#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:37 GMT TreeBASE (cc) 1994-2008 Study reference: Dueck L.A., Aygoren D., & Cameron K.M. 2014. A Molecular Framework for Understanding the Phylogeny of Spiranthes (Orchidaceae), a Cosmopolitan Genus with a North American Center of Diversity. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16076] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=219; TAXLABELS Sacoila_lanceolata_30_FL Spiranthes_aestivalis_Sa58_Kew_cult Spiranthes_aestivalis_Sa59_Switzerland Spiranthes_brevilabris_01a_FL Spiranthes_brevilabris_01b_FL Spiranthes_brevilabris_01d_TX Spiranthes_brevilabris_01e_TX Spiranthes_brevilabris_01f_TX Spiranthes_brevilabris_01g_FL Spiranthes_brevilabris_01h_FL Spiranthes_casei_var_casei_02a Spiranthes_casei_var_casei_02b_MI Spiranthes_casei_var_casei_02d_WI Spiranthes_casei_var_casei_02e_NY Spiranthes_cernua_04L_TX Spiranthes_cernua_04a1_NE Spiranthes_cernua_04a2_NE Spiranthes_cernua_04aa_MI Spiranthes_cernua_04b_SC Spiranthes_cernua_04bb_MI Spiranthes_cernua_04c_VA Spiranthes_cernua_04cc_SC Spiranthes_cernua_04dd_NC Spiranthes_cernua_04e_PA Spiranthes_cernua_04ee_cult Spiranthes_cernua_04f1_PA Spiranthes_cernua_04ff_cult Spiranthes_cernua_04g_PA Spiranthes_cernua_04h_WV Spiranthes_cernua_04j_TX Spiranthes_cernua_04k_TX Spiranthes_cernua_04m_FL Spiranthes_cernua_04n_NY Spiranthes_cernua_04p_ME Spiranthes_cernua_04q_ME Spiranthes_cernua_04r_ME Spiranthes_cernua_04s_ME Spiranthes_cernua_04t_WI Spiranthes_cernua_04u_OH Spiranthes_cernua_04v_OH Spiranthes_cernua_04wx_OH Spiranthes_cernua_04y_NY Spiranthes_cernua_04z_OH Spiranthes_delitescens_05a_AZ Spiranthes_delitescens_05b_AZ Spiranthes_delitescens_05c_AZ Spiranthes_diluvialis_06a1_NE Spiranthes_diluvialis_06a2_NE Spiranthes_eatonii_07a_FL Spiranthes_eatonii_07b_FL Spiranthes_floridana_08a_FL Spiranthes_floridana_08b_FL Spiranthes_floridana_08c_FL Spiranthes_floridana_08d_FL Spiranthes_floridana_08e_FL Spiranthes_floridana_08f_FL Spiranthes_infernalis_09a_NV Spiranthes_infernalis_09b_NV Spiranthes_infernalis_09c_NV Spiranthes_lacera_var_gracilis_11a_SC Spiranthes_lacera_var_gracilis_11b_WV Spiranthes_lacera_var_gracilis_11c_NC Spiranthes_lacera_var_gracilis_11d_TX Spiranthes_lacera_var_gracilis_11e_MO Spiranthes_lacera_var_gracilis_11f_AR Spiranthes_lacera_var_lacera_10c_MO Spiranthes_lacera_var_lacera_10d_WI Spiranthes_laciniata_12a_GA Spiranthes_laciniata_12b_GA Spiranthes_laciniata_12c_GA Spiranthes_laciniata_12d_GA Spiranthes_laciniata_12e_GA Spiranthes_longilabris_13a_NC Spiranthes_longilabris_13b_NC Spiranthes_longilabris_13c_FL Spiranthes_longilabris_13d_NC Spiranthes_longilabris_13f_TX Spiranthes_lucida_14a_VA Spiranthes_lucida_14b_PA Spiranthes_lucida_14d_MI Spiranthes_magnicamporum_15a1_IA Spiranthes_magnicamporum_15b_TX Spiranthes_magnicamporum_15c_MO Spiranthes_magnicamporum_15d_TX Spiranthes_magnicamporum_15e_TX Spiranthes_magnicamporum_15f_WI Spiranthes_magnicamporum_15g_WI Spiranthes_ochroleuca_16a_SC Spiranthes_ochroleuca_16b_VA Spiranthes_ochroleuca_16c_NH Spiranthes_ochroleuca_16e_MD Spiranthes_ochroleuca_16f_NH Spiranthes_ochroleuca_16g_MI Spiranthes_ochroleuca_16h_NY Spiranthes_ochroleuca_16i_SC Spiranthes_odorata_17a_NC Spiranthes_odorata_17aa_FL Spiranthes_odorata_17b_NC Spiranthes_odorata_17c_NC Spiranthes_odorata_17d_NC Spiranthes_odorata_17e_NC Spiranthes_odorata_17f_FL Spiranthes_odorata_17g_FL Spiranthes_odorata_17h_FL Spiranthes_odorata_17i_TX Spiranthes_odorata_17j_NC Spiranthes_odorata_17m_FL Spiranthes_odorata_17n_FL Spiranthes_odorata_17opq_GA Spiranthes_odorata_17r_FL Spiranthes_odorata_17s_FL Spiranthes_odorata_17t_FL Spiranthes_odorata_17u_FL Spiranthes_odorata_17v_FL Spiranthes_odorata_17w_FL Spiranthes_odorata_17y_SC Spiranthes_odorata_17z_FL Spiranthes_ovalis_var_erostellata_19a_VA Spiranthes_ovalis_var_erostellata_19b_SC Spiranthes_ovalis_var_erostellata_19c_NC Spiranthes_ovalis_var_erostellata_19d_SC Spiranthes_ovalis_var_erostellata_19e_FL Spiranthes_ovalis_var_ovalis_18b_FL Spiranthes_parksii_20a_TX Spiranthes_parksii_20b_TX Spiranthes_parksii_20c_TX Spiranthes_parksii_sp146_TX Spiranthes_parksii_sp167_TX Spiranthes_parksii_sp267_TX Spiranthes_parksii_sp70_TX Spiranthes_porrifolia_21L_CA Spiranthes_porrifolia_21Lb_CA Spiranthes_porrifolia_21a_CA Spiranthes_porrifolia_21c_OR Spiranthes_porrifolia_21d_OR Spiranthes_porrifolia_21f_CA Spiranthes_porrifolia_21h_CA Spiranthes_porrifolia_21j_CA Spiranthes_porrifolia_21k_CA Spiranthes_porrifolia_21m_CA Spiranthes_porrifolia_21mb_CA Spiranthes_porrifolia_21n_OR Spiranthes_porrifolia_21o_CA Spiranthes_porrifolia_21p_CA Spiranthes_porrifolia_21q_CA Spiranthes_porrifolia_21r_OR Spiranthes_porrifolia_21s_CA Spiranthes_porrifolia_21t_OR Spiranthes_porrifolia_21u_CA Spiranthes_porrifolia_21v_CA Spiranthes_porrifolia_21w_CA Spiranthes_porrifolia_21x_OR Spiranthes_praecox_22a_FL Spiranthes_praecox_22b_SC Spiranthes_praecox_22c_TX Spiranthes_praecox_22d_FL Spiranthes_praecox_22e_NC Spiranthes_praecox_22f_SC Spiranthes_praecox_22g_TX Spiranthes_praecox_22h_TX Spiranthes_praecox_22i_FL Spiranthes_praecox_f.albolabia_23a_FL Spiranthes_romanzoffiana_24a1_WY Spiranthes_romanzoffiana_24a2_WY Spiranthes_romanzoffiana_24b_MI Spiranthes_romanzoffiana_24d_AK Spiranthes_romanzoffiana_24e_WA Spiranthes_romanzoffiana_24f_OR Spiranthes_romanzoffiana_24g_UT Spiranthes_romanzoffiana_24i_MT Spiranthes_romanzoffiana_24j_MT Spiranthes_romanzoffiana_24m_NY Spiranthes_romanzoffiana_24n_CA Spiranthes_romanzoffiana_24o_WI Spiranthes_romanzoffiana_24pq_CA Spiranthes_romanzoffiana_24r_Spiranthes_Scotland Spiranthes_romanzoffiana_24s_NScotland Spiranthes_romanzoffiana_24t_OR Spiranthes_romanzoffiana_24u_OR Spiranthes_romanzoffiana_24v_OR Spiranthes_romanzoffiana_24w_AK Spiranthes_sinensis_29_Malaysia Spiranthes_sinensis_Si17_China Spiranthes_spiralis_Sp51_UK Spiranthes_stellata_31a_OR Spiranthes_stellata_31b_OR Spiranthes_stellata_31c_OR Spiranthes_stellata_31d_OR Spiranthes_stellata_31e_OR Spiranthes_stellata_31f_CA Spiranthes_sylvatica_25a_FL Spiranthes_sylvatica_25b_SC Spiranthes_sylvatica_25c_NC Spiranthes_sylvatica_25d_FL Spiranthes_torta_28a_FL Spiranthes_torta_28b_FL Spiranthes_torta_28c_FL Spiranthes_torta_28f_PuertoRico Spiranthes_torta_28g_PuertoRico Spiranthes_torta_28h_PuertoRico Spiranthes_tuberosa_26b_SC Spiranthes_tuberosa_26c_WV Spiranthes_tuberosa_26e_FL Spiranthes_tuberosa_26f_SC Spiranthes_tuberosa_26g_FL Spiranthes_vernalis_27a1_IA Spiranthes_vernalis_27a2_IA Spiranthes_vernalis_27b_FL Spiranthes_vernalis_27c_SC Spiranthes_vernalis_27d_NC Spiranthes_vernalis_27e_WV Spiranthes_vernalis_27f_TX Spiranthes_vernalis_27g_FL Spiranthes_vernalis_27h_SC Spiranthes_vernalis_27k_FL Spiranthes_vernalis_27m_FL Spiranthes_vernalis_27n_TX Spiranthes_vernalis_27o_TX Spiranthes_x_ichetuckneensis_Ich2_FL ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=219; TAXLABELS Sacoila_lanceolata_30_FL Spiranthes_aestivalis_Sa58_Kew_cult Spiranthes_aestivalis_Sa59_Switzerland Spiranthes_brevilabris_01a_FL Spiranthes_brevilabris_01b_FL Spiranthes_brevilabris_01d_TX Spiranthes_brevilabris_01e_TX Spiranthes_brevilabris_01f_TX Spiranthes_brevilabris_01g_FL Spiranthes_brevilabris_01h_FL Spiranthes_casei_var_casei_02a Spiranthes_casei_var_casei_02b_MI Spiranthes_casei_var_casei_02d_WI Spiranthes_casei_var_casei_02e_NY Spiranthes_cernua_04L_TX Spiranthes_cernua_04a1_NE Spiranthes_cernua_04a2_NE Spiranthes_cernua_04aa_MI Spiranthes_cernua_04b_SC Spiranthes_cernua_04bb_MI Spiranthes_cernua_04c_VA Spiranthes_cernua_04cc_SC Spiranthes_cernua_04dd_NC Spiranthes_cernua_04e_PA Spiranthes_cernua_04ee_cult Spiranthes_cernua_04f1_PA Spiranthes_cernua_04ff_cult Spiranthes_cernua_04g_PA Spiranthes_cernua_04h_WV Spiranthes_cernua_04j_TX Spiranthes_cernua_04k_TX Spiranthes_cernua_04m_FL Spiranthes_cernua_04n_NY Spiranthes_cernua_04p_ME Spiranthes_cernua_04q_ME Spiranthes_cernua_04r_ME Spiranthes_cernua_04s_ME Spiranthes_cernua_04t_WI Spiranthes_cernua_04u_OH Spiranthes_cernua_04v_OH Spiranthes_cernua_04wx_OH Spiranthes_cernua_04y_NY Spiranthes_cernua_04z_OH Spiranthes_delitescens_05a_AZ Spiranthes_delitescens_05b_AZ Spiranthes_delitescens_05c_AZ Spiranthes_diluvialis_06a1_NE Spiranthes_diluvialis_06a2_NE Spiranthes_eatonii_07a_FL Spiranthes_eatonii_07b_FL Spiranthes_floridana_08a_FL Spiranthes_floridana_08b_FL Spiranthes_floridana_08c_FL Spiranthes_floridana_08d_FL Spiranthes_floridana_08e_FL Spiranthes_floridana_08f_FL Spiranthes_infernalis_09a_NV Spiranthes_infernalis_09b_NV Spiranthes_infernalis_09c_NV Spiranthes_lacera_var_gracilis_11a_SC Spiranthes_lacera_var_gracilis_11b_WV Spiranthes_lacera_var_gracilis_11c_NC Spiranthes_lacera_var_gracilis_11d_TX Spiranthes_lacera_var_gracilis_11e_MO Spiranthes_lacera_var_gracilis_11f_AR Spiranthes_lacera_var_lacera_10c_MO Spiranthes_lacera_var_lacera_10d_WI Spiranthes_laciniata_12a_GA Spiranthes_laciniata_12b_GA Spiranthes_laciniata_12c_GA Spiranthes_laciniata_12d_GA Spiranthes_laciniata_12e_GA Spiranthes_longilabris_13a_NC Spiranthes_longilabris_13b_NC Spiranthes_longilabris_13c_FL Spiranthes_longilabris_13d_NC Spiranthes_longilabris_13f_TX Spiranthes_lucida_14a_VA Spiranthes_lucida_14b_PA Spiranthes_lucida_14d_MI Spiranthes_magnicamporum_15a1_IA Spiranthes_magnicamporum_15b_TX Spiranthes_magnicamporum_15c_MO Spiranthes_magnicamporum_15d_TX Spiranthes_magnicamporum_15e_TX Spiranthes_magnicamporum_15f_WI Spiranthes_magnicamporum_15g_WI Spiranthes_ochroleuca_16a_SC Spiranthes_ochroleuca_16b_VA Spiranthes_ochroleuca_16c_NH Spiranthes_ochroleuca_16e_MD Spiranthes_ochroleuca_16f_NH Spiranthes_ochroleuca_16g_MI Spiranthes_ochroleuca_16h_NY Spiranthes_ochroleuca_16i_SC Spiranthes_odorata_17a_NC Spiranthes_odorata_17aa_FL Spiranthes_odorata_17b_NC Spiranthes_odorata_17c_NC Spiranthes_odorata_17d_NC Spiranthes_odorata_17e_NC Spiranthes_odorata_17f_FL Spiranthes_odorata_17g_FL Spiranthes_odorata_17h_FL Spiranthes_odorata_17i_TX Spiranthes_odorata_17j_NC Spiranthes_odorata_17m_FL Spiranthes_odorata_17n_FL Spiranthes_odorata_17opq_GA Spiranthes_odorata_17r_FL Spiranthes_odorata_17s_FL Spiranthes_odorata_17t_FL Spiranthes_odorata_17u_FL Spiranthes_odorata_17v_FL Spiranthes_odorata_17w_FL Spiranthes_odorata_17y_SC Spiranthes_odorata_17z_FL Spiranthes_ovalis_var_erostellata_19a_VA Spiranthes_ovalis_var_erostellata_19b_SC Spiranthes_ovalis_var_erostellata_19c_NC Spiranthes_ovalis_var_erostellata_19d_SC Spiranthes_ovalis_var_erostellata_19e_FL Spiranthes_ovalis_var_ovalis_18b_FL Spiranthes_parksii_20a_TX Spiranthes_parksii_20b_TX Spiranthes_parksii_20c_TX Spiranthes_parksii_sp146_TX Spiranthes_parksii_sp167_TX Spiranthes_parksii_sp267_TX Spiranthes_parksii_sp70_TX Spiranthes_porrifolia_21L_CA Spiranthes_porrifolia_21Lb_CA Spiranthes_porrifolia_21a_CA Spiranthes_porrifolia_21c_OR Spiranthes_porrifolia_21d_OR Spiranthes_porrifolia_21f_CA Spiranthes_porrifolia_21h_CA Spiranthes_porrifolia_21j_CA Spiranthes_porrifolia_21k_CA Spiranthes_porrifolia_21m_CA Spiranthes_porrifolia_21mb_CA Spiranthes_porrifolia_21n_OR Spiranthes_porrifolia_21o_CA Spiranthes_porrifolia_21p_CA Spiranthes_porrifolia_21q_CA Spiranthes_porrifolia_21r_OR Spiranthes_porrifolia_21s_CA Spiranthes_porrifolia_21t_OR Spiranthes_porrifolia_21u_CA Spiranthes_porrifolia_21v_CA Spiranthes_porrifolia_21w_CA Spiranthes_porrifolia_21x_OR Spiranthes_praecox_22a_FL Spiranthes_praecox_22b_SC Spiranthes_praecox_22c_TX Spiranthes_praecox_22d_FL Spiranthes_praecox_22e_NC Spiranthes_praecox_22f_SC Spiranthes_praecox_22g_TX Spiranthes_praecox_22h_TX Spiranthes_praecox_22i_FL Spiranthes_praecox_f.albolabia_23a_FL Spiranthes_romanzoffiana_24a1_WY Spiranthes_romanzoffiana_24a2_WY Spiranthes_romanzoffiana_24b_MI Spiranthes_romanzoffiana_24d_AK Spiranthes_romanzoffiana_24e_WA Spiranthes_romanzoffiana_24f_OR Spiranthes_romanzoffiana_24g_UT Spiranthes_romanzoffiana_24i_MT Spiranthes_romanzoffiana_24j_MT Spiranthes_romanzoffiana_24m_NY Spiranthes_romanzoffiana_24n_CA Spiranthes_romanzoffiana_24o_WI Spiranthes_romanzoffiana_24pq_CA Spiranthes_romanzoffiana_24r_Spiranthes_Scotland Spiranthes_romanzoffiana_24s_NScotland Spiranthes_romanzoffiana_24t_OR Spiranthes_romanzoffiana_24u_OR Spiranthes_romanzoffiana_24v_OR Spiranthes_romanzoffiana_24w_AK Spiranthes_sinensis_29_Malaysia Spiranthes_sinensis_Si17_China Spiranthes_spiralis_Sp51_UK Spiranthes_stellata_31a_OR Spiranthes_stellata_31b_OR Spiranthes_stellata_31c_OR Spiranthes_stellata_31d_OR Spiranthes_stellata_31e_OR Spiranthes_stellata_31f_CA Spiranthes_sylvatica_25a_FL Spiranthes_sylvatica_25b_SC Spiranthes_sylvatica_25c_NC Spiranthes_sylvatica_25d_FL Spiranthes_torta_28a_FL Spiranthes_torta_28b_FL Spiranthes_torta_28c_FL Spiranthes_torta_28f_PuertoRico Spiranthes_torta_28g_PuertoRico Spiranthes_torta_28h_PuertoRico Spiranthes_tuberosa_26b_SC Spiranthes_tuberosa_26c_WV Spiranthes_tuberosa_26e_FL Spiranthes_tuberosa_26f_SC Spiranthes_tuberosa_26g_FL Spiranthes_vernalis_27a1_IA Spiranthes_vernalis_27a2_IA Spiranthes_vernalis_27b_FL Spiranthes_vernalis_27c_SC Spiranthes_vernalis_27d_NC Spiranthes_vernalis_27e_WV Spiranthes_vernalis_27f_TX Spiranthes_vernalis_27g_FL Spiranthes_vernalis_27h_SC Spiranthes_vernalis_27k_FL Spiranthes_vernalis_27m_FL Spiranthes_vernalis_27n_TX Spiranthes_vernalis_27o_TX Spiranthes_x_ichetuckneensis_Ich2_FL ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23132] TITLE Spiranthes; LINK TAXA = Taxa2; DIMENSIONS NCHAR=3689; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Sacoila_lanceolata_30_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTGTTTTG--------------------AG----------AAAAAAG---AAAAAATGAGAA--AAAAGAGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTAGATTAGTAGCTAAAATCCTTCTTTCTATC-----------------AAAAGAAAAGATCGAAATGACAGAAAGGATGACCTTATATACCTAATACATACGTATACATACTGACATAGCAAGC-------------GATTAATCACATTTCTTTCTATTACTATTATCTTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAAAATAAG----------------GATATATAT--AGAAACCCTCTATTTCT-----------ATTCTATTATTCTA---------------TATTAATTAGAATAATATACTATGAAAAGTTTAAATTCTATCAATTCTAATT----------------------------------------------------------------------------------GAAGTT-----------------GAAAAAAGAATCGAATTCAAATATAAAGTTCTTAAGTAATCAAATGATTCATTCCAGAGTTTG-----------------------------ATATATTTT---------TTGAAGAT--GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCGAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATCAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTGTTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTGTTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATAATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATTTCTTGAACTTCTTTGATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTCTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATCTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTATCTTAATTGGAATCTGACTTTTTATAGTCTTTGTATCTGGTCCTGCGCAAAT---ATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGCGCACGTATCAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT-ATGACTTTTGATAACCCGTGAACAT--GTGGCAGCGCCAGCTGTCTATAAGCGCCATTCGCCTGGTGCTCCCTTCTC--GATCGGA-GCATCACAAA-GGTGGATGAAATAAATCAATTGGGCGCGGTGTTGCGCCAAGGAAGATTTTTGTCACTAGCACCGATGGCTATCCGCAAAAGCTCGACGGGCTCAGCGGTGTGTTGTTGCTGCTT-CTGAATTATTATTGTAAGACTCTCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATTCGGCACCGCCTCGA------ACAAGGGGTGATTGTGTTGGGTTGAATGCGGAGATTGGCCCTTCGCGCAGACATTTGTGCGGCGGGTTGAAGCGCGAATGGCCTTCCT-CTTGGCAGATGATT-GATACAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCACTGTCATATCATTGGCCTTG-AGGAGGGCGTGCACACACATCGATAATAGGTCACCCGACGAATCTGTCGTA---GGTGGCACATTGAAATGCGACCCC----GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAATAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGAGGTTTTGGGGACATAAGAATTTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAATCATTCTAGAAATTCCATTCTCGTCGCGATTAGTATCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATCTCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGAGAAATTCTCACATTTAAATTCTGTGTCA-GATCTACTAATACCCCATCCG-ATCCATCTAGAAATCTTGGTTCAAATCCTTCAATG-CTGGATCAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTCTTTTCCACAAATATCATAATTTGAAAAGTATCATTAGTTCAAAGAAATCCATTCACGTCTTTTCAAAAAGAAAGAAAAGATTTTTTTGGTTCC-TACATAATTTT-TATGTATATGAATG-CGAATATCTATTTCTGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAAACGGAATATCTACTAGTAGTTTCTTTTAATTCTTTTCAGAAGATTCTATGGTTACTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTCATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTCTAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAAGACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTAAATTTTGTACTATATCGGGTCATCCTATTAGTAAACCAATCTGGACCGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTGGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGGTATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTATTCCATCTTCCTCCAAAAAA Spiranthes_aestivalis_Sa58_Kew_cult AACTAAAAATGGGCAATCCTGAGCCAAATCCTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGT-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA----------------TATCTACTA------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--ATAAAACCTATATTTTT-----------ATTATATTATTCTA----------------------T----------------------------------------------------------------------------------------------ATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTTAAAT--TCTATCAATTC--------------TAATTTAATTTGAAAAAATTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-CCAGATAGGATCTCTAT-------TTTCTTACTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATATGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGGATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGCATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCATTGGCATTGACGACTATCCGTACGAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGCGGAGATTGGCTCCTCGTGCAAACATTTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCCGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGGCGGATTCGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGATTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AGAAAACCAAAATATCATAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTCGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAAACAGAATATCTACTAGTAGTTTCTTTTAATTATTTTAAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTATATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_aestivalis_Sa59_Switzerland AACTAAAAATGGGCAATCCTGAGCCAAATCCTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGT-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA----------------TATCTACTA------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--ATAAAACCTATATTTTT-----------ATTATATTATTCTA----------------------T----------------------------------------------------------------------------------------------ATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTTAAAT--TCTATCAATTC--------------TAATTTAATTTGAAAAAATTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG----------------AT-------TTTCTTACTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATATGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGGATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGCATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCATTGGCATTGACGACTATCCGTACGAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGCGGAGATTGGCTCCTCGTGCAAACATTTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCCGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGGCGGATTCGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGATTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AGAAAACCAAAATATCATAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTCGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAAACAGAATATCTACTAGTAGTTTCTTTTAATTATTTTAAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTATATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_brevilabris_01a_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACAGGATAGGTGCAGAGACTCAACGGAAGCTATTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTCTTAATATATAGAATTTCTTAATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTATT--CTATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAGTACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTAATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACGTTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATGTGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????---------------------------------------TGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGGAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAAGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTATTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATTTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCTTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAA------------------------------------------------- Spiranthes_brevilabris_01b_FL -----------------CCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACAGGATAGGTGCAGAGACTCAACGGAAGCTATTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTCTTAATATATAGAATTTCTTAATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAATAGACTATG--AAGAATAATAGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAGTACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTAATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACGTTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATGTGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT------------TAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGC{CG}GCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCCGTCGGTGCGTTGTTGCTGCTT-CTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCTGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGATGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCGCATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAAGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATTTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCTTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_brevilabris_01d_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACAGGATAGGTGCAGAGACTCAACGGAAGCTATTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTCTTAATATATAGAATTTCTTAATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCCCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAGTACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTAATTTCCCCGATCCAAAAAGGAAAATCCTTTTAATTTTAATAAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACGTTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATGTGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCT-GATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCCGTCGGTGCGTTGTTGCTGCTT-CTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGATGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCGCATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTCTGTATCAGAATCTAC{AT}AATACCCCATCCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGGCTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTGGGTTCCCTATATAATTTAATATATATATGAATGGCGAATATCTATTTCGGTTT-CTTCGTAAACCAGTCTTCTTATTTACGAATCAACATCTTTTGGAGTCTTTTCTTGGAGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAAGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATTTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCTTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAAAA Spiranthes_brevilabris_01e_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACAGGATAGGTGCAGAGACTCAACGGAAGCTATTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTCTTAATATATAGAATTTCTTAATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCCCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAGTACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTAATTTCCCCGATCCAAAAAGGAAAATCCTTTTAATTTTAATAAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACGTTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATGTGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCT-GATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCCGTCGGTGCGTTGTTGCTGCTT-CTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCTGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGATGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCGCATCGAAATGCGAC-------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTCTGTATCAGAATCTAC{AT}AATACCCCATCCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGGCTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTGGGTTCCCTATATAATTTAATATATATATGAATGGCGAATATCTATTTCGGTTT-CTTCGTAAACCAGTCTTCTTATTTACGAATCAACATCTTTTGGAGTCTTTTCTTGGAGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAAGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATTTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCTTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAAAA Spiranthes_brevilabris_01f_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACAGGATAGGTGCAGAGACTCAACGGAAGCTATTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTCTTAATATATAGAATTTCTTAATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCCCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAGTACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTAATTTCCCCGATCCAAAAAGGAAAATCCTTTTAATTTTAATAAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACGTTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATGTGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCT-GATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCCGTCGGTGCGTTGTTGCTGCTT-CTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGATGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCGCATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTCTGTATCAGAATCTAC{AT}AATACCCCATCCCCATCCATCTGGAAATCTTGGTTCAAATCCTTCAATGGCTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTGGGTTCCCTATATAATTTAATATATATATGAATGGCGAATATCTATTTCGGTTT-CTTCGTAAACCAGTCTTCTTATTTACGAATCAACATCTTTTGGAGTCTTTTCTTGGAGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAAGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATTTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCTTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAAAA Spiranthes_brevilabris_01g_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACAGGATAGGTGCAGAGACTCAACGGAAGCTATTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTCTTAATATATAGAATTTCTTAATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT------------------------ATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAGTACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTAATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACGTTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATGTGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCCGTCGGTGCGTTGTTGCTGCTT-CTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGATGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCGCATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAAGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATTTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCTTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_brevilabris_01h_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACAGGATAGGTGCAGAGACTCAACGGAAGCTATTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTCTTAATATATAGAATTTCTTAATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT------------------------ATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAGTACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTAATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACGTTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATGTGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCCGTCGGTGCGTTGTTGCTGCTT-CTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCTGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGATGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCGCATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAAGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATTTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCTTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_casei_var_casei_02a AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{GT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_casei_var_casei_02b_MI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTCTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_casei_var_casei_02d_WI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTATTCGAATTTATTATATTATTCTATATACTATATAAATTA--------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT------GAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGAC{AG}TCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACGTCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_casei_var_casei_02e_NY AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTCGAATTTATTATAT--TAT------TCT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{GT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04L_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTCTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04a1_NE AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAATAGACTATT-----------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCA{CT}TAGCATTGATGA{AC}TATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGG{GT}TGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGC{AG}GATGGCTCTCCT-CTCGG{CT}TGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCAT{CT}GGCCTTG-AGGATGGCGTGCACACACATCGATAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Spiranthes_cernua_04a2_NE AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAATAGACTATT-----------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCA{CT}TAGCATTGATGA{AC}TATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGG{GT}TGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGC{AG}GATGGCTCTCCT-CTCGG{CT}TGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCAT{CT}GGCCTTG-AGGATGGCGTGCACACACATCGATA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Spiranthes_cernua_04aa_MI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTATATAAA-TTT------ATATACTATATAAATTA----------------GAAAATTAGAATAATAGACTATT-----------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCT-GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCATTAGCATTGA{CT}GAATATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGG{GT}TGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCAT{CT}GGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_cernua_04b_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAA---------------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATT--------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAAAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATA-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04bb_MI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTATATAAA-TTT------ATATACTATATAAATTA----------------GAAAATTAGAATAATAGACTATT-----------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCATTAGCATTGACGAATATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATCGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTT{GT}ACGAACCTGTGGAAATTCTTGGT{GT}ATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTT{AC}TAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTA{AGT}G{CG}GAAGATTAGGTTCGATATTTTTAGAAGAATTT---------------------------------------------- Spiranthes_cernua_04c_VA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-AGAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAAAAAATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04cc_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTATATAAA-TTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTCTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGAC-------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_cernua_04dd_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTATATAAA-TTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_cernua_04e_PA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-AGAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG--CAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{GT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCG------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAA-- Spiranthes_cernua_04ee_cult AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTC-------------------- Spiranthes_cernua_04f1_PA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA----TTTATTATATTATTCTATATACTATAGAAATTA------------------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA-------------------------------------TATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATC{GT}GGAAATCTTGGTTCAAATCCTTCAA{GT}G-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTT{GT}GGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTTTCTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGA-------------------------------------------------- Spiranthes_cernua_04ff_cult AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTATATAAA-TTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACC------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04g_PA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA----TTTATTATATTATTCTATATACTATAGAAATTA------------------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{GT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTT{GT}GGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTTTCTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_cernua_04h_WV AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA----TTTATTCGAA----------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--C{AC}ACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAG-----------------------------------------------------???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAAAAAATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04j_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTCTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA------------------------------------------------------------ACTTGTGAAACGTTTAATTACTCA{AT}ATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAAAAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAAAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATA-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTT------------------------------------------------------------------ Spiranthes_cernua_04k_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTCTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA-------------GACGAACCTGTGGAAATTC{CT}TGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGT{AT}A{GT}GGAAGAAGAACAAG--------------------------- Spiranthes_cernua_04m_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTCTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAAAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATA-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04n_NY AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTCGAATTTATTATAT--TAT------TCT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCAC{AG}TCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04p_ME AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTCGAATTTATTATAT--TAT------TCT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04q_ME AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-AGAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATAC{AG}TGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGAC{AG}GATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04r_ME AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT------------------------AGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04s_ME AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT------------------------AGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAAAAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTA{GT}GGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04t_WI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTATTATATTATTCTATATACTATATAAATTTATATACTATATAAATTA-----------------------------------------------------------------------------------------------GAAAATTAGAATAATAGACTATT-----------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGT------------GA{AT}GACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCA{CT}TAGCATTGA{CT}GA{AC}TATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGG{GT}TGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGC{AG}GATGGCTCTCCT-CTCGG{CT}TGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCAT{CT}GGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCC{AT}TCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04u_OH AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAATTTATTATATTATTCTATATACTATAGAAATTA----------------------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT------GAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04v_OH AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTATTATATTATTCTATATACTATATAAATTTATATACTATATAAATTA-----------------------------------------------------------------------------------------------GAAAATTAGAATAATAGACTATT-----------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGA{AT}GACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCA{CT}TAGCATTGA{CT}GA{AC}TATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGG{GT}TGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGC{AG}GATGGCTCTCCT-CTCGG{CT}TGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCAT{CT}GGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04wx_OH AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTATTCGAATTTATTATATTATTCTATATACTATATAAATTA------------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGAC{AG}TCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAA{AG}GGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCAC{AG}TCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04y_NY AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCT------------------------ATATACTATAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_cernua_04z_OH AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTATA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCT------------------------ATATACTATAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAAGAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTAGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTATTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTTTAATAAATACTCTGACTACGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATTGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_delitescens_05a_AZ AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTTTTTT----CT--------AAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------ATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGTTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--TGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCTGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_delitescens_05b_AZ AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTTTTTT----CT--------AAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------ATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGTTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--TGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCTGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_delitescens_05c_AZ AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTTTTTT----CT--------AAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------ATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAA{AG}AGGAAAATCCGTC{AG}--------GGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCT-------------TAACCCGTGGACAA--GTGGCAGCGTCAGTTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--TGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCTGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_diluvialis_06a1_NE AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------ATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGG-AAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{AG}AATGGGTGGATGCAACCCATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACT{AG}TCCGTGGGAGCTCGAAGGGCTC{AG}TCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCAT{AG}TCATTGGCCTTG-AGGATGGCTTGCACACACATCGATA{AG}TAGGTCACCCGA--------------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATATTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAAAA Spiranthes_diluvialis_06a2_NE AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------ATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGG-AAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{AG}AATGGGTGGATGCAACCCATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACT{AG}TCCGTGGGAGCTCGAAGGGCTC{AG}TCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCAT{AG}TCATTGGCCTTG-AGGATGGCTTGCACACACATCGATA{AG}TAGGTCA-----------------------------------------------------------------GAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATATTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAG--------------------------- Spiranthes_eatonii_07a_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGCTGACATAGCAAGCGATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCTTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCTGTCGGTGCGTTGTTGCTGCTA-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTGGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT{CG}TACGTACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGAAGGCTCTC{AG}{AT}-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATTCCTGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTC---GGTGGCACATCGAAATTCGACC------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_eatonii_07b_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGCTGACATAGCAAGCGATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG---AGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCT------------ATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCCGTCGGTGCGTTGTTGCTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGAGATTTGTGCGGCGGGCTGAAGCGCGGATGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCCTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}A{AT}AAAATCTCACATTTAAATTC{GT}GTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_floridana_08a_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT----AAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAAGAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATGGGTATTAGTATGA--TAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA-------------------------------------------------------------------------------TACTATATCACTATATACTAT-ATCAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTCTAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATAAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????------TCTTT{CT}{GT}GACGAACCTATGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGATGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAAGAAGAAAAAAAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATATACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCTTTCAA{GT}G-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTCTTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATAAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGGAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAAAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAG--------------------------- Spiranthes_floridana_08b_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT----AAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAAGAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATGGGTATTAGTATGA--TAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA-------------------------------------------------------------------------------TACTATATCACTATATACTAT-ATCAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTCTAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATAAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT-------------AACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAACCTATCATTTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACCAGCATTGATGACTATCCGCAGGAGCTCGAAGGGCTTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCCTCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACAATTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCCTG-AGGATGGCGTGCACACACATCGATAGCAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTATGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGATGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAAGAAGAAAAAAAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATATACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCTTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTCTTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATAAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGGAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAAAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_floridana_08c_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT----AAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAAGAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATGGGTATTAGTATGA--TAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA-----------------------------------------------------------------------------------------------------TATAC--------TATATC--AC--------T------ATATACTATATCAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTCTAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATAAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTTTCTTTTTTACGAACCTATGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGATGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAAGAAGAAAAAAAAAAACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTCTGTATCA-GATATACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCTTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTCTTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATAAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGGAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAAAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_floridana_08d_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT----AAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAAGAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATGGGTATTAGTATGA--TAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA-------------------------------------------------------------------------------TACTATATCACTATATACTAT-ATCAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTCTAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATAAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAACCTATCATTTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACCAGCATTGATGACTATCCGCAGGAGCTCGAAGGGCTTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCCTCCCGTGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACAATTGTGCGGCGGGTTGAAGCGTGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCCTG-AGGATGGCGTGCACACACATCGATAGCAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTATGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGATGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAAGAAGAAAAAAAAAAACCAAAATATCA{AG}AATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-{AG}ATATACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCTTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTCTTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATAAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGGAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAAAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_floridana_08e_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT----AAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAAGAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATGGGTATTAGTATGA--TAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA-------------------------------------------------------------------------------TACTATATCACTATATACTAT-ATCAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTCTAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATAAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAACCTATCATTTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACCAGCATTGATGACTATCCGCAGGAGCTCGAAGGGCTTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCCTCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACAATTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCCTG-AGGATGGCGTGCACACACATCGATAGCAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTATGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAAGAAGAAAAAAAAAAACCAAAATATCA{AG}AATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATATACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCTTTCAATG-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTCTTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATAAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGGAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAAAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_floridana_08f_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT----AAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAAGAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATGGGTATTAGTATGA--TAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA-------------------------------------------------------------------------------TACTATATCACTATATACTAT-ATCAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTCTAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATAAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAACCTATCATTTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACCAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCTTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCCGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCCTCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACAATTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCCTG-AGGATGGCGTGCACACACATCGATAGCAGGTCACCCGACGTATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTATGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGATGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAAGAAGAAAAAAAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATATACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCTTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAA{AG}AAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTCTTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATAAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGGAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAAAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_infernalis_09a_NV AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-------------AAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TAGAAATTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------TAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTAATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCATATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_infernalis_09b_NV AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-------------AAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TAGAAATTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------TAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTAATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCATATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_infernalis_09c_NV AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-------------AAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TAGAAATTAGAA-----------------------------------------------------------------------------------------------------------------------------------------------------TAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCG--------------------------------------------CA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTT-----GATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTAATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCATATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_lacera_var_gracilis_11a_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTT{GT}ACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCCCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTT--------------------- Spiranthes_lacera_var_gracilis_11b_WV AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCATGAGCTCGAAGGGCCTGTCGGTGCGTTGTTGCTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGAAGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAG--GAGTTTTCTTTTT{GT}ACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGA{AC}CAAGTTTCTT--------------------- Spiranthes_lacera_var_gracilis_11c_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-----------------T-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTT-----???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_lacera_var_gracilis_11d_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAAC{AT}ATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCATGAGCTCGAAGGGCCTGTCGGTGCGTTGTTGCTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGAAGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGT{AT}---GGTGGCACATCGAAATGCGACCCCAGG------------------AACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATT----------------------------------------------- Spiranthes_lacera_var_gracilis_11e_MO AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--------------------------------------CCCAGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_lacera_var_gracilis_11f_AR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAATTTATTATATTATTCTATATACTATATAAATTA----------------------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGTGGATGCAAACTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCTGTCGGTGCGTTGTTGCTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGACATTTGTGCGGCGGGCTGAAGCGCGGAAGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTT---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_lacera_var_lacera_10c_MO AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG---------------TAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTGACGAACCTGTGGAAATTCCTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAGATAAAATCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTT------------------------- Spiranthes_lacera_var_lacera_10d_WI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATTCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA--------------TTATTCTATAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGTCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCAGGAGCTCGAAGGGCCCGTCGGTGCGTTGTTGCTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------ACGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGGATGGCTCTTCGTGCAGAGATTTGTGCGGCGGGCTGAAGCGCGGATGGCTCTCGT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCCTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCC----GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTATTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTC-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAAGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_laciniata_12a_GA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--ATAA-CCCTATATTTTT-----------CTTATATTATTCTA----------------------TA----------------------------------------------------------------------------------------------TACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTTAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-----------------------------------------CAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATAAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATG---------------------------------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCATTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCTCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCGGATGGCTCTCCTGCTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TCCCGGTTGGCCTGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATA---------------------------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTATCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAACGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATATGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGAATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_laciniata_12b_GA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA----------------------TA----------------------------------------------------------------------------------------------TACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTTAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG--CAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATAAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA--------------------TAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCATTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCTCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCTGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTATCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCC{AT}TCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAACGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATATGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGAATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_laciniata_12c_GA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAAAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA----------------------TA----------------------------------------------------------------------------------------------TACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTTAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATAAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGT------------------------TAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCATTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCTCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCTGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTATCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTAC{AG}ATCTATTC{AGT}TTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTC{GT}GTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCT{GT}GGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAACGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATATGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGAATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_laciniata_12d_GA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAAAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA----------------------TA----------------------------------------------------------------------------------------------TACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTTAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATAAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA--------------------TAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCATTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCTCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCTGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTATCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAACGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATATGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGAATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_laciniata_12e_GA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAA-CCCTATATTTTT-----------CTTATATTATTCTA----------------------TA----------------------------------------------------------------------------------------------TACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTTAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATAAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA-------------------ATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCATTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCTCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCTGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTATCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAACGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATATGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGAATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_longilabris_13a_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTTAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCGA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATACTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTTAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_longilabris_13b_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAA-TTT------ATATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTTAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCGA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATACTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTTAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_longilabris_13c_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-----------------T-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTTAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGC{AG}GATATGGTCGA---ATGG-------------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTAATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATACTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTTAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_longilabris_13d_NC ------------------------------TTTTT------------------------AG---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--------------------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTTAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCGA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAA{CT}GTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAG--GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATACTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTTAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_longilabris_13f_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATTAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTTAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTG---------------------------------------------------------------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCGTGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA-------------------------------------TATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCC{AT}TCTGGAAATCTTGGTTCAAATACTTCAATG-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTTAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAG--------------------------- Spiranthes_lucida_14a_VA ------------------------------TTTTTTTTTTTTT----------------CT-------------AAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACATTAGATTAGTAGTGAAAATAGATCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-----------ATTCTATTATTCTA---------------ATTTCTATAGAATAATAGACTATGAAAAGATTCTATTATTCTAATTTCTATA-----------------------------------------------------------------------------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--TC----------------------------------CCCAGATAGGATCTCTATTTTCTTCTTTATTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTAA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGTATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCTGAACCGAACAAATCTTTACATTTTATTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTATGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---A--------------------------------CCGTGGACAT--GTGGCAGCGTCGGCTGCCTGTAA-TGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGCATTGCGCCAAGGAAG--CGTTGTCATTAGCATTGACGACAATCTGCAGGAGCTCTTATGGCTCATCGGTGCGTTGTTGTTGCTT-TTGAATTATTATTGTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGATTGTGCTGGGTTGAATGCGGAGATTGGCTCTTCGTGCAAAC{AG}TTTGTGCGGCGGGCTGAAGCGCGGATTGCTCTCCT-CTCGGTTGATGCGT-GGCAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACGTTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATGATGGGTCGCC-GACGAATTAGTCGGG---GGCTGCAGGTCGA----------------------CTTTTTGACGAACCTGTGGAAATTCGTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTCTTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAACAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAAGG-CGAATATATATTTCGTTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTTTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATGTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCATCAAGAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCA----- Spiranthes_lucida_14b_PA ------------------------------TTTTTTTTTTTT-----------------CT-------------AAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACATTAGATTAGTAGTTAAAATAGATCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-----------ATTCTATTATTCTA---------------ATTTCTATA------------------------------------------------------------------------------------------------------------------------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--TCC-------------------------------------------------------------------------------------------------------------------CAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTAA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGTATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCTGAACCGAACAAATCTTTACATTTTATTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTATGTATAAGGAACGAA----------------------------------------------???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCGTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTCTTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAACAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAAGG-CGAATATATATTTCGTTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTTTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATGTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAACACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCATCAAGAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_lucida_14d_MI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTTTTT---------------CT-------------AAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACATTAGATTAGTAGTTAAAATAGATCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-----------ATTCTATTATTCTA---------------ATTTCTATAGAATAATAGACTATGAAAAGATTCTATTATTCTAATTTCTATA-----------------------------------------------------------------------------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG------------------------CTTTATTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTAA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGTATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCTGAACCGAACAAATCTTTACATTTTATTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTATGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCGGCTGCCTGTAA-TGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGCATTGCGCCAAGGAAG--CGTTGTCACTAGCATCGACGACAATCTGCAGGAGCTCTTATGGCTCATCTGTGCGTTGTTGTTGCTT-TTGAATTATTATTGTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGATTGTGCTGGGTTGAATGCGGAGATTGGCTCTTCGTGCAAACATTTGTGCGGCGGGCTGAAGCGCGGATTGCTCTCCT-CTCGGTTGATGCGT-GGCAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACGTTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATGATGGGTCGCC-GACGAATTAGTCGGG---GGCTGCAGGTCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCGTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATATACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTCTTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAACAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAAGG-CGAATATATATTTCGTTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTTTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATGTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCATCAAGAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_magnicamporum_15a1_IA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATAT--------------ACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACC{CT}ATCAATTGGGCGCCGCGCCG{CT}GCCAAGGAAG--CGTTGTCA{CT}TAGCATTGA{CT}GACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGG?TGTGCCGGGTTGAAT{CG}TGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGG{ACT}TGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCAT{CT}GGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCA-------------------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAA-- Spiranthes_magnicamporum_15b_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATAT--------------ACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATC-----CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT-------------------------------------------------------------------------TTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACT{AG}TCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCAT{CT}GGCCTTG-AGGATGGC{GT}TGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAA{GT}GCGACCCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_magnicamporum_15c_MO AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATAT------------------------------------------------------------------------ACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCA{CT}TAGCATTGACGAATATCCGTGGGAGCTCGAAGGGCTCGTC{AG}GTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTT{CG}GTGCAGACATCT{AG}TGCGGCGGGTT{AG}AAGCGC{AG}GATGGCTCTCCT-CT{CT}GG{GT}TGATGCGT-GACAAAGGGGTGGTTGGATGC-T{CG}CCGGTTGGCCCGCATTG{CT}CAT{CG}TCAT{CT}GGCCTTG-AGGATGG{CG}{CG}{AT}GCACACACATCGATAGTA{AG}GTCACCCGACGGATTCGTC{AG}TA---GGTGGCACATCGAAATGCGACCCCAG--GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_magnicamporum_15d_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATAT--------------ACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT-----------------------------TGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACC{CT}ATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCA{CT}TAGCATTGACGACT{AG}TCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGC{GT}TGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_magnicamporum_15e_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATAT--------------ACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-CCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCT-GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCATTAGCATTGACGAATATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATCGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA--------------ACGAACCTGTGGAAATTC{CT}TGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTAGGGAAGAAGAACAAG--------------------------- Spiranthes_magnicamporum_15f_WI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTCTTATATTATTCTATATACTAT-ATTTATATTATTCTATATACTATATAAATTATAGAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACC{CT}ATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGC{GT}TGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTAGGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_magnicamporum_15g_WI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTCTTATATTATTCTATATACTAT-ATTTATATTATTCTATATACTATATAAATTATAGAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACC{CT}ATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCA{CT}TAGCATTGACGA{AC}TATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGGTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGTTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGC{GT}TGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCC{AG}GGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Spiranthes_ochroleuca_16a_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CA-------------------------------------AGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT--------------ACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{GT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA------------------------------------------------------TTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGA{AC}CAAGTTTTTT--------------------- Spiranthes_ochroleuca_16b_VA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAAC--------------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AG{GT}TGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAA{AG}GGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTC-------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ochroleuca_16c_NH AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--C-----------------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTC----------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ochroleuca_16e_MD AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAAC--------------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AG{GT}TGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAA{AG}GGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTC-------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTAACAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ochroleuca_16f_NH AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAAT-------------------------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{GT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCAC{AG}TCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ochroleuca_16g_MI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACA--------------------------------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AG{GT}TGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAA{AG}GGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCAC{AG}TCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ochroleuca_16h_NY AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTCGAATTTATTATAT--TAT------TCT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGTTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAA{AG}GGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ochroleuca_16i_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG--CAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{GT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCG------------------------------------GAGTTTTCTTTTT{GT}ACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTT--------------------- Spiranthes_odorata_17a_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA---------------TTTATTCGAA-----------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-------------TCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTTAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17aa_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAAACCCTATATTTTTATT--ATTTTTATTATATTATTCTA-----------------------------------------------------------------------------------------------------TATAC--------TATATAA-ATTATA----TAA----ATAAATTATATAAATTATATAT-------------AAATTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCTCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGT-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCGCCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTATATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGTAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACAAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-GTCGGATTACGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17b_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT--AGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAAAA Spiranthes_odorata_17c_NC ------------------------CAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAAACCCTATATTTTTATT--ATTTTTATTATATTATTCTA----------------------TA----------------------------------------------------------------------------------------------TACTAT-ATAAATTATATAAATAAATTATATAAATTATATAT--------------AAATTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAAT------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTATATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGTAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACAAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-GTCGGATTACGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17d_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATG-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAAACCCTATATTTTT----------------ATTATT------------------------------TTTATTATATTATTCTATAT--------------ACTATATAAA--------------------------------TTATATAA----ATAAATTAT-ATAAATTATATAT------------------------------------AAATTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG--------GGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAA----------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCT{CT}GT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TCCCGGTTGGCCCGCATTGTCATGTCATTG{AG}CCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTC{AG}CCCGAC{AG}{AG}ATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAAAAAATAAATTCTCACATTTAAATTCTATATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGTAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACAAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-GTCGGATTACGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17e_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATG-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAAACCCTATATTTTT----------------ATTATT------------------------------TTTATTATATTATTCTATAT--------------ACTATATAAA--------------------------------TTATATAA----ATAAATTAT-ATAAATTATATAT------------------------------------AAATTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-CCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCT{CT}GT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATG{CT}-TCCCGGTTGGCCCGCATTGTCATGTCATTG{AG}CCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGAC{AG}{AG}ATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17f_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA------------------------------------TACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TA---------GAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTATACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGC{AG}TTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-{CT}GTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGA--------------ACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAG--------------------------- Spiranthes_odorata_17g_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAAACCCTATATTTTT----------------ATTATT------------------------------TTTATTATATTATTCTATAT--------------ACTATATAAA--------------------------------TTATATAA----ATAAATTAT-ATAAATTATATAT------------------------------------AAATTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGT-T{CG}CCGGTTGGCCCGCATTGTCATGTCATTG{AG}CCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCGCCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA--------------ACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTATATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGTAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCACCCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACAAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-GTCGGATTACGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAG--------------------------- Spiranthes_odorata_17h_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA------------------------------------TACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TA---------GAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-CCGGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT-------------AACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17i_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT----------------ATTATT------------------------------TTTATTATATTATTCTATAT--------------ACTATATAAA------------------------TTATATAAATAAATTATA-TAAATTATAT-ATAAATTATATAT------------------------------------AATTTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG------TAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA--------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCTTTCTC--GATTGGG-GCATCAGGATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACAACGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGAATTCGTCGTA---GGTGGCACATCGAAAT--------------------------------------------------ATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTATATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGTAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCACCCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACAAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-GTCGGATTACGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAG--------------------------- Spiranthes_odorata_17j_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATG-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAAACCCTATATTTTT----------------ATTATT------------------------------TTTATTATATTATTCTATAT--------------ACTATATAAA--------------------------------TTATATAA----ATAAATTAT-ATAAATTATATAT------------------------------------AAATTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-CCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAA---------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCG{CT}GGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCT{CT}GT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-T{CG}CCGGTTGGCCCGCATTGTCATGTCATTG{AG}CCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTC{AG}CCCGAC{AG}{AG}ATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTTTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17m_FL ------------------CTGAGCCAAATCTTT{AT}TTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAG{AT}AGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA-----------------------------------------------------------------------------------------------------TATACTATATT--TATAT--TAT------TCT------ATATACTATATAAATTATAGAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATC-----CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTATACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17n_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA-----------------------------------------------------------------------------------------------------TATACTATATT--TATAT--TAT------TCT------ATATACTATATAAATTATAGAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCGGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGT------------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTTTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17opq_GA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTTATT--ATTTTTATTATATTATTCTA----------------------TA------------------------------------TACTATATAAA------------------------TTATATAAATAAATTATA-TAAAT--TAT---------------ATATAAATTATATATAAT--------------------TTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGT-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCGCCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTATATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGTAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACAAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-GTCGGATTACGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17r_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA------------------------------------TACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCGGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTTTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17s_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA------------------------------------TACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCGGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATTCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17t_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA------------------------------------TACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCGGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17u_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA------------------------------------TACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCGGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17v_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA------------------------------------TACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCGGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17w_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AT---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TA------------------------------------TACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTA--------------TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCGGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_odorata_17y_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTATATAAA-TTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCC{AG}GGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_odorata_17z_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAAACCCTATATTTTTATTATTTTT--ATTATATTATTCTA-----------------------------------------------------------------------------------------------------TATAC--------TATATAA-ATTATA----TAA----ATAAATTATATAAATTATATAT-------------AAATTAGAATAAT-------------------AGACTATGAA-----------AAATTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAAAGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGCGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGT-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCGCCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTATATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGTAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACAAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-GTCGGATTACGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ovalis_var_erostellata_19a_VA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATAT--------------ACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTATATAAATTATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG--CAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAACATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTGTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-ATGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTGATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTG------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTATATCA-AATCTACTAATACCCCATCCC-ATCC{AT}TCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGTAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACAAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-GTCGGATTACGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCC------ Spiranthes_ovalis_var_erostellata_19b_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATAT--------------ACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATT---------ATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCG-----CAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAACATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTGTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-ATGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTGATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTG------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCAGAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTTTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ovalis_var_erostellata_19c_NC -------------CAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATAT--------------ACTATA-----------------------------------TTTATATTATTCTATATACTAT-ATAAATTATATAAATTATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATC-------CAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAACATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTGTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-ATGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTGATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTG------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ovalis_var_erostellata_19d_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---AAAAAAAAAAAAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTAGAGAATTTCTTATA------------------------------------------TTATTCTA-TATACTATATT-TCTATTAT-TCT------ATATACTATATAAATTAGAATAAATTA------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCC----CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTAAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAACATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCG{CT}A---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTTTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTTTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_ovalis_var_erostellata_19e_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATATACTATATTTATA-----------------------------------------TTATTCTA-TATACTATATA-AATTA----TATAAAT---TATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAACATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTGTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-ATGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTGATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_ovalis_var_ovalis_18b_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAA----AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTATATACTATATTTATA-----------------------------------------TTATTCTA-TATACTATATA-AATTA----TATAAAT---TATACTATATAAATTATATAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAACATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTGTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAAT-------GAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-ATGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGCTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGTGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTGATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTTGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCC{AT}TCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTTTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_parksii_20a_TX ---------------------------ATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_parksii_20b_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-----ATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_parksii_20c_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTGACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTG--------------------------------------------- Spiranthes_parksii_sp146_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGG-------------GAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAG--------------------------- Spiranthes_parksii_sp167_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAA----------GAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTT{GT}ACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTT------------------------- Spiranthes_parksii_sp267_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAA---------GAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA------TCTTTTTGACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCC{AT}TCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTT---------------------- Spiranthes_parksii_sp70_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT------ATTTTTT--------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTTACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTT------ATATACTATATAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCGACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCATTCATGTCAAATCTGAATAAATTCATTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAA----------GAAGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTT{CG}TTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATTTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTTGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTC-------------------- Spiranthes_porrifolia_21L_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------A{AG}---------------A-AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC?CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTC--GATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21Lb_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGTGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGCGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21a_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-------------------ATTCTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTC?CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACA-A-GTGGCAGCGTCAGCTGCCTATAAATGTCATTCGCCTGGTGCCCCCTTCTC--GATTGTGAGCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGC??????????????????--???????????????????????????????????????????????????????????????????-??????????---?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------????????????-?????????????????????????????????????????????????????????????????TGGCTCTCCT-CTCGGCTGATGCGTGAACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21c_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21d_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACAT{AG}GCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21f_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------------A-AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCC----CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---A----------------???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21h_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------------A-AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCG---CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA--------GATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGTGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21j_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC?CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCT---GATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_porrifolia_21k_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC?CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTC--???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21m_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC-CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCT---GATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGTGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGCGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21mb_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGTGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGCGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21n_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCAATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21o_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-------------------ATTTTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC?CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21p_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------------A-AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCC----CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTGACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTT--------------------- Spiranthes_porrifolia_21q_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------------A-AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCC----CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21r_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCC----CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21s_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------------A-AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------AT-------TA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTCACCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGTGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAAAA Spiranthes_porrifolia_21t_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCATATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21u_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21v_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAAA- Spiranthes_porrifolia_21w_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT------------------AG---------------A-AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACATATGTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATGGATGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACGTCGCTTCATCCCGCGCCACCTCGC------AGGTGTGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGTGGATGGCTCTCCT-CTCCGCCGATGAGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCAGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_porrifolia_21x_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG-----------------AAAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGAATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTTTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------AT-------TA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTCAAATTGAATTTGAATAATTCAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAAAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTTCTCAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTCTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTCTGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTCTTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGGTATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATTTTATTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGATATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTAATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTATTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_praecox_22a_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTATTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCTGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTTTGCCGGGTTGAATGTGGAGAATGACTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGG{ACG}TGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAG--GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAA{AT}AAATTCTCACATTTCAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAAA Spiranthes_praecox_22b_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTATTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-CCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCTGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTTTGCCGGGTTGAATGTGGAGAATGACTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAG--GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAAA Spiranthes_praecox_22c_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGGCGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTGTGCCGGGTTGAGTGTGGAGAATGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGGGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAG--GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTCAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTATTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAAA Spiranthes_praecox_22d_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTATTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCTGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTC---------------ATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTTTGCCGGGTTGAATGTGGAGAATGACTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCT{GT}GGTTCAAATCCTTCAATG-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAAA Spiranthes_praecox_22e_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTATTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCTGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTT-------------------ACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTTTGCCGGGTTGAATGTGGAGAATGACTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAAA Spiranthes_praecox_22f_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTATTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCTGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCT-------------GATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCC{CT}GAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTTTGCCGGGTTGAATGTGGAGAATGACTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAGGA--------------------------------------ATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTCAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATATTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGT-------------------------- Spiranthes_praecox_22g_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG-CCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTTCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT---------------------------------------AGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGGCGACTATCCGTAGGAGCTCGAAGGGCTTCT{CT}GGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTGTGCCGGGTTGAGTGTGGAGAATGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGGGCGGATGGC{CT}CTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAGGA-----------------------------------------------------------------------------------------------------------------------------------------------------ATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATATTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAA------------------------------------------------- Spiranthes_praecox_22h_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTTCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA--------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGGCGACTATCCGTAGGAGCTCGAAGGGCTTCT{CT}GGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTGTGCCGGGTTGAGTGTGGAGAATGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGGGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTCAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAAA Spiranthes_praecox_22i_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTATTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-------------------------------------------------TATACTA--GAA---------------------------------------------------TA-ATAT---AT-AGAAATTA-----------------------------------------------GAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG--CAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCTGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCT-GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTTTGCCGGGTTGAATGTGGAGAATGACTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAA- Spiranthes_praecox_f.albolabia_23a_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTATTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCTGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT----------------CCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTTTGCCGGGTTGAATGTGGAGAATGACTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACG------------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAAA Spiranthes_romanzoffiana_24a1_WY AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTTTTTT--CT--------AAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Spiranthes_romanzoffiana_24a2_WY AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTTTTTT--CT--------AAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCC-----GAGTTTTCTTTTTGACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24b_MI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTTTT------AG----AAAAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGG-GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24d_AK AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT--------------ACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24e_WA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAA---------------------------------------------------------------------CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA---------------------AACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGA{CT}GACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGC{GT}TGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24f_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTT-----------------------------------------------------CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA--------GATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24g_UT ---------------------------------TTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--------------------------------------CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA--------???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAATAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24i_MT AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAA{AG}AGGAAAATCCGTC{AG}---AGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTC--???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24j_MT AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-------------------ATTCTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA--------GATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24m_NY AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-------------------ATTCTA------------------------------------------------TTATTCTATAGAA--------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGT--CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAA----------GATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCC----GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24n_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT----ATTTTTTTT------AG-----AAAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCC----CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAA{GT}GGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_romanzoffiana_24o_WI AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTTTTTT--CT--------AAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TA----------------------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24pq_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTTTT----CT--------AAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TAGAA------------------------------------------------------------------------------------------------------ATTA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24r_Spiranthes_Scotland AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG----AAAAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------AT-------TA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24s_NScotland AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG-----AAAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-----------ATTCTATTATTCTA----------------------TAGAA-----------------------------------------------------------------------------------------------AT-------TA-----------------------------------------------GAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTC{AG}CCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCT-GATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24t_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-------------------ATTCTA----------------------------------------------------------------------------------------------------------------------T--TAT------TCT-------------ATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24u_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-------------------ATTCTA----------------------------------------------------------------------------------------------------------------------T--TAT------TCT-------------ATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTG{CT}GTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24v_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-------------------ATTCTA----------------------------------------------------------------------------------------------------------------------T--TAT------TCT-------------ATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGTGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_romanzoffiana_24w_AK AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT-----ATTTTTTTT------AG------AAAAAAAAAAT-AAAAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATTTAT--AGAAACCCTATAGTTTT-------------------ATTCTA------------------------------------------------------------------------------------------------------------------------------------T-------TATTCTATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTAATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGGATATATTGGATATATATAATGAAATAATGAAAAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCT-GATGACCCTTGATAACCCGTGGACAA--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGTGCAGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATCTCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTGTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGACTATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTTTGGCTTCAAAGGGAACTCTTATTCTGATGAAGAAAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAAATGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGCGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAAAA Spiranthes_sinensis_29_Malaysia AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTG---------------------AT---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATCAAAAATCAAAATAAAACAAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGT-------------GATTAATAACATTTCTTTCTATTACTATTATCGTCTCTACTA--TATTACTATTCTCGTCTCTACTA------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAGATGAGTATAGGATAAGGATATATAT--AGAAACCCTATATTTTT-----------ATTATAGTATTCTA----------------------T----------------------------------------------------------------------------------------------ATACTAT-ATAAATTAATAAATTAGAAAATTAGAATAATATATAT------------AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTTCAAT--TCTATAAATTC--------------TAATTTCAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCGTGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTTATTTTTTATAGTCTTTTTATCTGTTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT-ATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACGAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTAACGGTGCGTTGTTGTTGCTT-TTGAAATACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCCCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCCGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGGATTCGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGATAGTTTTCTTTTTTATGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTATTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTAAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATACATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCATAAATATCATAATTTGAAAAGTATCATTACTTCAAAAAAATCCATTTACGTATTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATATATTTCGGTTT-TTTCGTAAA-CAGTCTTATTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAAAAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTTTAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTTACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTATTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTAGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTGCAAAAAA Spiranthes_sinensis_Si17_China AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTG----------------------AT---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAATAAAACAAAATAAAAGATTGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGT-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTCTCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTTATTATATTTTTATTATAGTATTCTA----------------------T-------------------------------------------------------------------------------------ATACTATATAAACTAT-ATAAATAAACTATATAAATTAATAAATAAATTA--------------GAAAATTAGAATAAT-------------------ATACTATGAA-----------AAGTTTAAAT--TCTATAAATTC--------------TAATTTCAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG------TAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTAGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAAATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATATAT------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAA-------------------------------------------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACGAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTAACGGTGCGTTGTTGTTGCTT-TTGAAATACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCCCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCCGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGGATTCGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTT{AT}TCTTTTTGACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTAAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATACATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATTATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAA{AG}AAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTAAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTTACTAAGAAATTGGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTAGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTT--------------------- Spiranthes_spiralis_Sp51_UK AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATAACCTTATA-------------------CATACTGACATAGCAAGT-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTCTCTACTA-------------------------------------------------TTAAGATATGAGTAGTTAGTATTAGTATAGGATAAG----------------GATATATAT--ATAAACCCTATATTTTT-----------ATTATATTATTCTA----------------------T----------------------------------------------------------------------------------------------ATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAATATATATAAATTAGAATAATAGACTATGAA-----------AAGTTTAAAT--TCTATCAATTC--------------TAATTTAAT---------TTTAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAAAAATGAAATTTATAGTAAGAGGAAAATCCGTCG----GATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTGTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTTTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAAC----------------------------------------GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCATCAGTTGCCTATAAATGCCATTCGCTCGGTGCCCCCTTCTC--GATCGGG-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTGGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTATCGGTGCGTCGTTGTTGCTT-TTGAATTACT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTATATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGACTCTCCT-CTCGGTTTATGCGT-GACAAAGGGGTGGTTGGATGC-TGTCGGTTGGCCCACGTTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGGATTCGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGACCCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCCTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATC{GT}GGAAATCTTGGTTCAAATCCTTCAA{GT}G-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATATA-TATATATATGAATG-TGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_stellata_31a_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT---ATTTTTTT-------CT------AAAAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTA------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-------------------ATTCTA----------------------------------------------------------------------------------------------------------------------T--TAT------TCT-------------ATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTACAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGGGGGATCCAATGGTATAGTTCATTTTTTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAC--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCTAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGTGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGCTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-ATTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_stellata_31b_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT---ATTTTTTT-------CT------AAAAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTA------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-------------------ATTCTA----------------------------------------------------------------------------------------------------------------------T--TAT------TCT-------------ATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTACAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGGGGGATCCAATGGTATAGTTCATTTTTTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAC--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCTAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGTGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGCTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-ATTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_stellata_31c_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTTT--ATTTTTTTTTTTTT-CT-----AAAAAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTA------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-------------------ATTCTA----------------------------------------------------------------------------------------------------------------------T--TAT------TCT-------------ATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTACAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGGGGGATCCAATGGTATAGTTCATTTTTTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAC--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCTAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGTGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGCTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-ATTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_stellata_31d_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTTT--ATTTTTTTTTTTTT-CT-----AAAAAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTA------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-------------------ATTCTA----------------------------------------------------------------------------------------------------------------------T--TAT------TCT-------------ATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTACAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGGGGGATCCAATGGTATAGTTCATTTTTTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAC--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCTAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGTGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGCTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-ATTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_stellata_31e_OR AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTTT--ATTTTTTTTTTTTT-CT-----AAAAAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-CTATTACTATTCTCGTATCTACTA------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-------------------ATTCTA----------------------------------------------------------------------------------------------------------------------T--TAT------TCT-------------ATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTACAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGGGGGATCCAATGGTATAGTTCATTTTTTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAC--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCTAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGTGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGCTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-ATTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_stellata_31f_CA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT---ATTTTTTTTTTTTT-CT------AAAAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGAAATTTACTACGTTAGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTAGA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GGTATATAT--AGAAACCCTATATTTTT-------------------ATTCTA------------------------------------------------------------------------------------------------------------------------------------T-------TATTCTATA-----------------------G-AAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTGAAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTACAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTATTTTCTTCTTTCTTCCTACGAATACAACA-AGATGATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGGGGGATCCAATGGTATAGTTCATTTTTTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCATTTCCCCGATCCAAAA-GGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATATATAATGAAATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTCTAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCT-GATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCTGGTGCCCCCTTCTC--GATTGGA-GCATCAAAAAGGGTGGATGCAACCTATCAATTGGGCGCGGTGTTGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGAAGCTCTAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------A-GTGGGGTGATTGTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAGCATTTGTGCGGCGGGCTGAAGCGCAGATGGCTCTCCT-CTCGGCTGATGTGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGCTCACCCGACGAATTTGTTGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCGAATGTATCAACAGAAATCTTTGATTTCTTTGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTATTCCTTTGAAGAAAAA---------AAAAGACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTC-TATATATATGAATG-CGAATATCTATTTCGGTTT-ATTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTCTTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCAGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGCACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_sylvatica_25a_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAA--------CCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????-------CTTTTTGACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CGGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTATTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCTTCCAAAAA- Spiranthes_sylvatica_25b_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCA{AG}AATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTCAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCT{GT}GGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTATTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CTTCCAAAAAA Spiranthes_sylvatica_25c_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA-----------------TATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????---------------------------------------------GAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGTAGAA------------------------------------------------- Spiranthes_sylvatica_25d_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG--------AAAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATA--------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA--TATTATATTATTCTATATACTAGAATAATATATA----------------------------------------------------------------------------------------------------------------------------------------G-AAATTAGAATAAT-------------------AAACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCCT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAAATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTATATTTCGTTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTAGAGTCTTTTTATTTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAAT----------------------CCCGTGGACAT--GTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTAGGAGCTCGAAGGGCTTCTCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGC------AGGTGGGGTGCTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTGTT---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCATCGCAATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAACTATCA{AG}AATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTCAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCT{GT}GGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGAAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTCAGAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTATCCAACTATTCTTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTTTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTTTATCGGGTCATCCTATTAGTAAACCAATCTGGACAGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCAATATTTTTAGAAGAATTTATTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CTTCCAAAAAA Spiranthes_torta_28a_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAAGAACATTCCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAA-CCCTATATTTTT-----------CTTATATTATTCTA-----------------TATACTATATAAATTTATATACTATAGAAATTTAGAAATTA------------------------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TATATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTAGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGCGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTAGTCACCAGCATTGACGGCTATCCGCAGGACCTCGAAGGGCCTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCTCCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGGTTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAATCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTTATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAAATCTCACATTTAAATTTTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTTTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCAAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAAATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_torta_28b_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAAGAACATTCCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAA-CCCTATATTTTT-----------CTTATATTATTCTA-----------------TATACTATATAAATTTATATACTATAGAAATTTAGAAATTA------------------------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TATATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCC----CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTAGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGCGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTAGTCACCAGCATTGACGGCTATCCGCAGGACCTCGAAGGGCCTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCTCCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGGTTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAATCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTTATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTTTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTTTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCAAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAAATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_torta_28c_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAAGAACATTCCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAA-CCCTATATTTTT-----------CTTATATTATTCTA-----------------TATACTATATAAATTTATATACTATAGAAATTTAGAAATTA------------------------------------------------------------------------------------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TATATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCC----CCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTAGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATT-CTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGCGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTAGTCACCAGCATTGACGGCTATCCGCAGGACCTCGAAGGGCCTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCTCCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGGTTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAATCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTTATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTAAATTTTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTTTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCAAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAAATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_torta_28f_PuertoRico AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAAGAACATTCCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAA-CCCTATATTTTT-----------CTTATATTATTCTA----------------------TATAC--------------------------------------------------------------------------TATATAAATTTAT---ATACTAT---------------AGAAATT-TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TATATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAAT--CTCTTCATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTTGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGCGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTAGTCACCAGCATTGACGGCTATCCGCAGGACCTCGAAGGGCCTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCTCCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGATGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGCAGGTCACCCGACGGGTTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAATCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTTATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTTTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTTTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAAATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_torta_28g_PuertoRico AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAAGAACATTCCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAA-CCCTATATTTTT-----------CTTATATTATTCTA----------------------TATAC--------------------------------------------------------------------------TATATAAATTTCT---ATACTAT---------------AGAAATT-TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TATATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAAT--CTCTTCATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTTGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGCGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTAGTCACCAGCATTGACGGCTATCCGCAGGACCTCGAAGGGCCTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCTCCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGATGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGCAGGTCACCCGACGGGTTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAATCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTTATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTTTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTTTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAAATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_torta_28h_PuertoRico AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAAGAACATTCCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATATATAGAA-CCCTATATTTTT-----------CTTATATTATTCTA----------------------TATAC--------------------------------------------------------------------------TATATAAATTTAT---ATACTAT---------------AGAAATT-TAGAAATTA----------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TATATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGATAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAAT--CTCTTCATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTCAGCCGCCTATAAATGCCATTTGCCCGGTGCCCCCTTCTC--GATCGGA-GCATCAGAATGGGCGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTAGTCACCAGCATTGACGGCTATCCGCAGGACCTCGAAGGGCCTGTCGGTGCGTTGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCTCCTCGT------AGGTGGGGTGGTTGTGCCGGGTTGAATGCGGAGAATGGCTCTTCGTGCAGACATTTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGATGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGCAGGTCACCCGACGGGTTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAATCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTTATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTAAATTTTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTTTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAAATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_tuberosa_26b_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGATAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------TATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA----------------------TAAAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAATATATAGAAATTAGAATAATAGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACAAATACAACA-AGATTATACATGAACTATCTGCTTGACTCCATGTCCAAATAAAAA-AAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGGATAT-TTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGAAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCCTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTCTCGATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTAACTAGCATTGATGACTATCCGTAGGAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTTGT------AGGT---------GTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGACAATAGGTCACCCGACGAATTCGTTTTA---GGTGGCACATCGAAATGCGACCCCAGG-GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATGAACAGAAATCTTTGATTTCTTCGGTGAATTCTTCTAACCTCAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTACATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACCTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATATATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAAGAGTATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTATCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACGTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTAAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTCTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_tuberosa_26c_WV AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT------------------AG---------AAAAAAAT---AAAAAATGATAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------TATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA----------------------TAAAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAATATATAGAAATTAGAATAATAGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACAAATACAACA-AGATTATACATGAACTATCTGCTTGACTCCATGTCCAAATAAAAA-AAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGGATAT-TTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGAAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCCTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTCTCGATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTAGGAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTTGT------AGGT---------GTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTTTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATGAACAGAAATCTTTGATTTCTTCGGTGAATTCTTCTAACCTCAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTACATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACCTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATATATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAAGAGTATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTATCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACGTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTAAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTCTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_tuberosa_26e_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT------------------AG---------AAAAAAAT---AAAAAATGATAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATTTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------TATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA----------------------TAAAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAATATATAGAAATTAGAATAATAGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACAAATACAACA-AGATTATACATGAACTATCTGCTTGACTCCATGTCCAAATAAAAA-AAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGGATAT-TTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGAAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCCTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTCTCGATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGC{CT}GCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTAGGAGCTCAAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTTGT------AGGT---------GTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTTTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATGAACAGAAATCTTTGATTTCTTCGGTGAATTCTTCTAACCTCAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-CTGGATTAAAGATGTTCCTTCTTTACATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACCTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATATATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAAGAGTATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTATCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACGTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTAAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTCTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_tuberosa_26f_SC -------------------------------TTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGATAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------TATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA----------------------TAAAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAATATATAGAAATTAGAATAATAGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--------------------------------------CCCAGATAGGATCTCTAT-------TTTCTTCCTACAAATACAACA-AGATTATACATGAACTATCTGCTTGACTCCATGTCCAAATAAAAA-AAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGGATAT-TTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGAAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCCTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTCTCGATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTAGGAGCTCGAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTTGT------AGGT---------GTGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGA{CT}AATAGGTCACCCGACGAATTCGTTTTA---GGTGGCACATCGAAATGCGACCCCAGG-GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATGAACAGAAATCTTTGATTTCTTCGGTGAATTCTTCTAACCTCAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCT{GT}GGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTACATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACCTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATATATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAAGAGTATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTATCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACGTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTAAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTCTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_tuberosa_26g_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTT------------------AG---------AAAAAAAT---AAAAAATGATAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATGACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATTTACTA-------------------------------------------------TTAAGATATGAGTA-TTAGTATGAGTATAGGATAAG----------------TATATATAT--AGAAACCCTATATTTTT-----------ATTATATTATTCTA----------------------TAAAA------------------------------------------------------------------------TTTATTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAATATATAGAAATTAGAATAATAGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTGAAAAAA-GAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATACCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACAAATACAACA-AGATTATACATGAACTATCTGCTTGACTCCATGTCCAAATAAAAA-AAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTACAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAG------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGGATAT-TTGGATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTTACTTTTTATAGTCTTTTTATCTGGTCCTACGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGAAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCCTGATAACCCGTGGACAT--GTGGCAGCGTCAGCTGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTCTCGATCGGA-GCATCAAAATGGGTGGATGCAACCTATCAATTGGGCGC{CT}GCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGATGACTATCCGTAGGAGCTCAAAGGGCTTATCGGTGCGTTGTTGTTGCTT-TTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTTGT------A-----GGTG----TGCCGGGTTGAATGTGGAGATTGGCTCTTCGTGCAAACATTTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCACATTGTCATATCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAATAGGTCACCCGACGAATTCGTTTTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATGAACAGAAATCTTTGATTTCTTCGGTGAATTCTTCTAACCTCAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTACATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACCTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TACATAATTTA-TATATATATGAATG-CGAATATATATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAAGAGTATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTATCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACGTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTAAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTCTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_vernalis_27a1_IA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCGTTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGTCGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATTGAAATGCGACCCCAG-A------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Spiranthes_vernalis_27a2_IA AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCGTTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCATAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGTCGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATTGAAATGCGACCCCAG-A------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Spiranthes_vernalis_27b_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTT---------------CCCGTGGA{CT}AT--GTGGC{CG}GCGTTAGCCGCCGATGAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTTACTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCT{ACT}GCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATCT-------------------------------------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAAT{AC}CTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTA{AT}G{CG}GAAGATTAGGTTCGATATTTTTAGAAGAATTTGTT------------------------------------------- Spiranthes_vernalis_27c_SC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTCAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTAT---------------------CCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTT-----???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAGAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTCAATTCTGTATCA-GATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_vernalis_27d_NC AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCGTTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{CGT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGTCGACTATCC{AG}TGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATAC{CG}TGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTGGAGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATG-----------GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGG{GT}TATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-C{GT}GGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAAT{AC}CTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTA{AT}G{CG}GAAGATTAGGTTCGATATTTTTAGAAGAATTTGTT------------------------------------------- Spiranthes_vernalis_27e_WV AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATA------------------------------------------------------------------------------------------GATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCGTTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCA{GT}AATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGTCGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTGGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCC{AT}TCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCAGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_vernalis_27f_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCGTTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGTCGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTGACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTCG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTATTTCATCTTC---------- Spiranthes_vernalis_27g_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA----TTTCTTATATTATTCTTTATATTATTCTATAGAATTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCG--CAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATG-------------------------------------------TGGCGGCGTTAGCCGCCGATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGC{CG}GCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGG-GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAA- Spiranthes_vernalis_27h_SC ------------------------------TTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAA---------------------AACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGC{CG}GCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGG{CT}TGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA-----TTCTTTTTT{AG}CGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTCAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATC------------- Spiranthes_vernalis_27k_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTATTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGA------TCTTTTTGACGAACCTGTGGAAATTC??GGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCA{AG}AATTTACGATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAA{GT}G-{CG}{GT}GGATTAAAGATGT{CT}CCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAA{AG}ATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAA{GT}G-C{AG}AATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTAC{AG}A-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTT{CGT}TGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTATAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAAT------------------------------------------------ Spiranthes_vernalis_27m_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAA------------------------------------------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTT------------------AACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCGGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTACGATCTATTCATTCAATATTTCCTTTTTTAGAAGATAAAATCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_vernalis_27n_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTT-------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------TTAAGATATCTCGTATCTACTA--TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCGGCGTTAGCCGCCGATAAATGCCGTTCGCCCGGTGCCCCCTTCTC--GATCGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGTCGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATA{CT}GTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCCCGCGCCACCTCGT------AGGTGGGGTGGTTGTTCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCGCGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-TGCCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACTTCGATAGTAGGTCACCCGACGGATTCGTCGTA---GGTGGCACATTGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AA{AG}ATAAAATCTCACATTTCAATTCTGTATCA-{AG}ATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCAGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCT-CCTCCAAAA-- Spiranthes_vernalis_27o_TX AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTT--------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-----------------AAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA----------------------TAGAATTTCTTATATTATTCTTTATATTATTCTATAGAA--------------------------------------TTTCTTATATTATTCTATATACTAT-ATAAATTA---------------------------------------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAAGAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTATTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTGGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTGTACGTATAAGGAACGAAGAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTC----???????????????????????????????????????????????????????????????????????????????????????-????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---????????????????????????????GAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTAAAAAATAAAATCTCACATTTCAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCCATCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAATAAATCCACTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAGTCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATATACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCATAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA Spiranthes_x_ichetuckneensis_Ich2_FL AACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT---------------------AG---------AAAAAAAT---AAAAAATGAGAA--AAACGGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACGAATGGAATTTACTACGTTTGATTAGTAGTTAAAATCCTTCTTTCTATC-------AAAAT-AAACAAAATAAAAGATCGAAATGATAGAAAGGATTACCTTATA-------------------CATACTGACATAGCAAGC-------------GATTAATAACATTTCTTTCTATTACTATTCTCGTATCTACTA-------------------------------------------------TTAAGATATGGGTA-TTAGTATGAGTATAGGATAAG----------------GATATATAT--AGAAACCCTATATTTTT-----------CTTATATTATTCTA-----------------------------------------------------------------------------------------------------TATACTATATT--TATAT--TAT------TCT------ATATACTATATAAATTATAGAAATTA-------GAAAATTAGAATAAT-------------------AGACTATGAA-----------AAGTTGAAAT--TCTATCAATTC--------------TAATTTCAT---------TTTAAAAAACGAATCGGACGAGAATAAAGAGAGAGTCCCCTTTTACATGTCAATGCCGA--CAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGCCCAGATAGGATCTCTAT-------TTTCTTCCTACGAATACAACA-AGATTATACATGAACTATCTGCTCGACTCCATGTCCAAATAAAAATAAAGTGGTAATAAGTTCTAATGAATAAATTCA-------------------------TTCATGTCAAATCCCTTCATGATGCATTTTTTAAAATTTTTACTAAGCGAGGGATCCAATGGTATAGTTCATTTATTGGTAGTTTGGAGGATGACAAGCATGACTATTGCTTTCCAATTAGCTATTTTTGCATTAATTGCAACTTCATTAATCTTATTGATTAGTGTACCCGTTGTATTTGCTTCTTCTGATGATTGGTCAAGTAACAAAAATGTTGTATTTTCTGGTACATCATTATGGATTGGATTAGTCTTTCTGGTAGCTATCCTGAATTCTCTCATCTCTTGAACTTCTTTTCTATTTCATTTCCCCGATCCAAAAAGGAAAATCCTTTTAAT------AAATTCAAATTGTGAGACACGCTAAGATTCCATTTGAGTTCCGAACCGACCAAATCTTTACATTTTCTTGTTATGAATTGG---------ATATAT--------ATAATGAAGAATCTTGTCTTCATTTGAATCTGACTTTTTATAGTCTTTTTATCTGGTCCTGCGCAGATGATATGATCCAAACGCATATATGATATAGAATATATGTCATATATGTGTGGACATATGTATACGTATAAGGAACGAATAAAACGCGTATGCGGATATGGTCAA---ATGGTAAAATTTCTCTTGATGACCCTTGATAACCCGTGGACAT--GTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTC--GATTGGG-GCATCAGAATGGGTGGATGCAACCTATCAATTGGGCGCCGCGCCGCGCCAAGGAAG--CGTTGTCACTAGCATTGACGACTATCCGTGGGAGCTCGAAGGGCTCGTCGGTGCGTCGTTGTTGCTT-CTGAATTATT---GTATGACTCCCGGCAATGGATATCTTGGCTCTTGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATTACATCGCTTCATCTCGCGCCACCTCGT------AG{CG}TGGGGTGGTTGTGCCGGGTTGAATGTGGAGAATGGCTCTTCGTGCAGACATCTGTGCGGCGGGTTGAAGCACGGATGGCTCTCCT-CTCGGCTGATGCGT-GACAAAGGGGTGGTTGGATGC-{CT}GTCGGTTGGCCCGCATTGTCATGTCATTGGCCTTG-AGGATGGCGTGCACACACATCGATAGTAGGTCACCCGACGGATTCGCCGTA---GGTGGCACATCGAAATGCGACCCCAGGAGAGTTTTCTTTTTTACGAACCTGTGGAAATTCTTGGTTATGACAAGAAATCTAGTTTAGTACTTGTGAAACGTTTAATTACTCAAATGTATCAACAGAAATCTTTGATTTCTTCGGTGAATTATTCTAACCTAAAGGGGTTTTATAGGCATGAAAATCTTTTTTCTTTTCATTTTTCTTCTCAAATATTATCAGAAGGTTTTGGAGTCATTCTAGAAATTCCATTCTCGTCGCGATTAGTTTCTTCCTTTGAAGAAAAA---------AAAAAACCAAAATATCAAAATTTAC{AG}ATCTATTCATTCAATATTTCCTTTTTTA{AG}AAAATAAATTCTCACATTTAAATTCTGTATCA-AATCTACTAATACCCCATCCC-ATCC{AT}TCTGGAAATCTTGGTTCAAATCCTTCAATG-CTGGATTAAAGATGTTCCTTCTTTGCATTTGTTGCGATTTATTTTCCACAAATATCATAATTTGAAAAGTATCATTACTTCAAAGAAATCCATTTACGTCTTTTCAAAAAGAAAAAAAAGATTTTTTTGGTTCC-TATATAATTTA-TATATATATGAATG-CGAATATCTATTTCGGTTT-CTTCGTAAA-CAGTCTTCTTATTTACGA-TCAACATCTTTTGGAATCTTT-CTTG-AGCGAACACATTTCTATGGAAAGACAGAATATCTACTAGTAGTTTATTTGAATTATTTTAATAGGATTCTATGGTTCCTCAAAGATCCTTTCATACATTATGTTCGATATCAAGGCAAAGTAATTCTGGCTTCAAAGGGAACTCTTATTCTGATGAAG-AAATGGAAATTTCATCTTGTTTATTTTTGGCAATTTTATTTTCACTTTTGGTCTCAACCTTATAGGATCCACATAAAGCAATTACCCAACTATTCCTTCTCATTTCTGGGGTATTTTTTAAGTGTACCAAAAAATACTTTGGTAGTAAGAAATCAAA-TGCTTGAGAATTCCTTTCTAATAAATACTCTGACTAAGAAATTAGATACCATAGCCCCAGTTATTTCTCTTATTGGATCATTGTCGAAAGCTCAATTTTGTACTCTATCGGGTCATCCTATTAGTAAACCAATCTGGACGGATTT-ATCGGATTCCGATATTCTTGATCGATTTTGTCGGATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTTTATATCGTATAAATTATATACTTCGACTTTCATGTGCTAGAACTTTAGCTCGTAAACATAAAAGTACAGTACGTACTTTTATGCGAAGATTAGGTTCGATATTTTTAGAAGAATTTGTTATGGAAGAAGAACAAGTTTTTTCTTTCATCTTCCTCCAAAAAA ; END; BEGIN TREES; TITLE Spiranthes; LINK TAXA = Taxa1; TRANSLATE 1 Sacoila_lanceolata_30_FL, 2 Spiranthes_porrifolia_21t_OR, 3 Spiranthes_porrifolia_21r_OR, 4 Spiranthes_infernalis_09a_NV, 5 Spiranthes_infernalis_09b_NV, 6 Spiranthes_infernalis_09c_NV, 7 Spiranthes_porrifolia_21v_CA, 8 Spiranthes_porrifolia_21u_CA, 9 Spiranthes_porrifolia_21h_CA, 10 Spiranthes_porrifolia_21m_CA, 11 Spiranthes_porrifolia_21s_CA, 12 Spiranthes_porrifolia_21Lb_CA, 13 Spiranthes_porrifolia_21mb_CA, 14 Spiranthes_porrifolia_21w_CA, 15 Spiranthes_porrifolia_21p_CA, 16 Spiranthes_porrifolia_21j_CA, 17 Spiranthes_porrifolia_21o_CA, 18 Spiranthes_porrifolia_21L_CA, 19 Spiranthes_porrifolia_21n_OR, 20 Spiranthes_porrifolia_21q_CA, 21 Spiranthes_porrifolia_21x_OR, 22 Spiranthes_porrifolia_21f_CA, 23 Spiranthes_porrifolia_21k_CA, 24 Spiranthes_porrifolia_21d_OR, 25 Spiranthes_porrifolia_21c_OR, 26 Spiranthes_delitescens_05a_AZ, 27 Spiranthes_delitescens_05b_AZ, 28 Spiranthes_delitescens_05c_AZ, 29 Spiranthes_romanzoffiana_24a1_WY, 30 Spiranthes_romanzoffiana_24a2_WY, 31 Spiranthes_romanzoffiana_24pq_CA, 32 Spiranthes_romanzoffiana_24o_WI, 33 Spiranthes_romanzoffiana_24s_NScotland, 34 Spiranthes_romanzoffiana_24r_Spiranthes_Scotland, 35 Spiranthes_romanzoffiana_24e_WA, 36 Spiranthes_romanzoffiana_24f_OR, 37 Spiranthes_romanzoffiana_24m_NY, 38 Spiranthes_romanzoffiana_24n_CA, 39 Spiranthes_romanzoffiana_24j_MT, 40 Spiranthes_romanzoffiana_24b_MI, 41 Spiranthes_romanzoffiana_24d_AK, 42 Spiranthes_romanzoffiana_24t_OR, 43 Spiranthes_romanzoffiana_24u_OR, 44 Spiranthes_romanzoffiana_24v_OR, 45 Spiranthes_romanzoffiana_24w_AK, 46 Spiranthes_porrifolia_21a_CA, 47 Spiranthes_romanzoffiana_24g_UT, 48 Spiranthes_stellata_31a_OR, 49 Spiranthes_stellata_31e_OR, 50 Spiranthes_stellata_31b_OR, 51 Spiranthes_stellata_31c_OR, 52 Spiranthes_stellata_31d_OR, 53 Spiranthes_stellata_31f_CA, 54 Spiranthes_romanzoffiana_24i_MT, 55 Spiranthes_diluvialis_06a1_NE, 56 Spiranthes_diluvialis_06a2_NE, 57 Spiranthes_lucida_14a_VA, 58 Spiranthes_lucida_14d_MI, 59 Spiranthes_lucida_14b_PA, 60 Spiranthes_tuberosa_26b_SC, 61 Spiranthes_tuberosa_26f_SC, 62 Spiranthes_tuberosa_26c_WV, 63 Spiranthes_tuberosa_26e_FL, 64 Spiranthes_tuberosa_26g_FL, 65 Spiranthes_sinensis_29_Malaysia, 66 Spiranthes_sinensis_Si17_China, 67 Spiranthes_aestivalis_Sa58_Kew_cult, 68 Spiranthes_aestivalis_Sa59_Switzerland, 69 Spiranthes_spiralis_Sp51_UK, 70 Spiranthes_praecox_22a_FL, 71 Spiranthes_praecox_22b_SC, 72 Spiranthes_praecox_22i_FL, 73 Spiranthes_praecox_22e_NC, 74 Spiranthes_praecox_22f_SC, 75 Spiranthes_praecox_f.albolabia_23a_FL, 76 Spiranthes_praecox_22d_FL, 77 Spiranthes_praecox_22c_TX, 78 Spiranthes_praecox_22g_TX, 79 Spiranthes_praecox_22h_TX, 80 Spiranthes_sylvatica_25b_SC, 81 Spiranthes_sylvatica_25d_FL, 82 Spiranthes_sylvatica_25a_FL, 83 Spiranthes_sylvatica_25c_NC, 84 Spiranthes_odorata_17aa_FL, 85 Spiranthes_odorata_17z_FL, 86 Spiranthes_odorata_17c_NC, 87 Spiranthes_odorata_17i_TX, 88 Spiranthes_odorata_17opq_GA, 89 Spiranthes_odorata_17d_NC, 90 Spiranthes_odorata_17g_FL, 91 Spiranthes_odorata_17e_NC, 92 Spiranthes_odorata_17j_NC, 93 Spiranthes_vernalis_27a1_IA, 94 Spiranthes_vernalis_27a2_IA, 95 Spiranthes_vernalis_27n_TX, 96 Spiranthes_vernalis_27e_WV, 97 Spiranthes_vernalis_27f_TX, 98 Spiranthes_vernalis_27d_NC, 99 Spiranthes_vernalis_27g_FL, 100 Spiranthes_vernalis_27k_FL, 101 Spiranthes_vernalis_27h_SC, 102 Spiranthes_vernalis_27b_FL, 103 Spiranthes_vernalis_27c_SC, 104 Spiranthes_vernalis_27m_FL, 105 Spiranthes_vernalis_27o_TX, 106 Spiranthes_brevilabris_01a_FL, 107 Spiranthes_brevilabris_01b_FL, 108 Spiranthes_brevilabris_01d_TX, 109 Spiranthes_brevilabris_01f_TX, 110 Spiranthes_brevilabris_01e_TX, 111 Spiranthes_brevilabris_01h_FL, 112 Spiranthes_brevilabris_01g_FL, 113 Spiranthes_floridana_08a_FL, 114 Spiranthes_floridana_08b_FL, 115 Spiranthes_floridana_08d_FL, 116 Spiranthes_floridana_08f_FL, 117 Spiranthes_floridana_08e_FL, 118 Spiranthes_floridana_08c_FL, 119 Spiranthes_torta_28a_FL, 120 Spiranthes_torta_28c_FL, 121 Spiranthes_torta_28b_FL, 122 Spiranthes_torta_28f_PuertoRico, 123 Spiranthes_torta_28h_PuertoRico, 124 Spiranthes_torta_28g_PuertoRico, 125 Spiranthes_eatonii_07a_FL, 126 Spiranthes_lacera_var_gracilis_11b_WV, 127 Spiranthes_lacera_var_gracilis_11d_TX, 128 Spiranthes_lacera_var_gracilis_11f_AR, 129 Spiranthes_eatonii_07b_FL, 130 Spiranthes_lacera_var_lacera_10d_WI, 131 Spiranthes_lacera_var_lacera_10c_MO, 132 Spiranthes_lacera_var_gracilis_11e_MO, 133 Spiranthes_lacera_var_gracilis_11a_SC, 134 Spiranthes_lacera_var_gracilis_11c_NC, 135 Spiranthes_laciniata_12a_GA, 136 Spiranthes_laciniata_12b_GA, 137 Spiranthes_laciniata_12c_GA, 138 Spiranthes_laciniata_12d_GA, 139 Spiranthes_laciniata_12e_GA, 140 Spiranthes_longilabris_13a_NC, 141 Spiranthes_longilabris_13b_NC, 142 Spiranthes_longilabris_13c_FL, 143 Spiranthes_longilabris_13d_NC, 144 Spiranthes_longilabris_13f_TX, 145 Spiranthes_magnicamporum_15a1_IA, 146 Spiranthes_magnicamporum_15b_TX, 147 Spiranthes_magnicamporum_15d_TX, 148 Spiranthes_magnicamporum_15e_TX, 149 Spiranthes_magnicamporum_15c_MO, 150 Spiranthes_magnicamporum_15f_WI, 151 Spiranthes_magnicamporum_15g_WI, 152 Spiranthes_odorata_17f_FL, 153 Spiranthes_odorata_17r_FL, 154 Spiranthes_odorata_17v_FL, 155 Spiranthes_odorata_17w_FL, 156 Spiranthes_odorata_17s_FL, 157 Spiranthes_odorata_17h_FL, 158 Spiranthes_odorata_17t_FL, 159 Spiranthes_odorata_17u_FL, 160 Spiranthes_odorata_17m_FL, 161 Spiranthes_odorata_17n_FL, 162 Spiranthes_x_ichetuckneensis_Ich2_FL, 163 Spiranthes_ovalis_var_ovalis_18b_FL, 164 Spiranthes_ovalis_var_erostellata_19e_FL, 165 Spiranthes_ovalis_var_erostellata_19a_VA, 166 Spiranthes_ovalis_var_erostellata_19c_NC, 167 Spiranthes_ovalis_var_erostellata_19b_SC, 168 Spiranthes_casei_var_casei_02a, 169 Spiranthes_cernua_04h_WV, 170 Spiranthes_ochroleuca_16c_NH, 171 Spiranthes_ochroleuca_16b_VA, 172 Spiranthes_ochroleuca_16a_SC, 173 Spiranthes_casei_var_casei_02b_MI, 174 Spiranthes_ochroleuca_16f_NH, 175 Spiranthes_ochroleuca_16i_SC, 176 Spiranthes_ochroleuca_16e_MD, 177 Spiranthes_ochroleuca_16g_MI, 178 Spiranthes_odorata_17a_NC, 179 Spiranthes_cernua_04c_VA, 180 Spiranthes_cernua_04f1_PA, 181 Spiranthes_cernua_04g_PA, 182 Spiranthes_cernua_04q_ME, 183 Spiranthes_cernua_04e_PA, 184 Spiranthes_cernua_04s_ME, 185 Spiranthes_cernua_04z_OH, 186 Spiranthes_cernua_04r_ME, 187 Spiranthes_cernua_04y_NY, 188 Spiranthes_cernua_04u_OH, 189 Spiranthes_casei_var_casei_02d_WI, 190 Spiranthes_casei_var_casei_02e_NY, 191 Spiranthes_cernua_04n_NY, 192 Spiranthes_ochroleuca_16h_NY, 193 Spiranthes_cernua_04p_ME, 194 Spiranthes_ovalis_var_erostellata_19d_SC, 195 Spiranthes_odorata_17y_SC, 196 Spiranthes_cernua_04wx_OH, 197 Spiranthes_cernua_04cc_SC, 198 Spiranthes_cernua_04dd_NC, 199 Spiranthes_cernua_04ff_cult, 200 Spiranthes_parksii_20b_TX, 201 Spiranthes_cernua_04ee_cult, 202 Spiranthes_parksii_sp70_TX, 203 Spiranthes_cernua_04a1_NE, 204 Spiranthes_cernua_04a2_NE, 205 Spiranthes_cernua_04aa_MI, 206 Spiranthes_cernua_04bb_MI, 207 Spiranthes_cernua_04t_WI, 208 Spiranthes_cernua_04v_OH, 209 Spiranthes_cernua_04b_SC, 210 Spiranthes_cernua_04j_TX, 211 Spiranthes_cernua_04m_FL, 212 Spiranthes_cernua_04k_TX, 213 Spiranthes_parksii_20c_TX, 214 Spiranthes_parksii_sp267_TX, 215 Spiranthes_parksii_sp167_TX, 216 Spiranthes_cernua_04L_TX, 217 Spiranthes_parksii_sp146_TX, 218 Spiranthes_parksii_20a_TX, 219 Spiranthes_odorata_17b_NC; TREE tree_1 = [&R] (1:0.04833931424304549,(2:0.0,(3:0.0,(((((((((((4:0.0,(5:0.0,6:9.908572198631671E-5):5.242089096657576E-5):9.016493374238363E-4,7:0.0):1.4333141425404428E-4,8:0.0):2.7102347470006616E-4,((((((9:3.1488710129576325E-5,10:2.804430479543957E-4):9.385129530612574E-5,11:2.2000248073084094E-4):1.1614850972403029E-4,(12:0.0,13:0.0):1.9583776019663907E-4):1.4770933846895706E-4,14:1.6354973546316154E-4):1.7600456012050597E-4,15:4.5367251997079777E-4):1.2046290872992638E-4,(((16:1.152379142931037E-5,17:0.0):2.221497864613592E-5,18:0.0):1.6822193225102255E-5,19:2.943431735139071E-4):3.2286333946748846E-4):1.3668068184495563E-4):0.0031678983852991213,20:0.0):0.001776159881473345,21:0.0):8.283255196413417E-4,22:0.0):2.952104267347974E-4,23:0.0):1.5117206520739307E-4,24:0.0):8.001156796833692E-5,25:0.0):5.029285361252342E-4,((((((((((((((((((((((26:0.0,27:0.0):3.800470507155443E-5,28:2.7412177736700627E-4):5.121625087125027E-4,(((29:0.0028537115415876654,30:0.0):0.0015763802653803102,31:0.0):8.265274321092135E-4,32:0.0):5.230756454629656E-4):6.876208262670998E-4,33:0.0):4.620693334315973E-5,34:0.0):3.6607212361414176E-5,35:0.0):1.7900385355529985E-5,36:0.0):4.652040311410935E-5,37:0.0):3.9132353845290624E-5,38:0.0):2.5659547207304567E-5,39:0.0):2.280868279856338E-5,40:0.0):2.129486270562378E-5,41:0.0):1.0533027609798545E-4,42:0.0):7.650730627126179E-6,(43:0.0,44:1.4009896622338078E-4):1.479477011437115E-4):2.6486987531673667E-5,45:0.0):0.0024964237594212874,46:0.0):0.0016591516679331716,47:0.0):0.0012481732467766737,(((((48:2.1926491784035607E-7,49:0.0):2.2607020132778266E-6,50:0.0):1.3577249314937478E-6,51:0.0):6.824167194940944E-7,52:0.0):2.9445799222065083E-4,53:3.2802915621114176E-4):0.005882037860155457):7.211695173959046E-4,54:0.0):0.001906425370779008,(55:0.0,56:9.582844568813143E-5):0.0015277686761358822):0.002102634100657391,((57:0.0021004123940156355,58:4.8413279637511686E-4):0.00503066598980181,59:0.0):0.01457736950727894):8.39290069198681E-4,(((((60:2.760830987861389E-4,61:3.9152956948868E-5):2.7490950226152083E-4,62:0.0):8.682231654683764E-5,(63:0.0,64:3.952356727197903E-6):5.343502257196819E-4):0.008452392066438046,(((65:0.007460537343290458,66:0.005615661463463217):0.0043419962565970464,(67:0.0,68:4.448860887192388E-5):0.006390325429188257):0.001589954980557265,69:0.006500809802663831):0.0013843112873645064):5.625317215827499E-4,(((((((70:0.0,(((71:0.0,72:2.240549947017667E-4):1.2369124897041936E-4,73:0.0):6.360712381384831E-5,74:2.538084643659566E-4):7.84875456177718E-5):3.0070567911327437E-4,75:0.0):1.5341138235243704E-4,76:1.595587041066035E-4):0.0012394516315861331,((77:0.0,(78:9.88085239468535E-4,79:2.3696338011837403E-5):2.587657213883633E-4):0.0012179764504292347,(80:0.0,81:1.582256169650395E-5):5.9548092919029655E-5):6.229980204579127E-4):0.00104244336097142,82:0.0):8.906694595771335E-4,83:0.0):0.00712442761022225,((((84:5.023156576994085E-4,85:4.2515602020814364E-4):0.0013313416746484619,(((86:6.802354678654698E-4,87:0.0018006049647576426):0.0013580252493086524,88:0.0012374331565681088):4.788706099751565E-4,(89:3.5154149158092216E-4,90:5.949501488331337E-4):4.401536116983469E-4):8.134083887000425E-4):0.0012828155313525796,(91:5.49588544315846E-4,92:7.156868845111658E-5):9.375556359044537E-4):0.0018663854081753042,((((((((((((93:0.0,94:0.0):0.0012232295467871426,95:0.0):6.755235163400583E-4,96:0.0):3.5017441966873203E-4,97:6.608076027073764E-4):5.5971657764837535E-5,98:1.8092333977648423E-4):6.85708171310459E-4,(99:0.0,100:0.0010493403155832047):9.601916892732279E-5):5.123875396434788E-5,101:0.0):1.1436348732221657E-4,102:8.557986330752602E-4):1.8110312633154782E-4,103:2.5606466071002865E-4):6.351894083651694E-4,104:9.486438757443094E-5):4.393030252331995E-4,105:1.5348941282884374E-4):0.0026878209654433854,((((106:0.0,((107:0.0,(((108:0.0,109:0.0):7.246307792869999E-7,110:3.059458127317796E-4):6.977678118124699E-4,111:0.0):6.635900628294139E-5):3.14871801137373E-4,112:2.2625030057520437E-4):0.0015866492560625833):0.006604662265350069,(((113:0.0,(((114:0.0,115:6.1947853599938E-4):1.6466512649010445E-4,116:4.5263960618075263E-4):1.8916523967923288E-4,117:1.1862839671887213E-4):0.0015731735856295004):0.0016828372122012838,118:8.458494921269322E-5):0.0026764400075721707,(((119:8.035674406062232E-6,120:0.0):5.660115473763577E-6,121:0.0):5.77567462430404E-4,((122:0.0,123:6.946454472710195E-7):1.3709505866775148E-4,124:1.724808073635259E-4):0.002176266965666633):0.006218428453922852):0.0016530680259709933):8.514259756377401E-4,((((((125:0.001866846432261985,((126:7.359299327695801E-5,127:0.0):3.941236870642559E-4,128:5.557358857360868E-4):4.8808462425556365E-4):0.0012214737248663413,(129:0.0,130:3.565598493326244E-4):9.224211739953421E-4):8.599929830393101E-4,131:0.0):9.87064845371883E-4,132:0.0):5.645290393757711E-4,133:0.0):3.510829057972835E-4,134:0.0):0.0018078735488950698):8.720556867762505E-4,((135:5.959038031586039E-4,((136:0.0,(137:5.4116502513339854E-5,138:0.0):3.5045261032359484E-4):2.3836710964526137E-5,139:0.0):5.4298873974314293E-5):0.0032435184242272097,(((140:0.0,(141:0.0,(142:2.7042296706355357E-4,143:4.7115378052159373E-5):3.66121178495514E-5):1.964298039923429E-5):9.301024438949576E-5,144:0.0):0.002062424752722669,(((((145:0.0,((146:2.698621075678427E-4,147:0.0):8.211008912960976E-5,148:9.84684673373877E-4):2.5712117119720476E-4):4.2775277139015314E-4,149:0.0):1.6556358688377126E-4,(150:0.0,151:0.0010300309742460427):0.002252117413192728):6.682527130060928E-4,(((152:3.746863460624278E-4,((153:3.3949409336231015E-4,(154:2.931964661789105E-6,155:0.0):2.7725755072862887E-4):1.7671684560026726E-4,156:4.400993267205458E-4):2.594102817195833E-4):3.672668955701057E-4,(157:4.39847053092364E-4,(158:0.0,159:7.0474519704918914E-6):4.912004141984019E-4):1.0084401220147865E-4):0.0013257822880870691,(160:5.997480987950735E-4,(161:6.276010477952419E-4,162:6.12931067307667E-4):5.401234440030427E-4):0.0014521183730162486):6.245823965928821E-4):4.273670636660773E-4,(((163:6.11671631753713E-4,164:3.0425833267419544E-4):0.00149919460738146,((165:0.0016966244970993243,166:4.7521958673414286E-4):9.68877507459033E-5,167:5.210438867158385E-4):4.567593645091808E-4):0.0020753916375120737,(((((((168:0.0,((169:1.2986952963759887E-4,170:0.0):6.696409779005305E-5,171:0.0):1.546332636522367E-4):1.0583886440927032E-4,172:0.0):3.5171724264451004E-5,(173:1.1530157282532358E-4,174:0.0):6.266131562230465E-5):4.452246447838801E-5,175:0.0):2.2982865473990255E-4,(176:2.8100288408191426E-4,(177:0.0,178:1.0186172311826489E-4):7.42662218849062E-5):8.024051414180812E-4):3.301605738761544E-4,((((((179:0.0,(180:1.0769765304601345E-4,181:0.0):3.097562204166099E-4):2.6365019396199646E-4,182:0.0):1.849333202784409E-4,183:0.0):1.054987218653547E-4,184:0.0):2.1536711387105598E-4,185:0.0):5.313618998236194E-5,((186:2.294179183239091E-4,187:0.0):6.182811884894099E-5,188:1.3519573063821774E-4):9.324675423080103E-6):0.002798877253374677):7.937884561757397E-5,(((189:1.459437146725251E-5,((190:0.0,(191:1.130602959916946E-5,192:2.980782805954048E-4):8.82289801016102E-5):3.464821423852793E-5,193:1.1993747604932548E-4):3.403942633850125E-4):0.0017555963316758655,194:0.004320398140863064):7.576796373445771E-5,(195:7.187130634060714E-4,(196:0.0014177205480256534,((197:1.6284764505303945E-4,(198:0.0,199:8.253730290168348E-7):1.4340990183980482E-4):1.428030895416002E-4,(200:0.0,((201:1.5041566050706667E-5,202:0.0):8.925012225810547E-6,((((((203:0.0,204:4.627567317463943E-7):1.631868526670681E-4,(((205:0.0,206:3.993972152350235E-4):8.132494630185907E-4,207:0.0):4.91549985049633E-4,208:0.0):1.689702005838803E-4):7.999252103861668E-4,(209:2.6102594677632554E-4,(210:0.0,211:5.180196363981093E-7):5.7692559843079694E-5):5.16073131911831E-4):9.468134989734991E-5,(((212:4.0041042685873274E-5,213:0.0):2.2258723587270657E-5,214:0.0):1.549829104909549E-4,215:0.0):1.1029166786807529E-4):3.274789174568388E-5,((216:4.4010120502129685E-5,217:0.0):2.580166309485224E-5,218:0.0):1.1324487542999084E-5):1.0415592055626477E-5,219:0.0):1.0415592055626477E-5):1.551169785547063E-5):3.097232443249609E-4):3.003963642368643E-4):9.002852511034651E-5):3.6057676015656404E-4):4.5292370723207936E-4):7.312543705479506E-4):2.9802452620373426E-4):2.07501685565388E-4):0.0010648642227956001):3.061117294785379E-4):6.375926747487909E-5):0.0011424331256928086):0.0036963995179052703):5.437208560865117E-4):0.003062332664449864):0.005137689353593045):5.890188380593964E-4):4.761447696257706E-4):0.0); END;