#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:28 GMT TreeBASE (cc) 1994-2008 Study reference: Sun G., Oide S., Tanaka E., Shimizu K., Tanaka C., & Tsuda M. 2003. Species separation in Curvularia "geniculata" group inferred from Brn1 gene sequences. Mycoscience, 44: 239-244. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1603] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=48; TAXLABELS Bipolaris_maydis Curvularia_affinis_IMI38975ku186R Curvularia_fallax_IMI170211ku201R Curvularia_fallax_IMI58645KU196new Curvularia_fallax_IMI79732ku185R Curvularia_geniculata_19A41L10 Curvularia_geniculata_ATCC6671 Curvularia_geniculata_Ascosg495ku187R Curvularia_geniculata_Ascosg4ku27R Curvularia_geniculata_AwaHito81ku6 Curvularia_geniculata_B771ku88 Curvularia_geniculata_B8012 Curvularia_geniculata_BlueStem3ku4 Curvularia_geniculata_Clover84384kuroba Curvularia_geniculata_ICMP614078 Curvularia_geniculata_Ku197R Curvularia_geniculata_L9 Curvularia_geniculata_NC2912 Curvularia_geniculata_Niigata5_ku28 Curvularia_geniculata_Yaseiine Curvularia_geniculata_ku195 Curvularia_matsushimae_AwaKenjyoku90 Curvularia_matsushimae_B71 Curvularia_matsushimae_B77 Curvularia_robusta_NC3cu2 Curvularia_robusta_NC7cu22 Curvularia_senegalensis_914Chijimi Curvularia_senegalensis_Byoucu72 Curvularia_senegalensis_CypHitoku184 Curvularia_senegalensis_IMI69539 Curvularia_senegalensis_IMI80285bku188 Curvularia_senegalensis_KokibimatsuL7 Curvularia_senegalensis_Myoga_cu42 Curvularia_senegalensis_atcc24154 Curvularia_sp._Cyp22 Curvularia_sp._Cypinag1xiaobei Curvularia_sp._Hostkuma39host Curvularia_sp._KarukayaDazai Curvularia_sp._Kobayashi4 Curvularia_sp._Kobayashiku57R Curvularia_sp._Lemong1ku53R Curvularia_sp._NC3cu1 Curvularia_sp._OhiAkatorii Curvularia_sp._Redtop Curvularia_sp._Shiba915ku9 Curvularia_sp._Tojin12 Curvularia_sp._Tojinku83new Curvularia_sp._Zoi_cg7.6ku7 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3486] TITLE Brn1_gene_for_naphthalenetriol_reductase; LINK TAXA = Taxa1; DIMENSIONS NCHAR=696; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bipolaris_maydis AGGCCGCGGTATCGGCAAGGCCATGGCCATTGAGCTCGCCAAGCGTGGCGCCAAAGTCGCCGTCAACTACGCCAACGCCGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCCCTCGGCAACGGCTCCGACGCCCACGCCTTCAAGGCCAACGTCGGCAACGTCGAGGAGTCTGAGAAGCTCATGGACGACGTCGTCAAGCACTTTGGCAAGCTCGACATTTGCTGCTCAAACTCTGGTGTTGTCTCTTTCGGCCACTTCAAGGATGTCACCCCCGAGGAGTTTGACCGTGTCTTCAACATCAACACCCGTGGTCAGTTCTTCGTAGCCAAGGCCGCGTACAAGCGCATGGAGATGGGTGGCCGCATTATCCTCATGGGTTCCATCACCGGTCAGGCAAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCAAAGGGTGCTATTGAGACTTTCACCAGGTGCATGGCTGTCGGTAAGTCCTCGTTATCCGCTTCAGGCTTTGGATTCTCGGGTTTGCTAATCATTTGTTTCAGACGCTGGTGAGAAGAAGGTCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACTGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCAACGGTGACCAGCTCTCCGACGACCAGGTCGACGAGTACGCCTGCACGTGGTCCCCCCACAACC Curvularia_affinis_IMI38975ku186R AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAAGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGTAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTTCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCGTCGCTTCACTCGT---ATACCATC---CACTAACAATAT-CTTA-GATGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGAAATGTACCAAGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_fallax_IMI170211ku201R GGGCCGTGGTATTGGAAAGGCTATGGCTATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAACGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_fallax_IMI58645KU196new AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAAGTGCATGGCCATCGGTAAGTCGTACCTCGACGCTTCACTCTT---ATACCATC---CACTAACAATAT-CTTA-GATGCCGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATCCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_fallax_IMI79732ku185R AGCCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_19A41L10 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACATCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCGACGCTTCACTCTT---ATACCATC---CACTAACAATAT-CTTA-GATGCCGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATCCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_ATCC6671 AGGCCGTGGTATCGGAAAGGCCATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTAACGCCCACGCCTTCAAGGCCAACGTCGGCAACGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCGATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGCATCTCGCCACTTTACTGTC---ACAACGTA---TACTAACAACAT-CTCAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATTCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_geniculata_Ascosg495ku187R AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGGAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_Ascosg4ku27R AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCGACGCTTCACTCTT---ATACCATC---CACTAACAATAT-CTTA-GATGCCGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATCCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_AwaHito81ku6 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTCCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCCCTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_B771ku88 GGGCCGTGGTATTGGAAAGGCTATGGCTATTGAGCTTGCCAAGCGCGGTGCAAAGGTCGCCGTCAACTACGCCAACGCCGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAACGTCGAGGAGAGCGAGAAGCTCATGGATGACGTCGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCCAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCCGTCTACTCCGGCTCCAAGGGTGCCATCGAGACCTTCACCAGGTGCATGGCTATCGGTAAGTCTTACCTCGTCATTCAACTTTC---ACTCCATAA--TACTAACAACAT-CTTA-GATGCTGGTGAGAAGAAGGTCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCATGCTGTCTGCCGCGAGTACATCCCCGATGGTGATAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_B8012 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCCCTGACGCCCACGCCTTCAAGGCCAATGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_BlueStem3ku4 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAAGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGTAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCGTCGCTTCACTCGT---ATACCATC---CACTAACAATAT-CTTA-GATGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_Clover84384kuroba AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGACCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGGCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCGACGCTTCACTCTT---ATACCATC---CACTAACAATAT-CTTA-GATGCCGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATCCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_ICMP614078 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCTATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_Ku197R AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAGGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGCTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACGAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_L9 AGGCCGTGGTATGGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_NC2912 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTATGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_Niigata5_ku28 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGC-AGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCGACGCTTCACTCTT---ATACCATC---CACTAACAATAT-CTTA-GATGCCGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATCCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_Yaseiine AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAAGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGTAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCGTCGCTTCACTCGT---ATACCATC---CACTAACAATAT-CTTA-GATGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_geniculata_ku195 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCTAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_matsushimae_AwaKenjyoku90 AGGCCGTGGTATTGGAAAGGCTATGGCTATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCCGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCTCACGCCTTCAAGGCCAACGTCGGCAACGTCGAGGAAAGCGAGAAGCTCATGGATGACGTCGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCCAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCCGGCTCCAAGGGTGCCATCGAGACCTTCACTAGGTGCATGGCTATCGGTAAGTTTTACCTTGTCATTCAACTTTC---ACTCCATAA--TACTAACAACAT-CTTA-GATGCTGGTGAGAAGAAGGTCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGTGAGTACATCCCCGACGGTGATAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_matsushimae_B71 AGGCCGTGGTATTGGAAAGGCTATGGCTATTGAGCTTGCCAAGCGCGGTGCAAAGGTCGCCGTCAACTACGCCAACGCCGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAACGTCGAGGAGAGCGAGAAGCTCATGGATGACGTCGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACCTCCAGGACGTCACCCCCGAGGAGTTTGACTGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCCAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCCGTCTACTCCGGCTCCAAGGGTGCCATCGAGACCTTCACCAGGTGCATGGCTATCGGTAAGTCTTACCTCGTCATTCAACTTTC---ACTCCATAA--TACTAACAACAT-CTTA-GATGCTGGTGAGAAGAAGGTCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCATGCTGTCTGCCGCGAGTACATCCCCGATGGTGATAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_matsushimae_B77 AGGCCGTGGTATTGGAAAGGCTATGGCTATTGAGCTTGCCAAGCGCGGTGCAAAGGTCGCCGTCAACTACGCCAACGCCGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCCTCAAGGCCAACGTCGGCAACGTCGAGGAGAGCGAGAAGCTCATGGATGACGTCGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGTAGTTTGACCGTATCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCCAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCCGTCTACTCCGGCTCCAAGGGTGCCATCGAGACCTTCACCAGGTGCATGGCTATCGGTAAGTCTTACCTCGTCATTCAACTTTC---ACTCCATAA--TACTAACAACAT-CTTA-GATGCTGGTGAGAAGAAGGTCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCATGCTGTCTGCCGCGAGTACATCCCCGATGGTGATAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_robusta_NC3cu2 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGTGGCGCAAAGGTCGCCGTCAACTACGCCAACGCCATCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCGCCGCCTTCAAGGCCAACGTCGGCAACGTCGAGGAGAGCGAGAAGCTCATGGACGACGTCGTCAAGCACTTTGGAAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAATATCAACACTCGTGGCCAGTTCTTCGTCGCCAAGGCTGCCTACAAGCGCATGGAGAAGTACGGTCGCATCATCCTCATGGGCTCCATCACTGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCCGGCTCCAAGGGTGCCATCGAGACCTTCACCAGGTGCATGGCTATCGGTAAGTCTTACGTCATCATTCAACTTTC---ACTCCATA---TACTGACGACAT-CTTA-GATGCCGGTGAGAAGAAGGTCACTGTCAACTGCGTTGCCCCCGGTGGTATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGTGATAAGCTCAGCGACGACCAGGTTGACGAGTACGCCTGCACATGGTCTCCTCACCAAC Curvularia_robusta_NC7cu22 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGTGGCGCAAAGGTCGCCGTCAACTACGCCAACGCCATCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCGCCGCCTTCAAGGCCAACGTCGGCAACGTCGAGGAGAGCGAGAAGCTCATGGACGACGTCGTCAAGCACTTTGGAAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAATATCAACACTCGTGGCCAGTTCTTCGTCGCCAAGGCTGCCTACAAGCGCATGGAGAAGTACGGTCGCATCATCCTCATGGGCTCCATCACTGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCCGGCTCCAAGGGTGCCATCGAGACCTTCACCAGGTGCATGGCTATCGGTAAGTCTTACGTCATCATTCAACTTTC---ACTCCATA---TACTGACGACAT-CTTA-GATGCCGGTGAGAAGAAGGTCACTGTCAACTGCGTTGCCCCCGGTGGTATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGTGATAAGCTCAGCGACGACCAGGTTGACGAGTACGCCTGCACATGGTCTCCTCACCAAC Curvularia_senegalensis_914Chijimi AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_senegalensis_Byoucu72 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_senegalensis_CypHitoku184 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_senegalensis_IMI69539 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_senegalensis_IMI80285bku188 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_senegalensis_KokibimatsuL7 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_senegalensis_Myoga_cu42 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_senegalensis_atcc24154 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGATGTTGTCAAGCACTTCGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAAGATGTGACCCCCGAGGAGTTCGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAACTACGGTCGCATCATCCTTATGGGCTCCATCACCGGCCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGTTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGTACCTCAACGCTTCACTCTT---ATATCATC---CACTAACAATAT-CTTA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGGCGGTGACAAGCTCAGCGACGCCCAGGTCGACGGGTACGCCTGCACATGGTCTCCTCACAACC Curvularia_sp._Cyp22 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Cypinag1xiaobei AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Hostkuma39host AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGACCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._KarukayaDazai AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Kobayashi4 AGGCCGTGGTATCGGGAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Kobayashiku57R AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Lemong1ku53R AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACGAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._NC3cu1 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCCGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTCGGCAACGTTGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTTGCCAAGGCTGCCTACAAGCGCATGGAGAAGTACGGTCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCAGGTGCATGGCCATCGGTAAGTCGCACCTCGCCGCTTAACTTTTGTTATGCCATA---TACTAATAACAT-CTCA-GACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCTGGTGGCATCAAGACCGACATGTACCACGCCGTCTGCCGCGAGTACATTCCCGACGGTGACAAACTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCTCCCCACAACC Curvularia_sp._OhiAkatorii AGGCCGTGGTATCGGAAAGGCCATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTTGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAATATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGTCGCATCATCCTCATGGGTTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAACACCTCGCCACTTAACTGCC---ACACTGTA---TACTAACAATAT-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCTCCCGGTGGCATCAAGACCGACATGCACCACGCTGTCTGCCGCGAGTACATCCCCGATGGTGATAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Redtop AGGCCGCGGTATTGGAAAGGCCATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCCGTCAACTACGCCGACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTAGGCAACGGCTCGGACGCCGCCGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTTAAGCACTTTGGCGAGCTCGATATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAACATCAACACCCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAAAAGTACGGTCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTATCTTGTCACTTAACTGTC---GTACCTTA---TGCTAACAACAT-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCCCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGACGGCGACAAGC--------------------------------------------------- Curvularia_sp._Shiba915ku9 AGGCCGTGGTATCGGAAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Tojin12 AGGCCGTGGTATCGGAAAGGCCATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTTGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAATATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGTCGCATCATCCTCATGGGTTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAACACCTCGCCACTTAACTGCC---ACACTGTA---TACTAACAATAT-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGTGATAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Tojinku83new AGGCCGTGGTATCGGAAAGGCCATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTCGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCACGCCTTCAAGGCCAACGTTGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAATATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGTCGCATCATCCTCATGGGTTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAACACCTCGCCACTTAACTGCC---ACACTGTA---TACTAACAATAT-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGCGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGTGATAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC Curvularia_sp._Zoi_cg7.6ku7 AGGCCGTGGTATCGGGAAGGCTATGGCCATTGAGCTTGCCAAGCGCGGCGCAAAGGTTGCTGTCAACTACGCCAACGCTGTCGAGGGTGCCGAGCAAGTCGTCAAGGAGATCAAGGCTCTGAACAACGGCTCTGACGCCCATGCCTTCAAGGCCAACGTCGGCAATGTCGAGGAGAGCGAGAAGCTCATGGACGACGTTGTCAAGCACTTTGGCAAGCTCGACATCTGCTGCTCCAACTCTGGTGTCGTTTCTTTCGGCCACTTCCAGGACGTCACCCCCGAAGAGTTTGACCGTGTCTTCAACATCAACACTCGTGGCCAGTTCTTCGTCGCAAAGGCTGCCTACAAGCGCATGGAGAAGTACGGCCGCATCATCCTCATGGGCTCCATCACCGGTCAGGCCAAGGGTGTCCCCAAGCACGCTGTCTACTCTGGCTCCAAGGGTGCCATTGAGACCTTCACCCGATGCATGGCTATCGGTAAGTAGTACCTCGCCACTTGACTGTC---AACCCGTA---TACTAACAATGC-CTTAAGACGCTGGTGAGAAGAAGATCACTGTCAACTGTGTTGCTCCCGGTGGCATCAAGACCGACATGTACCACGCTGTCTGCCGCGAGTACATCCCCGATGGCGACAAGCTCAGCGACGACCAGGTCGACGAGTACGCCTGCACATGGTCCCCTCACAACC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Brn1_gene_for_naphthalenetriol_reductase) = N: 1-696; CODONPOSSET CodonPositions (CHARACTERS = Brn1_gene_for_naphthalenetriol_reductase) = N: 1-696; END; BEGIN TREES; TITLE Tb7903; LINK TAXA = Taxa1; TRANSLATE 1 Curvularia_sp._Zoi_cg7.6ku7, 2 Curvularia_sp._Tojinku83new, 3 Curvularia_sp._Tojin12, 4 Curvularia_sp._Shiba915ku9, 5 Curvularia_sp._Redtop, 6 Curvularia_sp._OhiAkatorii, 7 Curvularia_sp._NC3cu1, 8 Curvularia_sp._Lemong1ku53R, 9 Curvularia_sp._Kobayashiku57R, 10 Curvularia_sp._Kobayashi4, 11 Curvularia_sp._KarukayaDazai, 12 Curvularia_sp._Hostkuma39host, 13 Curvularia_sp._Cypinag1xiaobei, 14 Curvularia_sp._Cyp22, 15 Curvularia_senegalensis_Myoga_cu42, 16 Curvularia_senegalensis_KokibimatsuL7, 17 Curvularia_senegalensis_IMI80285bku188, 18 Curvularia_senegalensis_IMI69539, 19 Curvularia_senegalensis_CypHitoku184, 20 Curvularia_senegalensis_Byoucu72, 21 Curvularia_senegalensis_atcc24154, 22 Curvularia_senegalensis_914Chijimi, 23 Curvularia_robusta_NC7cu22, 24 Curvularia_robusta_NC3cu2, 25 Curvularia_matsushimae_B77, 26 Curvularia_matsushimae_B71, 27 Curvularia_matsushimae_AwaKenjyoku90, 28 Curvularia_geniculata_Yaseiine, 29 Curvularia_geniculata_Niigata5_ku28, 30 Curvularia_geniculata_NC2912, 31 Curvularia_geniculata_L9, 32 Curvularia_geniculata_Ku197R, 33 Curvularia_geniculata_ku195, 34 Curvularia_geniculata_ICMP614078, 35 Curvularia_geniculata_Clover84384kuroba, 36 Curvularia_geniculata_BlueStem3ku4, 37 Curvularia_geniculata_B8012, 38 Curvularia_geniculata_B771ku88, 39 Curvularia_geniculata_AwaHito81ku6, 40 Curvularia_geniculata_ATCC6671, 41 Curvularia_geniculata_Ascosg4ku27R, 42 Curvularia_geniculata_Ascosg495ku187R, 43 Curvularia_geniculata_19A41L10, 44 Curvularia_fallax_IMI79732ku185R, 45 Curvularia_fallax_IMI58645KU196new, 46 Curvularia_fallax_IMI170211ku201R, 47 Curvularia_affinis_IMI38975ku186R, 48 Bipolaris_maydis; TREE Fig._5 = [&R] (48,(((((((1,10),4,9,13,14,12,11,8,46),(3,6,2)),5),40),(((38,26,25),27),(23,24))),7),(((43,29,45,41,35),(36,28,47)),(39,32,30,42,37,20,22,18,44,15,17,19,31,16,21,33,34))); END;