCGCCCGTCACCCTCCTCGCAGG-CG---CCCCCCCCCCCCCATAAAATAATAAGCTGT-CC--AGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACCA-CCAAGACGTAGC-TTAAGCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGTTA-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAA--AAAGCCACTACCC-CAA-AACCC----AACTAAAGCATT---T--ATTAGT-CCTAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAGCAATG-AAA---AC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTCCTCCAAGGAAAAC-CTACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ATTAACCCC-CCAAAC-TGAATTGTGGGCCCTCAAGCAGCCACCAACAAAGAGTGCGTTAAAGCTCTAC-ACCACAAAAATATAAG-AACCTAATGACTCCCT-CCCCATTAACAGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCGTA-CATTATTAACAAA-CTCCCA-ATATACGA--AAAAT---------CAA---ACAAGCA-CAG-TATTA-AACATA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACCCATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAGCCACC--TTAAAA-CACACA----CT-CACCCA--C-T-GGGTTCACTAAC-ACA-TAA-GA-A-TCTGGCC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACCG-AGAGCAACCTCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCTCGAGAGTCCGTATCGACAGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAATCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---CA-----CC---C--C----ATGAC----------CAACTACCCCATTCTGATCAGCCTTATCATAGCCCTATCCTATGCCCTGCCAATCCTAATCGCAGTCGCTTTTCTTACACTAGTAGAGCGCAAAATCCTGAGCTACATGCAAGGCCGAAAAGGCCCAAACATCGTCGGCCCCTTTGGGCTTCTCCAACCTCTGGCAGACGGTGTCAAACTGTTCATCAAAGAGCCTATCCGAC---------CATCAACATCGTCTCCAATCTTATTCGTTGCAACCCCAGTCCTAGCTCTCCTCCTGGCCATCTCAATCTGAACCCCACTGCCCCTCCCATTCTCTCTAGCAGACCTCAATCTAGGACTTCTTTTCCTACTAGCCATATCAAGTCTAGCAGTATACTCCATCCTATGATCAGGCTGAGCCTCCAACTCCAAATACGCCCTAATTGGAGCACTACGAGCAGTAGCCCAAACAATCTCCTACGAGGTAACCCTGGCTATCATTCTTCTCTCCGTTGTCCTCCTTAGCGGTAACTACACCCTAAATACCCTCGCAATCACCCAAGAGCCCTTATACCTTATCTTCTCCTGCTGGCCCCTTGCTATGATGTGATACGTCTCCACACTAGCCGAGACCAACCGTGCCCCTTTCGACCTAACAGAGGGGGAGTCCGAACTGGTATCAGGATTCAACGTAGAATATGCAGCAGGTCCTTTTGCACTATTCTTTCTAGCCGAATATGCCAATATTATACTTATAAACACACTAACTGCAATCCTATTCTTCAACCCAAGCTTCTTTAACCCACCTCAAGAGCTATTCCCCATCATCCTGGCCACAAAAGTCCTGCTTTTATCAGCAGGATTCCTATGAATTCGCGCCTCCTACCCACGATTTCGATATGACCAACTAATGCACCTGCTATGAAAAAATTTCTTACCACTTACACTAGCCCTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGCCTGCCC-----CCTTACCTA-A--GG-CC-----------TTGCTGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-A--GTAA-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTCCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAATCCTCAAGCAAGCCTGATCTTCGCCGCTAGCCTACTTCTAGGGACAACTATCACCATCTCAAGTAACCACTGAATTA---TAGCTTGAACCGGTCTTGAAATTAATACACTCGCCATCCTCCCATTAATCTCTAAATCCCACCACCCACGAGCTATTGAAGCTGCCACTAAATACTTCCTAACCCAGGCAGCTGCCTCTACCCTAGTCTTATTCTCCAGCATAACCAATGCATGACACACTGGACAATGAGACATCACCCAGCTTACCCATCCAACATCCTGCCTAATTCTTACTTCGGCTATCGCAATAAAACTAGGACTAGTGCCATTTCATTTCTGATTCCCAGAAGTACTCCAAGGCTCCCCCCTCACCACTGGCCTACTCCTATCTACCATAATAAAACTCCCCCCAATCACATTACTCTACATAACCTCCCCTTCACTTAACCCCACACTATTAACTACTCTAGCCATCCTTTCCGCAGCCCTAGGGGGCTGAATGGGTCTCAACCAGACACAAGTCCGAAAAATCCTAGCTTTTTCCTCCATTTCCCATCTGGGCTGAATAGCAATCATTATCATCTACAACCCTAAACTCACATTACTTAACTTCTACCTGTACACCGTAATAACCGCAACTGTCTTCCTCACCCTAAACACAATTAAAGTACTAAAACTATCCACCCTAATAACTGCATGAACTAAGACCCCATCCTTAAACGCAATACTACTTCTAACCCTGCTTTCCCTCGCAGGACTCCCTCCTTTAACAGGATTCCTGCCTAAATGACTCATCATCCAAGAACTAACTAAACAAGAAATAGTCCCAGCAGCTACACTTATCTCTCTACTTTCCCTACTAAGCCTATTCTTCTACCTTCGACTAGCATACTGTGCGACCATCACACTCCCCCCACATACTACAAACCACATAAAACAATGACGCACCAACAAACCAACTAACATTACAATTGCCATCCTAACCACTGTGTCCGTCATACTCCTCCCTATCTCACCTATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCATTACCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAA----CCTAGGCAGATGGGCTTCGATCCCACGATAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGGCCCCGGCGCATAA-TTAATGCACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTCATTACCCGATGATTATTCTCAACTAACCACAAAGACATTGGGACCCTGTATCTAATCTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTCCTAGGAGATGACCAAGTATACAACGTAGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATGCCAATCATAATCGGAGGGTTCGGAAACTGATTAGTCCCCCTAATAATCGGAGCCCCAGATATGGCATTCCCACGAATAAACAATATAAGCTTCTGACTACTTCCCCCATCCTTCCTTCTCCTCCTAGCATCTTCCACGGTTGAATCGGGCGTAGGAACAGGATGAACAGTATATCCCCCACTAGCAGGCAACCTGGCCCACGCCGGAGCCTCAGTCGACCTCGCAATTTTCTCCCTACATCTAGCCGGTATCTCTTCAATCTTAGGAGCAATCAACTTTATTACAACAGCAATCAACATAAAACCCCCCGCCCTATCACAATACCAAACTCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTGTTACTTCTATCCCTTCCAGTCCTAGCCGCAGGAATCACAATACTTCTCACAGACCGCAACCTTAACACCACATTCTTCGATCCTGCCGGAGGAGGAGACCCTGTGCTATACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTCGGGATCATCTCCCATGTTGTAGCCTACTACTCAGGCAAAAAAGAACCATTCGGATACATAGGGATAGTATGAGCCATGCTATCCATCGGATTCCTAGGCTTTATTGTCTGAGCCCACCACATATTCACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCTATCCCAACCGGAATCAAAGTATTTAGCTGACTAGCCACACTCCACGGAGGTACAATCAAATGAGACCCCCCAATGCTATGAGCCTTAGGATTTATCTTCCTATTCACCATCGGAGGACTGACAGGAATCGTCCTAGCAAACTCCTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTACTATCCATAGGAGCAGTATTCGCAATTCTAGCAGGCTTCACCCACTGATTCCCCCTATTCACCGGATATACACTACATTCAACATGAGCTAAAACACACTTTGGCGTAATATTCGTCGGCGTAAATCTAACCTTCTTCCCCCAACATTTCCTAGGCCTAGCAGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTGTGAAACACCATTTCTTCAGTGGGCTCACTCATCTCCCTGACAGCCGTAATCATGCTGGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTGCCACCAGAGCTGACAAGCACTAACGTGGAATGAATCCACGGCTGCCCACCTCCATTCCACACCTTCGAAGAACCCGCCTTTGTCCAAACC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAAACCCAGCACATCTCC-----ACCC--AAACATGGCCAACCACTCACAACTTAACTTCCAAGACGCCGCCTCACCTATTATAGAAGAACTAATAGGATTCCACGACCACGCCCTAATAATCGCACTAGCAATCTGCAGTCTCGTCCTCTACCTACTAACCCACACTCTCACAGAAAAACTGACATCAAGCACAGTCAACGCACAAGTAATCGAGCTAGTCTGAACAATCCTCCCTGCCCTAGTCCTAGTTACACTCGCCCTACCATCCCTACGAATTCTTTACATAATAGATGAAATTAATGAACCAGACCTAACCCTAAAAGCCATCGGTCACCAATGATACTGAACCTACGAATATACTGACAACAAAGACCTAACATTCGACTCCTATATAATCCAAACAGCAGACCTACCTTTAGGCCATTTCCGCCTACTAGAAGTTGACCATCGCGTTGTCGTTCCCATAAACTCAACTATCCGAGTCATCGTCACCGCCGACGACGTCCTCCACTCATGAGCTGTTCCCAGCCTAGGCGTAAAAACCGACGCAATCCCAGGACGTCTCAACCAAATCTCCTTTCTTGCCTCCCGACCAGGTGTATTCTACGGACAATGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCTACCCCACTCGCTAACTTCGAAAGCTGATTCTCTCTAA---TATCATCCT----------AATCATTAAGAAGCTATGAACCAGCGTTAGCCTTTTAAGCTAAAGAAAGAGGGA--TCCCCCCCTCCTTAATGATATGCCCCAACTAAACCCCAACCCCTGATTTTTTATCATGCTCACTACATGACTCACTTTCTCTCTAATCATTCAACCCAAAATTCTAACGTTCGTATCAATAAACCCCCCATCTAACAAAC---CACCAGCCGCCCCAAGCACCACCCCCTGGACCTGACCATGAACCTAAGCTTCTTTGATCAATTCTCAAGCCCATCATTCCTGGGGATCCCACTAATCCTCATCTCAATAACATTCCCAGCCCTTCTCCTACCATCCCTTGACAATCGATGAATCACCAACCGACTATCAACCCTCCAACTTTGATTCATCAACCTAGTCACAAAACAACTAATAACACCCCTAGACAAAAAAGGACACAAATGAGCCCTAATCCTGACATCCCTTATAATCTTCCTCCTCCTCATTAACCTCCTAGGCCTGTTACCATATACATTTACCCCAACCACCCAACTATCCATAAACCTAGCCCTAGCCTTTCCCCTATGACTAGCCACACTCCTAACAGGGCTGCGAAACCAGCCTTCTACTTCACTAGGTCACCTCCTACCAGAAGGCACACCCACCCCACTAATCCCAGCCCTCATCCTAATCGAAACGACAAGCCTTCTCATCCGCCCATTAGCACTAGGCGTGCGCCTAACAGCCAACCTAACAGCAGGCCACCTCCTCATCCAACTCATTTCTACCGCCACAACAGCCCTATTCTCCACAATACCAATAGTTTCCCTCCTAACCTTCGTAGTCCTCTTCCTACTAACAATCCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTATTTGTACTACTATTAAGCCTCTACCTCCAAGAAAACATCTAATTC--TA----AATGGCACACCAAGCACATTCCTACCACATAGTTGACCCCAGCCCATGACCTATCCTGGGAGCGGGAGCCGCCTTCCTTACTACCTCAGGACTGACAATATGATTCCACTGAAACTCCCCCAACCTCCTTATCCTAGGCCTACTGTCAACCATCCTCGTCATATTCCAATGATGACGCGACATTGTACGAGAAAGCACATTCCAAGGCCACCACACCCCAACCGTACAAAAAGGACTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTCTTCTTCCTGGGCTTTTTCTGAGCTTTCTTCCACTCGAGCCTAGCCCCTACACCAGAACTAGGAGGTCAATGACCCCCCGTAGGGATTAAACCCCTCAACCCCATAGAAGTCCCACTCCTAAACACTGCTATCCTCCTAGCCTCGGGAGTCACCGTCACATGAGCCCACCACAGCATCACAGAAGCTAACCGAAAACAAGCAATCCAAGCCCTATCCCTAACAGTTCTCCTGGGCTTCTACTTCACTGCCCTACAAGCCATAGAATATTACGAAGCACCATTCTCCATTGCCGACGGAGTCTACGGTTCAACATTCTTCGTCGCCACCGGATTCCACGGCCTACATGTAATTATCGGCTCTACATTCCTACTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTTGTATGACTACTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTAACCCTATCACTAACCCTAAGCATCCTCCTAACTATTCTAAACTTCTGACTTGCCCAAATAACCCCAGACCAAGAAAAGCTATCCCCATACGAATGTGGATTCGACCCCCTAGGGTCTGCCCGACTCCCTTTTTCAATCCGCTTCTTCCTAGTAGCTATCCTATTCCTCCTATTCGACCTAGAAATCGCCCTACTCCTTCCACTACCCTGAGCCATCCAACTACAATCCCCCACCACTACCTTAACCTGAACTGCCACACTCATCCTCCTACTCACCCTAGGCCTGGTGTACGAATGAATTCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCAACCCTATAACTTTCTTTATGTCCTATCTCCACCTAAGCTTTTACTCAGCCTTTACCCTAAGCGGCCTCGGCTTAGCCTTCCACCGAACCCACCTAATCTCCGCCCTACTATGCTTAGAGAGCATAATGCTTTCTATATACGTCGCCCTAGCCATATGACCCATCCAGGTCCAATCATCAATATCCACTATCCTGCCCATCCTCATACTAACATTCTCCGCCTGCGAAGCGGGCACAGGCCTAGCACTGCTAGTAGCCTCAACTCGTACTCACGGGTCCGACCACCTACACAATTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCACAATACTCCTCCCCCTAACCCTCCTCTCCCCACGCAAACACCTATGAACTAACATCACACTATACAGCCTACTAATCGCCACCGTCAGCCTACAATGACTTACACCAACATACTACCCAAACAAAAGCCTAACTCCATGAACATCAATTGACCAAATCTCCTCTCCCTTACTAGTCCTTTCATGCTGACTCCTCCCCCTCATAATCATAGCAAGCCAAAACCATCTAGAACAAGAACCCATCAACCGCAAACGAATCTTTGCCTCAACACTAATCCTAGCCCAACTATCCATCCTCCTGGCCTTCTCCGCTTCCGAACTAATACTCTTCTACATCGCATTTGAGGCCACCCTCATTCCCACCCTAATCCTCATCACACGATGAGGAAGCCAGCCAGAACGCCTAAATGCTGGCATCTACCTCCTATTCTACACCCTCGCCAGCTCACTCCCACTATTAATTGCCATCCTCCACCTACAAAACCAAATCGGCTCACTCTATCTACCAATACTCAAACTTTCACATTCAACATTGAACCCCTCTTGATCCAGCCTAGCTGCAAGCCTAGCCCTCCTACTAGCCTTCATGGTTAAAGCCCCCCTATATGGCCTACACCTATGACTCCCCAAAGCTCACGTAGAAGCCCCAATTGCTGGCTCCATGCTGCTAGCAGCCCTACTATTAAAACTCGGAGGCTACGGCATTATACGAATCACAATCCTAGTAAACCCATCATCAAACAACCTCCACTACCCATTCATCACCTTAGCCCTATGAGGAGCAGTAATAACTAGTGCCATCTGCTTGCGCCAAATTGACCTGAAATCACTAATCGCCTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCTGCAACCATAATCCAGACTCAATGAGCATTCTCAGGGGCAATAATCCTAATAATCTCACACGGCCTAACCTCCTCAATACTATTCTGCCTAGCCA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????-???-????????????????????????????????????????????????????????????-?????-???????????????????????????????????????-???????GTCTCCTT--ACTTTC-AAGGATAACAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCACTAGTCCTAAACACATTCATACTCCTAACCCTAGTCACCCTCTCCACCCCCATCCTATTTCCGCTACTATCCAACAACCTCAAAAACACCCCCAACACAATCACGAACACAGTCAAAACTTCATTCCTAATCAGCCTAATCCCTATAACAATTTTCATCTACTCTGGAACAGAAAACCTTACTTCCCTCTGAGAATGAAAATTCATCATAACCTTCAAAATCCCAATTAGCTTAAAAATGGACTTCTACACCCTCACTTTCTTCCCCATTGCACTATTCGTGTCATGATCCATCCTACAATTCGCAACATGATACATAGCTGCAGACCCTTACATCACAAAATTCTTTACCTACCTTCTATTCTTCCTAATTGCCATACTCATCCTAATCATCGCCAACAACTTATTTGTCCTATTCATCGGATGAGAAGGAGTCGGGATTATATCTTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTACAAGCTGTTCTCTACAACCGAATCGGCGACATCGGCCTCATCCTATGCATAGCATGACTAGCCTCCGCCACAAACACCTGAGAAATCCAGCAACTCCCTACCCCATCCCAAACCCCCACATTACCCTTGCTAGGCCTCATCCTAGCTGCAACCGGAAAGTCCGCCCAATTCGGCCTACACCCATGACTCCCAGCCGCAATAGAAGGACCAACCCCCGTATCCGCCCTACTCCACTCCAGCACGATAGTAGTAGCAGGAATCTTCCTACTCATCCGAACCCATCCCCTATTCAACAACAACCAAACTGCCCTAACCCTATGCCTCTGCCTAGGGGCTATCTCCACCTTATTCGCAGCCACATGTGCCCTAACCCAAAACGACATTAAAAAAATCATCGCCTTCTCCACTTCCAGCCAACTAGGCCTAATAATAGTAACAATCGGACTAAACCTACCCGAATTAGCCTTCCTCCATATCTCCACCCACGCATTTTTCAAAGCCATGCTCTTCCTATGCTCGGGCTCTATCATCCACAGCTTAAATGGTGAACAAGACATTCGAAAAATGGGAGGACTCCAAAAAACACTCCCTACAACAACCGCATGCCTCACAATCGGCAACCTCGCCCTAATAGGAACACCATTCCTAGCAGGATTTTACTCGAAAGACCAAATCATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCCCTAGTCCTAACCCTCCTAGCTACATCATTCACCGCAGTGTACACAATCCGCATAACCGTACTAGTACAAACCGGTTTCGTCCGAATTCCACCCTTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCCCCCATCACTCGTCTTGCACTAGGAAGCATTCTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACAAAAACTCCCCCAATAACCATACCACTCTACATTAAAATAACTGCCCTAATCGTAACAGCCTTAGGAATCGCCCTAGCCCTAGAAATCACAAAAATAGCCCAAACACTTATCCTCACAAAACAAACCCCCTTCTCAAATTTTTCAACCTCCCTAGGATACTTCAACCCCCTAACCCACCGCCTAAGCATAACTAACTTCCTCAAAGGAGGACAAAACATTGCCTCTCACTTAATCGACCTATCCTGATACAAAATACTAGGCCCAGAAGGACTAGCCACCCTACAACTGAAAGCAACCAAAACCGCCACTACCCTTCACTCAGGACTAATCAAAGCCTACTTAGGATCATTCGCCCTATCCATCCTCATTATCCTCA---TATCCACGCTTAGAAA--CAA-T-C---AATGGCCCTCAACCTTCGTAAAAACCATCAAATCCTCAAAGTCATCAACAACGCCTTAATCGACCTCCCAGCTCCATCAAACATCTCAACATGATGAAACTTCGGATCTCTACTAGGCGTTTGCTTAATTACTCAAATTATTACAGGCCTCCTGCTAGCCATACACTACACAGCAGACACCAACCTAGCCTTCTCTTCCGTGGCTCACATATGCCGAGACGTACAATTCGGCTGACTCATCCGTAACCTACACGCAAACGGAACCTCTTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGTCTCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACGTCGGAGTCATTCTTCTCCTAGCCCTAATAGCAACCGCCTTCGTTGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACCTGTTTTCAGCCATCCCATACATCGGACAAACACTAGTCGAATGAGCTTGAGGAGGGTTTTCCGTTGACAACCCCACACTAACCCGATTCTTTGCTCTACACTTCCTCCTCCCTTTCGTTATTGTAGGACTAACCCTTGTCCATCTAACCCTCCTCCACGAAACAGGATCAAACAACCCACTAGGCATCCCCTCAGACTGTGACAAAATCCCCTTCCACCCATACTACACCATCAAAGACATCCTAGGATTTGTCCTAATAATCTCCCTGCTCGTCTCACTAGCCCTATTCTCCCCCAACCTCCTAGGAGACCCAGAAAACTTCACCCCAGCCAACCCGCTAGTAACCCCCCCACACATCAAACCCGAATGATACTTCCTATTTGCCTATGCCATCCTCCGATCCATCCCAAACAAACTGGGAGGAGTACTAGCCCTAGCCGCCTCAATCCTAGTCCTATTCCTCATTCCACTCCTACACACATCCAAACTACGATCAATGACTTTCCGCCCTCTATCACAAATCCTATTCTGAACCCTAGTCGCCAATGTTCTCGTCCTAACCTGAGTAGGTAGCCAACCAGTAGAACACCCATTCATCATCATTGGCCAACTAGCCTCACTCTCATACTTCACAATCATTCTAATCCTATTCCCCCTCGCGGCCGCCCTGGAGAATAAAATCCTCAAACT----------TTA-ATA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Lanius_tephronotus_JX486029 GTCCATGTAGCTTAAAT-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-AACACCC-ATGGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCTAGACTTATACATGCAAGTATCCGCACTCCAGTG-TAAATGCCCTAGGCACCCT-TTAACC-------AAGTCGATAGGAGCGGGTATCAGGCACA---------CATCA--ATTGTAGCCCAAGACGCCTTGCACTTGCCACGCCCCCACGGGTTCTCAGCAGTAGTTAACATTAAGCAATGAGTGTAAACTCGACTTAGTCATAGCAAC-T---TAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTTATACAGGAGACCCAAATCAACTTTA--T----AACGGCGTAAAGGGTGGTAAC-ATGTTAT-CAAAGTAACTAAGATCAAAAAGCAACTGAGCCGTAACAAGCCTAAGATGC-CCATAAGACCAAC--TGCCGAAAGAGATCTTAGACT--AACGATTAATTGAAATCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATATTGATGCT-TTA--TCCTACCTAAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCTCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATT-TACCTAACCATTTCTTGC-AAA--AT--CAGCCTATATACCGCCGTCGCCAGCCCACCCTCT--CTGAAGGCCTAACAGTGAGCGCAATAG-TCTAA--CCCACTAGCAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GG-AGCAATGGGCTACATTTTCTAAACTAGAACA-T----TACGGCAAAGAGGTCTGAAACGGCCTCTCGAAGGCGGA-TTTAGCAGT-AAAGTGGGATAATCAAGCCCTCTTTAAGCCGGCTCTGGAGCACGTACATACCGCCCGTCACCCTCCTCACAAG-CG-----ACCAATCTTTAATACATTAATACGCTAT-CA--AGCTAAAGAGGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGTACTTAGACCA-CCAAGACGTAGC-TTTAAAA-AAAGCATTCAGCTTACACCTGAAAGATATCTGATA-ATACCAGATCGTCTTGA-TGCCAGACTCTAGCCC--------AATTG--CATTG------ACCTGGA-ATAAC--AAAGCTACTCCCC-ATA-CACCA----AACTAAAGCATT---T--ACTAGT-CTTAGTATAGGCGATAGAAAAGACAACCA-TTGGC-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAATAGTG-AAATAAAC--CAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTGAAGTTTGCCACCCCGAGACCCAAGCGAGCTACTTGTGAGCAGCTAA-TATTGAGCGAACCCGTCTCTGTCGCAAAAGAGTGGGATGACTTACTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAAAAC-TCACA-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA---------AATATTTTGTAGAAAAAATTACTGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCCT--AGCTTAAAAATACCTA-AACTTTATGACTCCCT-CATCATTAACAGGCTAACCTATACTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG-----TCATCCCTCT----ACGACGCGAGCTTACATCAGTA-CATTATTAACAAA-AAACCA-AGATACGA--CCAAT---------AAA---ACAAGCA-GAG-TATCA-AGCATA-TTGTTAACCCGACAGA-GGAGCGTCCGTT-AAGAAAGATTAAAACCTGCAAAAGGAACTAGGCAAACACACCAAGACCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACAACAA-ACAAGTATTGAAGGTGATGCCTGCCCAGTG--ACTC-AGT---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCTCATAAATCGGGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCGGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAACCACATAAGACGAGAAGACCCTGTGGAACTTAAAAATCAGCAGCCACC--CTAAAC-CACATA----CA-CACCCA--C-T-GGGTTCACGCAC-TTA-AAAGGA---ACTGGCC-TGCA-TTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAATTGGACCATAACTCTAGACCA-AGAGCAACCACTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCAAGAGTCCATATCGACGAGAAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCAGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATT-AACTCTTCCCAGTACGAAAGGACAGGAA-AAGTAAGGCCAATACTACAG-GCAAGCCTTC-GCCATAAGTAATGAATCCAACTAAATTACGAAAGGCCATCAC-ACCAT---AACAA-AATCCTAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTCCCT----------CTA----------ATGAC----------CAACTACCCTATTCTAATTAATCTCATTATAGCCCTATCTTATGCCGTCCCAATCCTAATTGCAGTAGCCTTTCTAACCCTAGTAGAACGAAAAATCCTAAGCTACATACAAGGCCGAAAGGGACCCAACGTTGTAGGGCCATTCGGCCTACTTCAACCCGTAGCAGACGGAATCAAACTATTCATCAAAGAGCCAATCCGAC---------CATCAACATCCTCACCAATCTTGTTCTTCTTCACCCCAATACTAGCCCTATTACTAGCAATTTCTATCTGAACACCCCTCCCAATTCCATTTCCACTTGCAGACCTAAACCTTGGACTATTATTCATACTAACCATGTCAAGCCTAGCAGTATACTCTATTCTATGATCTGGATGGGCCCCTAACTCAAAATACGCCCCAATCGGTGCACTACGAGCAGTAGCTCAAACTATTTCATACGAAGTTACTCTAGCAATTATCCTACTATCAGTCATTCTACTCAGCGGAAGCTACACACTAAGTACTTTAGCCATTACCCAAGAACCATTGTACTTAATCTTCTCTTGCTGACCACTAGCCATGATATGATATGTCTCAACATTAGCTGAAACCAACCGCGCTCCATTTGACCTCACAGAAGGAGAATCTGAACTAGTCTCAGGATTTAATGTTGAGTATGCAGCAGGACCGTTTGCTCTGTTCTTCCTAGCAGAATATGCCAACATCATGCTTATAAACATACTAACCGCCATCCTGTTCTTCAACCCAAGCCTGTTCAACCCTCCTCAAGAGCTGTTTCCCGTCATCCTAGCTACAAAAGTTCTACTACTTTCAGCAGGGTTCCTATGAGTTCGTGCATCCTACCCACGATTCCGATACGACCAACTCATACACCTCTTATGAAAAAACTTCCTACCCCTTACACTTGCCCTATGCCTATGACATATTAGCATACCAATCTGCTATGCAGGGCTACCA-----CCCTACATAAG--GAC-------------TTCATGGAAATGTGCCTGAACTT-T--AAGGGTCACTATGATAAAGTGAACATAGAGGTA-ACCAGTCCTCTCATTTCCT-G--CCAC-------TTAGGAAAGTAGGGATCGAACCTACACGAAAGGGATCAAAGCCCTTCATACTTCCTTTATATTATCTCCT----------------AGTAGGGTCAGCTAAGCAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTAACCCCTTCCCCTACTA-ATGAACCCCCAAGCCAAATTAATTTTCACCGCTAGCCTACTCCTAGGCACAACTCTCACAATTTCAAGCAACCATTGAATTA---TAGCCTGGGCCGGCCTTGAAATTAACACACTCTCTATTTTGCCCCTAATTGCAAAATCTCACCACCCGCGGGCCGTCGAAGCAGCAACTAAGTACTTTTTAGTACAAGCCGCTGCCTCTACCCTAGTACTATTCTCGAGCATAACAAATGCATGAGAGACTGGACAATGGGACATTACCCAGATATCCCACCCAGCATCATGCTCAATCCTAACTGCAGCTCTTTCAATGAAACTAGGCCTAGCCCCATTCCATTTTTGATTCCCAGAAGTCTTACAAGGGTCCTCTCTAATCACTGGACTAATCCTTTCAACCCTCATAAAATTCCCACCAATTACTCTTCTCTTCATGACTTCTCAGTCACTTAACCCCACCCTACTGGTTACAATGGGCATTCTCTCCGTAGCTGTAGGTGGGTGAATGGGCCTAAACCAAACACAGACCCGAAAGATCATGGCCTTCTCCTCTATCTCCCACCTAGGCTGAATGGCTACCATCATTGTCTACTTCCCCAAACTAACCCTATTAAACTTCTACCTCTACACTCTGATAACTGCGGCTGTATTCCTCACCTTAAACTCAATAAAAGTCCTAAAACTATCTACACTAATAACCGCATGAACAAAAATACCATCACTTAGCTCTATCTTCCTACTTACCCTCCTATCTTTAGCCGGCCTCCCGCCCCTGACTGGATTCCTCCCGAAATGACTTATCATCCAAGAACTCACTAAACAGGACATAGCCCCAACAGCAATGATTGTTTCACTTCTATCGCTATTAGGGCTATTCTTCTACCTCCGTCTTGCATACTGCGCAACCATCACACTTCCCCCCCACACCACAAACCACATAAAACTATGACATGTCAATAAACCAGTCAACATCCTAATTCCTATCTTAATCACCATCTCACTCGCATTACTACCAATTTCCCCCATAGTCCTTACTATC--------CTATAAAAGAAACTTAG----GATCACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGTTAAAATCCGCAGGACACTACCCTGCATCTCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACTTTTT------ATTACTAGACAGATGGGCTTCGATCCCATAACAC-TATAGTTAACAGCTATATGCCCAAACC-AACAGGCCTCTGCCT-AAC-----------AGACTCCGACGCATAA-TTAATGCGCATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATCAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACTTTCATTAACCGATGATTATTCTCAACTAACCACAAAGACATTGGTACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAATTGGTACCGCCCTAAGCCTCCTAATTCGAGCAGAACTGGGACAACCCGGTGCTCTTCTAGGAGATGACCAAATTTATAACGTAATTGTTACAGCCCATGCCTTCGTAATAATCTTCTTCATGGTTATGCCTATCATAATCGGGGGGTTTGGAAACTGATTAGTCCCACTAATAATCGGTGCCCCGGATATAGCATTCCCACGAATAAATAACATGAGCTTCTGACTTCTACCTCCATCATTCCTCCTCCTACTAGCCTCCTCAACAGTAGAAGCAGGAGTAGGAACAGGATGAACCGTGTACCCACCACTAGCTGGTAATCTAGCTCATGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCACTACATCTAGCAGGGATCTCATCAATCCTAGGAGCAATCAATTTTATCACCACAGCAATTAACATAAAACCTCCTGCTCTATCACAATACCAAACCCCACTATTTGTATGATCAGTCCTAATTACCGCAGTACTACTTCTTCTATCCCTACCAGTACTTGCTGCCGGTATCACTATACTCCTAACAGACCGTAACCTCAACACTACATTCTTTGACCCAGCAGGAGGAGGAGACCCAGTGCTATACCAACACCTATTCTGATTCTTTGGCCATCCAGAAGTATACATCTTAATCCTACCGGGATTCGGTATTATCTCCCACGTTGTAGCATACTATGCTGGCAAAAAAGAACCGTTCGGCTATATAGGAATAGTATGAGCAATACTATCAATCGGGTTCCTCGGATTTATCGTCTGAGTCCACCACATGTTCACAGTAGGAATGGACGTTGATACACGAGCCTACTTTACGTCAGCTACTATAATTATTGCTATTCCAACCGGAATTAAAGTATTTAGCTGACTAGCAACACTGCACGGAGGCACAATCAAATGAGACCCACCAATGCTATGAGCCCTCGGATTTATCTTCCTATTTACTATTGGGGGACTAACAGGAATTGTGCTAGCTAACTCTTCTTTAGACATCGCCCTACACGATACATACTATGTAGTAGCTCATTTCCACTACGTTCTATCCATAGGAGCAGTCTTTGCAATTTTAGCAGGATTCACCCACTGATTCCCACTATTCACCGGATATACCCTACACTCTACATGAGCCAAAATTCACTTCGGAGTCATGTTTGTAGGAGTAAACCTAACCTTCTTCCCTCAGCACTTCCTGGGACTAGCCGGAATACCACGACGATACTCAGATTACCCAGACGCCTATACACTATGAAATACTATCTCTTCAGTAGGCTCATTAATCTCTCTAACAGCCGTAATTATACTAATATTTATCATCTGAGAAGCATTCGCATCTAAACGTAAAGCCCCACGACCTGAACTAATGAGCACAAACGTTGAGTGAATGCACGGCTGCCCCCCACCATACCACACTTTCGAAGAACCAGCCTTTGTCCAAGTC------CAAGAAAGGAAGGAATCGAACCCTCATATGTTGGTTTCAAGCCAACCGC--ATACAAACCACTTATGCTTCTTTCTT---ATA--AGAGGTGTTAGT-AAAATT-ATTACATAG-TCTTGTCAAGACTAAATCACAGGTGAAAATCCAGTACACCTCAA---CATTT--AACTATGGCTAACCACTCACAATTCGGCTTCCAAGATGCTTCATCCCCTATCATAGAAGAACTAGTAGAATTCCACGACCATGCGCTAATGACTGCCCTAGCCATCTGCACTCTCGTACTGTACCTGCTAACCCTCATACTCACTGAAAAACTTTCATCAACCACAGTTGACGCACAAGAAATTGAATTAGTTTGAACAATTCTCCCTGCAGTAGTCCTAATCATACTTGCTCTCCCATCCCTACAAATTCTTTACATAATAGACGAAATCAACGAACCAGATCTCACCCTAAAAGCCATTGGCCACCAATGATACTGATCTTATGAATACACAGACCTAAAAGATCTTACATTCGACTCCTACATAACACCTACTGCCGACCTGCCTCTAGGACACTTCCGATTACTGGAAGTAGACCACCGCGTAGTTGTTCCCATAGAATCTCCAGTCCGAGTCATTGTAACTGCCGACGACGTACTTCACTCATGAGCCGTTCCAAGCCTAGGCGTCAAAACTGACGCAATTCCAGGACGACTCAACCAAACCTCATTCACTGCCTCTCGACCTGGAGTATTTTACGGTCAATGCTCTGAAATCTGCGGAGCTAACCACAGCTTTATGCCAATTGTAGTTGAGTCCGTCCCACTCCCTGTATTCGAGAACTGATCCTCCCTAC---TCTCATCTC----------AATCATTAAGAAGCTATGAACCAGCGCTAGCCTTTTAAGCTAGAGAAAGAGGGAA-ATAGGCCCTCCTTAATGATATGCCCCAATTAAACCCAAACCCATGATTCTTTATCATGCTAATTTCATGAATAACTTACTCCATAATCATCCAACCCAAAATTCTCTCCTTCCTGTCCACAAACCAAGTGTCCAGCAAAG---CCCCAACAATCCCAAATACCAAACCGTGAACCTGACCATGAACCTAAGTTTCTTCGACCAATTTTCGAGTCCATCCCTACTAGGTATCCCACTAATTCTGATCTCAATAACATTCCCAGCTCTACTAATCCCCTCACAAAACAACCGATGAATCACCAGCCGCTTCTCAACCCTACAATTATGACTAATCAACATAATTACAAAACAACTAATAATGCCACTGAATAAAAAAGGCCACAAATGAGCCCTAATTCTAACATCTCTCATAATATTCCTATTAACGGTTAACCTGCTAGGACTCTTACCATATACATTCACCCCAACTACTCAACTATCAATAAACTTGGCTCTAGCTTTCCCCCTGTGACTAGCCACCCTACTCACAGGCCTACGTAACCAACCATCAATTTCTTTAGGACACTTACTACCAGAAGGGACCCCAACCCCACTAATTCCAGCCCTAATCTTAATTGAAACTACCAGCCTACTAATCCGACCGCTCGCATTGGGAGTACGTCTAACAGCCAATCTTACAGCAGGCCACCTACTAATCCAACTCATCTCCACAGCCACAATTGTCTTAATCTCAATCATACCAGCAGTTTCATTCCTAACTCTTCTAATCTTATTCCTATTAACCATTCTAGAAGTAGCAGTAGCCATAATCCAAGCCTACGTGTTTGTTTTACTACTAAGCCTCTACTTACAAGAAAACATTTAGATC------TAAATGGCACACCAAGCACACTCTTTCCATATAGTCGACCCAAGCCCATGACCCATTTTAGGAGCCGCCGCCGCCCTGCTTACCACCTCAGGACTAACTATGTGATTCCACTTCAACTCCCCATATCTGTTAATCATTGGACTAACTTCTACTGCCCTAGTCATATTCCAGTGATGACGTGATATTGTACGAGAAAGCACATTCCAAGGCCACCACACACCTATAGTTCAAAAAGGACTACGATATGGAATAGTCCTATTCATTACATCAGAAGCATTTTTCTTTCTGGGGTTCTTTTGAGCCTTCTTCCACTCCAGCCTAGCTCCTACGCCAGAACTAGGAGGGCAATGACCACCAGTAGGAATCAAACCCCTCGACCCAATAGACGTCCCCCTACTAAATACCGCTATCCTTCTAGCTTCAGGAGTTACAGTTACATGAGCCCACCACGGCATCATAGAAGCTAAGCGCAAACAAGCAATCCAAGCCCTCACTCTAACAGTTCTTCTAGGGTTCTACTTTACCGCCCTTCAAGCCATAGAATACTATGAAGCCCCTTTCTCCATCGCCGATGGAGTATACGGCTCTACCTTCTTCGTCGCAACCGGATTCCACGGCCTCCACGTAATCATCGGCTCTACATTCCTTCTAGTCTGCCTTCTGCGCCTAATCAAATACCACTTTACACCTAAACATCACTTTGGATTTGAAGCAGCAGCCTGATACTGACATTTCGTAGACGTCGTATGACTATTCCTTTATATAACTATCTACTGATGAGGATCTTACTCTTCTAGTATATTC-ATTACAATTGACTTCCAATCTCTAGAATCTGGTTTAAGCCCAGAGAAGAGTAATG---AACATAGTTTTATTCATAATGATCCTATCACTGACCCTAAGCATTGCTCTAACTGCACTAAACTTCTGACTGGCCCAAACAAACCCAGACCCAGAAAAACTATCACCATACGAATGCGGGTTCGACCCACTAGGGTCCGCCCGGCTGCCATTTTCAATTCGATTTTTCCTAGTAGCAATCCTTTTCCTATTATTCGATCTAGAAATTGCCCTACTACTACCCCTACCATGAGCCATCCAACTACAAGACCCCACCGCCACTTTAACATGAGCTTCTATCCTCATCCTTCTCCTTACCCTAGGCTTAATTTATGAATGAATCCAAGGAGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAATTAAGACAGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTAATGTCTACTCTACATCTAAGCTTTATCTCCGCTTTCACCTTAAGCAGCTTGGGCCTAGCATTTCACCGGACACATCTAGTATCAGCACTCCTATGTTTAGAGAGCATAATACTATCCATGTACGTCGCCCTATCCATATGACCTATCCAAACCCAAACATCATCCGCTACAATTCTACCCATCCTCATACTGGCATTTTCTGCCTGTGAAGCAGGCACAGGACTAGCCCTCCTAGTCGCTTCCACCCGAACCCACGGCTCCGACCACTTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCATTATACTACTACCCACCGCCCTCCTCTCTCCATACAAATACCTATGGACCAACACTACTGCCTACAGTCTCCTAATCGCCGCTGTGAGCCTACAATGACTAGCTCCAACATACTACCCAAGCAAAGGTCTAACTCACTGAACCTCAATTGACCAAATTTCTTCCCCCCTATTAGTTCTATCCTGCTGACTACTACCACTAATACTCATAGCAAGCCAAAATCACCTAGAAAAAGAACCCATCGCACGTAAACGAATCTTCATCACAACAATCGTCGCAGTGCAGCCATTTATCTTACTAGCTTTTTCGGCCTCAGAACTAATACTATTCTATATCGCATTCGAAGCAACTCTAATTCCCACACTAATCCTCATTACACGATGAGGAAACCAACCAGAACGACTAAGTGCAGGCATTTACTTACTATTCTACACTCTCATCAGCTCACTGCCCTTACTAATTGTTATCCTCCACCTTCACAACCAAATTGGTACCCTCTACTTCCCAATACTAAAACTCTCCCACCCAACAATAAACGCTTCTTGAACAGGACTAATATCTAGCATAGCCCTTCTCCTAGCCTTCATAGTAAAATCCCCACTATACGGGCTCCACCTATGACTTCCGAAAGCCCACGTAGAAGCCCCAATTGCAGGGTCTATACTCCTTGCTGCCTTACTGCTAAAACTAGGCGGATATGGAATCATACGAGTTACCATCCTAATTAACCCATCCACAAATAACCTTTACTACCCATTTATTACACTAGCATTATGAGGTGCAGTTATAACAAGCGCAATCTGCCTACGACAAATCGACCTAAAATCACTAATCGCTTACTCCTCCGTAAGCCATATAGGATTAGTTGTCGCCGCAGGCATAATACAAACTCAATGAGCCTTCTCAGGCGCTATAATATTAATAATTTCCCATGGACTCACGTCCTCTATACTATTCTGCCTAGCCAACACAAATTATGAACGAACCCATAGCCGTATTCTCCTACTGACACGAGGACTCCAACCACTCCTACCTCTAATAGCCACCTGATGACTCCTAGCTAACCTGACAAATATAGCACTACCACCAACAACCAACTTTATAGCAGAACTAACCATCGTAATTACCCTGTTCCACTGATCCCCACTAACAATTATTCTAACAGGAACCACTATTCTACTAACTGCCTCATACACCCTATACATACTAACAATAACACAACGAGGAGCTTTACCATCCCACATTACCTCAATCCAAAACTCCTCCACACGAGAGCATCTCCTAATAACTCTGCACGTAATCCCCATAATCCTCCTTATCCTAAAACCAGAACTCATCTCAGGCATTCCGATAT-GCAAGTATAGTTT-TAA-CCAAAACATTAGACTGTGATTCTAAAAACAGAAGTTAAACCCTTCTTACTCGCCGAGAGG-AGATT-TAATCAACAAGAACTGCTAATTCTTGAGTCTGAGTATAA-AACCTCAGTCCTCTT--ACTTTCAAAGGATAGCAGTAATCCAATGGTCTTAGGAACCAGTAACCTTGGTGCAAATCCAAGTGAAAGT--AATGGATATATCACTAATCCTGAATACATTCATACTACTGACCTTAGCAACTCTCTCCACCCCTTTAGTCTTCCCCCTTTTATCAAATAAACTCAAAAATACCCCAACAACTATTGTAAAAACCGTTAAAACCTCATTTCTGATCAGCCTGATCCCAATAACAATCTTCCTCCACTCAGGAACAGAAAGCCTCGCCCTCCTATGAGAATGAAAATTCATCACGAACTTTAAAATCCCAATCAGTATTACTATAGACTTCTACTCCTTAACCTTCTTCCCAATCGCTCTATTTGTCTCTTGATCCATCCTACAATTCGCAACATGATACATGGCCTCAGACCCATATATTACAAAATTCTTCACATACCTACTTCTTTTCCTAATTGCTATGCTGATCTTAATTACTTCAAACAACCTCTTTGTCCTATTCATCGGATGAGAGGGAGTAGGAATCATGTCATTCCTCCTAATCAGCTGATGACACGGACGAGCAGAAGCCAACACTGCTGCCCTACAAGCTGTCTTATACAACCGAGTAGGAGATATCGGATTAATCATATGCATAGCATGACTAGCAACCAATACAAACACCTGAGAAATCCAACAAATCCTATCCACAGACCAAATCCCAACACTTCCAATTTTAGGCCTGATTATAGCTGCAACAGCCAAATCAGCCCAATTCGGCCTTCACCCATGACTTCCAGCCGCCATAGAAGGCCCTACCCCCGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATTTTCCTATTAATCCGAACTCATCCATTATTTAACAACAACCCCACCGCTCTCACCCTATGCTTATGCCTAGGAGCTTTATCCACACTATTTGCAGCCACATGCGCTCTAACACAAAATGATATCAAAAAAATCATTGCCTTTTCCACATCCAGCCAACTAGGCCTAATAATAGTCACAATCGGGTTAAACCTTCCCCAACTAGCCTTCCTCCATATTTCAACCCACGCATTCTTCAAAGCTATACTGTTCCTATGCTCTGGATCTATCATTCACAACTTAAACGGAGAACAGGACATCCGAAAAATAGGAGGCCTTCAAAAAATACTACCAACAACTACTTCATGCCTAACAATTGGAAACCTTGCCCTCATAGGAACTCCCTTCCTAGCAGGATTTTACTCAAAAGACCAAATTATCGAAAGCCTCAGCACATCCTACCTGAATGCCTGAGCTCTCACCCTCACCCTACTAGCTACATCATTCACTGCAATTTACACACTACGAATAACCCTACTAGTACAAACAGGCTTCGTGCGAATCCCCCCACTTACTGCAATAAACGAAAACAACCCAGCAATCCTATCTTCAATCACCCGTCTGGCAGTAGGAAGCATTGTAGCAGGCCTTCTAATTACCTCCTACATCCTCC---CTACAAAAACCCCACCACTAACTATGCCACTATCCATCAAACTAACAGCCCTTACAGTTACATTACTAGGAGCTGCCTTAGCCCTAGAACTCTCAAAAGTGTCACAAACACTAATTTCCCCTAAACGAAATCGCTTCTCAGATTTCTCCACAGCCCTAGGCTACTTTAACCCGCTCATCCACCGATTTAGCACAACTAACCTACTGAGCGGGGGCCAGAATATTTCTTCACACCTAATCGACCTATCTTGATACAAAATGCTAGGTCCAGAAGGACTAGCTAACTTACAAGTAATAGCATCAAAAACTGCTACTACCTTACATACCGGCCTAATTAAATCATACCTAGGAACATTCGCCTTATCAATCCTAATCATACTGA---TATCAACGTACAGAAC--CAAAA-T---AATGGCCCTCAATCTACGTAAAAACCACCCCATCATAAAAACCATCAACGATGCGTTAATCGACCTTCCTACTCCGTCAAATATCTCCATTTGATGAAACTTCGGATCTTTACTAGGCATTTGCCTAATCATACAAATCACTACAGGTCTACTGCTAGCTATACATTACACAGCGGACACTTCCCTAGCTTTCAGCTCCGTAGCCCACATCTGCCGAGACGTCCAATTCGGATGACTAATCCGAAACCTGCACGCAAACGGAGCCTCATTCTTCTTCATCTGCATCTACTTACATATTGGCCGAGGACTCTACTACGGCTCATACATAAACAAAGAAACCTGAAATGTCGGCATTATATTACTCTTAATGCTAATAGCAACTGCCTTTGTAGGATACGTCCTACCTTGAGGACAAATATCATTCTGAGGAGCTACCGTCATTACTAACCTCTTCTCAGCCATCCCGTACATCGGCCAAACATTAGTAGAATGAGCCTGAGGAGGATTCTCAGTCGATAATCCAACACTCACTCGATTCTTCGCACTCCACTTCCTTCTACCATTCCTAATCGCAGGGCTGACATTAGTCCATCTTACCTTCCTGCACGAAACAGGCTCAAACAACCCCCTAGGCATCCCATCGGACTGCGACAAAATCCCATTCCACCCTTACTACTCTATCAAAGACATTCTAGGATTTGCCCTAATACTAATCCTACTAGCTGCTCTAGCACTATTTTCCCCAAATATGCTAGGAGACCCAGAAAATTTCGCGCCGGCCAACCCCCTAGCTACCCCTCCACACATCAAACCTGAATGATACTTCCTATTCGCATACGCTATTCTACGATCAATCCCCAACAAACTAGGAGGCGTATTAGCCCTGGCAGCTTCAATTCTAGTCCTATTCCTAATCCCCCTACTCCACAAATCCAAACAACGCTCAATAACTTTCCGACCCCTATCACAAATCCTATTCTGAGCCCTAGTAGCCAACATCCTCATTCTAACATGAGTAGGCAGCCAACCAGTGGAACACCCATTCATCATCATTGGCCAACTAGCCTCGTTCTCCTACTTCCTAATTCTTCTAGTCCTATTCCCTATCGCAAGTGTACTAGAAAACAAAATACTCAAACT----------TTA-ACT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGACTATACATCTTCTTAGAGTT Leiothrix_argentauris_NC_015114 GTTCCTGTAGCTTATAC-AAAGCATGGCACTGAAGATGCCAAGATGGTCGC--TAAA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTGTTGCTAGATTTATACATGCAAGTATCCGCGATCCAGTG-TAGATGCCCTAGGCA-CCC-T-AATCTTC----AGGTCGATAGGAGCGGGTATCAGGCACACCCCTTATTCA-----ACCGTAGCCCAAGACGCCTCGCAATTGCCACACCCCCACGGGTATTCAGCAGTAATTAATATTAAGCAATGAGTGTAAACTTGACTTAGTCATAGCAAT-T---TAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACTCAAATCAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACCAAAAAGCAACTGAGTTGTCACAAGCTAAAGATGCGGCATAAGACCTCT--ATTCAAAGAAGATCTTAGACC--AACGATCAATTGAAG-CCACGAAAGCCAGGACCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-CGA--TCTAACCGGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCTCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATG-CACCCTACCATTCCTTGC-CCA-AAA--CAGCCTATATACCGCCGTCTCCAGCCCACCCTCC--ATGAGGGCCCAACAGTGGACGCAATAG-CCATG-ATACGCTAATAAGACAGGTCAAGGTATAGCCCATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAATTAGAACA-C----AACGGCAAAGGCACATGAAATTGTACCTAGAAGGCGGA-TTTAGCAGT-AAAGAGGGATTAGCGAGCCCTCTTTAAGCCGGCTCTGGAGCACGTACATACCGCCCGTCGCCCTCCTCAAAAG-CG-ACCCACACCCCACCCATACA-TAATAAGCCAC-CC--AGCCAAAGAGGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGTACTTGGGACA-CCAAGACGTAGC-TTAAAC--GAAGCATTCAGCTTACACCTGAAAAATATCTGCTC-ACAACAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AGCAT-ACC-TG------ACACAGA-ATAAC--AAAGCTACTCACC---A-CTCTT----AACCAAAGCATT---T--GCTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCTCTTGGC-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATAAAAATG-AAAAATCC--TAAGCTT-AAAATAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCTCCCCGAAACCCAAGCGAGCTACCTATGAGCAGCTAT-T-ATGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGTAGGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCCGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC---CCAGAACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AACCTTTCC--TCACTACTACCTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCAGC-ACC-TAAAAATATCTA-ATCTATATGACTCCCT-CACCACTAACGGGCCAACCTATAACTAAATAGGAGAATTAATGCTAGAATGAGTAACTAGGG--T--TC-TCCCTCT----TCGACGCAAGCTTACATCTGTA-CATTATTAACAAG-CACCCC-ATATACGA--CTAAT---------CAA---ACAAGCA-GAA-TATTAACACACC-TTGTTAACCCGACAGA-GGAGCGTCTTCT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAATTCGTCAGGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCAATAGACAAGTATTGAAGGTGATGCCTGCCCGGTG--------AGATAATTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACCCGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCAGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTCAAAAGCAGCAACCACC--CCAAAC-TACATC----CC-CACCCA--CTC-GGGCTCACTTAC-AC--CAACGGGCTACTGGCT-TGCACTTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-ATCTTAGACCTTACATCTAGACTA-AGAGCAACTACTCAACGTGCTAATAGCAACCAGATCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCAAGAGTCCATATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGCTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGACG-AGCTCTTCCCCGTACGAAAGGATAGGAA-AAGCGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAGCCAACTAAATTACAAAAGGCTATCAC-CTCCC-----CCA-CGTCCTAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTTACA----------ACACCC--T----ATGAC----------CAAATACCCCCTCTTAATCAACCTTGTAATAGCTCTCTCCTATGCACTCCCCATTCTAATTGCAGTAGCCTTCCTCACGCTAGTAGAACGCAAAATTCTAAGCTACATGCAAGGCCGAAAAGGCCCCAACATCGTAGGCCCATTCGGCCTTCTCCAACCCCTAGCCGATGGAGTAAAACTATTCATTAAAGAGCCAATCCGCC---------CATCAACATCCTCCCCCATCCTATTCATCACAACCCCTATACTAGCCCTCCTTCTAGCAATCTCAATCTGAACCCCTCTCCCCCTACCATTTCCACTTGCAGACCTCAACCTAGGCCTGCTATTCCTGCTAGCTATGTCCAGCCTTGCAGTGTACTCCATCCTATGATCCGGCTGAGCATCCAACTCAAAGTACGCACTAATCGGTGCCCTCCGTGCAGTAGCACAAACTATCTCCTATGAAGTCACCTTAGCAATCATTCTACTATCCATTATCCTACTAACTGGTAACTACACCCTCAGCACCCTTGCCACCGCCCAAGAGCCGCTCTACCTCATCTTCTCCTGCTGACCTCTGGCTATAATATGATATGTGTCCACCCTAGCCGAGACAAACCGCGCCCCGTTCGACCTCACAGAGGGTGAGTCCGAATTAGTCTCAGGGTTTAACGTAGAATATGCAGCGGGCCCATTCGCTCTCTTCTTCCTAGCTGAATACGCCAACATCATACTAATAAACACGCTCACCGCCATCCTATTCTTCAACCCAAGTCCATTCAACCTCCCCCAAGAGCTATTCCCAGTAGTACTAGCCACAAAAGTCCTCCTTCTGTCAGCAGGGTTCTTATGAATTCGAGCTTCCTACCCACGATTCCGATATGACCAACTAATACATCTCCTATGAAAAAACTTCCTACCACTCACACTGGCCTTATGCCTCTGACACACAAGCTTACCAATCTGCTATGCAGGTCTACCA-----CCATACCTAAG--AG--------------TCAAAGGAAATGTGCCTGAACGT-CCAAAGGGTCACTATGATAAAGTGAACATAGAGGTATACTAGTCCTCTCATTTCCTGTCTCACC-------TTAGAAAAGCAGGAATTGAACCTGCACTAGAGAGATCAAAACCCTCCATACTTCCCTTATATTATTTTCT----------------AGTAGGGTCAGCTAATCAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCTTCCCCTGCTA-ATGACCCCCCAAGCAAAACTAGTCTTCATCTCTAGCCTCCTACTAGGCTCAACAATCACAATCTCGAGCAATCACTGAATCA---CGGCCTGGGCCGGCCTGGAAATTAATACCCTAGCCGTCCTCCCTATAATCTCAAAATCCCACCATCCTCGAGCCATTGAAGCTGCGACCAAGTACTTTCTAACCCAAGCAACTGCCTCAACACTAGTGCTATTCGCCAGCATAACCAACGCATGATACACTGGACAATGGGACGTCACCCAAATAACTCACCCAACATCATGTCTAATTCTCACATCAGCTATCGCAATAAAACTAGGACTAGTCCCATTCCACTTTTGATTCCCAGAAGTACTCCAAGGATCCCCCCTTATAACTGGCCTCCTCCTCTCCACAGTAATAAAATTCCCACCCATCACGCTGTTCTTCATAACATCACCATCCCTAAACCAAACCCTACTAACACTCATGGCCATCATATCCGTAGCTGTGGGAGGATGAATGGGACTCAACCAAACACAGATCCGAAAAATCCTAGCATTCTCCTCTATCTCGCACCTAGGCTGAATAACTATTATCATCTCCTACAACCCTAAACTCACCCTATTAAACTTCTACCTATACATCCTAATAACTGCAGCCGTTTTCCTAACTTTAAACTCAATTAAAACCTTAAAACTGTCTACACTAATAACCACATGAACGAAAACCCCTGCACTAAGCGCTATACTCCTCCTAACAATGCTCTCCCTCGCAGGACTACCACCCTTAACAGGATTCTTACCCAAATGACTCATCATCCAAGAACTAACTAAACAAGACATAGCTGCAGTAGCAGTGATAATCTCAATTCTCTCCCTGCTGAGCCTATTCTTCTACCTCCGCCTAGCATACTGCGCCACAATTACACTCCCCCCTCATACCACAAACCACATCAAACAGTGACGCACTAACACCCCCATCAACACCATAATCGCCATCATAACCGTCACATCAACCTCACTCCTCCCTATCTCCCCAATAATCCCCACCATCAT------CT----AAGAAACTTAG----GATTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACTCTCTTAGTTTCTGATAAGACCCGCAGGATACTGCCCCGCATCTCCTGAATGCAACCCAGGTGCTTTAA-TTAAGCTAGGACCTT--TCCTACTACCCTAGACAGATGGGCTTCGATCCCATAAAAG-TATAGTTAACAGCTATATGCCCCAACC-AACAGGCTTCTGCCT-ACC-----------AGACCTCGGTGCAAA--CCAATGCACATCAATGAGCTTGCAACCCACCATGAATTTCACTACAAGGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTATGACATTCGTCAACCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTATACTTAATCTTCGGCGCATGAGCCGGGATGGTCGGTACCGCCCTAAGCCTGCTCATCCGAGCAGAACTAGGTCAACCTGGAGCCCTACTGGGAGACGACCAAGTTTATAACGTAATCGTCACAGCCCACGCTTTCGTAATAATCTTTTTTATAGTAATACCAATTATGATTGGAGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCTTTCTTACTCCTACTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGAACTGGTTGAACTGTCTACCCTCCCCTAGCTGGCAACCTAGCCCATGCAGGAGCCTCAGTCGACCTGGCCATCTTCTCCCTGCATCTAGCAGGAATCTCTTCAATCCTCGGGGCAAATAATTTCATCACAACAGCAATCAACATAAAACCCCCAGCCCTATCACAGTACCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACCGCAGTACTCCTCCTCCTATCCCTTCCAGTCCTTGCTGCAGGTATTACAATACTACTCACAGACCGCAACCTAAACACAACCTTCTTCGACCCAGC---AGGAGGAGACCCAGTACTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTCATCCTCCCTGGATTTGGAATCATTTCACACGTTGTAGCGTACTACGCAGGAAAAAAAGAACCATTCGGCTACATAGGGATAGTATGAGCCATACTCTCCATCGGATTCCTAGGATTCATTGTATGAGCCCACCACATATTCACAGTAGGGATGGACGTAGACACCCGAGCATACTTCACATCCGCTACAATAATCATCGCAATCCCAACTGGTATCAAGGTATTCAGCTGACTAGCCACTCTACACGGAGGAATTATCAAATGAGACCCTCCTATGTTATGAGCACTAGGCTTTATCTTCCTATTCACTATTGGAGGACTAACAGGCATCGTACTAGCCAACTCCTCCCTAGACATTGCTCTACATGATACATACTACGTAGTCGCCCACTTCCACTACGTCCTATCCATAGGAGCAGTATTTGCAATCCTAGCAGGCTTCACCCACTGATTCCCCCTATTCACCGGCTACACACCCCACTCAACATGAGCTAAAATCCACTTCGGAGTGATATTCGTAGGCGTTAATCTCACCTTCTTCCCACAACACTTCCTAGGCCTAGCCGGCATGCCACGACGTTACTCAGACTACCCAGATGCCTACACACTATGAAACACCATCTCCTCCGTAGGTTCACTGATCTCTATAACAGCCATAATCATGCTAGTGTTCATCATCTGAGAAGCCTTCGCATCCAAACGTAAAGCCCTACAGCCAGAACTAACAAGCACAAACATTGAATGAATCCATGGCTGCCCACCCCCATTCCACACATTCGAAGAACCTGCCTTTGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCACATGTTGGTTTCAAGCCAACCGC--AT---AACCACTTATGCTTCTTTCTC---ATA--AGAGGTGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTACAGGTGAAACCCCTGTACACCCCAA----------CATTATGGCAAACCACTCACAACTGAACTTCCAAGACGCCTCATCACCTATTATAGAAGAACTCATGCAATTCCACGACCACGCCCTAATGGTCGCCCTAGCTATTTGCAGCCTAGTCCTCTACCTCCTAGCCACCATACTTACGCAAAAACTATCATCAAGCACAGTTGACGCACAGGTAATCGAGCTAATCTGAACAATTCTCCCAGCCGGAGTACTAATCACACTAGCCCTCCCATCATTACGAATTCTATACATAATAGACGAAATTAACCAACCAGACCTCACCCTAAAAGCCATTGGCCACCAGTGATACTGAAGCTACGAGTACACTGACGTCAAAGACCTAACATTCGACTCATATATGACACCAACAACAGAACTACCACTAGGACATTTCCGTCTGCTAGAAGTAGACCATCGAGTGATCGTCCCAACAGAATCCACCGTCCGAGTTATCGTTACCGCCGACGACGTCTTACACTCATGAGCTGTTCCTAGCCTAGGTGTAAAGACCGATGCAATCCCAGGACGTCTAAATCAGACTTCATTCCTAGCCAGCCGACCTGGAATCTACTACGGCCAGTGCTCAGAAATCTGCGGAGCAAACCACAGTTTCATGCCTATTGTAGTAGAAGCTATCCCACTTGCCAGCTTCGAGAACTGACTCTCTATTA---CACCATCAT----------AATCATTAAGAAGCTATGGAACAGCACTAGCCTTTTAAGCTAGAGAAAGAGGGATAAC--CCCCTCCTTAATGATATGCCACAACTGAACCCAGCTCCCTGATTTTTTATCATGACCATCACATGACTAACATTTTCCCTAATCATCCAACCTAAACTCCTATCATTTGTGTCCACAAACCCACCATCCAACAAAA---CCCCAACAACTTACACTACCACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTTTCAAGTCCATCCCTCTTAGGAATCCCCTTAATCCTCATCTCAATAACATTCCCAGCCCTACTTCTCCCATCCCACAATAACCGATGGATCACCAGCCGAGTCTCAACCCTCCAGCTATGATTTGTCAACCTCATTACAAAACAACTAATAACCCCACTAAACAAAAAAGGCCACAAATGGGCACTAATCTTAACATCACTAATAGTCTTCTTACTCCTAATTAACCTTCTAGGTCTACTACCATACACCTTCACCCCCACCACCCAACTATCTATGAACTTAGCCCTAGCCTTCCCACTATGACTCGCCACACTCCTCACAGGCCTGCGAAACCAACCCTCCGTTTCCCTAGGACACCTTCTTCCAGAAGGAACTCCCACACCACTAATCCCGGCCCTTATCTTAATCGAAACCACACGCCTGCTCATCCGACCTCTAGCACTAGGCGTGCGCCTAACAGCAAACCTCACAGCAGGCCACCTCCTCATCCAACTGATCTCCACAGCCACTGTGGCCCTTTTCTCAACAATGCCCCTAGTCTCTCTCATAACACTACTAGTTTTATTCCTGCTCACAATTCTAGAAATTGCCGTAGCTATAATTCAAGCCTACGTTTTTGTCCTACTACTAACCCTTTATCTCCAAGAAAACATCTAACCAACCA----AATGGCACACCAAGCACACTCTTACCACATAGTAGATCCAAGTCCATGACCTATTCTCGGCGCAGCCGCCGCCCTTCTTACCACCTCTGGGCTGACTATATGATTCCACTACAACTCTCCCCATCTCCTAATCATCGGCCTCCTATCAACACTCCTAGTAATATTCCAATGATGACGAGACATTGTACGAGAAAGCACCTTCCAGGGCCACCACACCCCTACAGTCCAAAAGGGGCTACGATATGGAATAGTCCTATTCATCACATCCGAAGCCTTCTTTTTCCTAGGATTCTTCTGAGCCTTCTTCCACTCCAGCCTAGCTCCCACCCCAGAACTAGGAGGCCAGTGACCTCCCGTAGGAATCAAACCCCTAGACCCCATAGACGTCCCACTACTCAACACTGCCATCCTCCTAGCCTCAGGAATCACAGTTACATGAGCCCACCACAGCATTACAGAAGCACGCCGAAAACAAGCAATCCACGCTCTCACCCTAACAATTCTTCTAGGATTCTACTTCACAGGTCTCCAAGGCATAGAATACTACGAAGCGCCATTCTCCATCGCGGATAGCGTCTACGGCTCCACCTTCTTTGTCGCTACTGGGTTCCACGGCCTACACGTAATCATCGGCTCTACCTTCCTCCTAGTCTGCCTCTTACGTCTAATCAAATACCATTTCACACCAAACCACCACTTCGGCTTCGAGGCAGCAGCCTGATATTGACATTTTGTAGATGTTGCCTGACTATTCCTCTACATAACTATCTACTGATGAGGATCATACTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAACCCCAGAGAAGAGTAATG---AACATAATTACATTCATAATTGCCCTATCCCTAACCCTAAGTCTCATCCTAACTGCACTGAACTTCTGAATCGCCCAAATAAACCCAGATGCAGAAAAGCTATCCCCCTACGAATGCGGTTTCGACCCACTGGGTTCTGCTCGACTACCATTCTCAATCCGATTCTTCTTGGTAGCTATCCTCTTTCTCCTATTTGACCTAGAAATCGCCCTCCTCCTTCCCTTACCATGAGCCACCCAACTCCAAAATCCCACCACCACACTTACCTGAGCATCCATCCTGATCCTCCTCCTCACTCTAGGGCTAGTATACGAATGAATCCAAGGAGGACTAGAATGGGCAGAATA-AGAAGACAAGAAAGTTAGTCTAACCAAGGCAGTTGATTTCGACTCAACAGATTATAGCTCACACCCTATAACTTTCTTTATGACCCTACTCCACCTAAGCTTCTACTCAGCCTTTACCCTTAGCGGCCTAGGATTAGCCTTCCACCGAACCCACCTAATTTCAGCACTCCTATGCCTTGAAAGCATAATACTATCAATATACCTCGCCCTATCCATATGGCCCATCCAAACACAAACATCATCACCTACCCTCCTACCTATCCTAATACTCACTTTCTCTGCTTGCGAAGCAGGCACAGGGCTTGCCCTACTCGTAGCTTCCACCCGCACTCACGGCTCTGACCACCTACACAACTTCAACCTACTCCAATGCTAAAAATTATCATCCCAACTATTATACTCCTCCCCTTAACCTTCCTCTCTCCACGCAAACACCTGTGGACCAACACCACAATATACAGCCTATTAATCGCCACTATCAGCCTACAATGACTGGTACCAACCTACTACCCTAATAAAAGCCTATCCCCTTGAACTGCCATTGACCAAATCTCCTCTCCGCTGCTAGTTCTATCATGCTGACTCCTCCCCCTCATACTTATAGCGAGCCAAAACCACCTAGAACAAGAACCCACCATCCGCAAACGAATCTTTATCACAACGGTGGTCCTAGCCCAACCATCTATCCTTCTAGCCTTTTCAGCTTCAGAATTGATACTATTCTACATCGCGTTCGAAGCCACCCTAATTCCCACCCTAATCCTCATTACCCGATGAGGTAACCAACCAGAACGACTAAATGCTGGCATCTATCTCCTATTCTACACACTAGCCAGCTCACTACCCCTATTAATCGCCATCCTTCACCTACACAACCAAATCGGCACCCTCTACTTCCCCATACTAAAGCCATCACACCCAACAATAACCACCTCCTGATCGGGCCTGGTATCTAGCCTAGCCCTACTCCTTGCTTTCATAGTAAAGGCACCTCTATACGGCCTCCACCTATGACTCCCCAAAGCCCATGTAGAAGCCCCAATCGCCGGCTCAATACTACTAGCCGCCCTACTACTAAAACTCGGAGGCTACGGCATCATGCGATTCACAGCCCTAGTAAACCCGACACTAAACAACCTCCACTACCCATTCATCACCCTAGCTCTATGAGGGACACTAATAACCAGCGCCATCTGCTTACGGCAAATCGACCTAAAATCCCTAATTGCCTACTCATCCGTCAGCCATATAGGCCTAGTCATCGCCGCAACCATAATCCAAACCCAATGAGCATTCTCGGGAGCAATAATCTTAATAATCGCACATGGATTAACCTCCTCAATACTATTCTGCTTAGCCAACACCAACTATGAACGTACACACAGCCGAATCCTCCTACTCACCCGAGGTATGCAACCTATCCTTCCACTCATAGCCATCTGATGACTTATAGCAAACCTAACAAACATAGCACTTCCCCCAACAATCAACCTCATAGCAGAACTAACTATTGTAATCGCACTATTCAACTGATCCTCACTAACAATCCTACTAACAGGAGCGGCAATCCTACTAACTGCTTCCTACACCCTATACATGCTAATAATAACACAACGAGGAGCACTCCCATCTCACATCACATCCGTCCAAAACTCCTCCACACGAGAACACCTCCTCATAGCCCTTCACATAATCCCTATAATCCTTCTCATCCTCAAACCCGACCTCATCTCTGGAATCCCTATAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAAACCTTCTTACCTGCCGAGGGG-AGGTT-TAACCAGCAAGAACTGCTAATTCTCGCATCTGAGTATAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTAATCACCTCCATACTACTCACCCTAACTACCCTATCCACTCCCATTATCTTCCCACTTATATCAAACAAACTCAAAAACACCCCAAACATCATTACAAACACAGTAAAAGCTTCCTTCCTGATTAGCCTAATCCCAATGACAATCCACATCTACTCAGGAACAGAATGCCTTCTAACCTTATGAGAACGAAAATTCATCATAAACTTCAAAATCCCAATTAGCCTTAAAATAGACTTCTACTCCCTCACATTCTTTCCAATCGCCCTATTCGTGTCATGATCCATCCTACAATTCGCAATATGATATATAGCTTCGGACCCATATATCACAAAATTCTTCACCTACCTCTTACTCTTCCTAATTGCTATACTCATCCTAATTATCGCCAACAACCTATTCGTCCTATTCATCGGGTGAGAAGGAGTAGGCATTATATCCTTCCTCCTAATCAGCTGATGGCACGGCCGGGCCGAAGCTAATACCGCTGCCCTCCAAGCTGTCCTATACAACCGAGTCGGAGACATTGGACTCATTCTCTGCATAGCCTGACTAGCCTACACTATAAACACCTGAGAAATCCAACAACTATCCTCCCCACATCAAATCCCCACCCTACCACTTCTAGGCCTCATTTTAGCTGCAACAGGTAAATCCGCCCAATTCGGACTCCATCCCTGACTACCAGCCGCCATAGAAGGCCCAACCCCTGTATCCGCATTACTCCACTCTAGTACCATGGTAGTCGCTGGAATCTTCCTACTCATTCGAACACACCCATTATTCAGCAACAACCAAACAGCCCTAACACTATGCTTATGCCTTGGTGCCCTCTCTACTCTATTCGCAGCTATATGTGCCTTAACCCAAAACGACATCAAAAAAATTATCGCCTTCTCCACCTCAAGCCAACTAGGCTTAATAATAGTAACCATCGGGCTAAACCTCCCACAACTAGCCTTTCTACACATCTCTACCCACGCATTCTTCAAAGCCATGCTTTTCCTATGCTCCGGCTCAATTATTCACGCTCTCAACGGCGAACAAGACATCCGAAAAATAGGAGGACTACAAAAAATACTACCAACAACCACATCATGTCTTACCATCGGCAACCTGGCCCTGATAGGAACCCCATTCCTGGCAGGCTTCTACTCAAAAGACCAAATCATCGAAAGCCTAAGCACCTCGTACCTAAACACCTGAGCTCTAGTCCTAACCCTACTAGCAACATCATTTACCGCGGTATATACAATCCGCATAATTGTACTAGTACAAACCGGATTCGTACGAATCCCCCCTCTAACTCCAATAAACGAAAACAACCCACTAGTTACCTCCCCAATCACCCGACTTGCCTTAGGAAGCATTATAGCAGGACTCCTTATCACTCCATACATCCCCC---CTACAAAAACACCCCCTATAACTATACCTCTTTCAATCAAAGTCATAGCCCTAGTAGTCTCAGCCTTAGGAATTGTTATCGCGCTAGAACTTTCAAAAATAACCCAAACCCTCATTCTAACAAAACAAAGCCCGCTATACAACTTCTCCATCTCCTTAGGATACTTCAACCCACTTACACACCGCTTCAACATAACTAATCTACTGACTAGCGGACAGAACATCGCCTCCAGCCTAGTAGACCTCTCCTGACTAAAACTACTAGGACCAGAAGGACTAGCCAGCTCACAACAAACCATAACAAAAGCTACCACCCTTCTACACTCTGACCTCATCAAACCCTACTTAGGAGCTTTCGCCCTATCTATCATCATTATCCTCA---TATCCTCATACAGAAC--CCACT-----AATGGCTCTCAATCTTCGTAAAAATCACCCCCTACTAAAAACCATCAACGATTCCTTAATTGACCTTCCAACACCATCCAACATTTCAACCTGATGAAACTTTGGATCCCTACTAGGCATCTGCCTAATTACACAAATCATTACAGGCCTACTACTAGCAATACACTACACAGCAGACACTAACCTGGCCTTCGAATCCGTTGCTCACACGTGCCGAAACGTCCAATATGGCTGACTAATTCGAAACCTGCACGCGAACGGAGCCTCACTTTTCTTCATTTGTATCTACTTCCACATCGGCCGAGGACTCTACTACGGATCTTACCTAAATAAAGAGACATGAAACATCGGAGTTGTACTATTACTTACACTTATAGCCACCGCCTTTGTTGGTTACGTACTGCCCTGAGGACAAATATCATTCTGAGCGGCTACAGTAATTACAAATCTGTTCTCAGCAATCCCTTACATCGGTCAAACCCTAGTAGAATGACTGTGAGGAGGATTCTCAGTAGACAACCCCACCCTAACCCGATTTTTCGCCATCCACTTCCTCCTCCCATTCGTCGTTGCAGGTCTCACGCTAGTCCACCTTACCCTCCTGCACGAAACAGGATCAAACAACCCCCTAGGAATCCCCTCAGACTGCGATAAAATCCCATTCCATCCCTACTACACCATCAAAGACATCCTGGGATTCGTACTCATGTTCTCCCTACTAGCTGCTTTAGCCCTATTCGCCCCAAACCTGCTAGGAGACCCAGAAAATTTCACACCAGCCAATCCCCTATCAACCCCACCCCACATCAAACCCGAATGATACTTCCTATTCGCCTATGCTATCCTCCGATCTATCCCAAACAAACTAGGCGGAGTACTCGCCCTAGCTGCCTCTGTACTAGTCCTATTCCTCATCCCCCTTCTCCATACATCTAAACTACGCTCAATAACTTTCCGCCCTCTATCACAAATCCTATTCTGAACATTAGTAGCCAACCTCCTGATCCTCACCTGAGTAGGCAGCCAACCAGTTGAACACCCCTTTATCATCATCGGACAACTAGCCTCAATCTCCTACTTCACAATCATCTTAGTCCTATTCCCACTTGCATCCATCCTAGAAAACAAGATACTTAAACT----------TTA-ACT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGATTACACCCCTTCTTAGAGTT Leiothrix_lutea_NC_020427 GTTCCTGTAGCTTATACCAAAGCATGGCACTGAAGATGCCAAGATGGTCGC--TAAA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTGTTGCTAGATTTATACATGCAAGTATCCGCGATCCAGTG-TAGATGCCCTAGGCA-CCC-T-AACCTTT----AGGTCGATAGGAGCGGGTATCAGGCACACCC------CTTCTCAACCGTAGCCCAAGACGCCTCGCAATTGCCACACCCCCACGGGTATTCAGCAGTAATTAATATTAAGCAATGAGTGTAAACTTGACTTAGTCATAGCAAT-C---TAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATCAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACCAAAAAGCAACTGAGTTGTCACAAGCTAAAGATGCGGCATAAGGCCTCT--ATTCAAAGAAGATCTTAGACC--AACGATTAATTGAAG-CCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-CGA--TCTAACCGGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCTCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATG-CACCCAACCATTCCTTGC-CCA-AAA--CAGCCTATATACCGCCGTCTCCAGCCCACCCTCC--ATGAGGGCCCAACAGTGGACGCAATAG-CCATA-ACACGCTAATAAGACAGGTCAAGGTATAGCCCATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCAAAGGAATATGAAACTGTTCCTAGAAGGCGGA-TTTAGCAGT-AAAGAGGGATTAGCGAGCCCTCTTTAAGCCGGCTCTGGAGCACGTACATACCGCCCGTCGCCCTCCTCAAAAG-CG-ACCCACACCCCACCCAT-ACCTAATAAGCTAT-CC--AGCCAAAGAGGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGACA-CCAAGACGTAGC-TTAAAC--AAAGCATTCAGCTTACACCTGAAAGATATCTGCTT-ACAACAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AACAT-ACC-TG------ACACAGA-ATAAC--AAAGCTACTCTCC---A-CACCT----AACCAAAGCATT---T--GCTAGT-CCTAGTATAGGCGATAGAAAAGACA-CCACTTGGC-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATAAAAATG-AAAAATCC--TAAGCTC-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCTCCCCGAAACCCAAGCGAGCTACCTATGAGCAGCTAC-T-ATGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGTAGGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCCGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC---CCAGAACCCCA--ATGAAAC---GAATTAAGGGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AACCTTCCCATACAAC--TACCTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCAGT-ACC-TAAAAATATCTA-ATCTATATGACTCCCT-CACCACTAACGGGCTAACCTATAGTTAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--TC-TCCCTCT----TCGACGCAAGCTTACATCTGTA-CATTATTAACAAG-TACCCC-ATATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATTAACACACA-TTGTTAACCCGACAGA-GGAGCGTCTTCT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAATTCGTCAGGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCAATAGACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACAT---T---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACCCGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTCAAAAGCAGCAGCCACC--CCAAAT-TACATT----CT-CACCCA--CCC-GGGCTCACTTAT-AC--CAACGGGCTACTGGCT-TGCACTTTTTCGGTTGGGGCGACCTTGGAGCAAAGC-AAAACCTCCAA-ATCTTAGACCTTACATCTAGACTA-AGAGCAACTACTCAACGTGCTAATAGCAACCAGATCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCAAGAGTCCATATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCCACTAAGGGCTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGACG-AGCTCTTCCCCGTACGAAAGGATAGGAA-AAGCGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-TCCCC-----CCA-CGTCCTAGAAAAGGA--T-TAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTTACA----------ACACTC--T----ATGGC----------CAAATACCCCCTCTTAATCAACCTTGTAATAGCCCTCTCCTATGCACTTCCTATTCTAATCGCAGTAGCCTTCCTCACACTAGTAGGACGCAAAATTCTAAGCTACATGCAAGGCCGAAAAGGCCCTAACATCGTAGGCCCATTCGGCCTTCTCCAGCCCCTAGCCGACGGAGTAAAACTATTCATTAAAGAGCCAATCCGCC---------CATCAACATCCTCCCCCATCCTATTCATCACAACCCCCATATTAGCTCTCCTTCCCGCAATCTCAATCTGAACCCCCCTCCCTCTGCCATTTCCACTTGCAGACCTCAACCTAGGCCTACTGTTCCTGCTAGCCATATCCAGCCTGGCAGTCTACTCCATTCTATGATCTGGCTGAGCGTCCAACTCAAAATACGCGCTAATTGGGGCCCTTCGTGCAGTAGCACAAGCCATCTCCTATGAAGTTACCCTGGCAATTATTCTACTATCTATCGTCCTACTAACTGGCAACTACACTCTCAGCACTCTTGCCACCGCTCAAGAGCCGCTCTACCTCATCTTCTCCTGCTGACCTCTGGCCATAATATGATATGTATCCACCCTAGCCGAAACAAACCGCGCCCCGTTCGACCTCACAGAGGGTGAGTCCGAATTAGTCTCCGGTTTTAACGTAGAATATGCAGCGGGCCCATTCGCTCTTTTCTTCCTCGCTGAATACGCCAACATCATATTAATAAACACACTCACCGCTATTCTATTCTTCAACCCAAGCCTATTTAACCTCCCCCAAGAACTATTCCCCCTAGTACTAGCTACAAAAGTCCTCCTCCTATCAGCAGGATTCCTATGGATTCGAGCCTCCTATCCGCGATTCCGATACGACCAACTTATGCATCTTCTATGGAAAAACTTCCTACCACTCACACTAGCCCTATGCCTCTGACATACAAGCCTGCCAATCTGCTATGCGGGCCTACCA-----CCATACCTAAG--GA---------------TAAAGGAAATGTGCCTGAACGTCC--AAGGGTCACTATGATAAAGTGAACATAGAGGTATACCAGTCCTCTCATTTCCTATCACCCA-------TTAGAAAAGCAGGAATTGAACCTGCACTAGAGAGATCAAAACCCTCTATACTTCCCTTATATTATTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCTTCCCCTGCTA-ATGACCCCCCAAGCAAAACTAATCTTCATCTCTAGCCTTCTTCTAGGTTCAACTATCACAATCTCGAGTAACCACTGAATCA---CGGCCTGGGCCGGCTTAGAAATTAACACCCTAGCCATCCTCCCCATAATCTCAAAATCCCACCACCCCCGAGCCATTGAAGCTGCAACCAAGTACTTCCTGACCCAAGCGACCGCCTCAACACTAGTTCTATTCGCCAGCATAACTAACGCATGGCATACTGGGCAATGAGACATCACCCAAATAACCCACCCAACATCATGCTTAATCCTCACATCAGCCATCGCAATAAAACTAGGACTAGTCCCATTCCATTTTTGATTCCCAGAAGTACTCCAAGGGTCCCCCCTTATAACCGGCCTTCTCCTATCCACAGTAATAAAATTCCCACCCATCACACTATTCTTCATAACATCCTCATCCCTAAACCAAACATTATTAGCACTCATAGCTGTCCTATCCGTGGCCGTAGGAGGGTGAATAGGGCTCAACCAGACACAAATCCGAAAAATCCTAGCATTCTCCTCTATCTCACACCTAGGCTGAATAACTATCATCATCTCCTACAACCCTAAACTCACTCTATTAAACTTCTACCTATATATCCTAATGACCACAGCTGTTTTCCTAACCTTAAACTCAATTAAAACCCTAAAACTATCTACACTAATAACCACATGAACAAAAACCCCTGCGCTAAGTGCCATACTCCTCCTGACTATGCTCTCTCTTGCAGGACTACCACCCTTAACAGGATTCCTGCCCAAATGACTCATCATTCAAGAACTGACTAAACAAGATATAGCTACAATAGCAGTAATAATCTCGATTCTCTCCCTACTGAGCCTATTCTTCTACCTCCGCCTAGCATACTGCGCCACAATCACACTCCCACCTCACACCACAAACCACATCAAACAATGGCGTACTAACAGCCCTATCAACACTACAACCGCCATCTTAACCGTCGCATCAACTTCACTCCTCCCTATCTCCCCTATAATCCCCACTATCAT------CT----AAGAAACTTAG----GATTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGATAAGACCCGCAGGATACTACCCCGCATCTCCTGAATGCAACCCAGGCGCTTTAA-TTAAGCTAGGACCTTCT--TCACCGCCCTAGACAGATGGGCTTCGATCCCATAAAGG-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTGCCT-ACC-----------AGACCTCGGTGCAAA--CTAATGCACATCAATGGGCTTGCAACCCACCATGAATTTCACTACAAGGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTATGACATTCGTCAACCGATGACTATTCTCAACCAACCACAAAGACATCGGTACCCTATACTTAATCTTCGGCGCATGAGCCGGGATAGTTGGTACCGCCCTAAGCCTGCTCATCCGAGCAGAACTAGGTCAACCTGGCGCCCTACTGGGGGACGACCAAGTTTATAACGTAATCGTCACAGCCCATGCTTTCGTAATAATCTTCTTTATAGTGATACCAATTATGATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCTTACTCCTACTAGCTTCCTCCACGGTAGAAGCAGGGGCAGGAACTGGTTGAACTGTCTACCCTCCCCTAGCTGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTACATCTAGCAGGGATCTCTTCAATCCTCGGAGCAATTAATTTTATCACAACAGCAATCAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCAGTCCTAATTACTGCAGTACTTCTACTCCTATCCCTTCCAGTTCTTGCTGCAGGTATTACAATACTACTCACAGACCGCAACCTAAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAGTACCCTACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTCATCCTCCCCGGATTTGGAATCATTTCACATGTCGTAGCATACTACGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTCTCTATCGGATTCCTAGGATTCATTGTGTGAGCTCGCCACATATTCACAGTAGGGATGGACGTAGACACTCGAGCATACTTCACATCCGCCACAATAATCATCGCAATTCCAACCGGTATCAAAGTATTCAGCTGACTAGCCACCCTACACGGAGGAATTATCAAATGAGATCCCCCTATGCTATGAGCTCTGGGCTTCATCTTCCTATTCACTATCGGAGGACTAACGGGCATCGTACTGGCTAACTCCTCTCTAGACATTGCTCTTCATGACACATACTACGTAGTTGCCCACTTCCACTACGTCCTATCTATAGGAGCTGTATTCGCAATCCTGGCAGGCTTCACCCACTGATTCCCGCTATTCACCGGTTACACACTTCACTCTACGTGGGCCAAAATTCACTTTGGGGTAATATTTGTGGGTGTTAACCTCACCTTCTTCCCACAACACTTCCTAGGCCTAGCCGGCATGCCACGACGCTACTCAGACTACCCAGACGCCTACACACTATGAAACACCATCTCCTCCGTAGGCTCACTAATCTCTATAACAGCCGTGATCATGCTAGTGTTCATCATCTGAGAAGCCTTCGCATCCAAACGTAAAGCCCTGCAGCCAGAACTAACAAGCACAAACATCGAATGAATCCATGGCTGCCCACCTCCATTCCACACATTTGAAGAACCTGCCTTTGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCACATGTTGGTTTCAAGCCAACCGC--AT---AACCACTTATGCTTCTTTCTC---ATA--AGAGGTGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGGCTAAATTACAGGTTAAACCCCTGTACACCTCAA---CAC----AACCATGGCAAACCACTCACAACTCAACTTCCAAGACGCCTCATCACCTATCATAGAAGAACTCATACAATTCCACGACCACGCCCTAATGGTCGCCCTAGCTATCTGCAGCCTAGTCCTCTACCTCCTAGCCACCATACTTACGCAGAAACTATCATCAAACACAGTTGATGCACAAGTAATCGAGCTAATCTGAACAATTCTTCCGGCCGGAGTGCTAATTACACTAGCCCTCCCATCACTACGAATTCTATATATAATAGACGAAATTAATCAACCAGACCTCACTCTAAAAGCTATTGGCCACCAGTGATACTGAACCTACGAATACACTGACGTCAAAGACCTAACATTCGACTCATACATAACACCAACAACAGAACTTCCATTAGGACACTTTCGCCTACTAGAAGTAGACCATCGAGTGATCGTTCCAACAGAATCCACCGTTCGAGTCATTGTCACCGCCGACGACGTCCTGCACTCATGAGCTGTTCCCAGCCTAGGTGTAAAAACCGATGCAATCCCAGGACGCCTAAACCAAACTTCATTCCTAGCTAACCGACCTGGAATCTACTACGGCCAATGCTCAGAAATCTGCGGAGCAAACCACAGTTTCATACCAATCGTAGTAGAAGCTATCCCACTTGCCAGCTTCGAGAACTGACTCTCTATCA---CACCATCAT----------AATCATTAAGAAGCTATGGAACAGCACTAGCCTTTTAAGCTAGAGAAAGAGGGTT--AATCCCCTCCTTAATGATATGCCACAACTAAACCCAGCTCCCTGATTTTTTATCATGATCATCACATGACTAACATTCTCCCTAATCATCCAACCTAAACTCCTATCATTTGTAACCATAAACCCCCCATCCAGCAAGG---CCCCAACAACTTACACCACCACCCCTTGAACTTGACCATGAACCTAAGCTTCTTCGATCAATTCTCAAGTCCATCCTTCCTAGGGATCCCCTTAATCCTTATCGCAATAACATTCCCAGCCCTGCTTCTACCATCCCACAACAACCGATGAATCACCAGCCGAGTCTCAACCCTCCAACTATGATTTGTCAACCTCATTACAAAACAACTAATAACCCCACTAAACAAAAAAGGACACAAATGGGCACTAATCTTAACATCACTAATAATCTTCCTACTTTTAATTAATCTCCTAGGCCTACTACCATACACCTTCACCCCTACCACTCAATTATCTATAAACCTAGCCCTAGCCTTCCCTCTATGACTTGCTACGCTCCTCACGGGCCTACGAAATCAACCCTCCATCTCCCTAGGACACCTCCTCCCAGAAGGAACTCCTACACCACTAATCCCAGCCCTCATCCTAATCGAAACCACAAGCCTACTCATCCGACCCCTAGCACTAGGCGTACGCCTAACAGCAAATCTCACAGCAGGCCACCTCCTCATTCAACTGATTTCCACAGCTACTGTAGCCCTCTTCTCAACAATACCCCTAGTCTCTCTACTTACACTCCTAGTCTTATTCCTACTCACAATTCTAGAAATTGCCGTAGCTATAATTCAGGCCTACGTCTTTGTTCTACTACTAACCCTGTACCTCCAAGAAAACATTTAACCA----ACCCAATGGCACACCAAGCACACTCCTACCACATAGTAGATCCAAGCCCATGACCTATTTTCGGCGCAGCCGCCGCCCTTCTTACTACCTCTGGACTAACTATATGATTCCACTACAACTCCCCCCATCTCCTAATCATCGGCCTCCTATCAACACTCCTAGTAATATTCCAATGATGACGAGACATTGTACGAGAAAGCACCTTCCAAGGCCACCACACCCCCACAGTCCAAAAAGGACTACGATATGGAATAGTCCTATTCATCACATCCGAAGCCTTCTTCTTCCTGGGCTTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCCACCCCAGAACTAGGAGGTCAGTGACCCCCCGTAGGAATCAAACCCCTGGACCCCATAGACGTTCCACTACTCAACACTGCCATCCTTCTAGCCTCAGGGATCACAGTCACATGAGCCCACCACAGTATTACAGAAGCACGCCGAAAACAAGCAATCCACGCTCTTACCCTAACAATCCTTCTAGGATTCTACTTCACAGGCCTCCAAGGCATAGAATACTACGAAGCACCATTCTCCATCGCAGATAGCGTCTACGGCTCTACCTTCTTTGTAGCTACTGGATTCCACGGCCTACACGTAATCATCGGCTCCACCTTCCTTCTAGTCTGCCTCCTACGCCTAATCAAATACCACTTCACACCGAATCACCACTTCGGCTTTGAGGCAGCAGCCTGATACTGACATTTTGTAGATGTTGTCTGACTATTCCTTTACATAACTATCTACTGATGAGGATCATACTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAACCCCAGAGAAGAGTAATG---AACATAATTACATTCATAATTACCCTATCCCTAACCTTAAGCCTCATCCTAACCGCACTGAACTTCTGAATCGCCCAAATGAACCCCGATGCAGAAAAACTATCCCCCTACGAGTGTGGCTTTGACCCACTAGGCTCTGCTCGACTGCCATTCTCAATCCGATTCTTCCTAGTAGCCATCCTCTTCCTCCTATTCGACCTAGAAATCGCCCTTCTCCTCCCCCTACCATGAGCCACCCAACTCCAAAACCCCACCACCACACTCACCTGAGCATCCATCCTAATCCTCCTCCTCACTCTGGGACTAGTATACGAATGAATCCAAGGAGGACTAGAATGAGCAGAGTA-AAAAGGCAAGAAAGTTAGTCTAATTAAGACAGTTGATTTCGGCTCAACAGATTATAGCTCACACCCTATAACTTTCTTTATGACCCTGCTCCACTTAAGCTTCTATTCAGCCTTTACCCTTAGCGGTCTAGGACTAGCCTTCCACCGAACCCACCTAATCTCAGCCCTCCTGTGCCTTGAAAGCATAATACTGTCAATATACCTCGCCCTATCCATATGACCCATCCAAACACAAACATCATCACCCACCCTGCTACCTATCCTAATACTCACTTTCTCCGCCTGCGAGGCAGGCACAGGACTCGCCCTGCTCGTAGCTTCCACCCGCACCCACGGCTCTGACCACCTACACAACTTCAACCTACTCCAATGCTAAAAATTATCATCCCAACTATCATACTCCTCCCCCTAACTTTCCTCTCTCCACGTAAACACCTATGGACCAACACCACAATATACAGCCTACTAATTGCCACCATCAGCCTACAATGACTAGTACCAACTTATTACCCCAATAAGAGCTTATCTCCCTGAACTGCCATCGACCAAATCTCTTCCCCACTACTAGTTCTATCATGCTGACTCCTCCCCCTCATGCTTATAGCAAGCCAAAATCACCTAGAACAGGAACCTACCATCCGTAAACGAATCTTTATTACAACAGTTGTTCTAGCCCAACCATCCATCCTCCTAGCCTTCTCAGCTTCAGAACTAATACTATTCTATATCGCATTCGAAGCCACCCTCATCCCCACCCTAATCCTTATTACCCGATGAGGCAACCAACCAGAACGACTAAATGCCGGCATCTACCTACTATTCTACACACTAGCTAGTTCACTACCACTATTAATTGCCATCCTTCATCTACACAACCAAATCGGAACTCTCTACTTCCCTATACTAAAACTATCACACCCAACAATAACCACCTCCTGATCGGGCTTAATATCAAGCCTAGCCCTACTCCTCGCCTTCATAGTTAAAGCCCCCCTATACGGCCTTCACCTATGACTCCCTAAAGCCCATGTAGAAGCCCCAATCGCTGGCTCAATACTACTAGCCGCCCTACTACTAAAACTCGGAGGCTATGGTATTATACGATTCACAACCCTAGTAAACCCAACATTAAACAACCTTCACTACCCATTCATCACCTTAGCCCTATGAGGAGCACTAATAACCAGCGCCATCTGCTTACGACAAATCGACCTAAAATCCCTAATTGCCTACTCATCCGTCAGCCACATGGGCCTAGTCATCGCTGCAACCATAATCCAGACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCGCACATGGATTAACCTCCTCAATACTATTCTGCTTAGCCAACACTAACTACGAACGCACACATAGCCGAATTCTCCTACTCACCCGAGGTATTCAGCCCATCCTCCCACTCATAGCCATCTGATGACTCATAGCAAACCTAACAAACATAGCACTCCCCCCAACAATCAACCTCATAGCAGAACTAACCATTATAATCGCACTCTTCAACTGATCCTCACTAACAATCCTACTGACAGGAGCAGCAATCCTATTGACCGCCTCCTACACCCTATACATGCTAATAATAACACAACGAGGAGCACTTCCATCTCATATCACATCCATCCAAAACTCCTCCACACGAGAGCACCTCCTCATAGCCCTCCACATAATCCCCATAATCCTTCTCATCCTCAAACCCGACCTCATCTCCGGCATCCCTATAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACTGTGATTCTAAAAATAGAAGTTAAAGCCTTCTTACCTGCCGAGGG--GGGTT-CAACCAGCAAGAACTGCTAATTCTCGCATCTGAGTATAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCACTAGTCCTAATCACTTCCATACTACTCACCCTAACCACCCTATCCACCCCCATTATCCTACCGCTTATATCAAGCAAACTAAAAAATACCCCAAACATCATCACAAACACAGTAAAAACCTCCTTCCTGATTGGCCTAATCCCAATAACAATTCACATCTGCTCAGGAACAGGATGTCTTCTAACCCTGTGAGAATGAAAATTCATTATAAACTTCAAAATCCCAATCAGCCTTAAAATAGACTTCTACTCCCTTACATTCTTTCCAATCGCCCTATTCGTGTCATGATCCATTCTACAATTCGCAACATGATACATAGCCTCAGACCCCTACATCACAAAATTCTTCACCTACCTACTATTCTTTCTAATCGCTATGCTCATCCTAATTATCGCCAACAACCTATTCATCCTATTCATTGGATGAGAAGGAGTAGGAATCATATCCTTCCTCCTAATTAGCTGATGACACGGCCGGGCCGAAGCTAACACTGCTGCCCTCCAAGCTGTCCTATATAACCGGGTCGGAGACATTGGTCTCATTCTTTGCATAGCCTGATTAGCTTACACTATAAACACCTGAGAAATCCAACAATTATCCTCCCCCCATCAAATCCCCACCCTCCCACTTCTAGGCCTCATCCTAGCTGCAACAGGTAAATCCGCCCAATTTGGACTCCACCCCTGACTACCAGCCGCCATAGAGGGCCCAACCCCTGTACCCGCATTACTCCACTCTAGTACTATAGTGGTCGCCGGAATCTTCCTACTCATCCGAACGCACCCACTATTCAACCACAACCAAACAGCCCTGACACTATGCTTATGCCTTGGCGCTCTCTCCACATTATTCGCAGCTACATGTGCCTTAACCCAAAATGACATCAAAAAAATCATCGCCTTCTCCACTTCAAGCCAACTAGGCCTAATAATAGTAACCATTGGATTAAACCTCCCACAACTAGCCTTCCTTCACATCTCCACCCACGCATTTTTCAAAGCCATACTTTTCCTATGTTCCGGTTCAATTATCCACGCCCTCAACGGGGAACAAGACATTCGAAAAATAGGAGGACTACAAAAAATACTACCAACAACCACATCATGCCTTACTATCGGCAACCTAGCCCTGATAGGAACCCCATTCCTAGCAGGCTTTTACTCAAAAGACCAAATCATCGAAAGCCTAAGCACCCCATACCTAAACACCTGAGCCCTAGTCCTAACCCTACTAGCAACATCATTCACTGCAGTATATACAATCCGCATAACTGTGCTAGTACAAACCGGATTTGTACGAATCCCTCCCCTAACCCCAATAAACGAAAACAACCCGCTAGTAATCTCCCCAATCACCTGACTTGCCTTAGGAAGTATTATAGCAGGACTCCTTATCACCTCATACATCCCCC---CCACAAAAACACCACCCATAACTATACCTCTCTCAATCAAAATCACAGCCCTAGTAGTCTCAGCCCTAGGAATTGTTATTGTACTAGAACTATCAAAAATAACCCAAACTCTCATCCTGACAAAACAAAGCCCTCTATACAACTTCTCCATCTCCCTGGGATACTTTAACCCACTAACACACCGCTTCAACATAACCAACCTACTAAACAGCGGACAAAATATTGCCTCTAGCCTAGTAGACCTCTCCTGACTAAAACTACTAGGACCAGAAGGACTAGCCAACTCACAACTAGCCATAACAAAGGCCACCACCCTACTACACTCCGGCCTCATCAAACCCTACCTAGGAGCTTTTGCTCTATCCATCATCATCATCCTCA---TGTCCTCATACAGAAC--CCACT-----AATGGCTCTCAATCTTCGTAAAAACCACCCCTTACTAAAAACCATCAACGACTCCTTAATTGACCTTCCAACACCATCCAACATTTCAACCTGATGAAACTTTGGATCCCTACTAGGTATCTGCCTAATTACGCAAATCGTCACAGGCCTACTACTAGCCATACACTACACGGCAGACACTAACCTAGCCTTCGAATCCGTCGCTCACATGTGCCGAAACGTCCAATATGGCTGACTAATTCGAAACCTGCATGCGAACGGAGCCTCATTCTTCTTCATTTGCATCTACTTCCACATCGGCCGAGGACTTTACTACGGATCCTACCTAAACAAAGAGACATGAAACGTCGGAGTTGTACTCCTGCTCACACTCATGGCCACTGCCTTCGTCGGTTACGTACTACCCTGAGGACAAATATCATTCTGAGGGGCTACAGTAATTACAAACCTATTCTCAGCAATCCCCTACATTGGACAGACCCTGGTAGAATGACTATGAGGCGGATTCTCAGTAGACAACCCCACCCTAACCCGATTTTTTGCCATTCACTTCCTCCTCCCATTTGTCATTGCAGGACTTACACTAGTTCACCTAACTCTCCTGCATGAAACAGGATCGAACAACCCCCTAGGAATCCCCTCAGACTGCGACAAAATCCCATTCCACCCCTATTACACTATCAAAGACATCCTGGGATTCGTACTCATATTCGCCCTACTAGTTGCTCTAGCCCTATTTACCCCAAACCTGCTAGGAGACCCAGAAAACTTTACACCAGCCAACCCCTTAGCAACCCCACCCCATATTAAACCCGAATGATACTTCCTATTCGCCTACGCTATCCTCCGATCTATCCCAAACAAACTAGGTGGAGTACTTGCCCTAGCTGCCTCCGTACTAGTCCTATTCCTCATTCCCCTTCTCCACACATCCAAACTACGCTCAATAACTTTCCGCCCCCTATCACAAATCCTATTCTGAGCACTAGTAGCCAACCTCCTAATCCTCACCTGAGTAGGTAGCCAACCAGTTGAACACCCCTTCATCATCATCGGACAACTAGCCTCAATCTCCTACTTCACAATCATCCTAGTCCTTTTCCCACTTGCATCCATCCTTGAAAACAAGATACTTAAACT----------TTA-ACT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGATTATACCCCTTCTTAGAGTT Lepidothrix_coronata GTCCTTGTAGCTTACAATAAAGCATAACACTGAAGATGTTAAGACGGCTAT--CATA-TATACCC-AAGGACAAAAAAGACTTAGTCCTAACCTTACAGTTAGTTCTTGCTAAACATATACATGCAAGTATCCGCATCCCAGTG-AAAATGCCCTCAACA-CCT-TAAA---------AAGACAGCAGGAGCAGGCATCAGGCACA--C------CACCTTAACTGTAGCCCAAAACGCCTTGC-CTAGCCACACCCCCACGGGTACTCAGCAGTAATTAATATTAAGCAATAAGTGTAAACTTGACTTAGTTAAAGCAACTCA--CTAGGGTTGGTAAATCTTGTGCCAGCCACCGCGGTCACACAAGAAACCCAAATTAACTATG-------CACGGCGTAAAGAGTGGTTTT-TCATTAT-CTCTCAGACTAAGATTGAAGTACAACTAAGCTGTTATAAGCATAAGATGT-ATTCAATACCCCC----ATAAAAATGATCTTAGCTT--CATGGTCAACAAAACTCCACGAAAGCCAGGACACAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCCCGATGCTTTTA----CCACTCAAGCATCCGCCTGAGAACTACGAGCGCAAACGCTTAAAACTCTAAGGACTTGGCGGTGCTCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATAACCCACGATA-CACCCAACCATCCCTAGC-CAA--AC--CAGCCTATATACCGCCGTCGTCAGCCCACCCCAAAACTGAGGGTCTAACAGTGAGCAAAATAG-CAACA-CCCCGCTAATAAGACAGGTCAAGGTATAGCTCATGAGATG----------------------GT-AGAAATGGGCTACATTTTCTATCATAGAAAA-CTTCTTACGACAA-GGAATGTGAAATCACTCCTAAAAGGCGGA-TTTAGCAGT-AAAGCAGGATAATAACGCCTTCTTTAAACCGGCTCTGAAGCACGTACATACCGCCCGTCACCCTCCTCACAAG-CTATAGCCAATCTAATCCAT-----AATAAACT---CCAAAGCTAGAGATGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGTCTA-CCAAGACGTAGC-TATAACA-AAAGCATTCAGCTTACACCTGAAAGATATCTGTTCCATACCAGATCGCCTTGA-AGCCTAACTCTAGCTCTTCTACCAAATTACATA-TA------AACT----AAATC--AATACCACC---------CACTA----AATCAAAACATTCTCTTAACTCAA-CCTAGTATAGGCGATAGAAAGGTAA-ACT-CAAGACGCGATAGAGAT-CATGTACCGTAAGGGAAAAATGAAATAACAATG---ACAAAC--CAAGCAC-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGATTTAGCAAGAATTACCCAAGCAAAACGCCAATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTATTTATTGAGCAAACCCGTCTCTGTTGCAAAAGAGTGGAACGACTCGTTAGTAGTGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTATGAAACGAATCTCAGTTCCCTCTTAATTCATCTCCCAGG---TCTACATCCAACCCGC--ATGAAGC---GAATTAAGAGCTATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACATTCTCCC-TCAGCGGATA----AACTAAATTGCACT--------TAAACTGTGGGCCTTCAAGCAGCCACCATCAAAGAGTGCGTCAAAGCTCTAC-ACC-TAAAAATCCAAACCTTCCCATGATTCCCTCTCCCCCCAATAGGCTAACTTATAAT-AAATAAGAGAATCTATGCTAAAATAAGTAACTAGGG-----AT-TCCCTCT----ATGGCGCAAGCTTACATT-ACA-TATTATTAACAGA--TCTTA-AGATATTCCCTAACC---------CTA---ACAAGACTCTA-TATCA-AAAACT-CTGTTAACCCGCCTAT-GGAGCGCCTCTCAAAGAATGATTAAAATCTGTAAAAGGAACTAGGCAAACCC---AAGGCCCGACTGTTT-ACCAAAAACATAGCCTTTAGCAGAC-------TAAGTATTAAAGGTGAAGCCTGCCCAGTG--ACAA-TAC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGGGACCTGTATGAACGGCTCAACGAGGTCTTAACTGTCTCCTACAGATAATCAGTGAAATTGATCTTCCTGTGCAAAAGCAGGAATAACCTCATTAGACAAGAAGACCCTGTGGAACTTTAAAATCTGCTACCACTCCCATAAACAACTTT-------CTCCTA----CAGGACCTACTCCC-----CGGGATCTTACTGGTA-TGCA-TTTTTTGGTTGGGGCGACCTTGGAGATAAAC-TTAACCTCCAA-AAACCAGACAACCCATCTTGACCA-AGAACAACTCATCAACGTACTAATAGTAACCAGACCCAATAT--AATTGATTAATGAACCTAGCTACCCCAGGGATAACAGCGCAATCTCCTTCAAGAGCCCACATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAACCGCTACCAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGCTACAACTCCTTCTAGTACGAAAGGACCGAAG-AAGTAAGGCCTATACCACAA-GCACGCCTTC-GCCCTCAGTAATGAACTCAACTAAATTACTAAGAGCTCCAAC-ATAAC---C-----CCTCCTAGAAAAGGA----CCGCTAGCGTGGCAGAGCTTG--GCAAATGCAGAAGGCTTAAGCCCTTTA-CCCAGAGGTTCAAATCCTCTCCCTAGC-----TCCACATAGAACAT---------------ATGAC----------AATTCGCTTAGCTCTAACTTACCTCACCATATCACTATCCTATGCACTTCCCATCCTCATTGCCGTAGCATTCCTCACCCTAGTTGAACGTAAAGTTTTAAGTTATATACAAGCCCGTAAAGGACCAAACATTGTAGGACCATTTGGTCTCTTGCAGCCCATAGCAGATGGACTAAAACTATTCATCAAAGAGCCAATCCGCC---------CATCAACTTCATCTCCCTACCTATTTATAACTACTCCCATCTTAGCCCTCCTCCTAGCACTTACAATCTGAACACCACTCCCACTACCCTTTCCCCTCACTGACCTAAACCTTGGCATACTCTTTCTCCTAGCCCTATCCAGCCTAGCAGTCTACTCAATCCTATGGTCAGGATGAGCCTCTAACTCAAAGTACGCTCTAATTGGTGCCCTTCGAGCAGTCGCACAAACCATTTCCTATGAAGTCACCCTAGCCATTATCCTTCTATCTGTGATTATTTTAAGTGGCAACTATACCCTAAACACTCTTGCCACAACCCAAGAACCTCTTTACCTCATTTTCTCTTCTTGGCCCCTAGCAATAATATGATACATTTCCACACTAGCTGAAACAAACCGTGCCCCATTTGACCTAACAGAAGGGGAATCAGAATTAGTCTCAGGATTCAATGTAGAATACGCTGCAGGCCCATTCGCCCTATTCTTCCTAGCTGAATATGCCAACATTATGCTGATAAATGCACTCACAACCATTCTATTTTTAAACCCCAGCTCACTTAACCTACCCCAAGAGCTCTTTCCCTTGACTCTAGCTACAAAAACCCTTCTCCTCTCCGCAGGTTTCCTATGAATTCGCGCTTCCTACCCTCGATTCCGTTATGATCAACTTATACACTTACTTTGAAAAAACTTCTTACCTCTAACACTTGCCCTATGCCTATGACACGCTAGCCTCCCCATCTCCTATGCAGGCTTGCCC-----CCCTACCTA-A--GATA------------TCCCAGGAAATGTGCCTGAGTCCAA--AAGGGTTACTATGATAAAGTAAACATAGGGGTGTACCAACCCCCTCATTTCCT----AAGC-------TTAGAAAAGTAGGAATCGAACCTACACTAAAGGAATCAAAATCCTTTATACTCCCTCTATATTATTTTCT----------------AGTAAGGTCAGCTAATTAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCTTGCTA-ATGAACCCCCAAGCCAAATTAATTTCTGCAACTAGCCTACTCCTAGGAACTTCTATTACAATTTCAAGCAACCATTGGGTAA---TAGCATGAGTCGGCTTAGAAATTAATACCCTAGCCGTTCTCCCCTTGATTTCTAAAAGCCATCACCCACGAGCCATTGAGGCTTCTACTAAATATTTTCTAACCCAAGCAGCAGCATCCACACTACTCCTATTCTCTAGCATAACCAATGCATGATTCTCTGGCCAATGAGACATTACCCAACTAACCCATCCTATATCATGCATGCTATTAACAACTGCAATTTCAATTAAACTAGGCTTAGTCCCATTCCACTTCTGATTCCCAGAAGTCCTTCAAGGCTCAACCATAACTACATGCCTCCTATTAGCTACAATTATAAAATTCCCGCCAATCACCCTATTCTTCCTAACATCTCCTTCTCTCAACCCAACCCTACTGTCCCTCATGGCTATCGCTTCCGCAGCCCTAGGGGGCTGAATAGGCCTTAATCAAACTCAAACCCGCAAAGTTTTGGCTTTCTCATCCATCGCTCACCTAGGATGAATAACCATTATTCTCATCTATAGTCCTAACTTAACTTTAACTGCCTTTTATCTATACACAGTAACAACTTCCGCTATCTTCTTTATCCTTAACACAACTAATACCTTAAAATTATCCACTATAATAACCGCATGAACCAAAATCCCCCCACTAACCACAATCTTCATACTTACCCTACTCTCTCTCGCAGGCCTTCCTCCACTGACAGGATTCCTACCTAAGTGATTAATTATTCAAGAACTCACTAAACAAGGACTAACAATTATAGCCACAACCATTACCCTACTCTCTCTACTCGGACTCTTCTTTTACCTACGCCTAGCCTACTGTGCTACCATCACATTACCCCCAAACTTTATTAACTACACAAAACAGTGGCAAATTAGCAAACCAACCAACATTCTAACTACAACCCTAACTACTCTGTCAATCCTACTCCTACCATTATCCCCCATAGTATTCACAGTTTC------TT-----AGAAACTTA-----GGTTACCC--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGCTAATCCCTCTTAGTTTCTGCTAAGATCCACAGGATACTAACCTGCATCTCCTGATTGCAACTCAGATGCTTTAA-TTAAGCTAGAACCTC---------CTCCTAGACAGATGGGCTTCGATCCCATGAAAT-TTTAGTTAACAGCTAAATGCCTCAACC-AACAGGCTTCTGTCT-ACC-----------AGATCCCGGCGCATAT-CTAATGCACATCAATGAGCTTGCAACTCAACATGAACTTCACTACAGAATC---GATAAGAAGAGGAATTAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-CAACACTCAGCCATC--------------TTACCTATGACTTTCATCAACCGTTGATTATTTTCTACCAACCATAAAGACATCGGCACACTTTACCTTATTTTTGGTGCATGAGCTGGTATAATTGGTACAGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGACAACCAGGAGCCCTTCTAGGCGATGACCAAATCTATAATGTAATCGTTACCGCACATGCCTTCGTCATAATTTTCTTTATAGTAATACCCATTATAATCGGAGGATTCGGTAACTGGTTAGTTCCACTAATAATTGGCGCCCCCGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTCCTTCCCCCATCCTTTCTACTTCTCCTGGCATCCTCTACAGTAGAAGCTGGGGTTGGAACAGGATGAACCGTATACCCGCCCTTAGCCGGAAATCTTGCCCATGCCGGTGCATCAGTAGATCTTGCTATTTTTTCTCTACACCTGGCAGGTATCTCCTCTATTCTTGGGGCCATCAACTTTATTACCACGGCAATCAACATAAAACCGCCCGCCCTCTCACAATACCAAACTCCCTTATTCGTCTGATCCGTCTTAATTACTGCAGTCCTCCTTCTTCTCTCCCTGCCAGTCCTCGCTGCTGGTATTACAATACTCCTAACAGACCGAAATCTAAACACTACATTCTTCGACCCTGCAGGGGGCGGAGACCCAATCTTATATCAACATCTATTCTGATTCTTCGGACACCCAGAAGTCTATATTCTCATCCTACCAGGGTTTGGAATCATCTCCCATGTCGTAGCCTACTACGCAGGAAAGAAAGAACCCTTTGGCTACATAGGCATAGTCTGAGCCATATTATCCATTGGCTTCCTGGGCTTCATCGTATGAGCCCACCACATATTCACAGTTGGAATGGATGTAGATACCCGAGCTTACTTCACATCCGCTACCATAATCATTGCAATCCCCACTGGCATCAAAGTCTTCAGCTGACTAGCCACTCTACATGGTGGAACAATCAAATGAGACCCTCCCATACTATGAGCCCTAGGCTTTATTTTCCTTTTCACTATTGGTGGACTAACAGGCATTGTCCTAGCCAACTCCTCCCTAGATATTGCTTTACACGACACCTACTACGTAGTTGCACACTTCCACTATGTATTATCTATAGGAGCAGTATTCGCCATTTTAGCCGGTTTTACCCACTGATTCCCACTATTTACTGGCTACACCCTTCACCCTACATGAGCTAAAGCCCACTTCGGAGTAATATTCTTTGGAGTCAACCTAACATTCTTCCCCCAACATTTCCTAGGCCTTGCTGGCATGCCACGACGATATTCAGACTACCCAGATGCTTATACCCTATGAAATACCCTATCCTCCATCGGCTCCCTCATCTCCATAGTAGCAGTAATTATACTAATATTTATTATCTGAGAAGCCTTCGCATCCAAACGAAAAGTTATACAACCAGAACTCACTTCCACAAACATTGAATGAATTCACGGCTGCCCTCCTCCATACCACACATTCGAAGAACCAGCTTTTGTTCAAGTG------CAAGAAAGGAAGGAATCGAACCCTCATAAGCTGGTTTCAAGCCAACCGC--AT-CAAACCACTCATGCTTCTTTCTT---AT----GGGCTGTTAGT-AAAACC-ATTACATAG-TCTTGTCAAGACTAAATCACAGGTGAAAACCCAGTACACCCCATCCTCCTCT----CCATGGCCAACCACTCTCAATTTGGTTTTCAAGACGCCTCCTCCCCTATTATAGAAGAACTTATTGAATTTCATGACCACGCCCTAATAGTTGCACTAGCCATCTGTAGCTTAGTTCTATACCTCCTAGCTCTTATACTGATAGAAAAACTTTCTTCCAATACTGTTGATGCACAAGAAGTAGAACTTGTCTGAACAATCCTACCTGCTATCGTCCTTATCATATTAGCCCTCCCATCCCTCCAAATCCTATACATGATAGACGAAATCGACGAACCTGACCTCACTCTCAAAGCTATCGGTCATCAATGATACTGATCCTATGAGTATACAGACTTCAAAGATCTATCTTTCGACTCTTACATGCTACCAACCACAGATCTACCACTCGGCCACTTCCGCCTTCTAGAAGTTGACAACCGCATCGTCATTCCAATAGAATCTCCAATTCGAATTATTATTACAGCCGATGACGTTCTCCACTCCTGAGCCGTACCTAGTCTTGGTGTAAAAACCGATGCAATTCCAGGACGACTAAACCAAACTTCTTTTATCACAACTCGCCCCGGAATCTTTTACGGGCAGTGCTCAGAAATCTGTGGAGCTAACCACAGCTTCATACCTATCGTAGTAGAATCAGCCCCCTTAGCACACTTCGAAAACTGATCCTCACTTC---TAACATCCT----------AATCATTAAGAAGCTATGAATCAGCACTAGCCTTTTAAGCTAGAGAAAGAGGATT-ATCCACCCTCCTTAATGATATGCCCCAGCTAAACCCTGCACCATGACTTTTTATTATACTAGCTTCATGACTCACCTTCTCCCTCATCCTCCAGCCTAAACTCTTACTATTCGCTCCAACCAACTCACCCTCCAACAAAA---CTCTGCCCACTACAAAACCCCACTCCTGAAACTGACCATGAACCTAAGCTTCTTCGATCAATTCATAAGCCCAACGCTTCTAGGTATCCCCCTTATCCTCATCTCACTATTATTCCCAACTCTTTTATTTCCTTCTCCTGGCAATCGATGAATCACCAATCGCCTTTCAACTCTCCAACTCTGATTCCTCCAGCTAGTCACAAAACAACTAATAACCCCATTAAACAAAAAAGGCCATAAATGAGCCTTAATCCTATCATCACTCATAATCATATTACTAACAATCAACCTCTTAGGCCTCTTACCTTACACATTTACGCCCACCACCCAACTATCAATAAACCTAGCCTTAGCCTTTCCCCTATGACTTGCCACCCTACTAACAGGCTTACGAAACCAACCTTCAGCTTCCCTAGGACACCTCTTACCAGAAGGTACCCCAACACCCCTAATCCCCGCCCTTATCATAATCGAAACAACAAGCCTCCTTATTCGCCCCTTAGCCCTAGGAGTCCGCCTCACAGCCAACCTCACAGCAGGACATCTACTCATCCAACTCATCTCAACAGCTACCACCGTCCTCCTTCCCATTATACCCGCCGTATCACTCCTAACCACAGTAATCCTCCTCCTCCTAACAATCCTAGAAGTAGCCGTAGCAATAATCCAAGCCTATGTCTTTGTACTTCTACTAAGTCTCTACTTACAAGAAAACATTTAACTC------CTAATGACACACCAAGCCCACTCCTTCCACATAGTAGACCCGAGCCCTTGACCCATCTTCGGAGCAACAGCTGCTCTCCTCACTACCTCAGGATTAGCCATATGATTTCACCATAACTCTATGCAACTCTTACTCCTAGGCCTACTTTCCACAATATTAGTAATAATTCAATGATGACGCGACATTGTACGAGAGAGCACATTCCAAGGCCACCATACCCCCACAGTCCAAAAAGGACTACGTTACGGAATAATCTTATTTATTACATCCGAAGCCTTCTTCTTCCTAGGATTCTTCTGAGCATTCTTCCACTCTAGCCTAGTCCCTACCCCAGAACTTGGAGGACAATGACCCCCTATAGGAATCAAACCCCTTAACCCAATAGAAGTTCCCCTACTAAACACTGCAATCCTCCTGGCCTCAGGAGTCACCGTCACATGAGCACACCACAGCATTACAGAAGGTAATCGAAACCAAGCTATCCAAGCTCTACTTATAACTGTCCTTCTAGGATTCTACTTCACAACACTCCAAGCAATAGAATATTATGAAGCCCCATTCTCAATTGCTGATGGAGTCTATGGCTCAACTTTCTTTGTAGCTACAGGATTCCACGGCCTTCACGTAATCATTGGATCATCTTTCCTCCTAATTTGCCTTTTCCGCCTTATCAAATTCCACTTCACACCCAACCATCACTTTGGCTTTGAAGCAGCGGCCTGATACTGACATTTCGTTGATATCATCTGACTATTCCTCTACATAACAATCTACTGATGAGGATCTTGCCCTTCTAGTATACTT-ATTACAATTGACTTCCAATCTCTAAAATCTGGATCAAAACCAGAGAAAGGCAATC---AACATAATCCTCTTTATACTTACAATCTCTTTATCACTATGCATTATCCTAATTATATTAAACCTTTGACTAGCTCAAATAAACCCTGACTCAGAAAAACTATCCCCATACGAATGCGGCTTTGATCCTCTAGGCTCTGCTCGTCTTCCATTTTCAATCCGATTTTTCCTCGTCGCAATCTTATTTCTTTTATTCGACCTAGAAATCGCCCTCTTACTTCCTCTCCCATGAGCTACCCAACTCTTCTCCCCTCTCACTACTCTGACCTGAACCTCCACCATTATTCTTCTCCTCACACTAGGATTAATCTATGAATGAATCCAAGGAGGTTTAGAATGAGCAGAATA----GCCTCAGAAAGTTAGTCTAGTAAAGACAGTTGATTTCGGCTCAACAAACCACAG-TCCCACTCCGTGACTTTCTCAATGACCTTTCTACATTTAAGTTTCTACTCAGCCTTCACCCTAAGCAGTCTAGGACTAGCCTTCCATCGCATGCACCTAATTTCCGCCCTACTATGCTTAGAAAGTATAATATTATCCATGTACATTGCCCTATCTATATGACCTATCCAAACCCAAATAACATCATCCGCCTTAATACCCATCCTCATACTAGCCTTCTCAGCCTGTGAAGCAGGCGCCGGTCTAGCAATCTTGGTAGCCTCCACCCGAACCCACGGATCTGATCAATTACACAACCTAAACCTTCTACAATGCTAAAAATTATTCTCCCCACAATTATACTACTCCCTATAACCTTCTTATCCCCCCCAAAATTTATATGACTTAATGCTACCTCCCACAGCCTCTTAATTGCGACAATTAGCTTGCAATGACTCTCTCCAACCTATTATCCTAGCAAAAATCTCTCCCAATGATTTAGCACTGATCAAATCTCATCCCCCTTGTTAGTATTATCTTGCTGACTTCTACCTCTTATAATCCTAGCAAGCCAAAACCACCTCCAACAAGAGCCCTACACACGAAAATGTATCTTTATTATAACTATAATCCTCACACAACCATTCATTATTATGGCCTTCTCAGCCTCAGAACTAATACTATTTTATATTACATTTGAAGCTACCCTAATCCCTACCTTAATCCTAATTACACGGTGAGGTAGCCAGCCAGAACGCTTAAGCGCTGGAATCTACCTTTTATTTTATACACTAATCAGCTCTCTTCCTCTACTAGTCGTAATCCTTTACCTTCACACCCAAACAGGAACTATACATATTACTATAATAAAACTTTCACACTCATCTCTCACAAACTCCTGAACAGGCCTTATATCAAGCTTAGCCTTACTACTTGCCTTTATAGTAAAAGCCCCCCTTTATGGATTACACTTATGACTCCCAAAAGCCCACGTAGAAGCCCCAATTGCAGGATCTATACTTCTAGCCGCACTACTCCTCAAACTTGGAGGGTATGGTATTATACGTGTTTCAATAATCACAATCTCCCTACTAGACTATCTTTACTACCCGTTCTTAACTCTAGCCCTATGGGGAGCACTAATAACAAGCTCCATCTGTCTGCGCCAAATTGACCTTAAATCATTGATTGCCTACTCCTCAGTAAGCCATATAGGTCTAGTCATTGCCGCAACAATAATCCAAACTCACTGATCCTTTTCAGGAGCTATAATCCTAATGATCTCACACGGACTTACTTCTTCCATACTATTCTGCCTAGCCAATACAAATTATGAGCGCATGCATAGCCGGACCCTTCTCCTAACACGAGGTCTACAACCCCTCTTACCCCTCATAGGAATCTGATGACTTCTAGCCAACCTAACTAACATAGCCCTTCCCCCTACCACTAATCTGATAGCCGAACTAACCATCATAATCGCACTCTTCAACTGATCCACCTTCACCATCATCCTAACCGGGATTGCAACCTTACTAACTGCAGCCTATACTTTATACATGCTCCTCATAACCCAGCGAGGACCAACCCCAGCATATATCACAACCATTCAAAACTCGAATTCACGAGAACATCTCCTTATAACACTCCATATCCTCCCCTCCTTCCTTCTCATCCTAAAACCAGAATTGATCTCAGGAATTCCCACAT-GCAAGCATAGTTT-TAA-ATCAAACATTAGACTGTGATCCTAAAAATAGAAGTTAAACCCTTCTTGCCTGCCGAGGGG-AGGTT-TAACCAACAAGAACTGCTAACTCTTGCATCTGAGTCTAA-AACCTCAGCCCCCTT--ACTTTTAAAGGATAACAGCAATCCACTGGTCTTAGGAGCCACCCATCTTGGTGCAAATCCAAGTAAAAGT--AATGGACTTCCCACTAATCCTCAACATCTCTATATTCTTAACCCTTCTAATTCTCTCTTCTCCCATTCTACTTCCCCTTCTATCCAAGAACTACCAGAACTCCCCCACCACAATTATACGTACTGTCAAAACTTCCTTCATAGCCAGTTTAATCCCCATAATTCTCTCTATCTACTCAAACATGGAAAACACCACCTTCTATTGAGAGTGAAAATTCATTACAAACTTTAAAATCCCCTTTAGCCTTAAAATAGATCAATACTCCTTAATATTTTTTCCCATTGCACTATTCGTGACATGATCCATTCTTCAATTCGCAGTATGATACATAGCATCAGAACCTTATACCACAAAGTTTTCTCTTTTCCTCCTAATCTTCCTCATCGCCATGCTCATCCTAATTATCGCTAACAATATATTTCTCTTATTCATTGGCTGAGAAGGAGTCGGAATTATATCCTTCCTCCTAATTGGGTGATGACATGGTCGAGCAGAAGCTAACACCGCTGCGCTTCAAGCCGTACTCTACAACCGTATTGGAGATATTGGATTAATTCTCTGCATAGCCTGACTAGCTTCCTCCATAAATACCTGAGAAATCCAACAACATTCATCTACAAACCAAACGCCTCTTCTCCCACTCATAGGACTTATTCTAGCAGCCACAGGAAAATCCGCCCAATTTGGTCTCCACCCATGACTCCCGGCCGCTATAGAAGGGCCCACCCCTGTATCCGCCCTACTTCACTCCAGCACCATAGTAGTCGCCGGAATCTTCCTTCTTATTCGCACTCACCATATACTGTGTAATAACCAAATCGCCCTAACTACGTGCCTTTGTATAGGTGCTCTATCCACACTATTCGCCGCTACATGCGCACTTACCCAAAACGACATCAAAAAAATTATCGCTTTCTCGACATCCAGCCAACTAGGCCTGATAATAGTCACAATTGGCCTAAACCTCCCCCAACTAGCTTTCCTACACATCTCAACCCATGCATTCTTTAAAGCTATACTCTTTCTTTGCTCTGGATCTATTATCCATAGTCTTAATGGAGAACAAGATCTCCGAAAAATAGGAGGATTGCAAAAACTACTCCCCACAACCACCTCATGTCTAACAATTGGGAATCTAGCCCTCATAGGGACACCATTCTTAGCAGGGTTCTACTCAAAAGATCTCATTATCGAAAACCTTAACATATCCTACTTAAACACCTGAGCACTCCTCCTCACCCTCATTGCAACCTCATTCACCGCAACTTACAGCCTACGTATAGCCCTACTAGTACAGACTAACTACACTCGAATTCCTTCCATCACCCCTATCAATGAAAACAATCCAGCAATCACAAACCCAATTACCCGTCTTGCTCTCGGAAGCATCATAGCTGGACTACTAATTACCTCTTATATTCCCC---CTACAAAAACTCCTCCCATAACCATGCCACTAGCCACAAAAACCACAGCTATCATTATCACAACACTAGGTATTATCCTAGCCCTAGAATTATCAAAACTCACACACACCCTCACCACCCCCAAACAAAATGTGGCCTTAAACTTCTCCAACACCCTAGGATATTTTAACCCCCTCATACACCGCCTTAGCTCAACTAAACTCTTAAACAATGGCCAAAACATTGCATCTCACCTAATCGACCTATCCTGATATAAAAAAATAGGCCCAGAAGGATTAGCAACCCTTCAACTCAAAGCATCCAAAATCTCAACCACTCTCCACACCGGATTAATCAAAACCTATCTAGGATCCTTCGCCCTATCCATCCTAACCATTATTT---TATTTACA--CAGAACTAAGAAT-T---AATGGCCCCCAACCTACGAAAACACCACCCCCTCCTAAAAATAATCAACAATTCTTTAATTGATCTCCCAACGCCACCAAACATTTCTGCCTGATGAAACTTTGGATCTCTCCTAGGCATCTGCCTAATAATTCAAATTATTACCGGTCTTCTACTAGCAATACACTATACCGCAGATATCACTCTAGCTTTCACATCCGTCGCCCATACATGTCGAAATGTCCAATTCGGTTGACTAATTCGCAATCTGCACGCAAACGGTGCCTCTTTCTTCTTCATATGCATTTATATACACATTGGACGAGGGTTCTATTATGGTTCTTACCTATATAAAGAGACCTGAAACACGGGAGTCGTCCTCCTCCTAACCTTAATAGCAACTGCCTTCGTAGGATACGTTCTCCCATGAGGCCAAATATCCTTCTGAGGTGCTACAGTAATTACTAATCTATTCTCAGCTATCCCCTATATTGGCCAAACACTCGTAGAGTGAGCTTGAGGAGGATTCTCGGTTGATAACCCTACACTCACTCGATTCTTCGCCCTCCACTTTCTCCTCCCATTTTTAATTGCAGGCCTCACCTTTATTCACCTAACTTTCTTGCATGAGACAGGCTCAAACAACCCCCTAGGCATCCACTCAGACTGTGACAAAATTCCATTCCACCCTTACTTCTCAATAAAAGACGTCTTAGGCCTTCTGTTTCTCCTCATTCCACTAATGATCCTTGCTATATTCTCACCTAACCTTTTAGGAGACCCAGAAAACTTCACACCCGCAAATCCGCTAGTTACACCTCCTCATATCAAACCTGAATGATACTTCCTATTCGCATATGCCATCTTACGATCAATTCCTAACAAACTAGGAGGAGTTTTAGCCCTCGCCGCCTCCGTATTAATTCTGTTTTTAGCCCCATTCCTCCACGTCTCAAAACAACGAACAATAACCTTCCGACCCTTCTCCCAATTTCTATTTTGAATCCTAGTAGCAAACCTTTTAATCCTTACATGAATCGGTAGCCAACCAGTCGAACATCCATTTATCATCATCGGACAGCTCGCCTCAACTGCCTACTTCACAATCATTCTCATCCTATTCCCCATTACAAGTCTTCTAGAAAACAAGATACTTAATCT----------CTA-ACT------------ACTCTAATAGTTTATAAAAAACATTGGTCTTGTAAACCAAAGATTGAAGGCCAC-CCCCTTCTTAGAGTT Leucosticte_arctoa GTTCTTGTAGCTTATAG-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGAAGCCCTGGAAA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTACTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TCGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTAACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGTTCACCCACC--CTGAAGGCCAAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GG-AGTAATGGGCTACATTTTCTAGACTAGAACA-C-----ACGGCAAAGGGGTATGAAACAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG----CCCCCCCCCCCAATAAACTAATAAGCCAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGCTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACATCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--TC-ATA-CACCC----AACTAAAGCATT---C--ACCAGT-CCCAGTATAGGCGATAGAAAAGACA-CCT-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAATG-AAATAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--CTTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGCACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AGT--ACCAAC-CT-TCCAAT-TATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-CATACAAAAATATAAG-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-CTACCA-ATATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATTA-AGTACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAGCACGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACAGTAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTATAT-CACATA----TT-CACCCA--C-T-GGGTTCACTGAC-ACA-TAA-GA-C-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTGCAG-GCAAGCCTCC-GCTTTAAGTAATGAAATCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---AG-----ATCACC--C----ATGAC----------CAACTACCCCCTACTAATTAACTTTATCATAGCCCTCTCCTACGCCCTACCAATCTTAATTGCAGTGGCCTTTCTCACACTAGTAGAACGCAAAATTCTAAGCTACATGCAAAGCCGAAAAGGCCCTAACATCGTAGGCCCATATGGCCTACTGCAACCACTGGCAGACGGAGTAAAACTATTCATCAAAGAACCCATTCGAC---------CATCAACATCCTCCCCACTCCTATTTATTGCAACCCCAATACTAGCCCTACTCCTAGCAATCTCCATCTGAACTCCACTCCCCCTACCCTTTTCACTAGCAGACCTCAACCTAGGCTTACTGTTCCTACTAGCCATATCAAGCCTAGCGGTCTACTCCATCTTATGGTCCGGCTGAGCCTCCAACTCAAAATACGCATTAATTGGTGCACTACGAGCAGTAGCCCAAACAATCTCATATGAAGTGACCTTAGCAATCATCCTCTTATCCGTCGTCATCCTTAGCGGTAACTACACCCTCAGCACCCTTGCAGTGACTCAAGAACCCTTATACCTCATTTTCTCATGTTGACCCTTAGCCATAATATGATATGTTTCTACACTTGCTGAAACCAATCGAGCCCCCTTTGATCTCACAGAGGGAGAGTCCGAATTAGTTTCCGGGTTTAACGTAGAATACGCAGCAGGCCCATTTGCACTATTCTTCTTAGCCGAATACGCCAATATTATGCTCATAAACACTATCACTACCATTCTGTTCTTTAACCCTAGCCTACTAAACCCTCCCCAAGAACTATTTCCTGTAGTACTAGCTACAAAAGTACTGCTACTATCAGCCGGGTTTCTATGAATTCGAGCTTCCTACCCACGATTTCGATACGACCAATTAATACACCTACTATGAAAAAACTTCCTACCACTTACACTCGCTCTATGCCTCTGACATGTCAGCTTACCGATCTGCTACGCGGGACTTCCC-----CCTTACTTA-T--AGACT-----------TCTCCGGAAATGTGCCTGAATAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAACCCTCTCATTTCCT-A--AATC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTTGTAACTAGCCTACTTCTGGGAACCACCATCACAATCTCAAGCAACCACTGAATCA---TAGCCTGAGCCGGCCTAGAAATCAACACACTCGCCATCTTACCATTAATCTCAAAGTCCCATCACCCACGATCCATTGAAGCAGCCACAAAATATTTTCTAACCCAATCAGCCGCCTCGGCCCTAGTACTATTCTCCAGCATAACTAACGCATGGCACACCGGTCAATGAGACATTACTCAATTATCCCACCCAACATCTAGTCTAATCCTCACCTCAGCAATCGCAATAAAACTAGGCTTAGTCCCATTCCACTTCTGATTCCCGGAAGTACTACAAGGCTCTCCTCTCTCAACTGGCCTCCTCCTATCTACCGTCATAAAACTCCCCCCAATTACCCTCCTATACATAACCTCCTCAGCACTGAACCCCACCCTACTAACTATCCTAGCCATCCTCTCAGCAGCCCTAGGAGGATGAATGGGCCTGAACCAAACACAAATCCGAAAAATCTTAGCTTTCTCTTCTATCTCCCACCTAGGATGAATAGCAATCATTATTGCCTACAACCCTAAACTTACCCTACTTAACTTCTACCTATACACTATAATAACCGCAACCGTCTTTCTAGCCCTGAACTCAATTAAAGTACTAAAACTATCTACCCTAATAACTGCATGAACTAAAGTCCCATCCCTAAACGCAGTCCTGCTTCTAACCCTACTATCCCTAGCAGGACTACC?CCCCTAACAGGGTTCCTCCCTAAATGACTTATCATCCAAGAACTAACCAAACAAGAAATAATCCCCGCAGCCACACTTATATCCCTCCTCTCACTACTAAGCCTGTTCTTCTACCTTCGCCTAGCATACTGCACAACAATCACACTCCCACCACACACCACAAACCACATAAAACAATGGCGCACTGGCAAATCAACCAGTATCCTAATTGCCATCCTGGCCACAATATCCATCACCCTTCTTCCTATTTCACCTATGATTCTCACTGCCAT------CT----AAGAAGCTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAGACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGATGTTATCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTC-A--CAG-TTTACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTATCC-AACAGGCCTCTGCCT-A-------------AGACTCCGGCGCATAA-TTAATGCACATCAATGAGCTTGCAACCCATTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGACTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATTTTTGGCGCATGAGCTGGAATAGTAGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGACAGCCTGGAGCCCTCCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCACGCTTTCGTAATAATCTTCTTCATAGTTATGCCAATCATAATCGGTGGCTTCGGAAACTGACTAGTGCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGGATAAACAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTGCTACTGCTAGCATCCTCCACGGTTGAAGCAGGAGTGGGCACAGGCTGAACAGTATACCCCCCATTAGCTGGTAACCTAGCGCATGCTGGAGCTTCCGTCGACCTTGCAATCTTCTCCCTGCACTTAGCCGGTATCTCCTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATCAATATAAAACCCCCAGCCCTATCACAATACCAAAC?CCCCTATTCGTCTGATCCGTCCTAATCACCGCAGTCCTACTACTCCTCTCCCTTCCCGTCCTCGCCGCAGGAATCACAATGCTCCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTTCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATTCTACCAGGATTCGGAATTATTTCTCACGTTGTAACCTACTACGCAGGGAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATGCTATCCATCGGATTCCTAGGGTTTATCGTATGAGCCCACCACATATTCACAGTCGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATTATTGCTATTCCAACCGGAATTAAAGTATTCAGCTGACTAGCAACACTACACGGAGGCACAATCAAATGAGACCCTCCAATACTATGAGCCTTAGGGTTCATCTTCCTATTCACAATCGGAGGACTAACAGGAATCGTCCTAGCAAACTCCTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCCCATTTCCACTATGTCCTATCAATAGGAGCAGTGTTCGCAATCCTAGCAGGCTTCACACACTGATTCCCCCTATTCACCGGATACACCCTCCACTCAACATGAGCCAAAACCCACTTCGGTGTGATATTCGTAGGTGTAAATCTAACCTTCTTCCCACAACACTTCCTAGGCCTAGCTGGCATGCCACGACGATACTCAGACTACCCCGATGCCTACACTCTATGAAACACCATCTCCTCAGTAGGCTCACTCATCTCCCTGACAGCCGTAATCATACTGGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTAGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGACGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAAGTTAAACCCTTGCACGCCTCTT---CACCT--AAACATGGCCAACCACTCACAACTTAATTTCCAAGACGCCTCCTCCCCAATCATGGAAGAACTAATAGGATTCCATGATCACGCCCTAATGATTGCATTAGCAATCTGTAGCCTAGTACTCTACCTGTTAACACACATACTCACAGAAAAACTATCTTCAAGCACAGTAAACGCACAAGAAATTGAACTCGTATGAACAATCCTACCAGCTATAGTCCTAGTTACACTTGCCCTTCCATCCCTACGAATCCTATACATAATAGACGAAATCAACGAACCCGACCTGACCCTAAAAGCCATCGGCCACCAATGATACTGGACATACGAATACACCGACCTTAAAGACCTCACATTCGACTCCTACATAATCCCAACATCAGACCTACCCCTAGGACACTTCCGATTACTAGAAGTCGACCACCGCGTTGTAGTCCCTATAAGCTCCACAATCCGAGTAATCGTTACTGCCGACGACGTACTACACTCATGAGCCGTCCCAAGCCTAGGTGTAAAAACTGACGCAATCCCAGGTCGCCTCAACCAAACCTCCTTCCTTGCCTCACGACCCGGAGTTTTCTACGGACAATGCTCAGAAATTTGTGGAGCTAACCACAGCTTCATACCAATTGTGGTAGAATCCACCCCCCTCGCTAATTTCGAAAGCTGATCCTCTCTAG---CATCCTCCT----------AATCATTAAGAAGCTATGAACCAGCGTTAGCCTTTTAAGCTAAAGAAAGAGGACT-GCA-CCCCTCCTTAATGACATGCCTCAACTAAACCCCGCACCCTGATTTTTTATCATGATCATTTCATGACTCACTTTTTCCCTTATCATTCAACCTAAACTCCTATCATTCGTAACAATAAACCCCCCATCCAGCAAAC---CCCCTACCACCCCAAACACCACCCCTTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCCTCCCTCCTTGGCATCCCACTCATCCTCATCTCAATAACATTCCCAGCCCTTCTGATCCCCTCCCTGGACAACCGATGGATCACCAACCGACTCTCAACCCTCCAACTATGGTTCGTCAACCTAATCACAAAGCAACTAATAATACCCCTAGACAAAAAAGGACACAAATGAGCTCTAATCCTGACATCCCTAATAATCTTCCTCTTACTCATTAACCTCCTGGGCCTACTACCATATACATTCACCCCAACCACCCAACTATCTATAAACCTAGCCCTGGCCTTCCCCCTATGGCTTGCTACACTACTGACGGGACTACGAAACCAACCATCTGCCTCACTAGGACATCTACTTCCAGAAGGCACTCCAACCCCATTAATTCCCGCCCTAATCCTAATCGAAACAACAAGCCTACTCATCCGCCCACTAGCTCTAGGAGTACGCCTAACAGCCAACCTCACAGCAGGACACCTACTCATTCAACTCATCTCCACAGCCACAATAGCCCTGTCCTCCACAATACCAGCAGTTTCACTACTAACTTTCCTGGTCCTACTCCTGCTAACCGTCCTAGAAGTAGCAGTAGCAATAATCCAAGCCTATGTGTTCGTACTTCTACTAAGCCTTTATTTACAAGAAAATATCTAACAA--CC--CCAATGGCACACCAAGCACATTCTTACCACATAGTAGACCCAAGCCCATGACCTATTCTAGGCGCTGCCGCCGCTCTCCTAACCACCTCAGGATTAACAATATGATTCCACTACAACTCCCCCAAACTGCTTATCCTAGGCTTACTCTCCACTGCCCTAGTCATATTCCAATGATGACGCGACATCATCCGAGAAAGCACATTCCAAGGCCACCATACCCCCACTGTACAAAAAGGATTGCGATACGGAATGGCCCTATTCATCACATCCGAAGCCTTCTTCTTTCTAGGCTTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCCACCCCAGAGCTAGGAGGACAATGACCACCTGTAGGAATCAAACCCCTAAACCCCATAGAAGTCCCACTACTAAACACTGCCATCCTCTTAGCCTCCGGAGTCACCGTGACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATTCAAGCCCTCATCCTAACAGTTCTCCTAGGGTTCTACTTCACTGCACTACAGGCCATAGAATACTACGAAGCACCATTCTCCATCGCAGATGGAATCTACGGCTCTACCTTCTTCGTCGCTACCGGATTCCACGGCTTACACGTAATCATCGGCTCAACATTCCTCCTAGTATGCCTTCTACGTCTAATCAAATACCACTTCACATCAGGCCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTTTACATCTCTATCTATTGATGAGGTTCATACTCTTCTAGTATATCC-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTGTTCATATTAACCCTATCACTCACCCTAAGCATCCTACTAACTATCCTAAACTTTTGACTCGCCCAAATAAACCCAGACTCAGAAAAACTATCCCCATATGAATGCGGATTCGATCCCCTAGGATCCGCTCGACTCCCATTTTCAATTCGATTCTTCCTAGTAGCCATCTTATTCCTCCTGTTCGACCTAGAAATCGCTCTACTACTCCCACTGCCATGGGCCATCCAACTAGAATCCCCCACCACTACTCTAATCTGAACTTCCTTCCTGCTTCTTATCCTAACATTAGGGTTAATCTACGAATGAATCCAAGGAGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTCATGTCCTACCTGCACCTTAGCTTTTACTCAGCCTTCACCCTAAGCAGCCTAGGCCTAGCTTTCCACCGAACCCACTTAATCTCCGCCCTACTATGTTTAGAGAGCATGATACTATCCATATACGTAGCCCTCGCCATATGACCCATCCAAATACAATCACCATCCTCCACCATCCTACCAATTATCATACTAACATTCTCCGCCTGCGAAGCAGGCACAGGCTTAGCCCTACTGGTAGCCTCCACCCGGACCCACGGCTCCGACCACCTCCACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACTGCAACACTACTACCCCTAGCCCTCATGTCTCCACTTAAACACCTATGAACCAACATTACTCTACATGGCCTACTCATTGCAACCGTCAGCCTACAATGACTAACCCCCACATACTACCCAAGCAAAGGCCTGACCCCCTGATCATCAATCGACCAAATCTCTTCCCCCCTCCTAGTTCTGTCATGCTGGCTCCTCCCTCTCATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCTACCATTCGTAAACGAATCTTCGCCGCAACAGTAGTCCTGGCTCAACTATTCATCCTCCTAGCCTTCTCAGCCTCCGAACTAATACTCTTCTACATCTCATTCGAAGCAACTCTCATCCCCACCCTCATCCTCATCACACGATGAGGGAATCAACCAGAACGACTAAATGCTGGCATTTACCTCCTATTCTACACCTTGGCCAGCTCACTCCCCCTACTAATTGCCATCTTACACCTACAAAACCTAATCGGCACACTATACCTACCCATACTAAAACTATCACACCCTACGCTAAACACTTCCTGATCCGGACTCATCGCAAGCCTAGCACTACTACTAGCCTTCATAGTTAAAGCCCCCCTATACGGCCTACACTTATGATTACCAAAAGCCCACGTAGAAGCACCAATCGCCGGCTCCATACTACTAGCCGCCCTACTTCTAAAACTAGGAGGCTACGGCATCATACGAATCACAATTCTAGTAAACCCAGCATCAAACAACCTGCACTATCCATTCATCACCCTAGCTCTCTGAGGGGCCCTAATAACTAGTGCCATCTGCCTACGACAAATTGACCTGAAATCACTAATCGCCTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCTGCAACCATAATCCAAACCCAATGAGCATTCTCGGGAGCAATAATCCTAATAATCTCACACGGCCTAACCTCCTCAATACTATTCTGTCTAGCCAACACCAACTATGAACGAACCCACAGCCGAATCCTTCTACTCACACGAGGACTCCAACCTCTCCTGCCACTAATAGCCACCTGATGACTCCTAGCCAACCTCACAAACATAGCTCTCCCTCCAACAACGAACCTCATAGCAGAATTAACCATTGTAGTTGCACTATTCAACTGATCAGCCTTCACAATCATCCTAACAGGAGCAGCAATCCTGCTCACCGCCTCATACACTTTATACATGCTCACAATAACACAACGAGGCCCACTTCCATCCCACATCACCTCAATCCAAAACTCCTCCACCCGAGAACACCTCCTCATGGCTCTTCACATAATCCCCATGCTACTCCTAATCCTCAAACCCGAACTAATCTCCGGAGTCCCTATAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGGCTGTGATCCTAAAAATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTC-AAACCAACAGGAACTGCTAACTCTTGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGATCAAGCACTAATCCTAAATACCTTTATACTCCTGACCCTAACAACTCTATTTACCCCCATCCTATTCCCTCTCCTAGTCCCCAACTTCAAGAACACCCCAAATTCAATCACAAACACAGTCAAAACATCCTTCCTAATCAGCCTTGTCCCTATAACAATCCACATCTACTCCGGGACAGAAAGCCTAACTTCCCTATGGGAATGAAAATTTATCATGAACTTTAAAATCCCCATTAGCCTAAAAATAGACTTCTACTCGCTAACCTTTTTCCCAATCGCATTATTCGTATCATGGTCTATTCTACAATTCGCAACATGATACATAGCCTCAGATCCCTACATCACAAAATTCTTCACCTATCTGCTATTCTTCCTAATAGCAATACTCATCCTAATCATCGCTAACAACTTATTCGTCCTATTTATCGGCTGAGAAGGGGTAGGGATTATATCCTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTCCAAGCCGTACTATACAACCGAGTAGGAGACGTAGGACTTATCCTCTGCATAGCATGACTAGCCTCTGCCATAAACACCTGAGAAATCCACCAACTTTCATCTCCATCCCAAACCCCAACACTACCCCTGCTAGGCCTCATCCTGGCTGCAACAGGTAAATCAGCCCAATTCGGCCTACACCCATGACTCCCAGCTGCCATAGAAGGCCCCACCCCCGTATCAGCCCTGCTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCCCTATTCAGCAACAACCAAACCGCCCTAACCCTCTGCCTATGTCTAGGAGCTATCTCCACCCTATTCGCAGCCACATGTGCCCTCACCCAAAACGACATTAAAAAAATCATTGCCTTCTCCACCTCAAGCCAACTAGGACTAATAATAGTTACAATCGGACTAAACCTCCCCGAACTAGCCTTCCTCCACATTTCAACCCACGCATTCTTCAAAGCCATGCTCTTCCTGTGCTCAGGATCCATCATCCACAACCTAAACGGTGAACAAGACATCCGAAAAATAGGAGGTCTCCAAAAAATAATACCCACAACCACCTCATGTCTCACTATCGGTAACCTAGCCCTAATAGGGACGCCATTCCTAGCAGGCTTCTACTCAAAAGACCAAATTATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCCCTCCTGCTAACACTACTAGCCACATCATTCACTGCAGTTTACACAATCCGTATAACCGTACTAGTACAGACCGGCTTCGTCCGAATTCCCCCTATAACCCCAATAAATGAAAATAACCCCGCAGTAACCTCACCCATCACTCGACTTGCACTAGGAAGCATCCTAGCAGGATTCCTCATCACCTCCTTCATCATCC---CAACAAAAACCCCCACAATAACTATACCCCTCTCCATCAAAATAACAGCCCTGATAGTAACCGCCCTAGGAATTGCCCTAGCCCTAGAAATCTCAAAAATATCCCAAACCCTAATCCTCACAAAACAAACTACACTATCAAACTTCTCCACCTCCCTAGGATATTTCAACCACCTGACTCATCGCCTAAGCATATCTAACTTCCTCAGCGGGGGACAAAACATTGCCTCACATCTAATCGACCTATCCTGATTCAAAACCATTGGCCCAGAAGGACTAGCCCACCTACAACTAATAGCAACCAAAACCGCAACCTCTCTTCACTCTGGCCTAATCAAGGCCTACCTAGGAGCATTTGCTCTATCCATCATCATCATCCTTA---TATCTATACACAGAAT--AGA-C-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAATGACGCCCTAATTGACCTGCCCACACCATCAAACATCTCAACATGGTGAAACTTCGGGTCTCTTCTGGGTATTTGCTTAATCACTCAAATCGTTACCGGTCTACTGCTAGCCATACACTACACAGCAGACACCAACCTAGCCTTCTCCTCCGTAGCCCACATATGCCGTGACGTCCAATTCGGCTGACTAATCCGCAACCTCCATGCAAACGGCGCCTCCTTCTTCTTCATCTGCATCTACCTTCACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTCATTCTCCTTCTAACCCTCATAGCAACAGCCTTTGTAGGATACGTCCTGCCATGAGGACAAATATCATTCTGAGGCGCTACAGTCATCACAAACCTATTCTCAGCAATCCCGTACATCGGACAAACACTAGTAGAATGAGCCTGGGGAGGATTCTCCGTCGACAACCCCACTCTAACCCGATTCTTCGCACTCCACTTCCTACTCCCATTCGTCATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTACATGAAACAGGATCAAACAACCCAACAGGAGTACCCTCAGACTGCGACAAAATCCCATTCCACCCATACTACACTGTAAAAGACATCCTGGGCTTCGCACTAATAATCGCCCTACTCGTCTCCCTAGCCCTATTCTCCCCTAACATATTAGGAGACCCAGAAAACTTCACACCAGCCAACCCCCTAGTCACACCCCCACACATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCTATCCCAAACAAACTAGGAGGCGTACTAGCCCTAGCCGCCTCAATCCTTGTACTATTCCTAATGCCCCTACTCCACACATCAAAACTACGATCAATAACCTTCCGTCCCATCTCCCAAATCCTATTCTGAGCCCTAGTTGCAAACGTCCTAATCCTGACATGGGTGGGAAGCCAACCAGTAGAACACCCGTTCATCATCATCGGCCAACTAGCCTCACTCACCTACTTCACAATCATTCTAGTCCTTTTCCCTCTCGCAGCCGCACTAGAAAATAAAATACTGAAACT----------CTA-ATC-----------AACTCTAATAGTTTATT-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGAATAAACCCCTTCTTAGAGTT Leucosticte_brandti GTTCTTGTAGCTTATAG-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGAAGCCCTGGAAA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTACTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGATTAAAAAGCAGCTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TCGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAA--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTAACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGTTCACCCACC--CTGAAGGCCAAACAGTGAGCGCAATAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GG-AGTAATGGGCTACATTTTCTAGACTAGAACA-C-----ACGGCAAAGGGGTATGAAACAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG----CCCCCCCCCCCCATAAACTAATAAGCCAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGCTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGTTA-ACATCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--TC-ATA-CACCC----AACTAAAGCATT---C--ACCAGT-CCTAGTATAGGCGATAGAAAAGACA-CCT-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAAAC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--CTTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGCACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AGT--ACTAAC-CT-TCCAAT-TATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-CATACAAAAATATAAG-AACAATATGACTCCCT-CATCATTAACAGGCTAACCTATATTCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-CCACCA-ATATACGA--TAAAT---------CAA---ACAAGCA-GAG-TATTA-AGTACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAGCACGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACAGTAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAT-CACATA----CT-CACCCA--C-T-GGGTTCACTGAC-ACA-TAA-GT-C-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCGCAG-GCAAGCCTCC-GCTTTAAGTAATGAAATCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CATCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAAATCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---AG-----ATCACC--C----ATGGC----------CAACTACCCCCTACTAATTAGTTTTATCATAGCCCTCTCCTACGCCCTACCAATCTTAATTGCAGTGGCCTTTCTCACACTAGTAGAACGCAAAATTCTAAGCTACATGCAAAGCCGAAAAGGCCCTAACATCGTAGGCCCATACGGCCTGCTACAACCACTGGCAGACGGAGTAAAACTATTCATCAAAGAACCCATTCGAC---------CATCAACATCCTCCCCACTCCTATTCATTGCAACCCCAATACTAGCCCTACTCCTAGCAATCTCTATCTGAACCCCACTCCCCCTGCCCTTTTCACTAGCAGACCTCAACCTAGGCCTACTATTTCTACTAGCTATATCAAGCCTAGCAGTCTACTCCATCCTATGGTCCGGCTGGGCCTCCAACTCAAAATACGCATTAATTGGTGCACTACGCGCAGTAGCCCAAACAATCTCATATGAAGTGACTTTAGCAATTATCCTCCTATCCGTCGTCATCCTTAGTGGTAACTACACCCTCAGCACCCTTGCAGTGACTCAAGAGCCCCTATACCTCATTTTCTCATGTTGACCCTTAGCCATAATATGGTATGTTTCTACACTTGCTGAAACCAATCGCGCCCCCTTTGATCTCACAGAAGGAGAGTCCGAATTAGTTTCCGGGTTTAACGTAGAATACGCAGCAGGCCCATTCGCACTATTCTTCTTAGCCGAATACGCCAATATCATACTCATAAACACTATTACTACCATTCTATTCTTCAACCCTAGCCTACTAAACCCTCCCCAAGAACTATTTCCCGTAGTACTAGCTACAAAAGTACTACTACTGTCAGCTGGATTCCTGTGAATTCGAGCTTCCTACCCACGATTCCGATACGACCAATTAATGCACCTACTATGAAAAAACTTCCTACCACTTACACTCGCCCTGTGCCTCTGACACGTCAGCTTACCTATCTGCTACGCGGGACTTCCC-----CCTTACTTA-T--AGGCT-----------TCCCCGGAAATGTGCCTGAACAC-C--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAACCCTCTCATTTCCT-A--AAAC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTTGTAGCCAGCCTGCTTCTAGGAACCACCATCACAATCTCAAGCAACCACTGAATCA---CAGCCTGAGCCGGCCTAGAAATCAATACACTTGCCATCTTACCATTAATCTCAAAATCTCATCACCCACGATCCATCGAGGCAGCCACAAAATATTTTCTAACCCAATCAGCTGCCTCAGCCCTAGTACTATTCTCCAGCATAACTAACGCATGGCACACCGGACAATGAGACATTACTCAACTATCCCACCCAACATCTAGTCTAATCCTTACCTCAGCAATCGCAATAAAACTAGGCTTAGTCCCATTCCACTTCTGATTCCCGGAAGTACTACAAGGCTCTCCTCTCTCAACCGGCCTTCTCCTATCTACCATCATAAAACTCCCCCCAATTACCCTCCTATACATAACCTCCTCAGCACTAAACCCCACCCTACTAACTATCCTAGCCATCCTCTCAGCAGGCCTAGGAGGATGAATGGGCCTGAACCAAACACAAATCCGAAAAATCCTAGCTTTCTCCTCTATCTCCCACCTAGGATGGATAGCGATCATTATCGTCTACAACCCTAAACTCACCCTACTTAACTTCTACCTATACACTATAATAACCGCAACCGTCTTTCTAGCCCTAAACTCAATTAAAGTGCTAAAACTATCTACCCTAATAACTGCATGGACTAAAGTCCCATCACTGAACGCAGCCCTGCTTCTAACCCTACTGTCCCTAGCAGGACTCCCTCCCCTAACAGGGTTCCTCCCCAAATGACTTATCATCCAAGAACTAACCAAACAAGAAATAATCCCCGCAGCCACACTTATATCCCTCCTCTCACTACTAAGCCTATTCTTCTACCTTCGCCTAGCATACTGCACAACAATCACACTCCCACCACACACCACAAACCACATAAAACAATGACGCACTGGCAAATCAACCAATATCCTAATTGCCATCCTGACCACAATATCCATCACCCTTCTTCCTATTTCACCTATGATTCTCACTACTAT------TT----AAGAAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGATGTTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTC-A--AAG-TTTACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTATCC-AACAGGCCTCTGCCT-A-------------AGACTCCGGCGCATAA-TTAATGCACATCAACGAGCTTGCAACTCATTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGACTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATTTTTGGCGCATGAGCTGGAATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGACAACCTGGAGCCCTCCTAGGAGACGACCAGGTCTACAACGTAGTTGTCACAGCTCACGCTTTCGTAATAATCTTCTTCATAGTTATGCCAATCATAATCGGTGGTTTCGGAAACTGACTAGTACCACTGATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCTCCATCCTTCCTACTACTACTAGCATCCTCCACAGTTGAAGCAGGAGTAGGTACAGGCTGAACAGTATACCCCCCATTAGCCGGCAACCTAGCACACGCTGGAGCTTCCGTCGACCTTGCAATCTTCTCCCTCCACTTAGCCGGTATCTCCTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACCGCAGTCCTACTACTCCTCTCCCTTCCCGTCCTAGCCGCAGGAATCACAATGCTCCTCACAGACCGTAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTTCTGTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATTCTACCAGGATTCGGAATTATCTCTCATGTTGTAACCTACTACGCAGG?AAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATGCTATCCATCGGATTCCTAGGATTTATTGTATGAGCCCACCACATATTCACAGTCGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCTATTCCAACCGGAATTAAAGTATTCAGCTGACTGGCAACACTACACGGAGGCACAATCAAATGAGACCCCCCAATACTGTGAGCCCTAGGATTCATCTTCCTATTCACAATCGGAGGATTAACAGGAATCGTCCTAGCAAACTCCTCACTAGACATCGCCCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGGGCAGTGTTCGCAATCCTAGCAGGCTTCACACACTGATTCCCCCTATTCACCGGATATACCCTCCACTCAACATGAGCCAAAACCCACTTCGGTGTAATATTCGTAGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCCGATGCCTACACTCTATGAAACACCATCTCCTCAGTAGGTTCACTCATCTCCCTGACAGCCGTAATCATGCTAGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCTGCCTTCGTTCAGGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGACGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAAGTTAAACTCTTGCACGCCTCTT---CACCC--AAACATGGCCAACCACTCACAACTTAACTTCCAAGACGCTTCCTCCCCAATCATGGAAGAACTAATAGGATTCCATGATCACGCCCTAATAATTGCATTAGCAATTTGCAGCCTAGTACTCTACCTGTTAACTCACATACTCACGGAAAAACTATCATCAAGCACAGTAAATGCACAAGAAATTGAACTCGTATGGACAATCCTACCAGCCATAGTCCTAGTCACACTTGCCCTTCCATCCCTACGAATCCTATACATAATAGACGAAATCAATGAACCCGACCTAACCCTAAAAGCCATCGGCCACCAATGATACTGAACATACGAATACACCGACCTTAAAGACCTCACATTCGACTCCTACATAATCCCAACATCAGACCTACCCCTAGGACATTTCCGATTACTAGAAGTCGACCACCGCGTTGTAGTTCCTATAAGCTCCACAATTCGAGTAATCGTCACTGCCGACGACGTACTGCACTCATGAGCCGTCCCAAGCCTAGGCGTAAAAACTGACGCAATCCCAGGTCGCCTCAACCAAACCTCATTCCTTGCCTCACGACCCGGAGTCTTCTACGGACAATGCTCAGAAATTTGTGGGGCTAACCACAGCTTCATACCAATCGTGGTAGAATCCACCCCCCTCGCTAATTTCGAAAGCTGATCCTCTCTAA---TATCCTCCT----------AATCATTAAGAAGCTATGAACCAGCGTTAGCCTTTTAAGCTAAAGAAAGAGGGCT-ACA-CCCCTCCTTAATGACATGCCTCAACTAAATCCCGCACCCTGATTTTTTATCATGATCATTTCATGACTCACTTTTTCCCTTATCATTCAACCTAAACTCCTATCATTCGTAACAATAAACCCTCCATCCAGCAAAC---CCCCTACTGCCCCAAACACCACCCCCTGAACCTGACCATGAACCTAAGCTTCTTTGACCAATTCTCAAGTCCCTCCTTCCTTGGCATCCCACTCATCCTCATCTCAATAACATTCCCAGCCCTCCTAATCCCCTCTCTAGACAACCGGTGAATCACCAACCGGCTCTCAACCCTCCAACTATGATTCGTCAACCTAATCACAAAACAACTGATGATACCCCTAGACAAAAAAGGACACAAATGAGCTCTAATCCTCACATCCCTAATAATCTTCCTCTTACTCATCAATCTCCTAGGCCTACTACCATATACATTCACCCCAACCACCCAACTATCTATAAACCTAGCCCTGGCTTTCCCCCTATGACTTGCTACACTACTAACAGGATTACGAAACCAACCCTCTGCCTCACTAGGACATCTACTTCCAGAAGGTACTCCAACCCCATTAATTCCCGCCCTAATCCTAATTGAAACAACAAGCCTACTCATCCGCCCACTAGCCCTAGGAGTACGCCTAACAGCCAACCTCACAGCAGGACACCTACTCATTCAACTCATCTCCACAGCCACGATAGCCCTGTTCTCCACAATGCCAGCAGTTTCACTACTAACCTTCCTGGTTCTCCTCCTGCTAACCGTCCTAGAAGTAGCAGTAGCAATAATCCAAGCCTACGTATTCGTACTTCTATTAAGCCTTTATCTACAAGAAAACATCTAACAA--CC--TCAATGGCACACCAAGCACATTCTTACCACATAGTAGACCCAAGCCCATGACCTATCCTAGGCGCTGCCGCCGCCCTCCTAACCACCTCAGGACTAACAATATGATTCCACTACAACTCCCCCAAACTGCTTATCCTGGGCTTACTCTCCACCATCCTAGTCATATTCCAATGATGACGAGACATTATCCGAGAAAGCACATTCCAAGGCCACCACACTCCCACCGTACAAAAAGGACTACGATACGGAATGGCCCTGTTCATCACATCCGAAGCATTCTTCTTTCTCGGCTTCTTCTGAGCCTTCTTCCACTCAAGCCTAGCCCCCACCCCAGAACTAGGAGGACAATGACCACCCGTAGGAATCAAACCCCTAAACCCCATAGAAGTCCCACTACTAAACACCGCCATCCTCTTAGCCTCCGGAGTCACCGTAACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATACAAGCCCTCACCCTAACAGTTCTCCTAGGATTCTACTTCACTGCACTACAGGCCATAGAATACTACGAAGCACCATTCTCCATCGCAGACGGAATCTACGGCTCTACCTTCTTCGTCGCCACTGGATTCCACGGCCTACACGTAATCATCGGCTCAACATTCCTCCTAGTATGCCTACTACGTCTAATAAAATACCACTTCACATCAGGCCACCACTTCGGATTCGAAGCAGCCGCCTGATACTGACACTTCGTAGACGTCGTATGACTATTCCTTTACATCTCTATCTATTGATGAGGTTCATACTCTTCTAGTATATCC-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAATCCAGAGAAGAGTAATA---AACATAATCCTGTTCATATTAACCCTATCACTCACCCTAAGCATCCTATTAACTATCCTAAACTTTTGACTCGCCCAAATAAACCCAGACTCAGAAAAACTATCCCCATATGAATGCGGATTCGATCCCCTAGGATCCGCTCGACTTCCATTTTCAATCCGATTCTTCCTAGTAGCCATCTTATTCCTCCTGTTCGACCTAGAAATCGCCCTACTACTCCCACTACCATGGGCTGTCCAACTAGAATCCCCTACCACTACCCTGATCTGAACTTCCTTCCTGCTTCTTATCCTAACATTAGGTCTAATCTACGAGTGAATCCAAGGAGGACTAGAATGGGCAGAATA-A------CAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTCATGTCCTACCTGCACCTTAGCTTTTACTCAGCCTTCACCCTAAGTAGCCTAGGCCTAGCCTTCCACCGAACCCATTTAATCTCCGCCCTACTATGTTTAGAGAGTATAATACTATCCATATACGTAGCCCTCGCCATATGACCCATCCAAATACAATCACCATCCTCCACCATCCTACCAATTATCATACTAACATTCTCCGCCTGCGAAGCAGGCACAGGCTTAGCCCTACTAGTAGCCTCCACCCGGACCCACGGCTCCGACCATCTCCACAACTTCAACCTCCTACAATGCTAAAAATCATCATTCCAACTGCAACACTCTTACCCCTAACCCTTACGTCTCCGCTTAAACATCTATGAACTAACATCACCCTACACAGCCTACTCATTGCAACCGTCAGCCTACAATGACTAACCCCCACATACTACCCAAGCAAAGGCCTGACCCCCTGATCATCAATCGACCAAATCTCTTCCCCCCTTCTAGTTCTATCATGCTGGCTCCTCCCCCTCATAATTATAGCAAGCCAAAACCACCTAGAGCAAGAACCCGCCATTCGTAAACGAATCTTCGCCACAACAGTAGTCCTGGCTCAACTATTCATCCTCCTAGCCTTCTCAGCCTCCGAACTAATACTCTTCTACATCTCATTCGAAGCAACCCTCATTCCCACCCTCATCCTCATTACACGATGAGGAAACCAACCAGAACGACTAAACGCTGGCATTTACCTCCTATTCTACACCCTGGCCAGCTCACTCCCCCTACTAATTGCCATCCTACACCTACAAAACCTAATCGGCACACTATACCTACCCATACTAAAACTATCACACCCCACACTAAACACTTCCTGATCTGGACTCATTGCAAGCCTAGCGCTTCTACTAGCCTTCATAGTTAAAGCCCCCCTATATGGCCTACACTTATGATTACCCAAAGCCCACGTAGAAGCACCAATCGCCGGCTCCATGCTACTAGCTGCCCTACTTCTAAAACTAGGAGGCTACGGCATCATACGAATCACAATCCTAGTAAACCCAACATCAAACAACCTGCACTATCCATTCATCACCCTAGCTCTCTGAGGGGCGCTAATAACCAGTGCCATCTGCCTACGACAAATTGACCTAAAATCACTAATCGCCTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCTGCAACCATGATCCAAACCCAATGAGCATTCTCGGGAGCAATAATCCTAATAATTTCACACGGCCTAACTTCCTCAATACTATTCTGCCTAGCCAACACCAACTATGAACGAACCCACAGCCGAATCCTCCTACTCACACGAGGACTCCAACCTCTCCTACCACTAATAGCCACCTGATGACTCCTAGCCAACCTCACAAACATAGCTCTCCCTCCAACAACAAACCTAATAGCAGAACTAACCATTGTAGTTGCACTATTCAACTGATCAGCCTTCACAATCATCCTAACAGGAGCAGCAATCCTACTCACCGCCTCATACACCCTATACATGCTCACAATAACACAACGAGGCCCACTCCCATCCCACATCACCTCGATCCAAAACTCCTCCACCCGAGAACACCTCCTCATAGCTCTCCACATAATCCCCATGCTACTCCTAATCCTCAAACCCGAACTAATCTCCGGAGTCCCTATAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGGCTGTGATCCTAAAAATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTC-AAACCAACAGGAACTGCTAACTCTTGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGATCAAGCACTAATCCTAAACACCTTCATACTCCTGACCCTAACAACTCTATTTACCCCCATCCTACTCCCTCTCCTATTCCCCAACTTCAAAAACACCCCAAATTCAATCACAAACACAGTCAAAACATCCTTCCTAATCAGCCTTGTCCCTATAACAATCCACATCTACTCCGGGACAGAAAGCCTAACCTCCCTATGAGAATGAAAATTTATCATGAACTTTAAAATCCCCATTAGCCTGAAAATAGACTTCTACTCACTAACCTTCTTCCCAATCGCATTATTCGTATCATGGTCCATCCTACAATTCGCAACATGATACATAGCCTCAGACCCCTACATCACAAAATTCTTCACCTATCTGCTATTCTTCCTTATAGCAATACTTATCCTAATCATCGCTAACAACTTGTTCGTCCTATTCATCGGCTGAGAGGGGGTAGGAATTATATCCTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCCCTCCAAGCTGTACTATACAACCGAGTAGGAGACGTAGGACTTATCCTCTGCATAGCATGACTAGCCTCTGCCATAAACACCTGAGAAATCCACCAACTTTCTTCCCCATCCCAAACCCCAACACTACCCCTGCTAGGCCTCATCTTAGCTGCAACAGGCAAATCAGCCCAATTCGGCCTACACCCATGACTCCCAGCTGCCATAGAAGGCCCCACCCCCGTATCAGCCCTACTCCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTCATCCGAACCCACCCCCTATTCAGCAACAACCAAACCGCCCTAACCCTCTGCCTATGTCTGGGAGCTATCTCCACCCTATTCGCAGCCACATGTGCCCTCACCCAAAACGACATTAAAAAAATCATTGCCTTCTCCACCTCAAGCCAGCTAGGACTAATAATAGTTACAATCGGACTAAACCTCCCCGAACTAGCCTTCCTACACATTTCAACCCACGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGATCCATCATCCACAACCTAAACGGTGAACAAGACATCCGAAAAATAGGAGGTCTCCAAAAAATAATACCCACAACCACCTCATGCCTCACTATCGGTAACCTAGCCCTAATAGGAACGCCATTCCTAGCAGGTTTCTACTCAAAAGACCAAATTATCGAAAGCCTAAACACATCCTACCTAAACACCTGAGCCCTCCTACTAACACTACTAGCCACATCATTCACTGCAGTGTATACAATCCGCATAACCGTACTAGTACAAACCGGCTTCGTTCGAATTCCCCCTATAACCCCAATAAATGAAAATAACCCCGCAGTAACCTCACCCATCACCCGACTCGCACTAGGAAGCATCCTAGCAGGATTCCTCATCACCTCCTTCATCATCC---CAACAAAAACCCCAACAATAACCATACCCCTCTCCATCAAAATAACAGCTCTAATAGTAACCGCCTTAGGAATTGCCCTAGCCCTAGAAATCTCAAAAATATCCCAAACCCTAATCCTCACAAAACAAACTACACTATCAAACTTCTCCACCTCCCTAGGATACTTCAACCACCTAACCCATCGCCTAAGCATATCTAACTTCCTCAGTGGAGGACAAAACATTGCCTCACACCTAATCGACCTATCCTGATTCAAAACCATTGGCCCAGAAGGACTAGCCCATCTACAACTAATAGCAACCAAAACCGCCACCTCCCTTCACTCCGGCCTAATCAAGGCCTACCTAGGAGCATTCGCTCTATCCATCATCATCATCCTTA---TATCTATACACAGAAT--AAA-C-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAATGACGCCCTAATTGACCTGCCCACACCATCAAACATCTCAACATGATGAAACTTCGGGTCTCTTCTGGGTATTTGCTTAATCACTCAAATCGTTACCGGTCTACTGCTAGCCATACACTACACAGCAGATACCAACCTAGCTTTCTCCTCCGTAGCCCACATATGCCGTGACGTCCAATTTGGCTGACTAATCCGTAACCTCCATGCAAACGGCGCCTCCTTCTTCTTCATCTGCATCTACCTTCACATCGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTCATTCTCCTTCTAACCCTCATAGCAACAGCCTTTGTAGGATACGTCCTGCCATGAGGACAAATGTCATTCTGAGGCGCTACAGTCATCACAAACCTATTCTCAGCAATCCCATACATCGGACAAACACTAGTAGAATGAGCCTGAGGAGGATTCTCCGTCGACAACCCTACTCTGACCCGATTCTTCGCACTCCACTTCCTACTCCCATTCGTCATCGTAGGCCTTACACTAGTCCATCTCACCTTCCTACATGAAACGGGATCAAACAACCCAACAGGAGTACCCTCAGACTGCGACAAAATCCCATTCCACCCATACTACACTGTAAAAGACATCCTGGGCTTCGCACTAATAATCGCCCTACTCGTCTCCCTAGCCCTATTCTCCCCCAACATATTAGGAGACCCGGAAAACTTTACACCAGCCAACCCCCTAGTCACACCCCCACACATTAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCTATCCCAAACAAACTAGGAGGTGTACTAGCCCTAGCCGCCTCAATCCTTGTACTATTCCTAATACCCCTACTTCACACATCAAAACTACGATCAATAACCTTCCGTCCCATCTCCCAAATCCTATTCTGAGCCCTAGTTGCAAACGTCCTAATCCTGACATGAGTAGGAAGCCAACCAGTAGAACACCCGTTCATCATTATTGGCCAACTAGCCTCACTCACCTACTTCACAATCATTCTAGTCCTCTTCCCCCTCGCAGCCGCACTAGAAAATAAAATACTGAAACT----------TTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGAATAAACCCCTTCTTAGAGTT Loxia_curvirostra GTTCTTGTAGCTTATAT-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-AACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCTCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-T-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTTGCACTTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-TGATAAGGCCTCC-TCGTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAG--TA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACT--CTGAAGGCCCAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T-----ACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG----CCCCCCCCCCCCATACATTAATAAGCTAT-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACT--AC-ACA-CACCC----AACTAAAGCATT---T--ACTAGT-CCTAGTATAGGCGATAGAAAAGACA-CCA-TTGGC-GCGATAGAGAC-TACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAACC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAA-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACATG-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--AATACT-CC-CCAATT--ATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-TCCATAAAAATATAAG-AACAATATGACTCCCT-CATCACTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAA-TCACCA-ATATACGA--CAAAT---------CAA---ACAAGCA-GAG-TATTA-AGTACA-TTGTTAACCCGACAGA-GGAGCGTCCACT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAAAA-CACATA----CT-CACCCA--C-C-GGGTTCACTGAC-ACA-CAA-GA-C-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGTAAAAC-AAAACCTCCAA-AAATTAGACCAAACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTCGAGAGTCCGTATCGACGAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-ACCAC---A-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT---CA-----ACAACC--C----ATGAC----------CAACTACCCCCTACTAATCAACCTCATCATAGCCCTCTCCTACGCTCTTCCAATCTTAATTGCAGTAGCCTTTCTCACACTAGTAGAACGTAAAATCCTAAGCTACATGCAAGGCCGAAAAGGTCCAAATATTGTAGGCCCATACGGTCTCCTACAGCCTTTAGCAGACGGAGTAAAACTATTCATCAAAGAACCCATCCGAC---------CCTCCACATCCTCACCAATCCTGTTTATTGCAACCCCAATACTGGCCCTACTCCTGGCAATCTCCATCTGAACTCCTCTGCCCCTGCCATTCTCCTTAGCAGACCTCAACTTAGGACTTTTATTCCTTCTAGCCATGTCAAGCCTGGCAGTCTACTCCATTCTATGATCGGGCTGAGCGTCTAACTCAAAATATGCTCTAATTGGAGCACTACGGGCAGTAGCCCAAACAATTTCATACGAAGTAACTTTAGCAATCATCCTCCTATCCGTCATCCTGCTCAGCGGCAATTACACCTTTAACACCCTCGCAATTACCCAAGAGCCCCTATACCTTATCTTCTCATGCTGACCCCTCGCCATAATATGATACGTCTCCACACTTGCTGAAACCAACCGTGCCCCGTTTGACTTAACAGAAGGGGAATCTGAGCTAGTGTCCGGATTCAATGTGGAATATGCAGCAGGCCCATTCGCATTGTTCTTCTTGGCAGAGTACGCTAACATTATACTTATGAACACTATTACTACCATCTTATTCTTTAATCCAAGCCTACTAAACCTACCACAAGAGCTATTTCCCGTAGTACTAGCCACTAAAGTCCTACTGCTATCAGCAGGGTTCCTATGAATTCGTGCCTCCTACCCCCGATTCCGATATGACCAGCTAATACACCTACTATGAAAAAACTTTCTGCCCCTTACACTTGCGCTATGCCTTTGACATACTAGCATACCAATTTGTTATGCAGGACTACCT-----CCCTACCTA-A--GA--------------CTACCGGAAATGTGCCTGAACAC-C--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-A--TAAT-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGAAATCAAAATTCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCTTCCCCTGCTA-ATGAATCCTCAGGCAAAACTAATCTTTACAATTAGCCTACTCCTAGGAACCACCATCACAATCTCAAGTAACCATTGAATTA---TAGCCTGAGCTGGCCTAGAAATCAACACACTCGCCATCCTACCCTTAATCTCAAAGTCCCACCACCCACGATCCATTGAAGCAGCTACCAAATACTTCCTTACCCAAGCAGCTGCCTCAACCCTAGTGCTATTCTCCAGCATAACTAACGCATGACACACCGGACAATGAGACATTACTCAACTCTCCCACCCCACATCAAGTCTAATCCTAACCTCAGCAATTGCCATAAAACTAGGCCTAGTTCCATTCCACTTCTGATTCCCAGAGGTTTTACAAGGCTCTCCCCTCTCTACCGGCCTCGTCCTATCTACTGTAATAAAACTCCCCCCAATCACCCTCCTTTACATAACTTCCTCATCACTAAACCCCACACTCCTGACTACCCTAGCTATTCTATCAGCAGCTATCGGCGGATGAATGGGACTAAACCAGACACAAATCCGAAAAATCTTAGCTTTCTCCTCCATCTCCCACCTAGGATGAATGACAGTCATTATCATCTACAACCCCAAACTCACCCTCCTCAACTTCTACCTATACACCATAATAACTGCAGCCGTCTTTCTAACCCTAAACTCAATTAAAGTACTAAAGCTATCTACCCTAATAACTGCATGAACTAAAGTCCCATCACTAAACGCAATACTACTCCTAACCCTGCTATCCCTTGCAGGCCTGCCCCCCTTAACAGGATTTCTACCAAAGTGACTCATTATTCAAGAACTAACCAAGCAAGAAATAATCCCTGCAGCTACGCTCATTTCCCTTCTCTCCCTGCTAAGCTTATTCTTCTACCTCCGTCTTGCATACTGCACAACAATCACACTCCCCCCACACACTACAAACCACATAAAACAATGACGCACTGGCAAATCAACCCACGTACTGATTGCCATCCTAACCACGATATCTGTCATTCTCCTCCCCATTTCACCCATAATCCTCACCATCAT------CT----AAGAAACTTAG----GATTAA-T-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTGAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTAAATGCAACTCAGGTGCTTTAA-TTAAGCTAGGACCTT-G--TAG-CTCACTAGACAGATGGGCTTCGATCCCACGACTC-TGTAGTTAACAGCTACATGCCCAAACC-AACAGGCCTCTGCCT-A-------------AGACTCTGGCGCACGA-TTAATGCACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT-ATTCACTCAGCCATC--------------TTACCTGTGACATTCATTAACCGATGACTATTCTCAACCAACCACAAAGATATCGGAACCCTTTACCTGATTTTCGGTGCATGAGCCGGAATAGTAGGCACCGCCCTAAGCCTTCTCATCCGAGCAGAACTAGGACAACCCGGAGCCCTTCTAGGCGACGACCAAGTCTATAACGTAATCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTACTTCCTCCATCATTCCTTCTCCTACTAGCATCTTCCACCGTAGAAGCAGGTGTTGGTACAGGCTGAACAGTATACCCCCCACTAGCTGGCAACCTGGCCCACGCCGGAGCCTCAGTTGACTTAGCAATCTTCTCCCTACACCTAGCCGGTATTTCCTCAATCCTAGGGGCAATCAACTTTATCACAACAGCAATCAACATAAAACCCCCCGCCCTATCACAATATCAAACCCCTCTATTCGTCTGATCCGTCCTAATCACTGCAGTACTCCTACTTCTCTCTCTACCAGTCCTTGCCGCAGGAATTACAATGCTTCTCACAGACCGTAACCTCAACACCACATTCTTTGACCCCGCAGGAGGAGGCGATCCAGTCCTATATCAGCACCTTTTCTGATTCTTCGGCCATCCAGAAGTATATATCCTCATCCTTCCAGGATTCGGGATTATTTCCCACGTCGTAACCTACTATGCAGG?AAAAAAGAACCATTCGGCTATATAGGAATAGTATGAGCCATGCTATCCATCGGTTTCCTGGGGTTTATCGTATGAGCTCATCACATATTTACAGTCGGAATAGACGTTGATACTCGAGCATACTTCACGTCAGCCACTATAATCATTGCCATCCCAACTGGAATCAAAGTATTCAGCTGACTAGCTACGCTCCACGGAGGCATTATCAAATGAGACCCTCCAATACTATGAGCCCTAGGATTTATCTTCCTATTCACCATTGGAGGACTGACAGGGATTGTTCTAGCAAACTCCTCACTAGATATCGCCCTTCACGACACCTACTACGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTATTCGCAATCCTAGCAGGCTTCACACACTGATTCCCACTATTCACCGGATACACCCTCCACTCAACATGAGCCAAAACCCACTTTGGAGTAATGTTTGTAGGAGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCAGGTATACCACGCCGATACTCAGACTACCCAGACGCCTACACCCTATGAAATACCATTTCCTCCGTAGGATCCCTAATCTCCCTAACAGCCGTAATTATACTAGTGTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAGCCAGAACTGACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCTCCCTTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTA------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAAACGTTAGT-AAAACA-ATTACATAA-CCTTGTCAAGGCTAAATTGCAGGTGAAACCCCTGCACGTCTCTC---CACCT--AAACATGGCCAACCACTCACAATTCAACTTCCAAGACGCTTCCTCCCCCATCATAGAAGAACTAATAGGATTCCACGACCACGCCCTAATAGTCGCATTAGCAATCTGCAGCCTAGTACTTTACCTACTAACCCACATACTTACAGAAAAACTCTCATCAAGCACAGTAGACGCACAAGAAATCGAACTAGTTTGAACAATCCTCCCAGCCATAGTACTAGTTATACTTGCACTACCCTCCCTACGAATCCTATACATGATAGACGAAATCAACGAACCTGACCTTACCCTAAAAGCCATTGGTCACCAATGATACTGAACATACGAATACACCGACCTCAAAGACCTAACATTCGACTCTTACATAATCCCAACATCAGACCTACCCCTAGGACATTTCCGTCTACTAGAAGTAGACCACCGTGTTGTAGTCCCAATAAGCTCTACAATCCGAGTAATTGTTACTGCCGACGACGTACTCCACTCATGAGCCGTCCCAAGCCTAGGTGTAAAAACCGACGCAATCCCAGGCCGTCTCAACCAAACTTCCTTCCTCGCCTCCCGGCCCGGAGTGTTTTACGGACAGTGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCTCTCGCTAACTTCGAAAGCTGATCCTCTACAA---TAGCCTCCT----------AATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-ACA-CCCCTCCTTAATGATATGCCTCAACTAAACCCCGCACCATGATTTTTTATCATGATCATTTCATGAGTTACTTTCTCCCTAATTATCCAACCTAAAATCCTTACATTCGTATCAATAAACCCCCCATCCAATAAGC---CTCCTACCGCTCCAAGCACCACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTTTCAAGCCCATCCTTACTAGGAATCCCACTCATCCTAATTTCAATAACATTCCCCGCCCTCCTAATTCCTTCCCTGGACAACCGATGAATCACCAACCGACTTTCAACCCTCCAACTATGATTCATCAACCTAGTCACAAAACAACTGATAATACCTTTAGACAAAAAAGGACACAAATGGGCCCTAATCCTAACATCCTTAATAATCTTCCTCCTACTCATTAATCTTCTAGGCCTACTACCATACACATTCACCCCAACCACTCAACTATCCATAAACCTAGCACTAGCCTTCCCCCTATGACTCGCCACTCTACTGACAGGCCTACGAAACCAACCCTCCGCCTCATTAGGTCACCTCCTACCAGAAGGCACCCCAACCCCATTAATTCCTGCCCTAATCTTAATCGAAACAACAAGCCTACTCATCCGCCCACTAGCCCTAGGGGTACGCTTAACAGCCAATCTGACAGCAGGCCACCTACTCATCCAACTCATCTCCACCGCTACAATAGCCTTATTCACCACAATACCAGTAGTATCCCTACTAACTCTCCTAATCCTCCTCCTACTAACCATCCTAGAAGTAGCTGTAGCAATAATCCAAGCCTACGTTTTCGTACTTCTATTAAGCCTATACCTACAAGAAAACATCT-AACC--CC--ACAATGGCACACCAAGCACATTCCTACCACATAGTAGACCCCAGCCCATGACCTATTCTAGGAGCCGCTGCCGCTCTCCTAACCACATCAGGACTAACAATATGATTCCACTACAACTCCCC?CAACTCCTCATCCTAGGCCTACTATCCACTGTCCTAGTTATATTCCAATGATGACGAGATATTGTTCGAGAAAGCACATTCCAAGGCCACCACACCCCCACCGTACAGAAAGGATTACGATACGGCATGGCCCTATTCATCACTTCCGAAGCCTTCTTCTTCCTAGGCTTTTTCTGAGCCTTTTTCCACTCAAGCCTAGCCCCCACCCCAGAACTAGGAGGTCAATGACCACCCGTCGGAATCAAACCCCTAAACCCGATAGAAGTACCACTACTAAACACTGCCATCCTACTAGCCTCCGGAGTTACCGTAACATGAGCCCACCACAGCATCACAGAAGCGAGCCGAAAACAAGCAATCCACGCCTTAACCTTAACCGTTCTACTAGGCTTCTACTTCACTGCACTACAAGCCATAGAATACTACGAAGCGCCATTTTCAATCGCAGACGGAGTCTACGGCTCTACATTCTTCGTAGCCACCGGATTCCACGGCCTCCACGTCATTATTGGTTCTACATTCCTGCTAGTATGTTTACTTCGTCTAATCAAATACCATTTCACGCCAAACCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACATTTCGTAGACGTCGTATGACTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATA---AACATAATCCTATTCATACTGACCCTATCATTCGCCCTAAGCATCCTGCTAACCGCACTAAACTTCTGGCTAGCCCAAATAAACCCAGACTCAGAAAAACTATCTCCCTACGAATGCGGATTCGACCCACTCGGCTCCGCCCGGCTGCCCTTTTCAATCCGATTCTTCCTAGTAGCTATCCTATTCCTCCTCTTTGACTTAGAAATTGCCCTCCTCCTACCATTGCCATGAGCCACCCAACTAGAATCTCCCCTAACTACCCTAATCTGAACCTCCACCCTTCTTCTCCTCTTAACACTAGGACTCATCTACGAGTGAATCCAAGGCGGACTAGAATGAGCGGAGTA-A------TAGAAAGTTAGTCTAATCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTCATGTCCTACCTACACCTTAGCTTCTACTCAGCTTTCACCCTAAGCAGCCTAGGCCTAGCTTTCCACCGAACCCACTTAATCTCAGCCCTTCTCTGCCTAGAAAGCATAATACTGTCCATATACGTAGCACTCGCCATATGACCCATCCAAATGCAATCGCCCTCCTCCACCATCCTGCCGATCATCCTATTAACATTCTCCGCCTGCGAGGCAGGAACGGGCCTAGCTCTACTAGTAGCTTCTACCCGCACCCACGGTTCAGACCACCTACACAACTTCAACCTCTTACAATGCTAAAAATCTTAATTCCAACCGCAATACTCCTACCCATAGCCCTCACGTCCCCACTCAAACACCTATGAACCAACATTACACTACACAGCCTAATCATTGCCACCATCAGCCTACAATGATTAACCCCAACATACTACCCAAATAAAAGCCTAACTCCCTGAACATCCATCGACCAAATCTCCTCTCCCCTCCTAGTCCTCTCATGCTGACTCCTCCCTCTCATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCACCATCCGCAAACGAATCTTTGCTACAACAGTAATCCTAGCTCAACTATTTATTCTTCTAGCCTTCTCAGCCTCCGAGTTAATACTCTTCTATATCGCATTCGAAGCAACCCTCATCCCAACCCTTATCCTCATTACACGATGAGGAAACCAACCAGAACGACTAAACGCTGGAATCTACCTACTATTCTACACTCTAGCCAGCTCGCTCCCCCTACTAATCGCCATCCTACACCTACAAAACCAAATTGGTACTCTCTACCTCCCTATACTAAAACTGTCACACCCTACAATAAACTCCTCATGATCTGGGCTAATTGCAAGCCTCGCCCTACTCCTTGCTTTCATGGTCAAAGCCCCCCTATATGGCCTACACCTATGACTCCCCAAAGCCCACGTAGAAGCCCCAATCGCCGGTTCCATACTACTAGCCGCACTCCTCCTAAAACTAGGAGGCTACGGTATCATACGAATCACAATCCTAGTAAACCCAACATCAAACAACCTACACTATCCATTCATCACCTTAGCCCTATGAGGGGCACTAATAACCAGCGCCATCTGCCTACGACAAATCGACCTAAAGTCACTAATCGCCTACTCATCTGTCAGCCACATAGGACTAGTTGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGGGCAATAATCCTAATAATTTCACACGGCTTAACTTCATCAATACTATTCTGCCTGGCCAACACCAATTACGAACGAACCCACAGCCGAATCCTCCTTCTTACACGAGGACTCCAACCCCTTCTACCACTAATAGCCATCTGATGACTTCTAGCAAACCTAACAAACATAGCCCTCCCTCCAACAACAAACCTCATGGCAGAACTAACCATCGTCATCGCACTATTCAACTGATCTGCCTTTACAATTATCCTAACAGGAATAGCAATCCTACTTACTGCCTCCTACACCCTCTACATACTCATAATAACACAGCGAGGCCCACTTCCATCCCATATCACCTCAATCCAAAACTCTACCACCCGAGAGCATCTCCTCATAGCCCTCCACATAATTCCAATACTACTTCTCATCCTCAAACCAGAGCTAATCTCCGGTATCCCTATAT-GCAAGTATAGTTT-TAA-TCAAAACATTAGACTGTGACTCTAAAAATAGAAGTTAAACTCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACAAGAACTGCTAACTCTTGAGTCTGAGTATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAACCACTTATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTACCACTAGTCCTAAACACATTCATACTCCTAACCCTAGCAACCCTCTCCACACCCATCCTATTCCCCCTCCTATCGCCCAATTCCAAAAACACCCCCGACACCATCACAAATACAGTAAAAGCTTCCTTCCTAATCAGCTTAGTCCCCATAACAATTCACATCTACTCAGGGACAGAAAGCCTCACCTCCCTATGAGAATGAAAATTCATCATAAACTTCAAAATCCCCATTAGCCTAAAAATAGATTTCTACTCACTCACCTTCTTCCCTATTGCACTATTCGTTTCATGGTCTATCCTACAATTTGCAACATGATACATAGCCTCAGACCCCCACATCACAAAATTCTTCATCTACCTCCTATTTTTCCTAATAGCCATACTCATCCTAATCATCGCTAACAACCTATTTGTCCTATTTATCGGTTGAGAAGGGGTTGGAATCATATCCTTCCTACTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCCGCTCTACAAGCCATCCTATATAACCGAATCGGAGACATCGGTCTCATTCTATGCATAGCATGACTAGCCTCAGCCATAAACACATGAGAAATCCAACAACTCCCCTCCCCATCAAAAACCCCAACACTACCCCTGCTAGGCCTCATTCTAGCTGCAACAGGCAAGTCAGCCCAATTCGGCCTCCATCCATGACTACCTGCCGCCATAGAAGGACCCACCCCTGTCTCCGCCCTACTTCACTCCAGCACAATAGTAGTAGCCGGAATCTTCCTACTAATTCGAACCCACCCCCTATTCAGCAACAACCAAACCGCCCTAACCCTCTGCCTATGCCTGGGAGCCCTATCCACCCTATTCGCAGCCACATGTGCCCTCACCCAAAACGACATCAAAAAAATTATTGCCTTTTCCACCTCAAGCCAACTAGGCCTAATAATAGTTACAATCGGACTTAACCTCCCCGAACTGGCGTTCCTCCACATCTCAACCCATGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGATCTATCATCCACAACCTAAACGGTGAACAGGACATTCGAAAAATAGGAGGACTTCAAAAAATAATACCAACAACTACCTCATGCCTTACTATCGGCAATCTAGCCCTAATAGGAACGCCATTTCTAGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACATCCTACCTAAACAGCTGAGCCCTACTACTAACCCTTCTAGCCACATCATTTACCGCAGTGTATACAATTCGCATAACCGTACTAGTACAGACCGGCTTCGTTCGAATCCCTCCCCTGACCCCAATAAATGAAAACGACCCCGCAGTGACCTCCCCCATCACTCGACTTGCTCTAGGAAGCATCCTAGCAGGATTCCTCATTACCTCATTCATCATCC---CCACAAAAACCCCTACAATAACCATACCTATATCCATCAAAATAACAGCTCTAGTGGTAACTGCCCTAGGAATTGCCCTAGCCCTAGAAATCTCAAAAATAGCCCAAACTCTCATCCTCACAAAACAAACCGCCTTCTCAAACTTCTCTACATCCCTAGGATATTTCAACCCCCTAACTCATCGCTTAACCATGTCTAACCTCCTCAGCGGAGGACAAAACATCGCCTCACACCTAATTGACCTTTCCTGATACAAAATCCTAGGCCCAGAAGGACTAGCCAACTTACAACTGATAGCAACCAAAACCGCCACCTCCCTCCACTCAGGCCTAATTAAAGCCTACCTAGGAGCATTCGCCCTATCCATCCTCATTATCCTCA---TATCCCTACACAGAAT--CAA-C-C---AATGGCCCCAAATCTTCGTAAAAACCACCAAATCCTCAAAGTCATCAACAACGCCCTAATTGACCTACCCACACCACCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTGGGCATCTGCCTAATCACTCAAATCGTTACAGGCCTGCTACTAGCCACCCACTACACAGCAGACACCAACCTAGCCTTCTCCTCCGTAGCTCACATATGCCGTGACGTCCAATTCGGCTGACTAATCCGTAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACTTACACATCGGCCGAGGAATCTACTACGGCTCATATCTAAACAAAGAAACCTGAAACATCGGAGTCATCCTCTTATTAACCCTCATAGCTACCGCTTTCGTAGGATACGTCCTACCATGAGGCCAAATATCATTCTGAGGCGCCACAGTAATCACAAATCTATTCTCGGCAATCCCCTATATTGGACAAACGCTAGTAGAATGAGCCTGAGGGGGATTCTCCGTAGACAACCCCACATTAACCCGCTTCTTCGCTCTTCACTTCCTACTACCATTCGTTATCGTAGGCCTCACTCTAGTTCACCTCACCTTCCTACACGAAACAGGATCAAACAACCCAACAGGAGTCCCCTCAGACTGCGACAAAATTCCATTTCACCCTTACTACACCGTAAAAGACATTCTAGGTTTCGCACTAATAATCTCCCTACTTGTCTCCCTAGCCCTATTCTCCCCAAACCTCCTAGGAGACCCAGAAAACTTCACACCAGCCAACCCCCTAGTAACTCCCCCCCACATCAAACCAGAATGATACTTCCTATTCGCCTACGCCATCCTGCGATCCATCCCAAACAAACTAGGAGGCGTACTAGCCCTAGCCGCCTCAATCCTCGTACTATTCTTAATACCCCTACTCCACACATCAAAACTACGATCAATAACTTTCCGCCCCATCTCACAAATTCTATTCTGAGCCCTAGTCGCAAATGTCCTCATCCTCACATGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAAGTAGCCTCACTCTCGTACTTCACAATCATTCTAGTCCTATTCCCTATTGCAGCCGCACTAGAAAACAAACTCCTAAAACT----------CTA-ATT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Loxops_caeruleirostris GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCGCCAGTG-TAGATGCCCTGGACA-CCT-T-AA-C-C-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTCGCACTTGCCACGCCCCCACGGGTATTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-----TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATGAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCAAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-T----AACGGCATAGGGGTATGAAATAACCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CG--CCCCCCCCCCCCCCATAAATTAATAAGCTAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAATCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCCACT--TC-ATA-CACTT----AACTAAAGCATT---T--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAACAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAG-AA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAAC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AAGGAC-TT-ACTAAC-CGTACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTAC-CCTACAAAAATACAAA-AACAATATGACTCCCT-CCCCATTAACAGGCTAACCTATACCCAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--CTAAT---------CAA---ACAAGCA-GAG-TATTA-AGCACA-TTGTTAACCCGACAAA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTTCAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCACC--TTAGAT-CACTTA----CT-CACCCA--C-C-GGGCTCACTGTT-ACA-TAA-GA-C-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AGAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACCACAA-GCAAGCCCCC-GCCTTAAGTAATGAAAACAACTAAATTACAAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACC---CA-----ACAACT--C----ATGAC----------TAACTACCCCCTACTAATTAACCTAATCATATCCCTTTCCTACGCCCTCCCAATCTTAATTGCAGTAGCCTTCCTAACACTAGTAGAGCGCAAAATCCTAAGTTACATACAAAATCGAAAAGGCCCTAACATTGTAGGACCATACGGTCTCCTACAGCCCTTAGCAGACGGAGTGAAATTATTCATCAAAGAGCCCATCCGAC---------CTTCAACATCCTCCCCAATCCTATTCCTTGCAACTCCAATATTAGCTCTTCTCCTAGCAATTTCAATCTGAGCCCCCCTGCCTCTACCTTTTTCATTAGCAGACCTCAATCTAGGCCTATTATTCCTGCTAGCCATATCAAGCCTAGCAGTGTACTCTATCCTCTGATCTGGCTGAGCCTCCAACTCAAAATACGCTCTAATTGGTGCACTGCGGGCGGTAGCCCAAACAATCTCATACGAAGTAACCTTAGCCATTATCCTCCTATCTGTTGTACTCCTTAGCGGCAACTACACTCTAAGTACCCTTGCAGTCACTCAGGAACCTCTATACCTCATTTTTTCATGCTGACCTCTCGCTATGATGTGATACGTCTCCACACTTGCTGAGACTAATCGTGCTCCCTTTGACCTAACAGAAGGAGAATCTGAACTGGTCTCTGGATTTAACGTAGAATATGCAGCTGGCCCTTTCGCACTCTTCTTCTTAGCTGAATACGCCAATATCATACTTATAAACACTATCACCGCAATCCTCTTCTTCAACCCAAGCCTGCTTAACCTCCCCCAAGAGCTATTCCCCGTAGTACTAGCCACAAAAGTCCTACTACTATCAGCAGGATTTCTATGAATTCGTGCCTCCTACCCACGATTCCGATATGACCAACTAATACACTTACTATGAAAAAATTTCCTACCACTTACACTTGCTCTATGTCTCTGGCACACCAGCATGCCAATTTGCTATGCGGGGTTACCC-----CCTTATCTA-A--GA--------------CCACCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGCCCTCTCATTTCCT-A--TAGC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTCATAGTTAGCCTCCTCCTGGGGACTGCCATCACAATCTCGAGCAACCACTGGATCA---TAGCTTGAGCCGGCCTCGAGATCAACACACTTGCCGTCCTACCACTAATCTCAAAATCTCACCACCCACGATCCATCGAAGCAGCCACTAAGTACTTCCTAACCCAAGCAGCTGCCTCTGCCCTAGTCTTATTCTCCAGCATAACCAATGCATGACACACCGGACAATGAGACATTACCCAGCTAACTCACCCCACATCCAGCCTAATCTTAACTTCAGCAATTGCAATAAAATTAGGCCTAGTCCCATTCCACTTCTGATTCCCAGAAGTACTACAAGGTTCACCTCTCTCCACTGGGCTCCTGCTATCCACTATTATAAAACTACCCCCAATTACCCTTTTATACATAACTTCTCCATCACTAAACCCCACACTTCTGACTACCCTGGCTGTCCTCTCAGCAGCCATCGGAGGATGAATAGGCCTCAACCAAACACAAATTCGAAAAATCCTAGCTTTCTCCTCCATCTCACATCTCGGCTGAATAGCAATCATCATCATTTATAACCCTAAGCTTACCCTCCTCAACTTCTACCTGTACACTATGATGACTGCAACTGTATTTCTCACCTTAAACTCAATTAAAGTAATGAAACTATCCACCCTAATAACCATATGAACTAAAGCCCCATCACTAAATTCAATACTACTCTTAACCTTACTTTCCCTCGCAGGACTTCCCCCCTTAACAGGGTTCCTGCCTAAATGACTCATCATCCAAGAACTAACTAAACAAGAAATAATCCCCGCAGCCACACTTATATCCCTTCTCTCACTACTAAGCCTATTCTTCTACCTCCGCCTTGCATACTGCACAACAATTACACTCCCACCACACACCACGAACCACATAAAACAATGACGCACCAGCAAATCAACCAACATTACGATTGCTGTCCTAACCACAATATCCCTCATTCTTCTCCCTATCTCTCCCATAATCCTCTCCATCAT------TT----AAGGAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAAGTCCGCAGGTTATTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CGA-TACACTAGGCAGATGGGCTTCGATCCCATGACTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACACGA-TCAATGTACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGTCAACCCGGAGCTCTCCTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCCTTTGTAATAATCTTCTTCATAGTCATGCCTATTATAATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTTCTCCTGCTAGCCTCTTCCACTGTCGAAGCAGGAGTTGGTACAGGCTGAACAGTATACCCCCCACTGGCTGGCAACCTTGCCCACGCCGGAGCCTCAGTTGACCTCGCAATCTTCTCCCTACACCTAGCCGGTATCTCCTCAATCCTAGGGGCAATCAACTTCATCACAACAGCTCTCAACATAAAACCTCCAGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTATTAATCACTGCAGTACTTCTACTTCTATCCCTTCCTGTACTCGCCGCAGGAATCACAATGCTTCTAACAGACCGCAACCTCAATACTACATTCTTCGACCCAGCAGGAGGAGGCGACCCAGTCCTATACCAACATCTCTTCTGATTCTTTGGTCACCCAGAAGTCTACATCCTAATTCTACCAGGATTCGGAATTATCTCTCATGTCGTAACCTACTACTCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCCATCGGATTCCTAGGATTCATCGTCTGAGCCCACCACATATTTACAGTCGGAATAGACGTTGACACTCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCAACCGGCATTAAAGTATTCAGCTGACTAGCCACACTCCACGGAGGTGTAATCAAATGAGATCCACCAATACTATGAGCTCTAGGATTTATCTTCCTATTCACCATCGGAGGACTAACCGGGATTGTCCTAGCAAACTCCTCACTAGACATCGCATTACATGACACCTACTACGTAGTAGCCCACTTCCACTACGTCCTATCAATAGGAGCAGTGTTCGCAATCCTAGCTGGATTCACACACTGATTCCCCCTATTCACCGGATATACTCTTCACCAAACATGAGCCAAAACTCACTTCGGTGTAATATTCGTAGGAGTCAACTTAACCTTCTTCCCTCAACATTTCCTAGGCTTAGCCGGTATACCACGTCGATACTCAGACTACCCCGACGCCTACACCCTATGAAACACCATCTCCTCAGTAGGATCACTCATCTCCCTAACAGCCGTAATCATACTAGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTACAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--GAACCACTTATGCTTCTTTCTC---AT---AGAGACGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGACTAAATTGCAGGTGAAACCCCTGCACATCTCTT---CACCC--AAACATGGCTAACCACTCACAACTCAACTTTCAAGACGCTTCCTCTCCCATCATAGAAGAACTAATAGGATTCCACGACCACGCTATAATAATCGCATTAGCAATCTGCAGCCTAGTACTCTACCTTCTAACTCACATAATAACAGGAAAACTCTCATCCAGCACAGTAGACGCACAAGAAATTGAACTTGTCTGAACAATTCTGCCAGCCATAGTTCTAATCACACTCGCCTTACCATCCCTACGAATTCTATACATGATAGACGAAATCAACGAACCTGATTTAACCCTAAAAGCCATCGGCCATCAATGATACTGAACTTACGAATATACTGACCTTAAAGACCTTACATTTGACTCTTACATAATCCCAACATCGGACCTGCCCTTAGGACACTTCCGGCTACTAGAAGTCGACCACCGTGTTGTAGTTCCAATAAGCTCTACAATCCGAGTAATCGTCACCGCCGATGATGTACTTCACTCATGAGCAGTCCCAAGCCTAGGGGTAAAAACCGATGCAATCCCAGGACGCTTAAACCAAACTTCCTTCCTTGCTTCCCGACCCGGAGTTTTCTACGGACAATGCTCAGAAATCTGCGGAGCTAATCACAGCTTCATACCAATCGTGGTAGAATCAACTCCCCTCGCCAACTTCGAAAGCTGATCTTCCCTAG---CAGCCTCCT----------CATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-ACT-CTCCTCCTTAATGATATGCCTCAACTAAACCCTGCACCTTGATTTTTTATCATGATCATTTCATGACTGACCTTCTCCCTCATCATTCAACCCAAACTCCTCTCATTCGTATCAACGAACCCCCCATCCAACAAAC---CACCCATTGCCCCAAGCACCACCCCTTGAACCTGACCATGAACCTAAGCTTCTTCGACCAGTTCTCGAGCCCATCTTTCCTAGGAATCCCACTCATCCTCATCTCAATAACATTTCCAGCCCTTTTAATCCCCTCACTAGACAACCGATGAATCACTAACCGACTCTCAACCCTTCAACTATGATTCGTCAACCTAGTTACAAAGCAACTAATAATACCCTTAGAT-AAAAAGGACATAAATGAGCCCTAATCCTAACATCCTTAATAATCTTCCTACTACTAATCAACCTCCTAGGCTTACTGCCATACACATTCACCCCAACTACCCAGCTATCTATAAACTTAGCCCTAGCTTTCCCCCTATGACTTGCTACCCTACTAACAGGCCTGCGAAACCAACCTTCTATCTCACTAGGGCATCTTCTCCCAGAAGGAACCCCAACCCCACTAATCCCTGCCTTAATCCTAATCGAAACAACAAGCCTACTTATCCGGCCCCTAGCTCTAGGTGTACGCCTAACAGCCAACCTCACAGCAGGACACCTACTCATCCAACTCATCTCCACAGCCACAACAGCCTTATTCCCTACAATACCAGCAGTATCACTTCTAACCCTGTTAGTCCTTTTCTTACTAACTATCCTAGAAGTAGCAGTAGCAATAATTCAAGCCTACGTCTTCGTACTCCTACTAAGCCTTTACCTACAAGAAAACATCTAACAC--CC--ACAATGGCACACCAAGCACATTCTTATCACATAGTAGACCCCAGCCCATGACCTATTCTAGGAGCCGCCGCCGCCCTCCTGACCACCTCAGGACTCACAATGTGATTCCACTGAAACTCACCCCAACTCCTTATCCTAGGCTTACTCTCCACTTCCCTAGTCATATTCCAATGATGACGTGACATTGTCCGAGAAAGCACATTCCAAGGACACCACACTCCCACCGTACAAAAAGGCCTACGATACGGCATAGTCCTATTCATCACATCTGAAGCATTCTTCTTTCTTGGCTTTTTCTGGGCATTTTTCCACTCAAGCTTAGCCCCTACCCCAGAACTAGGAGGACAATGACCGCCCGTCGGAATCAAACCCCTAAACCCCATAGACGTACCTCTACTAAACACTGCCATTCTCCTAGCTTCCGGAGTCACCGTAACATGAGCCCACCATAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCACTTACTCTAACCGTTCTCCTAGGCTTCTACTTCACTGCACTACAAGCCATAGAATACTACGAAGCACCATTCTCCATTGCAGACGGAGTCTACGGCTCTACATTCTTCGTTGCTACCGGATTCCATGGCCTACATGTAATCATCGGTTCCACATTCCTGCTAGTATGCCTACTACGCTTAATCAAATACCACTTCACGTCAGGACACCACTTTGGATTCGAAGCAGCCGCCTGATACTGACATTTCGTAGACGTAGTATGGCTATTCCTCTACATCTCTATCTACTGATGAGGATCTTACTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATG---AACATAATCCTATTTATACTAACCCTATCACTCACCTTAAGCATCTTACTAACCGCACTAAACTTTTGACTAGCACAAATAAACCCAGACTCAGAAAAACTATCCCCCTATGAATGTGGATTCGACCCCCTAGGATCTGCTCGACTTCCATTTTCAATCCGATTCTTCCTGGTGGCCATTCTATTCCTCCTATTCGACCTAGAAATTGCTTTACTCCTCCCACTCCCATGAGCCATCCAACTGGAATCCCCCACCACCACTCTAATCTGAACCTCCTTCCTCCTCCTTCTACTAACACTAGGACTAATCTACGAATGAATCCAAGGAGGACTAGAATGGGCAGAATA-G------CAGAAAGTTAGTCTAACCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCCCACCCTATAACTTTCTTTATGTCCTACCTCCACCTTAGTTTCTACTCAGCCTTCACTATAAGCAGCCTAGGCCTAGCTTTCCATCGTACCCACTTAATTTCAGCCCTACTATGTCTAGAAAGCATGATGCTATCTATATATGTGGCACTCGCCATATGACCCATCCAAATACAATCACCATCCTCTACCATTCTACCAATTATCATACTAACCTTTTCCGCCTGCGAAGCCGGTACAGGCCTAGCCCTACTAGTAGCCTCTACCCGAACCCACGGCTCAGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATCCCAACCGCAACACTTCTACCCCTAGCCTTCATATCCCCACTTAAACACCTATGAACTAATATCACACTATACGGCTTACTCATTGCCACTGTCAGCCTACAATGACTAACACCTACATACTACCCTAACAAAGGCTTAACCCCCTGAACCTCTATCGACCAAATCTCCTCCCCCCTATTAGTCCTCTCATGCTGACTCCTACCCCTCATGATTATAGCAAGCCAAAACCACCTAGAACAAGAACCCGCCATCCGTAAACGAATCTTCACTACAACAGTAATCTTAGCCCAACTGTTCATCCTCCTGGCCTTCTCAGCCTCAGAGCTAATACTCTTCTACATTGCATTCGAAGCAACCCTCATCCCTACCCTTATCCTCATCACACGATGAGGAAATCAACCAGAGCGACTGAACGCTGGCATTTACCTCCTATTCTACACACTAGCCAGCTCACTCCCCCTACTAATCGCCATCCTACACCTACAAAATCAAATCGGCACACTCTACCTTCCTATACTAAAACTATCACACCCAACATTAAACTCCTCCTGATCCGGACTAATCGCAAGCCTCGCACTCCTCCTAGCTTTCATGGTCAAAGCCCCCCTATACGGCCTACACCTATGACTCCCCAAAGCTCACGTAGAAGCCCCCATTGCCGGCTCCATACTACTAGCCGCTCTGCTATTAAAACTAGGAGGCTACGGCATTATACGAATCACAATCCTGGTAAACCCAACATCAAACAACCTACACTACCCATTCATCACCCTAGCCCTATGAGGGGCACTAATAACCAGCGCAATCTGCCTACGACAGATCGACCTAAAATCACTAATTGCCTACTCTTCTGTCAGCCACATAGGACTGGTCGTAGCTGCAACCATAATCCAAACCCAATGAGCATTTTCAGGAGCAATAATCCTAATAATCTCACACGGCCTAACCTCCTCAATACTATTCTGCCTAGCCAACACCAACTACGAACGAACCCACAGCCGAATTCTCTTACTCACACGAGGACTCCAACCCCTACTACCCCTTATAGCAACCTGATGACTTCTAGCAAACCTAACAAACATAGCCCTCCCCCCAACAACCAACCTCATAGCAGAACTAACCATCGTCATCGCACTATTCAACTGATCCGCCTTCACAATCCTTCTAACAGGAGCAGCAATCCTCCTCACTGCCTCATACACCCTATACATACTAGCAATAACACAACGAGGCACACTCCCATCCCACATCACCTTCATCCAAAACTCCTCTACCCGAGAACACCTTCTCATGGCTCTCCACATGATCCCAATACTACTCTTAATTCTCAAACCCGAACTAATCTCCGGTACTCCTATAT-GCAAGTATAGTTT-CAA-GCAAAACATTAGACCGTGACCCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACGAGAACTGCTAACTCTTGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTATCCCTGACCCTAAACACATTCATAATCCTAACCCTAGTAACCCTCTCCACTCCCATTCTACTCCCACTACTTTCCCCTAAATTCAAGAACACCCCCAACTCCATCACAAACACAGTTAAAACCTCATTCCTAATCAGCCTAATCCCTATAACAATCCACATTTACTCAGGAACAGAAAGCCTAACCTCTCTATGAGAATGAAAATTTATTATAAACTTCAAAATCCCCATTAGCCTCAAAATAGACTTCTACTCCCTCACTTTCTTCCCAATCGCACTGTTCGTCTCATGATCAATCCTACAATTCGCAACATGATACATAGCCTCAGACCCCTACATCACAAAATTCTTCACCTACCTACTATTCTTCCTAATAGCAATACTCATCTTAATCATCGCCAACAACCTGTTCGTCCTATTCATTGGCTGAGAAGGAGTCGGAATCATATCCTTCCTACTAATCAGCTGATGACACGGACGAGCAGAAGCTAACACCGCCGCCCTACAAGCCGTACTATACAACCGAGTCGGTGATATTGGCCTAATCCTCTGCATAGCATGACTAGCATCTGCCACAAACACCTGAGAAATCCAACAACTACCATCCCCTTCTCAAACCCCAACACTCCCCCTCCTAGGTCTAATTCTAGCCGCAACCGGGAAATCCGCCCAATTTGGCCTACACCCTTGACTCCCAGCCGCCATAGAAGGACCTACCCCCGTATCCGCCCTGCTCCACTCCAGCACAATGGTAGTAGCCGGAATCTTCCTACTAATCCGAACTCACCCCCTATTTAACAACAACCAAACCGCCCTAACCCTATGCCTCTGCCTAGGAGCCCTATCCACCCTATTTGCAGCCACATGCGCCCTCACCCAAAACGACATCAAAAAAATCATTGCCTTCTCCACCTCAAGCCAACTAGGCCTAATAATAGTTACAATTGGATTAAACCTCCCTGAACTTGCCTTCCTACATATCTCAACCCACGCATTCTTCAAAGCCATACTCTTCCTATGCTCAGGGTCCATCATCCACAACCTAAACGGCGAACAAGACATTCGAAAAATAGGAGGACTCCAAAAAATAATACCCACTACCACCTCATGTCTAACCATCGGAAACCTAGCCCTAATAGGAACACCCTTCCTGGCAGGATTCTACTCAAAAGACCAAATCATCGAAAGCCTAAACACCTCCTACCTAAATACCTGAGCCCTACTACTAACCCTACTAGCCACATCCTTCACCGCAGTATACACAACCCGCATAACCGTACTCGTACAGACCGGCTTCGTCCGAATTTCCCCCTTAACCCCAATAAACGAAAACAACCCCGCAGTAACCTCACCAATCACCCGACTTGCACTAGGAAGCATCATAACAGGCTTCCTCATTACTTCATTCATCATCC---CAACAAAAACACCTACAATAACCATGCCCCTCTCCATTAAAATAACTGCCTTAACAGTAACCGCCCTAGGAATTGCCCTAGCCCTAGAAATCTCAAAAATAACCCAAACCCTCCTCCCCACAAAACAAACCACTTTCTCAAACTTCTCTACCTCCCTGGGATACTTCAATCCCCTAGTCCACCGCCTAAGCATGTCTAACCTCCTCAATGGAGGACAAAACATCGCCTCTCACCTAATTGACCTATCCTGATACAAAATACTAGGACCAGAAGGACTAGCCAACCTACAACTAGCAGCAACCAAAACCGCCACCTCCCTCCACTCAGGCCTAATCAAAGCCTACCTAGGAACATTCGCCCTCTCCATCATCATCATCCTCA---TATCCTCATACAGAA----AC-C-C---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAACAACGCCCTGATTGACCTACCCACACCACCAAACATTTCAACATGATGAAACTTTGGGTCTCTCCTAGGCATCTGCTTAATTACTCAAATTGTTACCGGTCTTCTGCTAGCCACACACTACACAGCAGACACCAACCTAGCTTTCTCCTCTGTAGCCCACATATGCCGTGACGTACAATTCGGCTGACTAATTCGCAACCTCCATGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACATATTGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAAACCTGAAACATCGGAGTAATTCTCCTCCTAACCCTCATAGCAACTGCCTTCGTAGGCTACGTACTGCCATGAGGACAAATATCATTCTGAGGAGCTACAGTAATTACAAACCTATTCTCAGCAATCCCCTACATTGGACAGACACTAGTAGAATGAGCCTGAGGAGGATTCTCTGTCGACAACCCAACACTCACCCGATTCTTCGCCCTCCACTTCCTCCTTCCCTTTGTAATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTTCACGAAACAGGATCCAATAACCCAACAGGAGTACCCTCAGACTGTGACAAAATCCCATTCCACCCATACTATACCGTAAAAGACATCCTAGGCTTTGCATTAATAATCTCCCTACTCGCCTCCCTAGCCCTATTCTCCCCCAACCTGCTAGGAGACCCAGAAAACTTCACACCAGCCAACCCCCTAGTAACACCCCCTCACATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATCCTACGATCTATCCCTAACAAACTCGGAGGCGTCCTAGCCCTAGCCGCCTCAATCCTCGTACTATTCCTAATACCTCTACTCCACACATCAAAACTACGATCAATAACCTTCCGCCCTATCTCACAAATCCTATTCTGAGCCCTAGTTGCAAACGTCCTCATTCTAACATGAGTGGGAAGCCAACCAGTAGAACACCCGTTCATTATCATCGGCCAACTAGCCTCATTCTCCTACTTCACCATCATTCTAGTCCTATTCCCCATTGCGGCCGCGCTAGAAAATAAACTACTAAAACT----------TTA-ACT-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Luscinia_calliope_NC_015074 GTCCCTGTAGCTTACAC-AAAGCATGGCACTGAAGATGCCAAGACGGCTGC--CACC-CGCACCC-AAGGAC--AAGAGACTTAGTCCTAACCTTACTGTTAGTTGTTGCTAGGTTTATACATGCAAGTATCCGCGCCCCAGTG-TAGATGCCCTGGACA-CCT-TAAACCCC-----AAGTAGATAGGAGCGGGCATCAGGCTCA--C------CAT-C--CCCGTAGCCCAAGACGCCTAGCAATTGCCACGTCCCCACGGATTCTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAACC---TCAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGATTAAAAAGCAACTGAGCTGTCATAAGCACAAGATGC-TCATAAGGCCTCCATCCTCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGTT-CCA--CCTTACCTGAACATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCATTTCTTGC-CAA-TAA--CAGCCTATATACCGCCGTCGCCAGCTCACCTTCC--CTGACAGCCCAACAGTGAGCGCAATAG-CCCCA-TGACGCTAGTAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAATTAGAACA-T----AACGGCAAAGGGATATGAAACTGTCCCTGGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCGCAAG-CG---ACCAACACACCCTAT-ACCTAATAAGCCAT-CC--AGCTAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTTAATA-AAAGCATTCAGCTTACGCCTGAAAGATATCTGCCC-ACACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AACAT-ACATTG------ACCCGGA-ATAAC--AAAGCTACT--CC-CTA-AACCC----AACCAAAGCATT---T--GCTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGG-GCGATAGAGAC-CACGTACCGTAAGGGAAAGATGAAATAACAATG--AATAGCC--TAAGCTA-TAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGT--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACCCATGAGCAGCTAT-TACTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGTGGGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGG-AAAC--CACG-AACCCCA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--AACCT--ACACAAAACCTATATTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCCGT-ACCA-AAAAATACCTA-AACCTTATGACTCCCT-CCCCACTAACAGGCCAACCTATAACCAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCCACA-CATTATTAACAAA-CCCCCA-ATATACGA--TCAGT---------TCA---ACAAGCA-GAG-TATTA-AACACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGCAAAAGGAACTAGGCAAA-CCACCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCAAA--ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACCT-GAC---GTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCAGGCAATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGGGATAAACCCATAAGACGGGAAGACCCTGTGGAACTTCAAAAACAGCAGCCACC--CCAAAT-AACATA----AA-CACCCA--C-T-GGGCCCACTCAC-ACA-TAA-GC-C-ACTGGCC-TGCATTTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAACTGGACCATACCTCTAGACCA-AGAGCAACCTCTCAACGTGCTAAAAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTTTAAGAGTCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATGATG-AGCTCTTCCCAGTACGAAAGGATAGGAA-AAGCAAGGCCAATACCACTA-GCAAGCCTTC-GCCTTAAGTGATGAAGTCAACTTAATCACAAAAAGCTATCAC-ATACC---A-CCC-CACCCTAGAAAAGGGCCC-CAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTCCC------------------------ATGAC----------CAACCACCCCCTACTAATCAACACCATTATAGCACTCTCCTACGCCCTCCCCATCCTGATTGCAGTAGCCTTTCTCACACTAGTTGAACGTAAAATCTTAAGCTACATACAAGGCCGAAAAGGCCCAAACATTGTCGGACCCTACGGGCTACTTCAACCCCTAGCAGATGGGGTTAAGCTATTCATCAAAGAACCCATCCGTC---------CATCAACATCCTCCCCCATTCTATTTATTGCGACCCCAATGCTAGCACTTCTCCTGGCAATTTCTATTTGAACTCCACTCCCTCTGCCATTCTCACTTGCAGACCTAAACCTAGGTCTACTCTTCCTCCTAGCCATATCAAGCCTAGCAGTGTACTCCATCCTCTGATCAGGATGAGCCTCCAACTCAAAATATGCTCTAATTGGAGCATTACGGGCAGTAGCACAGACTATTTCCTATGAAGTAACCCTAGCTATTATCCTTCTCTCTGTGATCCTACTGAGTGGCAACTACACCCTCAGCACCCTTGCGGTCACCCAAGAACCCCTGTACCTTATCTTCTCCTGCTGACCACTAGCCATGATGTGGTACGTGTCCACACTCGCCGAAACCAACCGAGCCCCATTCGACCTAACAGAAGGTGAATCCGAACTAGTTTCGGGGTTTAACGTAGAATACGCAGCAGGGCCTTTTGCCCTATTCTTCCTAGCCGAATACGCCAACATCATGTTCATAAATACACTAACCGCCATCCTCTTTCTCAACCCAAGCGCCCTCAATCCACCCCAAGAGCTATACCCAGTAATCCTAGCCACAAAAGCCCTACTTTTATCAGCGGGCTTCCTATGGATCCGCGCCTCTTACCCACGCTTCCGATATGACCAGCTAATGCACTTATTATGAAAAAACTTCCTCCCCCTCACACTTGCCCTATGCCTATGACACACCAGCATACCAATCTGCTATGCAGGGTTACCC-----CCCTATCTAAG--ACCTCCTTCCCCAGCTCCCTCGGAAATGTGCCTGAGAGT-C--AAGGATCACTATGATAAAGTGAACACAGAGGTGCACCAACCCTCTCATTTCCTAA--ATAT-------TTAGAAAAGCAGGAATTGAACCTACACTGAAGGAATCAAAATCCTCCATACTTCCTTTATATTATTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACCCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAGTCTTTACCATCAGCCTACTCCTAGGAACTACCATCACGATCTCAAGTAACCACTGAATCA---TAGCCTGAGCTGGACTCGAAATTAACACCCTAGCTATCCTGCCCCTAATCTCAAAATCCCACCACCCGCGGGCCATTGAAGCCGCAACTAAATACTTCCCAGTCCAAGCAGCTGCCTCCACCCTAATTCTATTCTCAAGCATAACCAACGCATGACAAACCGGGCAGTGAGACATCGCCCAGCTAACTTGCCCAACATCATGCCTAATCCTAACTACAGCTCTTGCAATAAAACTAGGGCTAGTCCCGTTCCACTTCTGATTCCCCGAAGTACTCCAAGGCACCTCTCTAACCACCGGCCTTCTCCTATCCACAGCCATAAAATTCCCCCCAATAACACTATTCTTCATAACCTCCCAATCACTAAATCCAACCCTACTAACCATCATGGCCATCCTCTCCGCAGCCCTGGGAGGGTGAATGGGGCTAAATCAAACACAAACCCGAAAAATCCTGGCTTTCTCATCCATCTCGCACTTAGGCTGAATAGCCATCGTTATTGTCTACAGCCCTAAACTTGCACTATTAAACTTCTTCCTGTACGCCTTAATGACTACAGCCGTATTCTTGACCTTAAACTCAATCAACACCCTAAAATTATCCACGCTCATAACTACATGAGCAAAAACCCCAGCACTAAGTGCAGCCCTAATACTAACCCTCCTCTCCCTTGCAGGTCTTCCCCCTCTAACAGGATTCCTTCCCAAATGACTAATCGTCCGAGAACTAACCAAACAAGGCATAGCCCCAGCAGCAACAATCATCGCCCTCCTTTCCCTTCTAAGTCTATTCTTCTACCTCCGACTTGCGTACTGTGCCACAATCACACTCCCCCCACATACTACCAACCACATAAAACAATGGCACACTAACAAACCCGTCAGCATCTTAGTTGCCATGCTAATCACTATATCTATCACCCTCCTACCAGTCTCACCCATAATCCTCACCATTGT------CT----AAGAAACTTAG----GATCACCT-TAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGCTAAGATTCGCAGGACGTTACCCTGCATCTTCTGAATGCAACCCAGATACTTTAA-TTAAGCTAGAACCTT--------GGCACTAGGCAGATGGGCTTCGATCCCATAACAC-TATAGTTAACAGCTATATGCCCAAACC-AACAGGCCTCTGCCT-A-------------AGGCCCCGGCGCGCAA-TTAGCGCACATCAATGAGCTTGCAACTCACCATGAACTTCACTACAAGGCC---GATAAGAAGAGGAATCAAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ATACACTCAGCCATC--------------TTACCTGTGACTTTCATTAACCGATGATTATTCTCAACTAACCACAAAGACATCGGCACCCTCTATCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTGGGCCAACCAGGCGCCCTACTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCACGCTTTCGTGATAATCTTCTTTATAGTCATACCAATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTACTCCCCCCATCCTTCCTTCTTCTCCTAGCCTCCTCCACAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTATACCCGCCCCTCGCCGGCAATCTAGCCCATGCCGGGGCTTCAGTAGACCTGGCCATCTTCTCCCTCCACCTGGCAGGTATCTCTTCAATCCTAGGTGCCATCAACTTCATCACAACAGCAATCAACATAAAACCCCCAGCCCTCTCACAGTACCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACCGCAGTCTTACTCCTCCTATCCCTCCCCGTCCTTGCTGCCGGCATCACCATGCTTCTAACTGATCGCAACCTAAACACCACCTTTTTCGACCCCGCAGGAGGAGGGGACCCAGTACTCTACCAACACCTCTTCTGATTTTTCGGACATCCAGAGGTCTACATCCTAATCTTACCAGGATTCGGAATTATCTCCCACGTCGTAGCCTACTACGCAGGGAAAAAAGAGCCATTCGGCTACATGGGCATAGTATGAGCAATGCTATCCATCGGATTCCTGGGGTTCATCGTCTGAGCCCACCACATATTCACAGTAGGAATGGACGTAGACACCCGAGCATACTTTACATCCGCTACCATGATCATCGCCATTCCAACAGGGATCAAAGTATTCAGCTGACTCGCAACACTGCACGGAGGCACAATCAAATGAGATCCGCCCATATTATGAGCCATAGGGTTCATCTTCCTATTCACCATCGGAGGCCTAACGGGAATTGTCCTAGCAAATTCTTCTCTAGACATTGCCCTACACGACACCTACTATGTAGTAGCCCACTTCCACTACGTCCTATCCATAGGCGCAGTATTTGCAATTCTAGCGGGTTTCACACACTGATTCCCCCTGTTCACTGGCTACACCCTCCACTCTACATGAGCTAAAGCCCACTTCGGCGTAATGTTCGTAGGGGTCAACCTAACCTTCTTCCCCCAACACTTCCTAGGCTTGGCCGGTATGCCACGACGATACTCAGACTACCCAGATGCCTACACACTATGAAACACTATCTCCTCCATCGGCTCTCTAATCTCCCTAACAGCCGTAATTATGCTAGTGTTCATCATCTGAGAAGCCTTTGCATCAAAACGTAAAGCATTCCAACCAGAACTAACAAGCACCAACATCGAGTGAATTCACGGCTGCCCTCCCCCATTCCACACATTCGAAGAGCCAGCCTTTGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGCATAT--AAACCACTTATGCTTCTTTCTC---AT---AGAAGTGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATCACAGGTTAAACCCCTGTACACTTCAC---CCACCAAAAAAATGGCCAACCACTCACAATTCGGTTTCCAAGACGCTTCATCCCCTATCATAGAAGAACTAATACAATTTCATGACCACGCCCTAATAGTTGCCCTCGCCATTTGCAGCCTTGTCCTATACCTACTAGCCCTGATACTCACAGAAAAGCTATCATCAAGCACTGTCGATGCCCAAGAAATCGAGCTCGTCTGAACAATCCTCCCAGCCGCAGTCCTAATCATACTTGCCCTCCCCTCCCTACGAATCCTCTACATAATAGACGAGGTAAACGAACCAGACCTAACCCTAAAAGCCATCGGACACCAATGATACTGATCATACGAGTACACCGACTTCAAAACCCTCACCTTCGACTCCTACATAATCCCCACATCAGACCTCCCACTAGGTCACTTCCGCCTACTAGAAGTCGACCATCGTGTCATCGTACCAACAGAATCCAAAGTCCGAGTTATCGTCACCGCCGACGACGTACTCCACTCCTGAGCCGTCCCCAGCCTTGGTGTAAAAACCGATGCAATCCCAGGTCGCCTCAACCAAACCTCCTTCCTCGCCTCCCGTCCCGGAGTGTACTACGGGCAGTGCTCAGAAATCTGCGGAGCCAATCACAGCTTCATGCCAATCGTAGTAGAAGCAACCCCTCTAGCTAACTTCGAGAACTGATCCTCCCTAC---TATCTTCCT----------AATCATTAAGAAGCTATGAAACAGCACTAGCCTTTTAAGCTAGAGAAAGAGGA---CCAGCCCCTCCTTAATGGTATGCCTCAACTAAACCCAAATCCATGATTTTTTATCATGCTTACTTCATGACTCACCTTCTCCATGATCATCCAACCCAAACTACTCACATTCATCACTATGAACCCCCCATCCAGCAAAA---CGCCCACAACCCCTAAAACCACCCCCTGAACCTGACCATGAACCTAAACTTCTTCGACCAATTCTCAAGTCCCTCCCTACTAGGCATCCCCTTAATCCTAATCTCCATGGTCTTCCCAGCCCTCCTCCTCCCATCCCCTGGCAACCGATGAATCACCAACCGACTCTCCACCCTACAACTGTGATTCATCAACCTCATCACAAAACAACTAATAATGCCACTCAATAAAAAAGGACATAAATGGGCCCTAATTCTAACGTCCCTAATAATCTTCCTATTATTAATCAACCTACTAGGACTACTACCCTACACATTTACACCAACCACCCAACTATCCATAAACCTGGCTTTGGCCTTCCCCCTATGACTAGCCACGCTCCTAACAGGCCTACGAAACCAGCCCTCCGCCTCCTTAGGCCACCTCCTACCAGAAGGCACCCCCACGCCCCTAATCCCCGCCCTAATCATGATCGAAACAACAAGCCTCCTCATCCGACCCCTAGCACTAGGCGTCCGCCTAACCGCCAACCTAACAGCAGGCCACCTCCTCATCCAACTCATCTCCACTGCCACAGTAGCCTTATTCTCAACAATACCAGCAGTATCCCTACTAACCCTAATTGTTCTCTTACTCTTAACCATCCTAGAAGTAGCAGTAGCCATAATCCAAGCCTACGTATTTGTCCTCCTACTAAGCCTCTACCTACAAGAAAACATCTAACAC-------CAATGGCACACCAAGCACACTCTTACCATATAGTAGACCCAAGCCCATGACCTATCCTAGGAGCAGCCGCCGCTCTTCTCACCACCTCAGGCCTAACCATATGATTCCACTATAGCTCACCCCAACTCCTAATCATTGGCCTCACCTCAACCCTCCTAGTTATATTCCAATGATGACGCGATATCGTACGCGAAAGCACCTTCCAAGGCCACCACACCCCTACCGTACAAAAAGGCCTACGATACGGCATAGTACTGTTTATCACATCAGAAGCCTTCTTCTTCCTCGGCTTCTTCTGAGCATTCTTCCACTCAAGCTTAGCCCCCACCCCCGAATTAGGGGGCCAATGACCCCCTGTCGGGATTAAACCACTAGACCCAATAGACGTACCCCTTCTAAATACCGCAATCCTACTAGCTTCAGGGGTAACAGTCACATGAGCCCACCACAGTATTACAGAAGCAAACCGAAAACAAGCAATCCAAGCCCTAACTCTAACAGTTCTCCTAGGCTTCTACTTCACCGGCCTTCAGGCCATAGAATACTACGAAGCCCCATTCTCCGTCGCAGACGGAGTTTACGGCTCAACCTTCTTCGTCGCCACAGGATTCCACGGCCTACATGTAATCATCGGCTCTACATTCCTCCTGGTCTGCCTCTTTCGCCTGATTAAATTCCACTTCACATCAAACCACCACTTTGGCTTCGAAGCAGCAGCATGATACTGACACTTCGTAGATGTTGTCTGACTCTTCCTCTACATTTCCATCTACTGATGAGGATCTTGCTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTTAAATCTGGTTTAAACCCAGAGAAGAGCAATG---AACATAATCATATTCATGATCGCCATGTCCCTGACCCTAAGCATTGCCCTAACCGCCCTCAACTTCTGACTAGCCCAAATAACCCCAGATTCAGAAAAACTATCCCCATATGAATGCGGATTTGACCCACTAGGATCTGCCCGACTCCCCTTTTCAATCCGATTCTTCCTAGTAGCAATCCTATTCCTACTATTCGACCTAGAAATCGCCCTCCTACTCCCCCTACCCTGAGCAACACAACTCGAGTCCCCTACAACCACACTAATTTGAGCTTCTACCCTACTGTTTCTTCTCACCCTAGGTCTGGTATACGAGTGGATCCAAGGAGGGCTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACCAAGACAGTTGGTTTCGGCCCAACAAATTATAGTACTCACCCTATAACTTTCTTCATGTCCCACTTACACCTAAGCTTCTACGCAGCATTCACCCTAAGCAGCCTAGGCCTAGCCTTCCACCGAACACACCTAATCTCAGCCCTACTTTGCCTAGAAAGTATAATACTATCAATGTATGTCGCCCTAACCATATGGCCGATCCAAATACAAGCGCCATCCTCCACCATCCTCCCCATTCTCATACTAACATTCTCTGCTTGCGAGGCAGGAGCAGGACTAGCACTGCTAGTAGCCTCCACCCGAACCCACGGCTCCGACCACCTCCACAACTTCAACCTCCTACAATGCTAAAAATCATTATCCCAACCATCATACTCCTCCCCCTAGCCCTCCTCTCCCCCTGCAAACACCTATGAACCAACATTACAACCCACAGCCTACTAATCGCCGCCATCAGCCTTCAATGACTAGCCCCAACATACTACCCAGGCAAAACCCTTACCCCCTGGGCCTCCATCGACCAGATTTCCTCCCCCCTACTAGTACTTTCATGCTGACTACTCCCCCTCATAATCATAGCAAGCCAAAACCACCTAGAACAAGAACCCCCCATCCGCAAACGAATCCTCGCCACAACCCTAATCCTAGCCCAACCATCAATCCTCTTAGCCTTCTCTGCCTCAGAACTAATACTATTTTACATCGCATTCGAATCCACCCTAATCCCCACTCTAATCCTCATCACACGCTGAGGCAACCAACCAGAACGACTAAGTGCCGGCATTTACCTTCTATTCTATACCCTAGCCAGCTCCCTCCCCCTGCTCATCGCCATCCTACACCTACACGACCAAATTGGGACCCTATACTTCCCTATACTCAAACTCTCACACCCTACAACTCCATCCTCCTGAACCGGTCTAATATCAAGCCTAGCCCTACTAATAGCCTTCATAGTAAAGGCTCCTCTATATGGACTACACCTGTGACTTCCAAAAGCCCATGTAGAAGCCCCTATTGCCGGATCCATGTTACTAGCCGCCCTCCTACTAAAACTAGGAGGATACGGCATTATACGAATCACCCTGCTAGTAAACCCATCAACAAACAACCTCCACTACCCCTTTATCACCCTCGCCCTATGAGGTGCTCTAATAACTAGCGCCATCTGCTTACGCCAAATAGACCTAAAGTCACTAATCGCATACTCATCTGTCAGTCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACCCAATGAGCATTCTCAGGAGCAATAATCCTAATAATCTCACACGGCCTAACCTCTTCAATACTATTCTGCCTAGCCAACACCACCTACGAACGAACCCACAGCCGCATCCTCCTACTAGCTCGAGGACTCCAACCCCTCCTACCCCTCATAGCCACCTGATGACTCCTAGCCAACCTGGCAAACATGGCACTCCCCCCAACAATTAACCTCATAGCTGAACTAACCATTGTAATCGCACTTTTCAACTGATCCTCCCTAACACTCATCCTCACAGGGACTGCAATCCTACTAACCGCTTCATACACCTTATATATGCTCATGATAACCCAACGAGGCGTTCTACCATCCCACATTACATCCATCCAAAACTCCTCCACACGAGAACATCTCCTCATGGCCCTTCACATAATCCCTATAATCCTCTTAATCTTTAAACCCGAACTTATCTCCGGCATCCCCATAT-GCAAGTATAGTTT-TAACCCAAAACATTAGACTGTGATTCTAAAAATAGGAGTTAAACCCTCCTTACCTGCCGAGGGG-AGGTT-CAACCAGCAAGAACTGCTAATTCTTGCATCTGAGTGTAA-AACCTCAGCCCCCTT--ACTTTCAAAGGATAATAGCTATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGAACCAACCACTAGTCCTCAACACGTTCATACTACTAACCCTAGCAACCCTTTCCACCCCAATTATCTTCCCCCTCCTCTCAGACAGCCTTAAAAACACCCCTACCACCATCACTAATACAGTAAAAACCTCCTTCCTAATCAGCCTAGTCCCCATAACAATCTACATCCACTCAGGGACAGAAAGCCTAACCACCCTATGAGAATGAAAATACATCATAAACTTCAAAATCCCTATCAGCCTAAAAATAGACTTCTATTCCCTCACATTCTTCCCAATCGCCCTATTCGTATCTTGATCTATCCTACAATTTGCAACATGATACATGGCCTCAGACCCCTACATCACAAAATTCTTCACCTACCTCTTATTATTCCTAATTGCAATACTCATCTTAATTGTCGCTAACAACTTCTTCGTCCTATTCATTGGCTGAGAGGGGGTCGGAATCATATCCTTCCTCCTAATCAGCTGATGACACGGACGAGCAGAAGCCAACACCGCCGCCCTCCAGGCCATCCTATACAACCGAGTTGGAGACATCGGCCTTATCCTATGCATAGCCTGACTAGCCTCCACACTAAACACCTGAGAAATCCAACAAATCTCCTCACCCTCCCAAACCCCCACACTCCCCCTATTAGGCCTCATCCTAGCCGCAACAGGCAAATCCGCCCAATTTGGCCTACACCCATGACTCCCAGCCGCCATAGAAGGCCCAACCCCAGTATCCGCCCTACTCCACTCCAGCACAATAGTAGTCGCCGGGATCTTCTTACTTATCCGAACCCACCCCCTATTTAGCAACAACCAAACAGCCCTTACCCTATGCCTATGCCTCGGAGCTCTGTCCACACTATTCGCAGCCACCTGCGCCCTCACCCAAAACGACATCAAAAAAATCATCGCCTTCTCAACTTCAAGCCAATTAGGCCTCATAATAGTAACAATCGGACTAAACCTGCCCCAACTGGCCTTCCTCCACATCTCAACCCATGCATTCTTCAAAGCCATGCTATTCCTCTGCTCCGGCTCCATCATCCACAGCCTCAACGGCGAACAAGACATTCGAAAAATAGGAGGTCTCCAAAAACTACTACCAACAACCACCTCATGCCTCACCATTGGAAATCTAGCCCTAATAGGAACCCCATTCCTGGCGGGCTTCTACTCAAAAGATCAAATTATCGAGTGCCTCAACACATCATACCTAAATGCCTGGGCCCTCCTACTAACCCTCTTAGCCACAGCCTTCACCGCAGTATACTCAATCCGCATAACCGTACTTGTGCAAGCCGGATTCGTACGCATCCCTCCCCTCACCCCAATAAATGAAAATAACCCCGCAGTAATCTCCCCAATCACCCGCTTAGCGCTAGGCAGCATCACAGCTGGGTTCATCATCACCTCATTCATTCCCC---CAACAAGCACACCACCCACAACAATACCTCTACACATCAAAATCACCGCCATAATCGTCACAATCCTGGGCATCCTCCTCGCCCTAGAAATCTCAAAAATAACTCAAGTCATAATCCTCACAAAACAAGGACCCTTCTCAAACTTTTCTACATCCCTAGGCTACTTCAACCCATTAGTACACCGATTCAGCGTGACAAGCCTCCTAACTGCAGGCCAAAACACCGCCTCCCACCTAATCGACCTCTCCTGATACAAACTACTAGGACCAGAAGGACTAGCCAACCTACAAACAATAGCAGCTAAAACCCTCACCACCCTTCACTCCGGACTAATCAAGGCCTACCTAGGATCCTTTGCCTTATCCATCCTCATCGTCCTCA---TATCCATACACAGAAC--CAACT-----AATGGCCCTCAATCTTCGTAAAAACCACCCACTATTCAAAACCATCAACGATGCCCTAATCGACCTTCCAACACCATCAAACATCTCAGCTTGATGAAACTTCGGATCGTTACTAGGCATCTGCCTAATCACACAAATCGTCACCGGTCTACTACTAGCTACACACTATACAGCAGACACCTCCCTAGCCTTCAACTCTGTTGCCCACCTATGCCGAAATGTCCAATTTGGCTGACTAATCCGAAACCTCCACGCAAACGGCGCCTCATTCTTCTTTATCTGCATCTACCTCCACATTGGCCGAAGCTTCTACTATGGCTCTTATCTCAACAAAGAGACCTGAAACGTCGGAGTCGTCCTCCTTCTAGCACTAATAGCAACTGCTTTCGTAGGATACGTCCTGCCCTGAGGACAAATGTCTTTCTGAGGGGCTACAGTAATTACCAACCTATTCTCAGCCATCCCATACATTGGTCAAACACTAGTAGAATGAGCCTGAGGTGGGTTCTCAGTAGACAACCCCACACTCACCCGATTCTTCGCCCTACACTTTCTTCTCCCATTCCTAATTGTAGGCCTCACACTAGTACATCTCACATTCCTACACGAGACAGGCTCAAACAACCCACTAGGCATTCCCGCAGACTGCGACAAAATCCCATTCCACCCCTACTACTCCACAAAAGACATCCTGGGGTTCGCACTAATACTCATCCCCCTCATCGCCCTCGCCCTATTTTCTCCCAACCTACTAGGAGACCCAGAAAACTTCACACCAGCCAACCCACTAGCCACACCACCCCACATCAAACCCGAATGATACTTCCTATTTGCATATGCCATCCTACGCTCAATCCCAAACAAACTAGGAGGGGTACTAGCCCTAGCCGCTTCTGTCCTAGTCCTATTCCTCGCCCCACTACTACACACATCCAAACAACGCTCACTAACCTTCCGACCCATCTCACAAGTCCTATTCTGAGCCCTAGTTGCTAACCTATTTATCCTAACCTGAGTGGGAAGCCAACCAGTCGAACACCCATTCATTATCATCGGCCAATTAGCCTCCTTATCTTATTTCACAATCATTCTAGTCCTATTCCCTCTTGCAGCCGTACTAGAGAACAAAATACTAAACCT----------CTA-ACC-----------CACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTTCGCCCCTTCTTAGAGTT Macroagelaius_imthurni_JX516073 GTCCTTGTAGCTTATAG-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGGAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGTTCCGGTG-TAGATGCCCTGGACA-CCT-A-AA-T-C-----AGGCAGATAGGAGCGGGTATCAGGCTCA--C------CAC-A--ACCGTAGCCCAAGACGCCTTGCAATTGCCACACCCCCACGGGTAATCAGCAGTAGTTAATATTAAGCAATGAGTGCAAACTTGACTTAGCCATAGCAAA-T---CTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACTTTA--T----AACGGCGTAAAGAGTGGTCAC-ATGTTAT-CCAAGTAGCTAAGACTAAAAAACATCTAAGCTGTCACAAGCCCAAGATGT-CAGTAAGACCTCC-ACATCAAAGAAGATCTTAGAAC--AACGATCAATTGAATTCCACTAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAT--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACTAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGTTA-TACCTGACCATTCCTTGC-CAA-AAT--CAGCCTACATACCGCCGTCGCCAGCCCACCTACA--CTGAAAGCCCAACAGTGGACGCAATAG-CCTCA-CCACGCTAATAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GC-AGTAATGGGCTACATTTTCTAAGCTAGAACA-T----AACGGCAAAGGGGTATGAAACAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCCCTGGGACATGTACATACCGCCCGTCGCCCTCCTCGCAGG-CG----CCCCCTCACCCAATAAACTAATAAGTTAT-CC--AGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCGAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ATACCAGATCGTCTTGA-TGCCAAACTCTAGCCC--------AATCG-ACA-TG------ACCTGGA-ATAAC--AAAGCTACTACCC-C-A-AACCC----AACTAAAGCATT---C--ACTAGT-CCCAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAC-TACGTACCGTAAGGGAAGGATGAAATAGCAATG-AAA---AC--TAAGCTA-TAAATAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCACCCCGAAACCCAAGCGAGCTACCTACGAGCAGCTAT-TATTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTGGTAGAGGTGAAAAGCCAAT-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTAAGTTCACTCTTAATTCTTCTCCAAGGAAAAC-TCACG-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGAGGGACAGCTCCTTTAAAAAAGAATACAATCTCCA-CGAGCGGATA----AAT--ATATA-CCC-CCTAAC-TGAACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCCAC-ACCACAAAAATATAAG-AACCCCATGACTCCCT-CCCCATTAACAGGCTAACCTATATTCAGATAGGAGAATTAATGCTAGAATGAGTAACCAGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCTGTA-CATTATTAACAAG-TCCACA-ATATACGA--CAAAT---------CAA---ACAAGCA-CAG-TATTA-AACATA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCTAAA-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--GC---GTTCAACGGCCGCGGTATCCTGACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTACAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTT-AAACCAACAACCACC--CTAAAT-CACATA----CT-CACCCA--T-C-GGGTTCACTGAC-ACA-TAATGG-C-CCTGGTTACGCG-GTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AAAACCTCCAA-AAATTAGACCATACCTCTAGACTG-AGAGCAACCTCTCAACGTGCTAATAGCATCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCCCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AGCTCTTCCCAGTACGAAAGGATAGGAA-AAGCGAGGCCAATACCACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTTAATTACAAAAGGCTATCAC-ACCAC---C-CCA-CGTCCAAGAAAAGGA--C-CAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAATTCAGAGGTTCAAATCCTCTCCCTAGC-----TTAACT---CC-----CC--AA--C----ATGAC----------CAACTACCCTATTCTAATCAACTTAATCATAGCCCTCTCCTATATCCTACCAATCCTAATCGCAGTAGCTTTCCTCACACTTGTAGAACGCAAAATCCTGAGTTACATGCAGGGCCGAAAAGGCCCAAACATCGTCGGCCCCTTTGGACTTCTCCAGCCCCTGGCAGACGGTGTCAAACTGTTCATCAAAGAGCCAATCCGAC---------CATCAACATCCTCTCCAATATTATTTATTGCAACCCCGGTCCTAGCTCTTCTCCTAGCTATCTCAATCTGAACCCCATTACCCCTCCCATTCTCTCTAGCAGACCTCAATCTGGGGCTTCTTTTCCTACTAGCCATGTCAAGCCTAGCAGTATACTCTATCTTGTGATCAGGCTGAGCCTCCAATTCCAAATACGCCCTGATTGGAGCTCTACGAGCAGTAGCCCAGACAATCTCCTACGAGGTAACCTTAGCTATCATTCTCCTCTCCGTCGTACTTCTTAGCGGTAACTACACCCTGAGCACCCTCGCAACCACTCAAGAACCATTATACCTTATCTTCTCCTGCTGGCCCCTTGCTATAATATGATACGTCTCCACACTAGCTGAAACTAACCGTGCTCCTTTCGACTTGACAGAAGGAGAATCTGAACTAGTGTCCGGATTCAACGTAGAATATGCGGCAGGTCCTTTCGCACTATTCTTTCTAGCCGAATACGCTAATATTATACTCATAAACACACTAACCACAATCCTATTCTTCAACCCAAGCTTCCTTAACCCACCCCAAGAGCTATTTCCAGTCATCCTAGCCACAAAGGTCCTACTTTTATCAGCAGGATTCCTATGAATTCGTGCTTCCTACCCGCGATTCCGATACGACCAATTAATACACTTACTATGAAAAAACTTCTTACCGCTCACACTAGCACTATGTCTCTGACACACCAGCATACCAATTTGCTACGCGGGCCTACCC-----CCTTACCTA-A--GG-TC-----------TTGTTGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAACCCTCTCATTTCCT-G--ATAA-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTCCCCTTATATTACTTTCT----------------AGTAGGGTAAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAGCCTGATTTTCATCATTAGCCTACTTCTAGGGACAACTATCACCATCTCAAGCAACCACTGAATCA---TAGCCTGAACCGGCCTCGAAATTAACACACTTGCCATCCTCCCATTAATCTCTAAATCCCACCACCCGCGAGCCATTGAAGCCGCCACCAAATACTTCTTAACTCAAGCAGCTGCCTCCGCCCTAGTACTATTCTCCAGCATAACCAATGCATGACACACCGGACAATGAGACATCACCCAACTTACCCATCCAACATCCTGCCTGATTCTTACCTCAGCAATCGCAATAAAACTAGGACTGGTACCATTCCATTTTTGATTCCCGGAAGTACTCCAAGGCTCTCCCCTCACCACTGGCCTACTTCTATCCACAATCATGAAACTCCCCCCAATCACATTACTCTACATAACCTCCCCCTCACTAAACCCTACACTATTAACCACCTTAGCCATCCTTTCTGCAGCCCTCGGAGGCTGAATAGGTCTCAACCAGACACAAATCCGAAAAATCCTAGCCTTTTCTTCCATTTCCCACCTGGGTTGAATAGCAATCATTATCATCTACAACCCCAAACTCACACTCCTCAACTTCTACCTGTACGCCATAATAACCGCAACTGTCTTCCTCACCTTAAACACAATTAAAGTACTAAAACTATCTACCCTAATAACCGCATGAACTAAAACCCCATCCTTAAACGCAATGCTACTCCTAACCCTGCTTTCCCTCGCAGGACTCCCTCCCCTAACAGGATTCCTGCCTAAATGACTCATCATCCAAGAACTAACTAAACAAGAAATAATCCCAGCGGCTACACTTATCTCTCTACTATCTCTACTAAGCCTATTCTTCTACCTCCGACTAGCATACTGTGCAACCATCACACTCCCCCCACACACTACAAATCATGTGAAACAATGACGCACTAAAAAATCAACCAACATCACAATTGCCATCCTAACCACTATGTCCGTCATACTCCTCCCTATCTCCCCCATAATCCTCACTATTGT------CT----AAGAAACTTAG----GATTACCT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCCATTACCCTGCATCCCCTAAATGCAACTCAGGTACTTTAA-TTAAGCTAGGACCTT------AATCTTCTAGACAGATGGGCTTCGATCCCATAATAC-TATAGTTAACAGCTATATGCCCTAACC-AACAGGCTTCTGCCT-A-------------AGACCCCGGTGCATGA-TTGACGCACATCAATGAGCTTGCAACTCACTATGAATTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-AAACACTCAGCCATC--------------TTACCTGTGACATTTATCGACCGATGATTATTCTCAACTAACCACAAAGACATTGGGACCCTATATCTAATTTTCGGCGCATGAGCCGGAATGGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCTCTTCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATTATGATCGGGGGGTTCGGGAACTGATTAGTTCCCCTAATAATCGGAGCCCCAGACATGGCATTCCCACGAATAAACAATATAAGCTTCTGACTACTTCCCCCATCCTTCCTTCTCCTACTAGCATCTTCCACAGTCGAAGCGGGCGTAGGAACAGGCTGAACAGTATACCCACCACTAGCAGGCAACCTAGCTCACGCCGGAGCCTCAGTCGACCTAGCGATTTTCTCCCTACATCTAGCTGGTATCTCTTCAATCCTAGGAGCAATCAACTTTATTACAACATCAATCAATATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCAGTCCTTATCACTGCAGTACTACTACTGCTATCCCTCCCAGTCCTCGCCGCAGGAATCACAATGCTTCTCACAGACCGCAACCTTAACACTACATTCTTTGATCCCGCTGGGGGAGGAGACCCTGTACTATACCAACACCTATTCTGATTCTTCGGCCATCCAGAAGTCTACATCTTAATCCTCCCAGGATTCGGGATCATCTCCCACGTAGTAGCCTACTACTCAGGCAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCCATGCTATCCATCGGATTCCTAGGCTTTATTGTCTGAGCTCATCACATATTCACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACTATAATCATTGCCATCCCGACCGGAATCAAAGTATTCAGCTGACTAGCCACACTGCATGGAGGCACAATCAAATGAGACCCCCCAATACTATGAGCTCTAGGATTCATCTTCCTATTCACCATCGGGGGACTAACAGGAATTGTCCTAGCAAACTCCTCACTAGACATCGCCCTGCACGACACCTACTACGTAGTAGCCCACTTCCACTACGTACTATCCATGGGAGCAGTATTCGCAATTCTAGCAGGCTTCACCCACTGATTCCCGCTATTCACCGGATACACACTTCACTCAACATGAGCTAAAACACATTTCGGCGTAATATTTGTAGGTGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGCATGCCACGACGATACTCAGACTACCCAGACGCCTACACACTGTGAAACACTATTTCTTCAGTAGGATCACTCATCTCTCTGACAGCCGTAATCATGCTAGTATTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGCCACACAATCAGAGCTAGCAAGCACTAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAACC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--AAACCACTTATGCTTCTTTCTC---ATA-AAGAGATGTTAGT-AAAATA-ATTACATAG-CCTTGTCAAGGCTAAATTGCAGGTGAAAACCCAGCACATCTCT-----ACCT------ATGGCCAACCACTCACAATTCAACTTCCAAGATGCCGCCTCACCCATTATAGAAGAACTAATAGGATTCCACGACCACGCCCTAATAATCGCACTAGCAATCTGCAGCCTAGTCCTCTACCTATTAACCCACACTCTGACAGAAAAACTGACATCAAACACAGTCAACTCACAAGCAATCGAACTAATCTGAACAATTCTCCCTGCCCTAGTCCTAGTCACACTCGCCCTGCCATCCTTACGAATCCTCTACATAATAGACGAAATCAATGAACCAGATTTAACCCTAAAAGCCATCGGACATCAATGATATTGAACCTACGAATACACTGACAACAAAGACTTAACATTCGACTCCTACATGATCCAAACAGCAGACCTTCCTCTAGGACACTTCCGCCTACTAGAAGTTGACCACCGTGTTGTCGTCCCAATAAACTCAACCATCCGAGTCATCGCCACCGCTGACGACGTCCTACACTCATGAGCTGTCCCCAGTCTAGGAGTAAAAACCGACGCAATCCCAGGACGTCTTAACCAAATTTCCTTCCTTGCCTCCCGACCAGGTGTGTACTACGGACAATGCTCAGAAATCTGCGGAGCCAACCACAGCTTCATACCAATCGTAGTAGAATCCACCCCCCTCGCTAACTTCGAAAGCTGATTCTCTCTAA---TAACATCCT----------AATCATTAAGAAGCTATGAATCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGGA--CCCCTCCCTCCTTAATGATATGCCTCAACTAAACCCCAACCCCTGATTTTTTATCATGCTCACTTCATGAATCACTCTATCTCTAATTATCCAACCCAAACTCCTAACATTCGTATCAATAAACCCCCCATCTAGCAAGC---CACCCGCTGCTCCAACCACCACTCCTTGAACCTGACCATGAACTTAGCCTTCTTCGACCAATTCTCAAGCCCATCATTCCTAGGAATCCCACTAATCCTCATCTCAATAACATTCCCAGCCCTCCTCATCCCATCCCTCGACAACCGATGAATCACTAACCGACTATCAACCCTTCAACTCTGATTCATCAATCTAGTCACAAAACAACTAATAACACCCTTAGACAAAAAAGGACATAAATGGGCCCTAATACTAACATCCCTCCTAATCTTCCTCCTACTCATCAACCTCCTAGGCCTACTACCATACACATTCACCCCAACCACCCAACTATCTATAAATTTAGCTTTAGCCTTTCCCCTATGACTGGCCACACTCCTAACAGGACTGCGAAACCAACCCTCCACCTCACTAGCTCACCTCCTGCCAGAAGGCACACCAACCCCACTAATCCCAGCCCTCATCCTAATCGAAACGACAAGCCTTCTCATCCGCCCACTGGCACTGGGCGTGCGCCTAACAGCCAACCTAACAGCAGGACACCTCCTAATCCAACTCATTTCTACCGCCACAACAACCCTATTCTCCACAATACCAATAGTTTCGCTCCTGGCCTTCGTACTCCTCTTCCTACTGACAATCCTAGAAGTGGCAGTAGCAATAATCCAAGCCTACGTCTTCGTACTCCTACTAAGCCTCTACCTACAAGAAAACATCTAAACC--CA----AATGGCACACCAAGCACACTCCTATCACATAGTTGACCCCAGCCCATGACCCATCCTAGGAGCGGCCTCCGCTCTCCTCACTACATCAGGACTAACAATATGATTCCACTGAAACTCCCCTCGACTACTTATCTTAGGCTTACTATCAACTGCTCTTGTCATATTCCAATGATGACGAGACATTGTACGAGAAAGCACATTCCAAGGCCACCATACCCCAACCGTACAAAAAGGACTACGATACGGAATAGCCCTATTCATCACATCAGAAGCCTTTTTCTTCCTAGGCTTTTTCTGAGCTTTCTTCCACTCAAGCCTAGCCCCTACACCAGAACTAGGAGGACAATGACCACCCGTAGGAATTAAACCCCTCAACCCTATAGAAGTCCCACTCCTAAACACCGCCATTCTCCTGGCCTCAGGAGTTACCGTCACATGAGCCCACCACAGCATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCCCTATCCCTGACAGTTCTCCTAGGCTTCTACTTCACTGCCCTACAAGCCATAGAATATTACGAAGCACCATTTTCCATTGCCGATGGAATTTACGGCTCAACATTCTTCGTTGCTACCGGATTCCATGGCCTGCATGTAATCATCGGCTCTATCTTCCTACTAGTATGCCTCCTACGCCTAATCAAATACCACTTCACATCAAACCACCACTTCGGATTTGAAGCAGCCGCCTGATACTGACACTTTGTAGACGTTGTATGATTACTCCTCTATATCTCTATCTACTGATGAGGATCTTGCTCTTCTAGTATATTA-ATTACAATCGACTTCCAATCCTTAGAATCTGGTTTAAGCCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTAACCCTATCACTAACCCTAAGCATCCTCCTAACCATACTAAACTTCTGGCTTGCCCAAATAATCCCAGATTCAGAAAAACTATCCCCATACGAATGCGGATTTGACCCATTAGGGTCTGCCCGACTCCCTTTCTCAATCCGCTTCTTCCTAGTAGCTATCCTGTTCCTCCTATTCGACCTAGAAATCGCCCTACTCCTCCCACTACCCTGAGCTACCCAACTACAATCCCCAACCACCACCTTAACCTGAACCGCCACCCTTATCTTCCTGCTCACTCTAGGCCTAGTGTACGAATGAATCCAAGGCGGACTAGAATGAGCAGAATA-A------CAGAAAGTTAGTCTAACTAAGACAGTTGATTTCGACTCAACAGATTATAGCTCCCACCCTATAACTTTCTTTATGTCATACCTCCACCTAAGCTTCTACTCAGCCTTTACCCTAAGCAGCCTCGGCCTAGCCTTCCACCGAACCCACCTAATCTCCGCCCTACTATGTTTAGAGAGCATAATACTATCCATATACGTCGCCCTAGCCATATGACCCATCCAAATCCAATCATCAGTAGCCACCATCCTACCTATCCTCATACTAACATTTTCCGCCTGCGAGGCAGGCACAGGCTTAGCACTACTAGTAGCCTCAACCCGCACCCACGGGTCCGACCACCTACACAACTTTAACCTCCTACAATGCTAAAAATCATCATCCCAACCACAACACTCCTTCCCCTAGCCCTCCTCTCCCCATGCAAACACCTATGAACTAACATCACGCTGTATAGCCTACTAATCGCTACCATCAGCCTCCAATGACTTACACCCACATACTACCCAAGCAAAAGCCTAACTCCATGAACAGCAATCGACCAAATCTCCTCTCCTCTACTAGTCCTCTCATGCTGACTTCTTCCCCTCATAATCATAGCAAGCCAAAACCACTTAGAACAAGAACCCATCAACCGTAAACGAATCTTCGCCTCAACACTAATCTTAGCCCAACTATCCATCCTCCTAGCCTTCTCAGCCTCCGAACTAATACTCTTCTACATTGCATTCGAAGCCACCCTCATTCCTACCCTGATCCTCATCACACGATGAGGAAGCCAACCAGAACGCCTGAATGCTGGCATTTACCTCCTATTCTACACCCTCGCCAGCTCACTCCCACTACTAATTGCCATCCTTCACCTACAAAACCAAATCGGCTCACTATACATACCAATATTCAAACTTTCACACCCAACATTAAACTCTTCCTGATCTAGCCTAGCCGCAAGCCTAGCCCTCCTACTAGCTTTCATAGTTAAAGCCCCCTTATACGGCTTACACCTATGACTCCCCAAAGCTCACGTAGAAGCCCCAATTGCCGGGTCCATGCTTCTAGCAGCCCTGCTATTAAAACTCGGAGGATACGGTATTATACGAATTACCATCCTAGTAAACCCATCATCAAACAACCTCCACTACCCATTCATCACAATAGCCCTGTGAGGAGCAGTAATAACCAGTGCCATTTGCTTACGCCAAATTGACCTAAAATCACTAATCGCTTACTCATCTGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATAATCCAAACTCAATGAGCAATCTCAGGAGCAATAATCTTAATAATCTCACATGGCCTAACCTCCTCAATACTATTCTGCCTAGCCAACACCAACTACGAACGAACCCACAGCCGAATCCTCCTACTTACACGAGGACTCCAACCTCTCCTACCACTTATAACCATCTGATGATTACTAGCCAACCTAACAAACATAGCCCTTCCCCCAACAACAAACCTCATAGCAGAACTAACTATCGTAGTAGCACTTTTCAACTGATCAGCCCTAACAATCATCCTAACAGGAACTGCCATCCTATTCACCGCCTCATACACCCTATACATACTAATCATAACACAACGAGGAACCCTTCCATCTCACATCACATCAATCCAAAACTCTTCCACACGAGAGCACCTCCTCATGGCCCTACACATAATCCCCATAATCCTACTAATCTTCAAACCCGAACTGATCTCCGGTATCCCCGCAT-GCAAGTATAGTTT-CAA-CCAAAACATTAGACCGTGACTCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGAG-AGGTA-AAACCAACGAGAACTGCTAACTCTTGCATCTGAGCATAA-AACCTCAGTCTCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAACCACTCATCTTGGTGCAAATCCAAGTGAAAGT--AATGGACCTCTCAATAACCCTAAACACATTCATACTCTTAACCCTAGCAACCCTCTCCACCCCTATCCTACTCCCGCTGCTATCTGACAGCCTCAAAAACACCCCTAGCACAATCACCAACACAGTCAAAACTTCCTTCCTAATCAGTCTAATCCCCATAACAATTTTCATCCACTCCGGGACAGAAAACCTCACTTCCCTCTGAGAATGAAAATTCATCATAACTTTCAAAATTCCAATTAGCCTAAAAATAGACTTCTATACACTCACCTTCTTCCCCATCGCACTATTCGTATCATGATCTATCCTACAATTTGCAACATGATACATGGCCTCAGACCCTTACATTACAAAATTCTTCACTTACCTCTTATTCTTCCTAATTGCCATACTCATCCTAATCATTGCCAACAACCTATTTGTCCTATTCATTGGTTGAGAAGGGGTAGGTATCATGTCTTTCCTCCTAATCAGCTGATGACACGGCCGAGCAGAAGCCAACACCGCTGCCTTACAAGCAGTCCTCTACAACCGAATCGGCGACATCGGCCTTATCCTATGCATAGCATGACTAGCTTCCACCACAAACACCTGAGAACTCCAACAACTCCCCACCTCCACACAAACCCCCACATTACCCCTACTAGGCTTAATCCTAGCCGCAGCCGGAAAATCCGCCCAATTCGGCCTGCACCCATGACTACCAGCTGCAATAGAAGGACCAACCCCTGTCTCCGCCCTACTCCATTCCAGCACAATAGTAGTAGCAGGAATCTTCCTACTAATTCGAACCCATCCACTATTCAACAACAACCAAACCGCACTAACCCTATGCCTGTGCCTAGGAGCCATCTCCACTTTATTCGCAGCTACGTGCGCCCTAACCCAAAACGACATTAAAAAAATCATCGCCTTCTCCACCTCCAGCCAACTAGGCCTAATAATAGTCACAATCGGACTAAACCTACCTGAATTAGCCTTCCTCCATATCTCCACCCACGCATTCTTCAAAGCCATACTCTTCCTATGTTCAGGCTCCATCATCCACAGTTTAAACGGCGAACAGGACATCCGAAAAATAGGGGGACTCCAAAAAATACTCCCCACAACAACCGCATGCCTCACAATCGGCAACCTCGCCTTAATAGGAACACCATTCCTAGCAGGATTCTACTCAAAAGACCAGATCATCGAAAGCTTAAACACATCCTACTTAAACACCTGAGCCCTAATCTTAACCCTCCTAGCTACGTCATTCACCGCAGTGTACACGATCCGCATAACCGTACTAGTTCAAACCGGTTTCGTCCGAATTCCTCCCCTAACCCCAATAAATGAAAACAACCCCGCAGTGATCTCCCCCATCACCCGCCTCGCACTAGGAAGCATCCTAGCAGGCTTCCTCATTACCTCATTCATCATCC---CAACAAAAACCCCCACAATAACCATACCACCACACATCAAAATAACAGCCCTAATCGTAACAGCCTTAGGAATCGCCCTAGCCCTAGAAATTACAAAAATGACTCAAACACTTATTCTCACAAAACAAACTCCATTCTCAAACTTCTCAACTTCCCTAGGATACTTCAACCCCCTAGCCCACCGCCTAAGCATAACCAACTTCCTCAAAGGAGGACAAGATATCGCTTCCCACCTAATCGATCTATCCTGATACAAAATACTAGGCCCAGAAGGACTAGCCAGCCTACAACTAACAGCAACTAAAACCGCCACCACCATCCACTCAGGCCTAATGAAAGCCTACTTAGGGTCATTCGCCCTATCTATCCTCATCATCCTCA---TATCCTCACTCAGAAA--CAA-C-C---AATGGCCCCAAATCTTCGTAAAAACCACCAAATCCTCAAAATCATCAATGACGCCTTAATCGATCTTCCAGCTCCATCAAACATTTCAACATGATGAAACTTCGGATCCCTACTAGGCGTCTGCTTAATCACTCAAATCATCACAGGTCTTCTGCTAGCCATACACTACACAGCAGATACCAACCTAGCCTTCTCCTCCGTAGCCCACATATGCCGAGACGTACAATTTGGCTGACTCATCCGTAACCTACATGCAAACGGAGCTTCTTTCTTCTTCATCTGCATTTACCTACACATTGGCCGAGGTATCTATTATGGCTCATACCTATACAAAGAAACCTGAAACGTAGGAGTCATCCTCCTCCTGGCCCTAATAGCAACCGCCTTCGTCGGATACGTCCTACCATGAGGACAAATATCATTCTGAGGCGCTACCGTAATCACAAACCTATTTTCAGCCATCCCATACATCGGACAAACACTAGTCGAATGAGCCTGAGGAGGATTCTCCGTCGACAACCCAACACTAACCCGATTCTTCGCCCTCCACTTCCTCCTCCCCTTCGTCATCGTAGGGCTCACCCTAGTACATCTAACCTTCCTCCACGAAACAGGATCCAACAACCCACTAGGCATCCCGCCGGACTGCGACAAAATCCCCTTCCACCCATATTACACCATCAAGGACATCCTAGGATTTGTCCTAATACTTTCCCTGCTAGTCTCACTAGCTCTATTCTCCCCCAATCTCCTAGGAGACCCAGAAAACTTTACTCCAGCTAACCCGCTAACCACCCCTCCACATATCAAACCCGAGTGATACTTCCTATTCGCCTACGCCATCCTTCGATCCATCCCAAACAAACTAGGAGGCGTACTAGCCCTAGCCGCCTCAATCCTAGTCCTATTCCTTATCCCATACCTACACACATCAAAAATACGATCAATGACCTTCCGCCCTCTATCACAAATCCTATTCTGAACTCTAGTCGCCAACATCCTTCTCCTAACTTGAGTAGGCAGCCAACCAGTAGAACACCCATTCATCATCATTGGGCAACTAGCCTCACTATCATACTTCACAATCATTTTAATCCTATTCCCCCTCGCGGCCGCTTTAGAGAATAAAATATTCAAATT----------CTA-ATA-----------TACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAACCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Magumma_parva GTTCTTGTAGCTTATAA-AAAGCATGACACTGAAGATGTCAAGATGGCTGC--CACA-CACACCC-AAGAAC--AAAAGACTTAGTCCTAACCTTACTGTTAGTTTTTGCTAGGTATATACATGCAAGTATCCGCGCGCCAGTG-TAGATGCCCTGGACA-CCT-T-GA-T-T-----AGGTAGATAGGAGCGGGTATCAGGCTCA--C------CAT-A--ACCGTAGCCCAAGACGCCTAGCACTTGCCACGCCCCCACGGGTATTCAGCAGTAGTTAATATTAAGCAATGAGTGTAAACTTGACTTAGCCATAGCAAA-----TTAGGGTTGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACCCAAATTAACATTA--T----AACGGCGTAAAGAGTGGTCAC-ATGCTAT-CCAAGTAACTAAGATTAAAAAGCAACTGAGCTGTCACAAGCCCAAGATGC-CAATAAGGCCTCC-TTATCAAAGAAGATCTTAGAAC--AACGATTAATTGAACTCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCT-TAC--ACCTACTAAAGCATCCGCCCGAGAACTACGAGCACCAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATA-TACCTGACCATTCCTTGC-CAA--AA--CAGCCTACATACCGCCGTCTCCAGCTCACCTACC--CTGAAAGCCAAACAGTGAGCGCAACAG-CCCCA-CCACGCTAATACGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-AGCAATGGGCTACATTTTCTAAGTTAGAACA-C----AACGGCAAAGGGGTATGAAATAACCCCTAGAAGGCGGA-TTTAGCAGT-AAAGTGGGACAATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCATAGG-CC--GCCCCCCCCCCCCCATAAACTAATAAGCTAC-CC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGGATA-CCAAGACGTAGC-TTAATCA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACACCAGATCGTCTTGA-TGCCAACCTCTAGCCC--------AACCG-ACA-TG------ACCTGGA-ATAAC--AAAGCCACT--TC-AAA-CACCC----AACTAAAGCATT---T--ACTAGT-CCTAGTATAGGCGATAGAAAAGACA-CCA-TTGGA-GCGATAGAGAT-CACGTACCGTAAGGGAAAGATGAAATATTAGTG-AAATAAAC--TAAGCTA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAATGA--ATTTAAGTTTGCCATCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAT-T-TTGAGCGAACCCGTCTCTGTGGCAAAAGAGTGGGATGACTTGTTAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGG-AAGC-ACACA-AACCCTA--ATGAAGC---GAATTAAGGGCAATTTAAAGGAGGTACAGCTCCTTTAAAAAAGAATACAATCTCTA-CGAGCGGATA----AAT--AAGGAC-TT-ACCAAT-CATACTGTGGGCCCTCAAGCAGCCATCAACAAAGAGTGCGTTAAAGCTCTCC-CCTACAAAAATACAAA-AACAATATGACTCCCT-CCTCATTAACAGGCTAACCTATATTTAAATAGGAGAATTAATGCTAGAATGAGTAACCTGGG--T--CC-TCCCTCT----ACGACGCAAGCTTACATCGGCA-CATTATTAACAAA-TCACCA-ATATACGA--CTAAT---------CAA---ACAAGCA-GAG-TATTA-AGCACA-TTGTTAACCCGACAGA-GGAGCGTCCATT-AAGAAAGATTAAAACCTGTAAAAGGAACTCGGCAAACCCGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCACAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACTC--AC---GTTCAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCAATCGGTGAAATTGATCTCCCTGTTCAAAAGCAGGGATAAACACATAAGACGAGAAGACCCTGTGGAACTTTAAAACCAGCAACCATC--TTAGAT-CACCTA----CT-CACCCA--T-C-GGGTTCACTGTC-ACA-TAA-GA-T-ACTGGTC-TGCG-TTTTTCGGTTGGGGCGACCTTGGAGCAAAAC-AGAACCTCCAA-AAATTAGACCACACCTCTAGACTG-AGAGCAACCCCTCAACGTGCTAATAGCACCCAGACCCAATAT--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTTGTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AACTCTTCCCAGTACGAAAGGATAGGAA-AAGTGAGGCCAATACTACAA-GCAAGCCTTC-GCCTTAAGTAATGAAACCAACTAAATTACAAAAGGCTATCAC-TCCAC---A-CCA-CGTCCAAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GAAAATGCAAAAGGCTTAAGTCCTTTAACTCAGAGGTTCAAATCCTCTCCCTAGC-----TTTAAC---CT-----ACAACC--C----ATGAC----------TAACTACCCCCTACTAATTAACCTAATTATATCCCTCTCCTACGCCCTCCCAATCTTGATTGCAGTAGCCTTCCTGACACTAGTAGAGCGCAAAATCTTAAGTTACATGCAAAATCGAAAAGGCCCTAACATTGTAGGACCATACGGCCTCCTGCAACCCCTAGCAGACGGAGTGAAACTATTCATCAAAGAGCCTATCCGAC---------CCTCAACATCCTCCCCAGTCCTGTTTCTTGCAACCCCAGTATTAGCTCTTCTCTTAGCAATTTCAATCTGAGCCCCTCTCCCCCTGCCTTTTTCACTAGCAGACCTTAATCTAGGCCTGCTATTCCTGCTGGCCATATCGAGCCTAGCAGTATACTCTATCCTCTGATCCGGCTGAGCCTCCAACTCAAAATATGCGCTAATTGGTGCACTGCGAGCAGTAGCCCAGACAATCTCGTACGAAGTGACCCTAGCCATTATCCTCCTGTCTGTTGTACTCCTTAGCGGTAACTACACCCTAAGTACCCTTGCAGTCACTCAAGAACCCCTATACCTTATTTTCTCATGCTGGCCCCTCGCTATAATGTGATACGTCTCCACACTTGCTGAGACTAATCGTGCTCCCTTTGACCTAACAGAAGGGGAATCCGAACTGGTCTCTGGGTTTAACGTAGAATACGCAGCTGGCCCTTTCGCACTCTTCTTCTTAGCTGAATACGCCAACATTATACTCATAAACACTATTACCACAATCCTCTTCTTCAACCCAAGCCTGCTTAACCTCCCCCAAGAGCTATTCCCCGTAGTACTAGCCACAAAAGTCCTACTACTATCAGCAGGATTTCTATGAATTCGTGCCTCCTATCCACGATTCCGATATGACCAGTTAATGCACTTACTATGAAAGAATTTCCTACCACTCACACTTGCCCTATGTCTATGGCACACCAGCATGCCAATTTGCTATGCGGGACTACCC-----CCTTATCTA-A--GA--------------CCACCGGAAATGTGCCTGAACAC-T--AAGGGTCACTATGATAAAGTGAACATGGAGGTATACCAGTCCTCTCATTTCCT-A--CAGC-------TTAGAAAAGCAGGAATCGAACCTACACTAGAGGAATCAAAATCCTCCATACTTCCCTTATATTACTTTCT----------------AGTAGGGTCAGCTAAACAAGCTATCGGGCCCATACCCCGAAAATGATGGTTTGACTCCTTCCCCTGCTA-ATGAACCCCCAAGCAAAACTAATTTTCATAATCAGCCTCCTCCTGGGGACTGCCATTACAATCTCGAGCAACCACTGAATCA---TAGCTTGAGCTGGCCTCGAAATCAATACACTCGCCGTCCTACCATTAATCTCAAAATCTCACCATCCACGGTCCATCGAAGCAGCTACTAAGTACTTCCTGACCCAAGCAGCTGCCTCCGCCTTAGTCTTATTCTCCAGCATAACCAACGCATGGCACACCGGACAATGAGACATTACCCAACTAACTCATCCCACATCTGGCCTAATCCTAACTTCAGCAATTGCAATGAAATTAGGCTTAGTCCCATTCCACTTCTGATTCCCAGAAGTGCTACAAGGCTCCCCTCTTTCCACTGGACTCCTGCTATCCACTATCATAAAACTACCCCCAATCACCCTTTTATACATAACTTCTCCATCACTAAACCCCACACTCCTGACTACCCTGGCCATCCTTTCAGCAGCCATCGGAGGATGAATAGGCCTCAACCAAACACAGATTCGAAAAATCCTGGCTTTCTCCTCCATCTCGCACCTTGGCTGAATAGCAATCATCATCATCTACAACCCTAAACTCACCCTCCTAAACTTCTACCTGTACACTATAATAACTGCAACTATCTTCCTCACCCTAAACTCAATCAAAGTAATAAAACTATCTACTCTAATGACCGCATGGACTAAAATCCCCTCACTAAATATAATGCTACTCTTAACCTTACTTTCTCTTGCAGGGCTTCCCCCCTTAACAGGATTTCTGCCTAAATGACTCATCATTCAAGAACTAACTAAACAAGAAATAATCCCCGCAGCCACACTCATGTCCCTTCTCTCACTACTAAGCCTATTCTTCTACCTCCGCCTTGCATACTGCACAACAATTACACTCCCACCCCACACTACAAATCACATAAAACAATGACGCACCAGCAAATCAACCAACATTATGATTGCTGTCCTAACTACAATATCCCTCATTCTCCTCCCCATCTCACCCATGATCCTCTCCATCAT------TT----AAGAAACTTAG----GATTAATT-TAAACCGAAGGCCTTCAAAGCCTTAAATAAGAGTTAAACCCTCTTAGTTTCTGCTAAAGTCCGCAGGCTATTACCCTGCATCCCCTGAATGCAACCCAGGTACTTTAA-TTAAGCTAGGACCTT-A--CAA-CACACTAGGCAGATGGGCTTCGATCCCATGATTC-TATAGTTAACAGCTACATGCCCTAACC-AACAGGCCTCTGCCT-A-------------AGACTCCGGTACACGA-TCAATGTACATCAATGAGCTTGCAACTCACTATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-ACACACTCAGCCATC--------------TTACCTATGACATTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGGACCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCCTTTGTAATAATTTTCTTCATAGTCATGCCTATTATGATCGGAGGGTTCGGAAACTGATTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATGAGCTTCTGACTACTTCCCCCATCATTCCTTCTCCTACTAGCTTCCTCCACTGTTGAAGCAGGAGTTGGTACAGGCTGAACAGTATACCCCCCACTAGCTGGCAATCTCGCTCACGCCGGAGCCTCAGTTGACTTAGCAATCTTCTCCCTACACTTGGCCGGTATCTCTTCAATCCTAGGGGCAATCAATTTCATCACAACAGCCCTCAACATAAAACCCCCAGCCCTATCACAATACCAAACTCCCCTATTCGTGTGATCCGTATTAATCACTGCAGTACTTCTACTCCTCTCCCTTCCCGTACTTGCTGCAGGAATCACAATGCTCCTGACAGACCGCAACCTCAATACCACATTCTTCGACCCAGCAGGAGGAGGGGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCATCCAGAAGTCTACATTCTAATCCTACCAGGATTTGGGATCATCTCCCATGTAGTAACCTACTACGCAGGAAAAAAAGAACCATTCGGGTACATAGGAATAGTATGAGCCATGCTATCCATCGGATTCCTAGGATTCATCGTCTGAGCCCACCACATGTTCACAGTTGGAATAGACGTTGACACTCGAGCATACTTCACGTCCGCCACTATAATCATTGCCATCCCAACCGGCATTAAAGTATTCAGCTGACTGGCCACACTCCACGGGGGCGTGATCAAGTGAGACCCACCAATACTATGAGCCCTAGGGTTTATCTTCTTATTCACCATCGGAGGACTAACTGGAATCGTCCTAGCAAACTCCTCACTAGATATCGCACTACACGACACCTACTACGTAGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCAGTGTTTGCAATCCTAGCCGGCTTCACACACTGATTCCCCCTATTCACCGGTTACACCCTCCACTCAACATGAGCCAAAGCCCACTTCGGCGTAATGTTCGTAGGAGTCAACTTAACCTTCTTCCCTCAACATTTCCTAGGCCTGGCTGGTATACCACGCCGATACTCAGACTACCCCGATGCCTACACCCTATGAAACACTATCTCCTCAGTGGGATCGCTCATCTCTCTAACAGCCGTAATCATACTAGTCTTCATCATCTGAGAAGCCTTCGCATCAAAACGTAAAGTCCTGCAACCAGAACTAACAAGCACCAACGTCGAATGAATCCACGGCTGCCCACCCCCATTCCACACCTTCGAAGAACCCGCCTTCGTCCAAGTC------CAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACCGC--AT--GAACCACTTATGCTTCTTTCTC---AT---AGAGATGTTAGT-AAAACA-ATTACATAG-CCTTGTCAAGACTAAATTGCAAGTGAAACCCCTGCACATCTCTT---CACCC--AAACATGGCCAACCACTCACAACTTAACTTTCAAGACGCTTCCTCTCCCATCATAGAAGAACTCATAGGATTCCACGATCACGCCATAATGATCGCACTAGCAATCTGCAGTCTAGTACTTTACCTCCTAACCCATATAATAACAGGAAAACTCTCATCCAGCACCGTAGACGCACAAGAAATTGAACTTGTCTGAACAATTCTCCCAGCCATAGTTCTAATCACACTTGCCCTACCATCCCTACGAATTCTATACATGATAGACGAAATCAACGAACCCGATTTAACCCTAAAAGCCATCGGCCACCAATGATACTGAACATATGAGTACACTGATCTTAAAGACCTCACATTCGACTCTTACATAATCCCAACATCAGACCTACCTCTAGGACACTTCCGACTGCTAGAAGTCGACCACCGTGTTGTAGTTCCAATAAGCTCTACAATCCGAGTAATCGTCACCGCCGATGACGTACTTCATTCATGAGCAGTCCCAAGCCTAGGAGTAAAAACCGATGCAATCCCAGGACGCTTAAACCAAACTTCCTTCCTTGCTTCCCGACCTGGAGTCTTCTACGGACAATGCTCAGAAATCTGCGGAGCTAACCACAGCTTCATGCCAATCGTAGTAGAATCAACTCCCCTCGCCAACTTCGAAAGCTGATCTTCTCTAG---CAGCCTCCT----------CATCATTAAGAAGCTATGAACCAGCATTAGCCTTTTAAGCTAAAGAAAGAGGACT-ACT-CTCCTCCTTAATGATATGCCTCAACTAAACCCTGCACCTTGATTTTTTATCATGATTATTTCATGACTAACCTTCTCCTTCATCATTCAACCCAAGCTTCTATCATTCGTATCAATAAATCCCCCATCCAACAAGC---CACCTATTGCCCCAAGCACCACCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCTCAAGCCCATCCTTCCTAGGAATCCCACTCATCCTCATCTCAATAACATTTCCAGCTCTTTTAATCCCCTCACTAGACAACCGATGAATCACTAACCGACTCTCAACCCTCCAACTATGATTCGTTAACCTAATTACAAAACAACTAATAATACCCCTAGACAAAAAAGGACACAAATGAGCCCTAATCCTAACATCCCTAATAATCTTCCTGCTACTAATCAACCTCCTGGGCTTACTACCATACACATTCACCCCAACCACCCAACTATCTATAAACTTAGCCTTAGCCTTCCCCCTGTGACTTGCCACCCTACTAACAGGCCTACGAAACCAACCCTCTATCTCATTAGGGCACCTCCTACCAGAAGGCACCCCAACCCCACTAATCCCTGCTCTAATCCTAATCGAAACAACAAGCCTACTAATCCGACCCCTAGCCCTAGGAGTACGCCTAACAGCCAACCTTACAGCAGGACACCTACTCATCCAACTCATCTCCACAGCCACAACAGCCCTATTCCCTACAATACCAGCAGTCTCACTCCTAACCCTACTAGTTCTATTCTTACTGACTATCCTAGAAGTAGCAGTAGCAATGATTCAAGCCTACGTCTTCGTACTTCTACTAAGCCTCTACCTACAAGAAAACATCTAACCC--CC--ACAATGGCACACCAAGCACATTCCTACCACATAGTAGACCCCAGCCCATGACCTATTCTAGGAGCCGCCGCCGCCCTCCTGACTACCTCAGGACTCACAATGTGATTCCACTGAAACTCACCCCAACTCCTTATCCTAGGCCTAATCTCCACCTCCCTAGTCATATTCCAATGATGACGTGACGTTGTCCGAGAAAGCACATTCCAAGGACACCACACTCCCACCGTACAAAAAGGCCTACGATACGGCATGGTTCTATTCATCACATCCGAAGCATTCTTCTTTCTTGGCTTTTTCTGAGCATTCTTCCACTCAAGTCTAGCCCCTACCCCAGAACTAGGAGGACAATGACCGCCCGTCGGAATCAAACCCCTGAACCCCATAGACGTACCGCTTCTGAACACTGCCATCCTCCTGGCTTCCGGAGTTACCGTAACATGAGCCCACCACAGTATCACAGAAGCCAACCGAAAACAAGCAATCCAAGCACTTACCCTAACCGTTCTCCTAGGCTTCTACTTCACTGCACTACAAGCCATAGAATACTATGAAGCACCATTCTCCATTGCAGACGGAATCTACGGCTCTACATTCTTCGTCGCTACCGGATTCCACGGCCTACATGTAATCATCGGTTCCACATTCCTACTAGTATGCCTACTACGCTTAATCAAATACCACTTCACATCAGGACACCACTTTGGGTTCGAAGCAGCTGCCTGATACTGACACTTCGTAGACGTCGTATGGCTATTCCTCTACATCTCAATCTACTGATGAGGATCTTACTCTTCTAGTATATTC-ATTACAATCGACTTCCAATCCTTAAAATCTGGTTTAAATCCAGAGAAGAGTAATG---AACATAATCCTATTCATACTAACCCTATCACTTACCCTAAGCATCCTACTAACCGCACTAAACTTTTGACTAGCACAAATAAACCCAGACTCAGAAAAACTATCCCCCTACGAATGTGGATTCGACCCCCTAGGATCCGCTCGACTCCCATTCTCAATCCGATTCTTCCTGGTAGCCATCCTATTCCTCCTATTCGATTTAGAAATTGCCCTACTCCTCCCACTCCCATGAGCTATCCAACTAGAATCACCAACCACCACCCTAATCTGAACCTCCTTCCTCCTTCTTCTACTAACACTAGGACTAATCTACGAATGAATCCAAGGAGGATTAGAATGGGCAGAATA-G------CAGAAAGTTAGTCTAACCAAGACGGTTGATTTCGACTCAACAAATTATAGCTCACACCCTATAACTTTCTTTATGTCCTACCTTCACCTCAGCTTCTACTCAGCCTTCACCCTAAGCAGCTTAGGCCTAGCTTTTCACCGCACCCATTTAATTTCAGCCCTACTATGCCTAGAAAGCATAATACTATCCATGTATGTAGCGCTCGCCATATGACCGATCCAAATACAATCCTCATCTTCTACCATCCTACCAATTATCATACTGACATTCTCTGCCTGCGAAGCCGGCACAGGCCTAGCCTTACTAGTAGCCTCCACCCGAACCCACGGCTCAGACCACCTACACAACTTCAACCTCCTACAATGCTAAAAATCATCATTCCAACCGCAACACTTCTACCTCTAGCCCTCGTATCCCCGCTCAAACACCTATGAACTAACATCACACTACACAGCTTACTCATTGCCACTATCAGCCTACAATGACTAACACCCACATACTACCCAAACAAAGGCTTAACCCCCTGAACCTCAATTGACCAACTCTCCTCTCCCCTGCTAGTTCTCTCATGCTGACTCCTACCCCTCATGATTATAGCAAGCCAAAACCATTTAGAGCAAGAACCCACTATCCGCAAACGAATTTTCGCCACAACAACAATCTTAGCTCAATTGTTTATCCTTCTAGCCTTCTCAGCCTCAGAGCTAATACTCTTCTACATTGCATTCGAAGCAACCCTCATCCCCACCCTCATCCTCATTACACGATGAGGAAACCAACCAGAACGACTAAACGCTGGCATTTACCTCCTATTCTACACACTAGCCAGCTCGCTCCCCCTGCTAATTGCTATCCTACACCTACAAAACCAAGTCGGCACACTCTACCTTCCCATACTAAAACTATCCCACCCAACATTAAACTCCTCCTGATCCGGGCTAATCGCAAGCCTCGCACTCCTCCTAGCTTTCATGGTCAAAGCCCCCCTATACGGCCTACACCTATGACTCCCCAAAGCCCACGTAGAAGCCCCTATTGCCGGCTCCATACTACTAGCTGCTCTATTACTAAAGCTAGGAGGCTACGGCATTATACGAATCACAATCCTGGTAAACCCAACATCAAACAACCTACACTACCCATTCATCACCCTAGCCCTATGAGGAGCACTGATAACTAGCGCAATCTGCCTACGACAAATCGACCTAAAATCACTAATCGCCTACTCCTCTGTCAGCCACATAGGACTAGTCGTAGCCGCAACCATGATCCAAACCCAATGAGCATTTTCAGGAGCAATAATCCTAATAATCTCACACGGCCTAACCTCCTCAATACTATTCTGCCTAGCCAACACTAACTACGAACGAACCCACAGCCGAATCCTTCTACTTACACGAGGACTCCAACCCCTGCTACCACTTATGGCAACCTGATGACTCCTAGCAAACCTAACAAACATAGCCCTCCCCCCAACAACCAATCTCATGGCAGAACTAACTATCGTCATCGCGCTATTCAACTGATCCGCCTTCACAATCCTCCTAACAGGGGCAGCAATCCTCCTCACCGCCTCATACACCCTATACATACTAACAATAACACAACGAGGCATTCTTCCATCCCACATCACCTCCATCCAAAACTCCTCCACCCGAGAACACCTCCTCATGGCCCTTCACATGATCCCAATACTACTCCTGATCCTCAAACCCGAACTAATCTCCGGCACTCCTATAT-GCAAGTATAGTTT-TAA-TCAAAACATTAGACTGTGATCCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGGG-AGGTT-AAACCAACGAGAACTGCTAACTCTTGAATCTGAGCATAA-AACCTCAGTCCCCTT--ACTTTCAAAGGATAACAGTAATCCAATGGTCTTAGGAGCCACTCATCTTGGTGCAAGTCCAAGTGAAAGT--AATGGATCTATCCCTAATCCTAAACACATTCATACTCCTAACCCTGACAACCCTCTCCACCCCCATTCTATTCCCACTACTCTCCCCTAAATTCAAAAACACCCCTAACTCCATCACAAACACAGTTAAAGCCTCATTCCTAATCAGCCTAATCCCCATAACAATTCACATCTACTCAGGAACAGAGAGCCTAGTCTTTTTATGAGAATGAAAATTCATCATAAACTTTAAAATCCCCATTAGCCTCAAAATAGACTTCTACTCCCTCACTTTCTTCCCAATCGCACTATTCGTCTCATGGTCAATTCTACAATTTGCAACATGATACATAGCCTCAGACCCCTACATCACAAAATTCTTCACCTACCTCTTATTCTTCCTAATAGCCATACTCATCCTAATCGTCGCTAACAACCTATTCATTCTATTCATTGGCTGAGAAGGAGTCGGAATCATATCTTTTCTACTAATTAGCTGATGACACGGACGAGCAGAAGCCAACACCGCTGCCCTACAAGCCGTACTGTACAATCGAGTCGGCGACATTGGCCTCATCCTCTGCATAGCATGACTAGCATCCGCCATAAACACCTGAGAAATTCAACAACTACCATCCCCCTCTCAAACCCCAACACTTCCCCTCCTAGGCCTAATTCTAGCTGCAACCGGAAAATCCGCCCAATTCGGCCTGCACCCTTGACTCCCAGCCGCCATAGAAGGGCCTACCCCCGTATCTGCCCTACTCCACTCCAGCACAATAGTAGTAGCTGGAATCTTCCTACTAATCCGAACCCACCCCCTATTTAACAACAACCAAACTGCCCTAACCCTATGCCTCTGCCTAGGGGCCCTATCCACCCTATTTGCAGCTACATGCGCCCTCACCCAAAATGATATCAAAAAAATCATTGCCTTCTCCACCTCAAGCCAACTAGGCCTAATAATAGTCACAATTGGACTGAACCTCCCTGAACTCGCTTTCCTCCACATCTCAACCCACGCATTCTTCAAAGCTATACTCTTCCTATGCTCAGGGTCCATCATCCATAGCCTAAACGGCGAACAAGACATTCGAAAAATAGGAGGTCTCCAAAAAACAATACCCACTACCACCTCATGCTTAACCATCGGGAACCTAGCCCTAATAGGAACACCCTTCCTAGCAGGATTCTACTCAAAAGACCAAATCATTGAAAGCCTAAGCACCTCCTACCTAAACACCTGAGCCCTACTACTAACCCTACTAGCCACATCCTTCACCGCAGTATACACAATCCGCATGACCGTACTCGTACAAACCGGCTTCGTCCGAATTTCCCCTCTAACCCCAATAAATGAAAACAACCCCGCAGTAACCTCACCCATCACCCGACTTGCACTAGGAAGCATCATAGCAGGCTTCCTCATCACTTCATTCATTATCC---CAACAAAAACACCTACAATAACCATGCCTCTATACATCAAAATAACTGCTCTAGTAGTAACCGCCCTAGGAATCGCCCTAGCCCTAGAAATCTCAAAAATAGCCCAAACCCTCCTCCCTACAAAACAAACCACCTTCTCAAACTTCTCTACCTCCCTAGGATACTTCAACCCCCTAGTCCACCGCCTAAGCATATCTAACCTCCTCAACGGAGGACAAAATATTGCCTCCCACCTAATCGACTTATCCTGATACAAAATCCTAGGACCAGAAGGACTAGCCAGCTTACAACTAGCAGCAACCAAAACCGCCACTTCCCTCCACTCAGGCTTAATCAAAGCCTACCTAGGAGCATTCGCCATCTCCATCATCATCATCCTCA---TATCCTCATACAGAA----AC-C-T---AATGGCCCTCAATCTTCGTAAAAACCACCAAATCCTAAAAATCATCAACAACGCCCTGATTGACCTACCCACACCACCAAACATCTCAACATGATGAAACTTCGGGTCTCTACTAGGCATCTGCTTAATTACTCAAATCGTTACCGGTCTTCTGCTAGCCACACACTACACAGCAGATACCAACCTAGCTTTCTCCTCTGTAGCCCACATATGCCGCGACGTACAATTCGGCTGACTTATCCGTAACCTCCACGCAAACGGAGCCTCCTTCTTCTTCATCTGCATCTACCTACACATTGGCCGAGGAATCTACTACGGCTCATACCTAAACAAAGAGACCTGAAACGTTGGAGTAATTCTCCTCCTAACTCTCATAGCAACTGCCTTTGTAGGCTACGTACTGCCATGAGGACAAATATCATTCTGAGGGGCTACTGTAATTACAAACCTATTCTCAGCAATCCCCTACATTGGACAAACACTAGTAGAATGAGCCTGAGGGGGGTTCTCCGTCGACAACCCAACACTCACTCGATTCTTCGCCCTCCACTTCCTCCTCCCCTTTGTAATCGTAGGCCTCACACTAGTCCACCTCACCTTCCTCCACGAAACAGGATCCAACAACCCAACAGGAGTGCCCTCAGATTGCGACAAAATCCCATTCCACCCATACTACACCGTAAAAGACATCCTAGGCTTCGCACTAATAATCTCCCTACTCGTATCCCTAGCCCTATTCTCCCCCAACCTACTAGGAGACCCAGAAAACTTCACACCAGCCAACCCCCTAGTAACACCCCCTCACATCAAACCCGAATGATACTTCCTATTCGCCTACGCCATTCTACGATCCATCCCTAACAAACTCGGAGGTGTCCTAGCCCTAGCTGCCTCAATTCTTGTACTATTCCTAATACCTCTACTTCACACATCTAAACTACGATCAATGACCTTCCGCCCCATCTCTCAAATCCTATTCTGAGCCCTAGTTGCAAACGTCCTCATTCTAACATGAGTGGGAAGCCAACCAGTAGAACACCCATTCATCATCATTGGTCAACTAGCCTCGCTCTCCTACTTCACCATCATTCTAGTCCTATTCCCCATTGCGGCCGCGCTGGAAAATAAACTACTAAAACT----------CTA-ATC-----------AACTCTAATAGTTTATA-AAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACCCCTTCTTAGAGTT Malurus_melanocephalus GTTTTTGTAGCTTAAGGTAAAGCATGACACTGAAGATGTCAAGACGGATGC--TTCA-CGCACCC-AAAGAC--AAAAGACTTAGTCCTAACCTTACTGTTGGTTGTTGCTAGGAATATACATGCAAGTATCCGCGCCCCAGTG-TAGATGCCCTCGGTG-CCTGTCACTC-------AGGTCGGTAGGAGCGGGTATCAGGCTCACAC------CCCCC--CCCGTAGCCCAAAACGCCTTGCACTTGCCACGCCCCCACGGGTACTCAGCAGTAGTTAATATTAAGCAATGAGTGAAAACTTGACTTAGCCATAGCAAC-----TCAGGGTCGGTAAATCTTGTGCCAGCCACCGCGGTCATACAAGAGACCCAAGTCAACTTTA--T----AACGGCGTAAAGCGTGGTAAT-ATGCTAT-CAAAGTAACTAAGGTTAAAAAGCAACTGAGTTGTCACAAGCCCAAGATGC-TCATAAGGCCACC-CCCAAAAAGAAGACCTTAGACT--AACGATCAATTAAAACCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGGTGCT-TTA--ATCAACTCAAGCATCCGCCCGAGAACTACGAGCGCAAACGCTTAAAACTCTAAGGACTTGGCGGTGCCCCAAACCCACCTAGAGGAGCCTGTTCTATAATCGATGATCCACGTTA-TACCCGACCATTTCTTGC-CAG-----TCAGCCTATATACCGCCGTCGCCAGCCCACCCAT---CTGAAGGTTCAACAGTGAGCGCAATAG-CCTAA--CCCGCTAGTAAGACAGGTCAAGGTATAGCCTATGGAATG----------------------GA-GGTAATGGGCTACATTTTCTAGTATAGAACA-T----CACGGCAAAGGGACATGAAACTGTCTCTCGAAGGCGGA-TTTAGCAGT-AAAGTGGGACCATCGAGCCCTCTTTAAGCCGGCTCTGGGGCACGTACATACCGCCCGTCACCCTCCTCAAAGG-CG-----ACCCCCTCCCCAT-AACTAATAAGCTAT-TC--AGCCAAAGATGAGGTAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACTA-CCAAGACGTAGC-TTAAACA-AAAGCATTCAGCTTACACCTGAAAAATGTCTGCTA-ACATCAGATCGTCTTGA-GGCCCAGCCCTAGCCC--------GAGAC-ACATTG------ACCTGGA-ATAAC--AAAGCCACTTAGACATA-AAC------AACTAAAGCATT---T--ACTAAT-CCCAGTATAGGCGATAGAAAAGATA-CCA-TCGGC-GCGATAGAGAG-CACGTACCGTAAGGGAAAGATGAAATAATAATG-AAAAAAGA--TAAGCCA-AAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTAGCAAGAAA-AACCAAGCAAAACGA--ATTGAAGCTTGCCACCCCGAAACCCAAGCGAGCTACTTACGAGCAGCTAA-C-ATGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGATGACTTGTCAGTAGAGGTGAAAAGCCAAC-CGAGCTGGGTGATAGCTGGTTGCCTGTGAGACGAATTTAAGTTCACTCTTAATTCTCCTCCAAGG--AACTCCACG-AACCCTA--ATGAAGC---GAATTAAGGGCTATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAGTACAATCTCTA-CGAGCGGATA----AGTACACTAG-----TGTAGAACTTACTGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGCGTCAAAGCTCCTA-CTATGAAAAATATGTT-AATCCTACGACTCCCT-CCCCACTAACAGGCTAACCTATAT--GAATAGGAGAATTAATGCTAGAATGAGTAACTAGGG--A--TCTTCCCTCT----ACGACGCAAGCTTACATCAATA-CATTATTAACAAG-ACACCC-ATATACGA--CTAAT---------CCA---ACAAGCA-TAG-TATTA-AACAAC-TTGTTAACCCGACAGA-GGAGCGTCCGT--AAGAAAGATTAAAACCTGTGAAAGGAACTAGGCAAA--CGTCAAGGCCCGACTGTTT-ACCAAAAACATAGCCTTCAGCAAACCCCAG-ACAAGTATTGAAGGTGATGCCTGCCCGGTG--ACCT-CGT---GTTAAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCCCATAAATCGAGACTAGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTCACAGGCGATCAGTGAAATTGATCTTCCTGTGCAAAAGCAGGAATAACCCCATAAGACGAGAAGACCCTGTGGAACTTTAAAAACAGCAACCACG--CCTAAA-TACTTA----CC-CCCCCATAC---GGGCTCACTTAT-TCATTAG-GC-C-CCTGGTC-TGCATTTTTTCGGTTGGGGCGACCTTGGAGAAAAAC-AAATCCTCCAA-AAATTGGACCACACCTCTAGACTA-AGAGCGACTCCTCAACGTGCTAATAGCATCCAGACCCAATAC--AATTGATCAATGGACCAAGCTACCCCAGGGATAACAGCGCAATCTCCTCCAAGAGTCCATATCGACGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCAGCTACTAAGGGTTCGTTTGTTCAACGATTAACAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTATGATG-AGCTCTTCCCAGTACGAAAGGATCGGAA-AAGTGAGGCCAATACTGCAA-GCAAGCCTTC-GCCTTAAGTAATGAATGCAACT-AATTACGAAAGGCTATCACAACCAA-----CCA-CGTCCCAGAAAAGGA--C-TAGCTAGCGTGGCAGAGCTCG--GCAAATGCAAAAGGCTTAAGTCCTTTATCTCAGAGGTTCAAATCCTCTCCCTAGC-----TTCCTT----------TCCCCTCTTACCTATGGC----------CAACCATCCCCTCCTAGTCAATCTTATTATGACCCTCTCCTACGCTCTCCCCATCTTAATCGCCGTAGCCTTTCTAACCCTGGTAGAACGGAAAATCCTCAGCTACATACAAGGTCGGAAAGGACCCAATGTTGTAGGCCCTTTCGGACTACTTCAACCCCTAGCAGATGGAGTGAAACTATTCATCAAAGAACCCATCCGAC---------CATCAACCTCATCCCCAATTCTATTCGTCACAACCCCTATACTAGCCCTTCTCTTAGCAATCTCAATTTGAACCCCCCTACCCCTCCCATTTTCCCTTGCAGACCTTAACCTAGGCTTACTATTCCTACTAACTATGTCAAGTCTAGCAGTATACTCAATTCTTTGATCCGGATGAGCCTCCAACTCTAAATACGCCCTAATCGGAGCACTCCGAGCAGTAGCCCAAACCATCTCATACGAGGTGACCCTAGCAATCATTCTCCTATCTATTATTCTTCTCAGCGGTAACTACACCCTTAGCACCCTCGCAGTCACCCAAGAACCCCTATACCTCATCTTCTCCTGCTGGCCCCTTGCCATAATATGATACGTCTCTACCCTCGCCGAAACAAACCGCGCCCCATTCGACCTAACAGAAGGAGAATCAGAACTAGTCTCAGGCTTCAACGTGGAATATGCAGCAGGACCCTTCGCCCTATTCTTCCTAGCAGAATACGCCAACATTATACTCATGAACACCCTCACCGCCATCCTATTTTTCAACCCAAGCCTCCTCCACCCCCCTCAAGAACTCTTCCCCATAATCCTGGCTACTAAAGTCCTACTCCTATCCGCAGGCTTTCTGTGAGTTCGCGCCTCTTACCCACGATTCCGATACGACCAGCTTATGCACCTCCTATGAAAAAATTTCCTTCCTCTGACATTAGCCCTCTGCCTATGACACACCAGCTTACCAGTCTGCTACGCAGGCTTACCC-----CCCTATCTATA--AC--------------CATAAGGAAATGTGCCTGAACCT----AAGGGTCACTATGATAAAGTGAACATGGAGGTACACCAACCCTCTCATTTCCTGA--A----------TTAGAAAAGCAGGGATTGAACCTGCACAGAAGGAATCAAAATCCTTCATACTTCCTTTATATTATTTTCT----------------AGTAAGGTAAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGATGGTTCAACTCCTTCCCCTACTA-ATGAATCCCCAAGCAAAACTGATTTTCACCATTAGCCTAGCCCTAGGAACAACTCTCACAATTTCAAGCAACCATTGAATCA---TAGCCTGAACCGGCCTTGAAATCAACACACTAGCCATCCTCCCTTTAATCGCAAAATCCCATCACCCCCGAGCAATCGAAGCAGCAACTAAATACTTTTTAGTTCAAGCAGCCGCCTCAGCTCTAGTGCTATTCTCAAGCATAACTAACGCATGACATACCGGACAATGAGACATCACTCAACTAACCCACCCGACCTCCTCCGTAATTTTGACTTCAGCTATCGCAATAAAATTAGGATTAGTCCCATTCCATTTCTGATTTCCAGAAGTTCTCCAAGGGTCCTCACTGCTCACCGGTCTCCTCCTTTCAACAGCTATAAAATTTCCTCCACTAACACTCCTCTTCCTAACCTCCCACTCCCTAAATCCCACCCTACTGACCCTCATGGCCATCATATCCACAGCACTGGGAGGGTGAATAGGACTCAACCAAACACAAATCCGTAAAATCCTAGCCTTCTCCTCTATCTCCCACCTAGGATGAATGGCCATCATCATCGCCTTTAACCCAAAACTTACAATACTCAACTTCTATCTCTACAGCCTAATGACTGCCACAGTATTCCTTACCCTAAACACAATAAAAGTTACAAAGTTACCATCACTAATAACCGCCTGAACAAAAACTCCTTCTCTCAATGCTATACTTCTTCTAGCACTCCTATCCCTAGCCGGCCTCCCACCTTTAACAGGTTTCCTACCCAAATGACTTATCATCCAAGAACTAACTAAACAAGAAATAGCCCTAGCAGCAACAATTATCTCCCTTCTCTCCTTACTCAGCCTATTCTTCTACCTACGTCTAGCGTACTGTGCAACAATCACACTTCCTCCTCACACCACAAACCACATCAAACTATGACACACCAACAAACCAACTAGCATCATTACTGCCATTCTGATTACCCTTTCCATCACCCTCCTACCACTCTCCCCCATACTACCCACCATCAT------TT----AAGAAACTTAG----GATTACTT--AAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCTCTTAGTTTCTGTTAAAGTCCGCAGGGTACTATCCTGCATCTCCTGAATGCAACCCAGATACTTTAA-TTAAGCTAGGACCTTGT--CACACCCCCTAGATAGATGGGCCTCGATCCCATAATAC-TATAGTTAACAGCTATATGCCCAAACC-AGCAGGCCTCTACCT-A-------------AGGCCCCGGCACACAA-TCAATGTACATCGATGAGCTTGCAACTCACCATGAACTTCACTACAGAGCC---GATAAGAAGAGGAATTGAACCTCTGTAAAAAGGACTACAGCCTAACGCTT-TTACACTCAGCCATC--------------TTACCTATGACTTTTATCACCCGATGACTATTCTCAACCAACCACAAGGATATCGGAACTCTCTACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGAACCGCCCTGAGCCTCCTAATTCGAGCAGAATTAGGCCAACCCGGCGCCCTCCTTGGAGACGACCAGATTTATAATGTGGTCGTCACTGCCCACGCCTTCGTCATAATTTTCTTTATAGTTATACCAATTATGATTGGAGGATTCGGCAACTGACTAGTCCCCCTCATAATCGGAGCTCCAGACATAGCATTCCCTCGGATGAACAACATGAGCTTCTGACTCCTACCTCCATCCTTCCTCCTTCTATTAGCCTCTTCCACCGTAGAAGCAGGGGCTGGAACAGGATGAACTGTTTATCCCCCCCTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTGGATTTAGCCATCTTCTCCCTCCACCTAGCAGGTATCTCCTCCATCCTAGGGGCCATCAACTTCATCACAACAGCAATTAACATAAAACCTCCCGCCCTCTCACAATATCAAACCCCCCTATTCGTCTGATCAGTCCTAATTACTGCAGTCCTCCTTCTCCTATCCCTCCCAGTCCTTGCCGCTGGTATTACCATGCTCCTCACAGACCGCAACCTAAACACTACATTCTTCGACCCAGCAGGAGGAGGAGACCCTATTCTGTACCAACACCTATTCTGATTCTTCGGTCACCCAGAGGTCTACATCCTAATTCTACCAGGATTCGGAATTATTTCCCACGTCGTAGCTTACTACGCAGGGAAAAAAGAACCATTCGGCTACATAGGAATGGTATGAGCTATGCTGTCCATCGGATTCCTAGGATTTATCGTATGAGCCCATCATATATTCACAGTAGGAATGGATGTAGACACCCGAGCATACTTCACATCCGCCACCATAATCATTGCAATCCCAACCGGCATCAAAGTCTTTAGCTGACTAGC