#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 3:52 GMT TreeBASE (cc) 1994-2008 Study reference: Rahman M.Z., Uematsu S., Suga H., & Kageyama K. 2014. Diversity of Phytophthora species newly reported from Japanese horticultural production. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16153] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=80; TAXLABELS Phytophthora_bisheria Phytophthora_boehmeriae Phytophthora_botryosa Phytophthora_brassicae Phytophthora_cactorum Phytophthora_cajani Phytophthora_cambivora Phytophthora_capsici Phytophthora_captiosa Phytophthora_cinnamomi Phytophthora_clandestina Phytophthora_colocasiae Phytophthora_cryptogea Phytophthora_cuyabensis Phytophthora_drechsleri Phytophthora_erythroseptica Phytophthora_europaea Phytophthora_fallax Phytophthora_foliorum Phytophthora_fragariae Phytophthora_glovera Phytophthora_gonapodyides Phytophthora_gregata Phytophthora_hedraiandra Phytophthora_hedraiandra_MAFF235099 Phytophthora_heveae Phytophthora_hibernalis Phytophthora_humicola Phytophthora_idaei Phytophthora_ilicis Phytophthora_infestans Phytophthora_insolita Phytophthora_inundata Phytophthora_ipomoeae Phytophthora_iranica Phytophthora_katsurae Phytophthora_kernoviae Phytophthora_macrochlamydospora Phytophthora_meadii Phytophthora_megakarya Phytophthora_megasperma Phytophthora_melonis Phytophthora_mexicana Phytophthora_multivesiculata Phytophthora_multivora Phytophthora_multivora_NBRC31016 Phytophthora_nemorosa Phytophthora_nicotianae Phytophthora_nicotianae_GF468 Phytophthora_nicotianae_MAFF235794 Phytophthora_niederhauserii Phytophthora_niederhauserii_CH96HE1 Phytophthora_niederhauserii_CH96HE2 Phytophthora_palmivora Phytophthora_palmivora_GF534 Phytophthora_parvispora Phytophthora_phaseoli Phytophthora_pistaciae Phytophthora_porri Phytophthora_primulae Phytophthora_pseudosyringae Phytophthora_pseudotsugae Phytophthora_psychrophila Phytophthora_ramorum Phytophthora_sansomeana Phytophthora_sansomeana_CH95PHG7 Phytophthora_sansomeana_CH95PHG8 Phytophthora_sansomeana_NBRC31624 Phytophthora_sojae Phytophthora_sojae_Pm_1 Phytophthora_sp_kelmania Phytophthora_sp_kelmania_GF433 Phytophthora_sp_kelmania_GF543 Phytophthora_sp_kelmania_GF649 Phytophthora_syringae Phytophthora_tentaculata Phytophthora_trifolii Phytophthora_uliginosa Phytophthora_vignae Phytopythium_vexans ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=80; TAXLABELS Phytophthora_bisheria Phytophthora_boehmeriae Phytophthora_botryosa Phytophthora_brassicae Phytophthora_cactorum Phytophthora_cajani Phytophthora_cambivora Phytophthora_capsici Phytophthora_captiosa Phytophthora_cinnamomi Phytophthora_clandestina Phytophthora_colocasiae Phytophthora_cryptogea Phytophthora_cuyabensis Phytophthora_drechsleri Phytophthora_erythroseptica Phytophthora_europaea Phytophthora_fallax Phytophthora_foliorum Phytophthora_fragariae Phytophthora_glovera Phytophthora_gonapodyides Phytophthora_gregata Phytophthora_hedraiandra Phytophthora_hedraiandra_MAFF_235099 Phytophthora_heveae Phytophthora_hibernalis Phytophthora_humicola Phytophthora_idaei Phytophthora_ilicis Phytophthora_infestans Phytophthora_insolita Phytophthora_inundata Phytophthora_ipomoeae Phytophthora_iranica Phytophthora_katsurae Phytophthora_kernoviae Phytophthora_macrochlamydospora Phytophthora_meadii Phytophthora_megakarya Phytophthora_megasperma Phytophthora_melonis Phytophthora_mexicana Phytophthora_multivesiculata Phytophthora_multivora Phytophthora_multivora_NBRC_31016 Phytophthora_nemorosa Phytophthora_nicotianae Phytophthora_nictianae_GF468 Phytophthora_nictianae_MAFF_235794 Phytophthora_niederhauserii Phytophthora_niederhauserii_CH96HE1 Phytophthora_niederhauserii_CH96HE2 Phytophthora_palmivora Phytophthora_palmivora_GF534 Phytophthora_parvispora Phytophthora_phaseoli Phytophthora_pistaciae Phytophthora_porri Phytophthora_primulae Phytophthora_pseudosyringae Phytophthora_pseudotsugae Phytophthora_psychrophila Phytophthora_ramorum Phytophthora_sansomeana Phytophthora_sansomeana_CH95PHG7 Phytophthora_sansomeana_CH95PHG8 Phytophthora_sansomeana_NBRC_31624 Phytophthora_sojae 'Phytophthora sojae Pm-1' Phytophthora_sp._kelmania Phytophthora_sp._kelmania_GF433 Phytophthora_sp._kelmania_GF543 Phytophthora_sp._kelmania_GF649 Phytophthora_syringae Phytophthora_tentaculata Phytophthora_trifolii Phytophthora_uliginosa Phytophthora_vignae Phytopythium_vexans ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=80; TAXLABELS Phytophthora_bisheria Phytophthora_boehmeriae Phytophthora_botryosa Phytophthora_brassicae Phytophthora_cactorum Phytophthora_cajani Phytophthora_cambivora Phytophthora_capsici Phytophthora_captiosa Phytophthora_cinnamomi Phytophthora_clandestina Phytophthora_colocasiae Phytophthora_cryptogea Phytophthora_cuyabensis Phytophthora_drechsleri Phytophthora_erythroseptica Phytophthora_europaea Phytophthora_fallax Phytophthora_foliorum Phytophthora_fragariae Phytophthora_glovera Phytophthora_gonapodyides Phytophthora_gregata Phytophthora_hedraiandra Phytophthora_hedraiandra_MAFF_235099 Phytophthora_heveae Phytophthora_hibernalis Phytophthora_humicola Phytophthora_idaei Phytophthora_ilicis Phytophthora_infestans Phytophthora_insolita Phytophthora_inundata Phytophthora_ipomoeae Phytophthora_iranica Phytophthora_katsurae Phytophthora_kernoviae Phytophthora_macrochlamydospora Phytophthora_meadii Phytophthora_megakarya Phytophthora_megasperma Phytophthora_melonis Phytophthora_mexicana Phytophthora_multivesiculata Phytophthora_multivora Phytophthora_multivora_NBRC_31016 Phytophthora_nemorosa Phytophthora_nicotianae Phytophthora_nicotianae_GF468 Phytophthora_nicotianae_MAFF_235794 Phytophthora_niederhauserii Phytophthora_niederhauserii_CH96HE1 Phytophthora_niederhauserii_CH96HE2 Phytophthora_palmivora Phytophthora_palmivora_GF534 Phytophthora_parvispora Phytophthora_phaseoli Phytophthora_pistaciae Phytophthora_porri Phytophthora_primulae Phytophthora_pseudosyringae Phytophthora_pseudotsugae Phytophthora_psychrophila Phytophthora_ramorum Phytophthora_sansomeana Phytophthora_sansomeana_NBRC_31624 Phytophthora_sansomiana_CH95PHG7 Phytophthora_sansomiana_CH95PHG8 Phytophthora_sojae 'Phytophthora sojae Pm-1' Phytophthora_sp_kelmania Phytophthora_sp._kelmania_GF433 Phytophthora_sp._kelmania_GF543 Phytophthora_sp._kelmania_GF649 Phytophthora_syringae Phytophthora_tentaculata Phytophthora_trifolii Phytophthora_uliginosa Phytophthora_vignae Phytopythium_vexans ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M25153] TITLE Phytophthora_5_genes; LINK TAXA = Taxa2; DIMENSIONS NCHAR=3673; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phytophthora_bisheria TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTCCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCCGTGGCAGTTTTTCTGCGCCTGGCGTGGTGGTGTGAGTGTTTGCCGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGGGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGATTCTATCGCAAGGTCTGAGCAAGTAGTTTTTAAACATTTTAATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATATGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGAGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGTGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGACGTTTTCCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGTGATACTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGCGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCATTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTGATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCAGGTGGAGGAGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGG{CT}CAGACCCGCGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATTGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCAC{GT}TACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATTTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGGTTGACAAGCCGCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTGGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTCGGTCTGTCGACTGAAGTCAAGTCCGTGGAAATGCACCACGAGTCCCTGCCCGAGGCTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGCTGCGTCGTGGTTT{CT}GTCGCTTCGGACTCCAAGAACGACCCCGCCAAGGGCACCCAGGACTTCACCGCCCA{AG}GTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGATGTCGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGCTCCGGTATGGGTACGCTTCTTATCTCGAAGATCCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCATCAGCTGGTTGAGAACGCCGATGAGGTTATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACCACCCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTAAACTCTGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGCGCCCTCACGGTTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGTGCTGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAAGGTATGGATGAG Phytophthora_boehmeriae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGCGAGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGCGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTTGCAGTTTTTCTGCGCTGGGTGCGGCTGTGCGTGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGGGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGGAACTCTCTGTGTGCGCGCTGTGCGGATAGCTTGCTATGTGTGCGGTGCTGTGCGTGGATTGAGGTCTGCTGTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTTTTGGGGACTCTATCACGAGGTCTGAGTTGCGAGTTTTTAAACCATCCTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCCTGTAGTCGGTGGGGGAATGCCAGACGTGAAGTGTCTTGGCGGTTCGGTGCGCGAGTCCTTTGAAATGTAGATACTGTTCTCTCTTTGCTCGAAAAGTGAGTGATGTTGTGGCTGCCGGCATGTCGGCGACTTTTGCTGAGGCGGAGAGGGGTTCGATTCGCGGTAGTGTTGGTTTCGGCCGAACCGCTTATTGGGTTCTTTTCCAGCTTTGGCGTCGGTGTACCGGCTTGGCCTTTGAACTCGTTTTGGCGATAGAGTGGGTTTCGGCCGACGATTTGGGAAATGCCCTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCTGGTATTGTTGGTACAACATTCTCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATAATGGTATTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCGGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCATTATTATTATTAGTTTCATCTGCTTTAGTTGAATCAGGTGCAGGTACCGGTTGGACAGTTTATCCACCTTTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATATCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCCTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGACGACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGAGACAACATGATTGAGAAGTCCCCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTGGACAACCTGAACCCCCCCAAGCGTCCGTCCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTCGAGACTGGTGTGATCAAGCCGGGCATGATCGCCACCTTCGGCCCCGTGGGTCTGACCACGGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTGGCTTCGGACTCGAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACTGCTCAGGTCATTGTGCTGAACCACCTGGCGCAACGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAAATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGATGTCGTCCGGAAGGAGGCCGAGTCCTGCGATTGCCTGCAGGGTTTCCAGATTACCCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGAACGCTGCTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCCCCCAAGGTGTCGGACACTGTGGTGGAGCCTTACAACGCGACGCTATCTGTGCACCAGCTTGTGGAGAACGCCGATGAAGTTATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACCTACGGTGATCTGAACCACCTGGTGTGTGCCGCCATGTCCGGTATCACGACGTGCCTTCGATTCCCAGGCCAGCTGAACTCCGACCTGCGTAAGCTGGCTGTGAACTTGATCCCATTCCCGCGTCTTCACTTCTTTATGATCGGTTTCGCGCCGCTGACATCACGTGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCGGAGCTGACCCAGCAGCAGTTCGACGCGAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGTGGACGGATGAGCACGAAGGAGGTGGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCATACTTTGTGGAATGGATCCCGAACAACATCAAGGCTAGTGTGTGTGATATCCCGCCGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACCGCTATCCAGGAGATGTTCAAGCGCGTGTCTGAGCAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACAGGCAGGGTATGGATGAA Phytophthora_botryosa TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCCTGGTGTGGTGGTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTGCTATCGCGAGGTCTGGGCTAGTAGGTTTTAAACCATAACATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGTTTGTTCGGCGTGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGTATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCGATTACTATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCAGATGATTGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACGACCTACCTGAAGAAGGTTGGTTACAAGCCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGATCGACCGTTCCTCCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACAACCTGAACCCCCCCAAGCG{CT}CCGTCGGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGT{CT}AAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTTCCGGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCAGTGCTTGATGTCGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACTGTGGTGGAGCCCTACAACGCCACGTTGTCGGTACACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTACGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACTACGTGTCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGTTGGCTGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAACAGTTCGATGCCAAGAACATGATGTGTGCCGCTGATCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGTGGACGGATGAGCACGAAGGAGGTCGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAG Phytophthora_brassicae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCATGCAAGTTTTGTATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCCTGAGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGTGTGTCTGTGGCAGTTTTACTGCGCCTGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTAGCGCGAGGCTTGGGCTAGTAGATTTTAAACCATTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGATGCCAGATGTGAAGTGTCTTGCTGGTTCGGTGGGCGAGTCCTTTTAAATGTACAAACTGTATTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTAGATGTTTTTCTTACTGCGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCGATATTGCGATAGAGTGAGTTCCGGCCGTCGATTTGGGAAATGCCCTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCCCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGGGCACCTGATATGGCATTTCCGCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTGGCAATCTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCCCCGGGTTTAAGTTTCCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACGGCTTTCCTTTTATTATTAACTTTACCTGTTTTTGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACGTCTTTTTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCA{AG}GCTGATTGCGCCATTCTGGTTGTCGCCTCGGGTGTCGGCGAGTTCGAGGCTGGTATCTC{CT}AAGGAGGGCCAGAC{AG}CG{CT}GAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCA{AG}ATGATTGTGGCCAT{CT}AACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGA{AG}GTCACCACCTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCAT{CT}TCCGGCTGGGAGGGTGACAACATGATTGAGAAGTCTAGCAACATGCCGTGGTACAAGGGACC{GT}TACCTTCTCGAGGC{AT}CTTGACACCCTGAACGCCCCCAAGCGTCCCTCGGACAAGCCTCTGCGTCTGCC{CT}CTCCAAGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGT{CT}GGCCGTGT{CT}GAGACCGGTGTTATTAAGCCGGGCATGATCGC{CT}ACTTTCGGCCC{CT}GTGGGTCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCC{CT}GGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCTTCGGACTCCAAGAACGACCCCGC{CT}AAGGG{AC}ACGCAGGACTT{CT}ACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCT{AG}CCGGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCCGG{AC}AAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGAGGTACTGGTTCCGGTATGGGAACGCTTTTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCTCCCAAGGTGTCAGACACGGTTGTGGAGCCCTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCTGATGAAGTCATGTGCCTGGATAACGAGGCCTTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGCATCACCACCTGTCTGCGTTTCCCGGGTCAGTTGAACTCAGACTTGCGAAAGCTGGCCGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGTGTGTGTGACATCCCGCCGGACTGAAGATGAGCACTACATTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACAGGTAAGGTATGGACGAG Phytophthora_cactorum TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGCCTGAGCTAGTAGCTTTTAAACCATCTTATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGAGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCTAGCAAGTTGGCGACCTTTGCTGCGGCGGAAGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGTTTTTTCTGCTGTGGCGTCGGTGAACCAGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATATACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGGGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGCGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATTGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGATCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCTGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCAGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGGGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCCTGCACTGGTACACCGGGAAGGTATGGACGAG Phytophthora_cajani TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCAAGAACTAGATCATGAGTTTTTAAACCATTTGATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAGGTGTCTTGGCGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGTGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACGGCACATGCTTTTATCATGGTTTTCTTTCTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCAC{CG}CTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGGTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTTGTCCGAAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTCGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAATGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_cambivora TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGCTTTTCTGCGCTCGGTGCGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGAACTGAGCCAGTAGTTTTTAAACCATTTGATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGACGTGAGGTGTCTTGGTGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGACGTTCTTCCTGCTGTGGCGCCGGTGAACCGGCTTGGCCTTTGAACGCGGTGTCGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTTAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGAGCAATTACAATGTTATTGACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGGGGAGATCCTGTACTATATCAAGGTCATCGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGG{CT}CAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCCGAGGTGTCGACCTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTGGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCCACCCAGGACTTCCTGGCCCAGGTCATTGTGCTGAACCACCGGCCGCACTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTTGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_capsici TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCCTGGCGTGGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGC{CT}TTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCCGGGCGAGTAGGTTTTAAACCATCACATTCTGATATACTGGGGGGACAAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGGGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGTTGTTTCGGCGAGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGAATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGTTTTGCTGCGATAGAGTGGGCTTCGGCCGTCAATTTTGGGAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGC{CT}GATTGCGCCATTCTGGTGGT{CT}GCTTCGGGTGTGGGTGAGTT{CT}GAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGC{CT}CTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGATTGACCGTTCCACCAACATGCCGTGGTACAAGGGACCTTACCTCCT{CT}GAGGCTCTTGACAACCTGAACGCCCC{CT}AAGCG{CT}CCGGTTGACAAGCCGCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGATTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGATGTTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAAGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCATCGCCTAAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCCCACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACCACGTGTCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCCGAGCTGACCCAACAACAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACTGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_captiosa TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGTGGGCTCTCGGGGTAAGTTCCTTGGAAGAGGATAGCATGGAGGGTGAAACTCCCGTTCATACCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTTCCAGTGTCTATAATCCGTGGCATATTCCATTGCGAGTGTGTGCGTGTGTGGTTTCGGCAGTTGCTCTGCGCTGTGCCTGGCTGTGCGTGTGCTTGGTGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTGTGCCGCGGGAAATATCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCTGTGTGCGCGCCGTGCGAATAGCTTGCTATGCGTGTGGTGTTGTGTGTGGATTGAGGCGTGCTGTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACTGTCTTCGGGGACCCATCTCGAGGTCGGAGCCAGTAGTTTGTAAACCTTCTAATACTGAAAAACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTATATCAAACTTGCCTTCCTTCCTTCCTGTAGTCGGTGGGGGAACGTCAGATGTGAAGTGTCTTGGCGGTTCGGCGGGCGAGTCCTTTTAAATACAAATACTGTTCTCTCTTTGCTCGAAAAGTGGGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACTTTTGCTGAGACGGGGGAGGGCTTGATTCGCGGTATGGTTGGCTTCGGCTGAACTGCTTATTGGGCTTCTTTCATGTCTTGGCGTTGGTGTACCGGCTTGGCTTTTGAACGTTCTGTTGCGATAGAGTGGTTTTCGGACGACGTTTTGGGAAATGCCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTTCTGGTATCGTTGGTACAACATTTTCACTTTTAATTAGGATGGAATTAGCACAACCAGGTAACCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCCTTAATAGGTGGATTCGGTAATTGGTTTGTACCTTTAATGATTGGAGCTCCAGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCGCCCTCATTATTATTATTAGTTTCATCTGCTTTAGTTGAATCAGGTGCTGGTACCGGTTGGACAGTATATCCACCTTTATCGAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCGGGTTTAAGTTTTCATAGATTACCTCTATTTGTATGGTCTGTATTAATTACAGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTTAATACATCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCCGGCCACCGCGACTTCATCAAGAACATGATTACGGGCACGTCGCAGGCTGATTGCGCCATCCTCGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCGCTGCTGGC{CT}TTCACGCTGGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGC{CT}GAGGTCAGCACGTACCTGAAGAAGGTGGGCTACAAGCCCGTCAAGATCCCGTTCGTGCCCATCTCCGGATGGGAGGGCGACAACATGATCGAGCGCTCTGGCAACATGCCGTGGTACAAGGGCCCGTTCCTGCTCGAGGCTCTGGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCCCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCTGGCATGGTCGCCACCTTCGGCCC{CG}GTCGGTCTGTCGACGGAAGTCAAGTCTGTCGAGATGCACCACGAGTCTCTGCCCCAGGCTGTCCCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGCACTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCGCTCGGTGGCGGCACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGCATCATGTGCACCTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCGTACAACGCGACGCTCTCGGTGCACCAGCTGGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACCACCCCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACGACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGTTTCGCCCCGCTCACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACTGTGCCGGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCGAACAACATCAAGGCGAGCGTGTGTGACATCCCGCCGGTCTGAAGATGTCGACCACGTTCATCGGTAACTCGACGGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAG Phytophthora_cinnamomi TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGCGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGGTGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGAGCTAGTAGCTTTTAAACCATTGTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGGTGCCAGACGTGAGGTGTCTTGGCGGTTCGGTGGGTGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGTTCTTCCTGCTGTGGCGCCGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATAGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATCTTAATGGGAAATCATCAATTATATAATGTAATTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCAATTGTTGAGTCTGGTGCAGGTACAGGTTGGACAGTTTATCCACCTTTATCAAGTGTTCAAGCACACTCTGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCCGGTTTAAGTTTTCATAGATTACCATTATTTGTATGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGGGGTGATCCAGTATTATATCAAGGTCATCGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCCGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACCCTGGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGCGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCGTACCTCCTTGAGGCTCTCGACAACCTGAACCCCCCCAAGCGCCCGGTTGACAAGCCGCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGT{GT}GAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGT{CG}AAGGAGCTGCGTCGTGGCTACGTGGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGTAAGGTGACTCGGTGCTCGATGTCGTCCGCAAGGAGGCGGAGAGCTGCGACTGCCTGCAGGGATTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCGACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGCCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGCTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGCAACTCCACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAG Phytophthora_clandestina TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGTGGGCACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTATCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTATGGCAGTTTTTCTGCGCTTGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTAGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTAACGCGAGGTCCGGGCTAGTAGATTTTAAACCATCTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGTCAGATATGAAGTGTCTTGTTGGTTCGGCGAGCGAGTCCTTTTAAATGTACAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGCTGTTGGCCAATTGGCGACCTTTGCTGTGGCGGAAGAATGCTTGATTCGCGGTATGATTAGCTTCGGCTGAACGGCTTATTGGGTGTTTATCCTGCTG{CT}GGCGTTGGTGAACCAACTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAGGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGGACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCTCGTATGAATAATATAAGCTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCGGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGG{CT}ACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGA{AG}TTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACTCTGGGTGTGAAGCAGATGGT{CT}GTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGG{CT}CAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGT{GT}CCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCT{GT}GAGGC{CT}CTTGACAACTTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTTCAGGATGTTTACAAGATCGGCGG{GT}ATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGG{GT}CTGTCGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCTTCGGACTCCAAGAACGACCCTGCCAAGGGCACCCAGGACTTCACCGCCCAGGTTATCGTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCG{AT}TCGGGCAAGGTGACTCGGTGCTTGACGTCGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGCTTCCAGATCACGCACTCTCTTGGCGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCAGACACGGTTGTGGAGCCCTACAATGCTACGCTGTCGGTGCATCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTAAAGCTCACCACCCCCACCTACGGCGACCTTAACCACCTGGTTTGCGCTGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCTGGTCAGTTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGC{CT}CCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTACCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGTTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAGGTGGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACAGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_colocasiae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCCTGGTGTGGTGGTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCC{AG}AGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTGCTATCGCGAGGTCTGGGCTAGTAGGTTTTAAACCTTACAATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGTTTGTTCGGCGAGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGTATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCTCACTCAGGTCCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTCTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGATTG{CT}GCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCAGATGATTGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTC{GT}GAGGTCACGACCTACCTGAAGAAGGTTGGTTACAA{AG}CCGGCCAAGATCCCGTTCGTGCC{CT}ATCTCCGGATGGGAGGGTGACAACATGATCGACCGTTCCACCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTGGACAACCTGAACCC{CT}CCCAAGCGTCCGTC{CG}GACAAGCC{AC}CTCCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGT{CT}AAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCAC{CG}CAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTTCCGGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGG{CT}AAGGTGACTCGGTGCTTGATGTCGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACTGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTATGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACTACGTGCCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGTTGGCTGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCTCCGTTGACCTCTCGTGGATCTCAGCAGTACCGTGCCCTCACGGTTCCTGAGCTGACCCAGCAACAGTTCGATGCCAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAAAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACTGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAG Phytophthora_cryptogea TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGCGCTGTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGTTTTTAAACCATCTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCTTTGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGTGTTCTGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCTCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCCGGATGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCTCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCAT{CT}AAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGGCGGAGGCTCTCCCTGG{CT}GACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATTGTGCTCAACCACC{CT}GGCGCAACGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCAAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGTTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACAACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGTACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAA Phytophthora_cuyabensis TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATGGAGGCGTGGTCAGCGCGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGCCGCTGCGCGTACGACCCGTGTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATCGTGAGTGTGTGCGTGCGTGTTGTTCGCAGTTTTTCTGCGCGGCGCGTGGCTGTGCGTGTGCTTGGAGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTCTCTCTGTGTGCCCGGTGTGCGGATAGCTTGCTATGCGTGTGTCGTCGTGCGCGGATGGGGGCGTGCTGTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACTGTGTTGGGGGCCTCATCACGAAGTCGAGGGTAGTAGTTTGTAAACCTTGTATTTCTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCCTGTAGTCGGTGGGGGAATGCCAGACGTGAAGTGTCTTGCTGGCGTGTTGGGCGAGTCCTTTGAAATGTAAATACTGTTCTCTCTTTGCTGGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACTCTTGCTGAGGCGGAGAGGAGCTCGATTCGCGGTATGGTTGGCTTCGGCTGAACTGCTTATGGGCTGCTTGTGCTGCTTTGGCGCTGGTGAACCGGCTTGGCTTTTGAACGCGCTGTCGCGATATGGTGGGTCCAGACCGACGATTTGGGACATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCTGGAATTGTGGGTACAACTTTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCCTTTATCATGGTATTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATAGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTCTTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCACAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATCCTGGTCGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCTCGTTACGACGAGATCAAGAACGAGGTGACCACGTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGCGACAACATGAT{CT}GAGCGCTCGACCAACATGCCGTGGTACAAGGGACCTTACCTCCT{CT}GAGGCTCTTGACAACCTGAACCCCCCCAAGCGCCCGGTCGACAAGCCGCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCTACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCTGTCGAGATGCACCACGAGTCGCT{GT}CC{CT}GAGGCTGTGCCCGGTGACAACGTTGGCTTCAACGTGAAGAACGTGTCGGTGAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGATGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTACAGGGATTCCAGATCACCCACTCGCTCGGTGGCGGTACCGGCTCTGGTATGGGCACGCTTTTGATCTCCAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCTACGCTGTCGGTCCACCAGCTGGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACTACCCCCACCTACGGTGACCTGAATCACCTAGTGTGCGCCGCCATGTCGGGTATCACAACGTGCCTGCGTTTCCCGGGCCAGCTGAACTCGGACCTGCGTAAGCTGGCTGTGAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGTTTCGCTCCGTTGACGTCGCGTGGATCGCAGCAGTACCGTGCTCTGACCGTCCCGGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTTCAGAACAAGAATTCCTCGTACTTCGTGGAGTGGATTCCTAACAACATCAAGGCTAGCGTGTGTGACATTCCGCCGGCTTGAAGATGTCCACGACGTTCATTGGTAACTCAACGGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAATTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAA Phytophthora_drechsleri TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTGCCCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGTCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGCTGTGTGTGGATTGATGCGCGCTGTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGTTAGTAGTTTTTAAACCATCTAATACTGAAAAACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTTAAATGTACACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTTCTGCTGCGGCGTTGGTGAACCGGCTTGGCGTTTGAACGCGGTATTGCGATAGGGTGTGTCTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCGGGTGCCGGTACCGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACGTCTTTTTATGATCCATCAGGTGGGGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCAC{CG}TCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCAC{CG}ACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATTGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGAC{CT}GGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGT{CT}GAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCGGTGCTTGACTGCCACACGGC{CT}CACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTATCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_erythroseptica TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGCGCTGTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGTTTTTAAACCATCTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCTTTGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGTGTTCTGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCTCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCCGGATGGGAGGGTGACAACATGAT{CT}GAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCTCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCAT{CT}AAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTC{CT}GTTGAGATGCACCACGAGTCTCTGGCGGAGGCTCTCCCTGGCGACAACGTCGGTTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATTGTGCT{CG}AACCACC{CT}GGCGCAACGCCCGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCAAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACAACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGTACCACTTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAA Phytophthora_europaea TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGCTTTTTTGCGCTCGGTGCGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGAACTGAGCCAGTAGCTTTTAAACCATTTGATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGACGTGAGGTGTCTTGGTGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGAACGTTCTTCCTGCTGTGGCGCCGGTGAACCGGCTTGGCTTTTGAACGCGGTGTCGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTTAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTGTTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACGGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACAATGTTATTGACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGGGGAGGAGATCCTGTACTATATCAAGGTCAT{CT}GACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGAC{CG}CGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTC{AG}TCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAGCGAGGTGTCCACCTACCTGAAGAAGGTCGGCTACAAGCCCGC{CT}AAGATCCCGTTCGTGCCCAT{CT}TCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCC{AG}TCGGACAAGCC{AC}CTCCGTCTGCCCCTCCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGT{CT}ATTAAGCCTGGCATGGTCGCCACGTTCGGCCCTGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCCGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCCACCCAGGACTTCCTGGCCCAGGTCATTGTGCTGAACCACCGGCCGCACTGCCCGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAATGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGCTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_fallax TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGTGGGCTCTCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATACCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTTCCAGTGTCTATAATCCGTGGCATATTCCATTGCGAGTGTGTGCGTGTGTGGTTTCGGCAG-TTTGCTGCGCTGTGCCTGGCTGTGCGTGTGCTTGGTGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTGTGCCGCGGGAAATATCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTAGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGCTTCTCTGTGTGCGCGCCGTGCGAATAGCTTGCTATGCGTGTGGTGTTGTGTGTGGATTGAGGCGTGCTGTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACTGTCTTCGGGGATCCATCACGAGGTCGGAGCCAGTAGTTTGTAAACCTTCTAATACTGAAAAACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTATATCAAACTTGCCTTCCTTCCTTCCTGTAGTCGGTGGGGGAACGTCAGATGTGAAGTGTCTTGGCGGTTCGGCGGGCGAGTCCTTTTAAATACAAATACTGTTCTCTCTTTGCTCGAAAAGTGGGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACTTTTGCTGAGACGGGGGAGGGCTTGATTCGCGGTATGGTTGGCTTCGGCTGAACTGCTTATTGGGCTTCTTTCATGTCTTGGCGTCGGTGTACCGGCTTGGCTTTTGAACGTTCTGTTGCGATAGAGTGGTTTTCGGACGACGTTTTGGGAAATGCCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCCTTTTCTGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAACTTGCACAACCGGGTAATCAAATTTTAATGGGGAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTCTTTTTAGTTATGCCTGCCTTAATAGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATTGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCCTTAGTTGAATCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCTAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGGATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCGGGTGCAATTACAATGTTATTAACTGATAGAAATTTTAATACATCTTTTTATGACCCTTCAGGTGGAGGTGATCCAGTATTATATCAAAGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACGTCGCAGGCTGATTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGC{GT}CT{AG}CTGGCCTTCACGCT{CT}GGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTC{CG}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGC{CT}GAGGTCAGCACGTACCTGAAGAAGGT{CG}GGCTACAAGCCCGTCAAGATCCCGTTCGTGCCCATCTCCGGATGGGAGGGCGACAACATGATCGAGCGCTCGACCAACATGCCGTGGTACAAGGGACCGTTCCTCCTCGAGGCT{CT}TGGACCTCCTGAACGCCCCCAAGCG{CT}CCGAGCGACAAGCCCCTGCGTCTGCC{CT}CTCCAGGA{CT}GTGTACAAGATCGGCGGTATCGGCACGGTACC{GT}GTCGGCCGTGTCGAGACGGGTGTGATCAAGCCTGGCATGGTCGCCACCTTCGGCCCGGTCGGTCTGTCGACGGAAGTCAAGTCTGTCGAGATGCACCACGAGTCTCTGCC{CG}GAGGCTGTCCCGGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCC{GT}GCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGCACTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTG{CT}AAGTTCAAAGAGATCAC{GT}GAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCGCTCGGTGGCGGTACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGCATCATGTGCACCTACTCGGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCGTACAACGCGACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGCCTGGATAACGAGGCCTTGTACGACATTTGCTTCCGCACGCTGAAGCTCACCACCCCTACCTATGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACGACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGGTTCGCCCCGCTCACGTCGCGTGGCTCACAGCAGTACCGTGCCCTAACGGTGCCGGAGTTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTCCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCGAACAACATCAAGGCGAGCGTGTGTGACATCCCGCCGGCCTGAAGATGTCGACCACGTTCATCGGTAACTCGACGGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAG Phytophthora_foliorum TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGGTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATGGATGCGTGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGTCTGAGCTAGTAGCTTTTAAACCATCTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGACGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGCTGGTGAACCGGCTTGGCTTTTGAATGCGATGTTGCGATAGAGTGGTGTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATAATGGTTTTTTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCCTTTCCACGAATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCGGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCCTTTCTTTTATTATTAACATTACCCGTTTTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCATCTGGGGGGGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGGCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATCGAAAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACAACCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCCCTGCGTCTGCCTCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTGGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCGAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCTGGTGCAACGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGGTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGAATGGGTACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCCTGGATAACGAGGCTCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCCACCTACGGCGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGATTTGCGGAAGCTGGCGGTGAACTTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCGGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_fragariae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGCTTTTCTGCGCTCGGTGCGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGAGCCAGTAGCTTTTAAACCATTTGATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGACGTGAGGTGTCTTGGTGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGACGTTCTTCCTGCTGTGGCGCCGGTGAACCGGCTTGGCCTTTGAACGCGGTGTCGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTTAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTATTTGGTCTGTATTAATTACAGCATTTCTTTTATTACTAACTTTACCGGTATTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGGGGAGATCCAGTACTATATCAAGGTCATCGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGGTCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCCGAGGTGTCGACCTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACTGTACCTCCTCGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCCG{AT}CGGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCC{CG}GAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGT{CG}TCGGTCAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCCACCCAGGACTTCCTGGCCCAGGTCATTGTGCTGAACCACCGGCCGCACTGCCGGTCCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACCACGTGCCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAAGGTATGGACGAG Phytophthora_glovera TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCCTGGCGTGGTGCTGCGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCCGGGCGAGTAGGTTTTAAACCATCACATTCTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGTTGTTTCGGCGAGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCAAAAAGTGTGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTCCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGAATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTTGGGAATGTCTTAATCATAAAGATATTGGAACTTTATATATAATTTTTAGTGCTTTTGCAGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATCTTTATGGGAAATCATCAATTATATAATGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACGGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGGCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAATGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCTGATTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGAT{CT}GTTGCCATCAACAAGATGGA{CT}GACTCGTC{CT}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTTGGCTACAA{AG}CCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGAT{CT}GACCG{CT}TC{CT}ACCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACA{AG}CCTGAACGCCCC{CT}AAGCGTCCGTCTGACAAGCCTCTTCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACTGGTGTCAT{CT}AAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGATGTTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCATCGCCCAAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCCCACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACCACGTGTCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTTTTTATGATTGGTTTCGCCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCCGAGCTGACCCAACAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACCGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_gonapodyides TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGCGCGTGCCTGTGGCAGTTTTTCTGCGCTCGGTGCGGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTCGGGGGCCTATCGCGAGGCTCGAGCTAGTAGCTTTTAAACCATTTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATATGCCAGACGTGAAGTGTCTTGGCGGTTCGACTGGTGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTCGCTGTGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACCGCTTATTGGGTGCTTTTCCTGCTGCAGCGTTGGTGAACCGGCTTGGCTTTTGAACGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAGATGTCTTAATCATAAAGATATGGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACCTTATCACTTTTAATCCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGAAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTGTCATCAGCTATTGTCGAATCTGGTGCTGGGACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCATCATTATTGGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCACAGATTACCCCTATTTGTTTGGTCTGTGTTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGTGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCGTTTTACGATCCATCTGGAGGAGGTGATCCGGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCCGACTGCGCCATTCTGGTGGTTGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCAC{CG}ACCTACCTGAAGAAGGTCGGCTACAAGCC{CT}GCCAAGATCCCGTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATTGACCGTTCGGCCAACATGCCGTGGTACAAGGGACCCTTCCTCCTCGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCC{CG}TCGGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTCATCAAGCCCGGCATGGTCGCCACCTTCGGCCCCGT{CG}GGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCT{CT}TGCCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCTAAGGCCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCATTGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGCTCCGGCATGGGCACGCTTCTTATTTCCAAGATCCGTGAAGAGTACCCGGATCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCAACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACCACGTGCCTGCGTTTCCCGGGCCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCGGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGACGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTGGATGAACAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCAAGCGTGTGCGACATCCCGCCGGCCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_gregata TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGCCTGTGGCAGTTTTTCTGCGCTCGGTGCGGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTTGGGGGCCTATCGCGAGGCTCGAGCTAGTAGATTTTAAACCATTTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATATGCCAGACGTGAAGTGTCTTGGCGGTTCGACTGGTGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCTTGTCGGCGACCTTTGCTGTGACGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACCGCTTATTGGGTGCTTTTCCTGTCATGGCGCTGGTGAACCGGCTTGGCTTTTGAATGTTTTGCTGCGATAGTGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATATAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTATTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGGGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTAGCAAGTGCACAAGCACACTCAGGACCTTCCGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTGTTAGCAGGTGCTATTACAATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGACCCATCCGGTGGGGGAGATCCCGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACCACCTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATTGACCGTTCGGCCAACATGCCGTGGTACAAGGGACCCTTCCTCCTCGAGGCTCTTGACAGCCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTCATCAAGCCCGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCTACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCATCGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGATGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGCGGTGGTACCGGCTCGGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTA{CT}AACGCCACGCTGTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGAATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTAACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGCCTCAAGATGAGCACCACGTTCATCGGCAACTCGACCGCCATCCAGGAGATGTTTAAGCGCGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_hedraiandra TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTATGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGCCTGAGCTAGTAGCTTTTAAACCATCTTATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGAGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCTAGCAAGTTGGCGACCTTTGCTGCGGCGGAAGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGTTTTTTCTGCTGTGGCGTCGGTGAACCAGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACCGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCAGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCATCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTAAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAAGGTATGGACGAG Phytophthora_hedraiandra_MAFF_235099 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTATGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGCCTGAGCTAGTAGCTTTTAAACCATCTTATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGAGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCTAGCAAGTTGGCGACCTTTGCTGCGGCGGAAGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGTTTTTTCTGTTGTGGCGTCGGTGAACCAGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCGAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCCGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACGGAAGTTAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTTCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACCGAGAAGATGGACCGTCGTTCGGGTAAGGTGACTCAGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTAAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAAGGTATGGACGAG Phytophthora_heveae TAGTACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTTCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGACTTGGGGGCGCTATCGCGAGGTCTGAACTAGTAGCTTTTAAACCATCTAATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGAGAGATGCCAGATGTGAAGTGTCTTGCTGGCTCGATGGGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAATGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTCTGCTGCAGCGGAGGCGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGTATGTGTTTCCTGTTGTGGCGATGGTGTACCGGCTTGGCTTTTGAATGCTTTGCTGTGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCACCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTACGATCCTTCTGGTGGAGGAGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCCTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCCTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATCGACCGCTCCAGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCCCTCGACAACCTGAACCCCCCCAAGCGCCCGCTCGACAAGCCGCTGCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTCGTCCGTAAGGAGGCTGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATTTCCAAGATCCGAGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCGACGTTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGTATCACGACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAATCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTTACGGTGCCCGAGCTGACCCAGCAGCAATTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCCCCGGTCTCAAGATGAGCACCACGTTCATTGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAG Phytophthora_hibernalis TAGTACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCACACAAGTTTTGTGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGTCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTATGGCAGTTTTTCTGCGCTTGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGATGCGGTGGGACGTCAAGGTCAATTCGTATGCCGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGATTGAGGTGCCTACAACGTGCTTTTGAGTGTCCGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTACTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGTCTGAGCTAGTAGCTTTTAAACCTTTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGTCAGACGTGAAGTGTCTTGTTGGTTCGGCGGGCGAGTCCTTTTAAATGTACGAACGGTACTCTCTTTGCTCGAAAAATATGAATGGTTGTGGCTTCCGGCAAGTCGGCGACTTTTGCTACGGCGGAGGAATGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAACGGCTTATTGGATGTTTTTCCTGCTGTGGTGATGGTGAACCGGATTGGCCTTTGAACAGGATGTTGTGATAGAGTGGGGTTTGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCCCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTCGTTCCTTTAATGATAGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCCGCTTTATTATTATTAGTATCATCAGCTATTGTGGAATCTGGAGCAGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCGGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTTTTAGCAGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCCTCTGGAGGTGGTGATCCCGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTGGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGGCCGTTACGAGGAGATCAAGGCCGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCGGGCTGGGAGGGAGACAACATGATTGAGAAGTCTAGCAACATGCCGTGGTACAAGGGACCGTACCTTCTCGAGGCGCTCGACTCCCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTTAAGAACGTGTCGGTGAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCCGTGCT{AG}GACTGCCACACGGCCCACGTTGCGTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTGCAAGGGTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGCTCCGGAATGGGCACGCTCCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACATACTCCGTGTGCCCGTCGCCCAAGGTGTCGGACACCGTCGTGGAGCCCTACAACGCCACACTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCGCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGGTTCCCCGGTCAGCTGAACTCGGACCTGCGGAAACTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGCTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTCAAGATGAGTACCACGTTCATCGGTAACTCGACCGCTATCCAGGAAATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGACGAG Phytophthora_humicola TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCCGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGTGTGCGTGCCTGTGGCAGTTTTTCTGCGCTCGGTGCGGTGTTGTGCTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCTGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGCGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGAGCTCTATCGCGAGGCTCGAGCTAGTAGCTTTTAAACCCTTTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATATGCCAGACGTGAAGTGTCTTGGCGGTTCGACTGGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGTAGTAGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACCGCTTATTGGGTACTTTTCCTGCTATGGCGCTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTCGAATGGAATTAGCACAACCGGGTAATCAAATTTTTATGGGGAATCATCAATTATATAATGTTATTGTTACAGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCACTGCTTGCCTTCACGCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCCTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATCGACCGCTCGGCGAACATGCCGTGGTACAAGGGACCCTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTTCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCCACCTTCGGCCCCGTGGGTCTGTCCACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCGCTGGCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCATCGAGAAGATGGACCGTCGTTCGGGCAAGATGACTCGGTGCTTGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCTGACACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGCTTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACCACGTG{CT}CTGCGATTCCCCGGTCAGCTGAACTCGGATCTGCGTAAGCTAGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCCCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGTCACGGCCGTTATTTAACTGCAGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAAATGCTGAATGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCCAGCGTGTGTGACATTCCGCCGGACTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_idaei TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGCCTGAGCTAGTAGCTTTTAAACCATCTTATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGAGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCTAGCAAGTTGGTGACCTTTGCTGCGGCGGAAGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGTTTTTTCTGCTGTGGCGTCGGTGAACCAGCTTGGCTTTTGAATGCTTTGCTGCGGTAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTGATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATCACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGG{CT}AC{CT}TCGCAAGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGG{AC}CAGAC{GT}CGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAAGGTATGGACGAG Phytophthora_ilicis TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGCTTTACTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACTGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGTTTTTAAACCATTTTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAAGTGTCTTGCGAATTCGATTGGTGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGTGGCGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAACGGCTTATTGGATGTTCTTCTTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTGGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCGCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCATTAATGATTGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCCGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACAATGTTGTTAACCGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGC{CG}TTCACCCTGGGCGTGAAGCAGATGGTCGT{CT}GCCATCAACAAGATGGACGACTCCTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCCGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGTCAAGATCCCCTTCGTGCCCATCTCTGGATGGGAGGGAGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGCTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGCGTGGAGACCGGTGTCATCAAGCCTGGCATGATCGCCACGTTCGGCCC{CT}GTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGA{CT}TTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTG{CT}AAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGAACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTTGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTTCGTAAGCTTGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCATTGGTACACCGGTAGGGTATGGACGAG Phytophthora_infestans TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGATTTTAAACCTTCTTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGTTGGTTCGGCGAGCGAGTCCTTTTAAATGTACAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGCTGCTAGCGAGTTGGCGACCTTTGCTGCGGCGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGGTGATTTTCCTGCTGTGGCGTTGGTGAACCAGCTTGGCATTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTATTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAA{AG}AACATGATTACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATG{AG}TCGTCGCCAT{CT}AACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCC{CT}ATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGTC{GT}GACAAGCCGCTGCGTCTGCCCCTTCAGGA{CT}GTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTC{CT}GTCGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTC{CG}AAGAACGACCCTGCTAAGGCAACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGG{CT}CGGCCTGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTT{CT}AAAGAGATTACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTCGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCCGTCGCCCAAGGTATCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGACAATGAGGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCCACTTATGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATTACCACGTGCCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCATGGCCGCTATTTAACTGCAGCTTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACTGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_insolita TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCGAGTTTCGCGTGGCGAATTGTAGTCTATAGATGCGTGGTCAGCGTTGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATC{CT}CTGAGTGGCTGCGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATCGGGAGTGTGTGCGTGCGTG{CT}CTTTGGCAGTTTTTCTGCGCTGGGCGTGGCTGTGCGTGTGCTTGGTGGTGCCCTGTGTTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGCGTGTGTGTCTCTGGATGCGTGCTGTGCGGATAGCTTGCTATGCGTGTGGCGTTGTGTTTGGATTGGCGTGCGCTTTTGCTGTTGCCGTTCCCACACTAAAAGTCCACGTGACTGTCGTTGGGGCGTCATCACGAGGCCTGTGTTCTTTGGTTTTAAACCTTCTTACACTGATGTACTGTGGGGACGAAAGTCTCTGCTTTGACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATGAAACTTGGCTTCCTTCCTTCCTGTAGTCGGTGGGGGAACGCCAGACGTGAAGTGTCTTGCTTGTGTAGTGTGCGAGTCCTTTGAAATGTAAGACGTGTGTTCTCTTTGCTGGAAAAGTGGGCGTGGTTGTGGCTGCCGGCCAGTCGGCGACTTTTGCTGATGCGGGAGAGCGTTCGATTCGCGGTATGGTTGGCTTCGGCTGATTTGCTTATTGGTTGCGTTTGCTGCGTCGGCGTCGGTGAACCGGCTTGGCTTCTGAACGTGCTGTTGCGATATGGTGGGCCTCGGCCGACTATTTGGGAAGCGTCCTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCAGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACACGCTTTTATTATGGTATTCTTTTTAGTTATGCCTGCATTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCTGGTATTTCTTCTTTATTAGGTGCTATCAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCATTATTTGTTTGGTCTGTTTTAATTACAGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTCTATGATCCTTCTGGAGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTCGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACGCTCGGCGTGAAGCAGATGATCGT{CT}GCCATCAACAAGATGGACGACTCTTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACGACCTACCTGAAGAAGGTGGGCTACAAGCC{AG}GCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGTGACAACATGATTGACCGCTCCAC{CT}AACATGCCGTGGTACAAGGGACCCTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCGATTGACAAGCCGCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCTACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCGAAGAACGACCCTGC{CT}AAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTC{GT}GTGCTGGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTG{CT}CCGTCCCC{CT}AAGGTCTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAA{CT}GAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACCACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGTATCAC{CT}ACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGATCTGCGTAAGCTGGCTGTCAACCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGC{AG}CCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGT{AG}CCGGAGCTGACGCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGTGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAATGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGACATCCCGCCGGTCTGAAGATGTCCACGACGTTCATCGGTAACTCTACGGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAA Phytophthora_inundata TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCCGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGTGTGCGTGCCTGTGGCAGTTTTTCTGCGCTCGGTGCGGTGTTGTGCTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCTGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGCGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGAGCTCTATCGCGAGGCTCGAGCTAGTAGCTTTTAAACCCTTTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATATGCCAGACGTGAAGTGTCTTGGCGGTTCGACTGGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGTAGTAGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACCGCTTATTGGGTGCTTTTCCTGCTATGGCGCTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTATTGTTACAGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCAAGTGTACAGGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGGGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTC{CT}AAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCCTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATCGACCGCTCGGCGAACATGCCGTGGTACAAGGGACCCTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTTCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCCACCTTCGGCCCCGTGGGTCTGTCCACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCGCTGGCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCCTCGGACTCCAAGAACGA{CT}CCGGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCTTGCAAGTTCAAAGAGATCATCGAGAAGATGGACCGTCGTTCGGGCAAGATGACTCGGTGCTTGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCTGACACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGCTTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCC{CT}ACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGATCTGCGTAAGCTAGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACGTCCCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGTCACGGCCGTTATTTAACTGCAGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAAATGCTGAATGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCCAGCGTGTGTGACATTCCGCCGGACTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_ipomoeae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAG{CT}TGCTGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGCTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGATTTTAAACCTTCTTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGTTGGTTCGGCGAGCGAGTCCTTTTAAATGTACAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGCTGCTAGCGAGTTGGCGACCTTTGCTGCGGCGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGGTGATTTTCCTGCTGTGGCGTTGGTGAACCAGCTTGGCATTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAGTTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACGGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCGGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTATGATCCATCAGGTGGAGGTGATCCCGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTC{AG}CAGGCCGATTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGAT{CT}GTCGCCAT{CT}AACAA{AG}ATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAA{AG}ATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTC{CG}ACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGTCGGACAAGCCGCTGCGTCT{GT}CCCCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTT{CT}GGCCCCGT{GT}GGTCTGTC{GT}ACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCC{GT}GAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTT{CT}GTCGCTTCGGACTC{CT}AAGAACGACCCTGCTAAGGCAACCCAGGACTTCACCGCCCAGGTGATTGTGT{CT}GAACCACCGGCCGGCCTGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATTACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTCGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTTATGTGCCTGGACAATGAGGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCCACTTATGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATTACCACGTGCCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCAGCTTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACTGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_iranica TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGTGGGCACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTATCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTATGGCAGTTTTTCTGCGCTTGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTAACGCGAGGTCTGGGCTAGTAGATTTTAAACCATCTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGTCAGATATGAAGTGTCTTGTTGGTTCGGCGAGCGAGTCCTTTTAAATGTACAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGCTGTTGGCCAATTGGCGACCTTTGCTGCGGCGGAAGAATGCTTGATTCGCGGTATGATTGGCTTCGGCTGAACGGCTTATTGGGTGTTTATCCTGCTGCGGCGTTGGTGAACCAACTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGGACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGT{AG}GTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGC{AC}ATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGT{CT}GGCTACAAGCCCGCCAAGAT{CT}CCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACCCCCCCAAGCGCCCAAGCGACAAGCCTCTGCGTCTGCCCCTTCAGGATGTTTA{CT}AAGATCGGCGGTAT{CT}GGCACGGTACC{GT}GT{CG}GGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGT{CT}AAGTCCGT{CT}GAGATGCACCACGAGTCT{CT}TGCCTGAGGC{CT}GTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTC{CG}GACTC{CT}AAGAACGACCC{CT}GCTAAGGGCACCCAGGACTTCACCGCCCAGGTTATCGTGCTGAACCACCGG{CT}CGGCCTGCCCGTGCTTGATTGCCACACGGCCCACGTTGCCTGCAAGTT{CT}AAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCTGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAATGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTAAAGCTCACCACCCCCACGTACGGCGACCTAAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCTGGTCAGTTAAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCTCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTACCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACCACGTTCATTGGTAACTCTACTGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAAGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_katsurae TAGTACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTCGCTATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGACTTGGGGGCGCTATCGCGAGGTCTGAACTAGTAGCTTTTAAACCATCTAATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGCTGGCTCGATGGGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCAAAAAATGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTCTGCTGCGGCGGAGGCGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGTGTTTCCTGCTGTGGCGATGGTGTACCGGCTTGGCTTTTGAATGCTTTGCTGTGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCATCATTATTAGGTGCTATTAACTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCCTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCCTTCGTGCCCATCTCGGGCTGGGAGGG{CT}GACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCCCTCGACAACCTGAACCCCCCCAAGCGCCCGGTCGACAAGCCGCTGCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCCGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTCGTCCGTAAGGAGGCTGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATTTCCAAGATCCGCGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCGACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGTATCACGACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAATCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTTACGGTGCCCGAGCTGACCCAGCAGCAATTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATTGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAG Phytophthora_kernoviae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGCGAGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGTGTATGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGTGCGGTTGTGCGTGTGTTTGCTGGTGCCCTGTGCTATGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCTGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTCTGGAACTCTCTGTGTGCGTGCTGTGTGGATAGCTTGCTATGTGCGTGGTGCTGTGCGTGGATTGAGGTCTGCTGTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGAATTGGGGGCTCTATCACGAAGTCGGAATTGAGAGTTTTTAAACCATCTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCCTGTAGTCGGTGGGGGAATGCCAGACGTGAAGTGTCTTGGCGGTTCGGTGTGCGAGTCCTTTGAAATGTAGATACTGTTCTCTCTTTGCTCGAAAAGTGAGTGTAGTTGTGGCTGCCGGCATGTCGGCGACTTTTGCTGAGGCGGAGAGGGGTTCGATTCGCGGTAGTGTTGGTTTCGGCCGAACCGCTTATTGTGTCTTTTTCCTGCTTTGGCGTTGGTGTACCGGCTTGGCTTTTGAACACTTTGTTGCGATAGAGTGGTTTTCGGACGACGTTTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTTCTGGTATTGTTGGTACAACATTTTCACTTTTAATTCGTATGGAATTATCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTCTTAGTTATGCCTGCTTTAATTGGTGGCTTTGGTAATTGGTTTATTCCTTTAATGATAGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCATCAGCTTTAGTTGAATCAGGTGCGGGTACAGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCGGTAGATTTAGCTATTTTTAGTTTACATTTATCCGGAATGTCTTCACTGTTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATTTTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCATTTTATGATCCTTCAGGCGGAGGTGATCCGGTATTATATCAACGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATCCTGGTGGTCGCTTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCTTTCACTCTTGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCTTCGGTGATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACCACGTACCTGAAGAAGGTTGGTTACAAACCCGCTAAGATCCCGTTCGTGCCCATCTCTGGATGGGAGGGAGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCGTACCTCCTCGAGGCTCTGGACACCCTGAACGCCCCCAAGCGTCCGTCCGACAAGCCTCTCCGTCTTCCCCTCCAGGACGTTTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTCGAGACTGGTGTGATCAAGCCGGGCATGATCGCTACCTTCGGCCCCGTGGGTCTGTCCACGGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCTCTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTTGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCTCAGGTGATTGTGCTGAACCACCTGGCGCAACTCCGGTGCTTGACTGCCACACGGCCCACGTTGCGTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCG{CT}TCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGTAAGGAGGCCGAGTCCTGCGATTGCCTGCAGGGTTTCCAGATTACCCACTCCCTTGGTGGTGGTACCGGTTCCGGTATGGGAACGCTTCTAATCTCCAAGATTCGTGAAGAGTACCCAGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCCCCCAAGGTGTCGGACACTGTGGTGGAGCCTTACAACGCGACACTTTCCGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACACTCAAGCTCACGACCCCCACCTATGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCTGGTATCACAACGTGCCTGCGTTTCCCCGGTCAGCTCAACTCTGACCTGCGTAAGCTGGCTGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCGCCGCTGACGTCGCGTGGATCGCAGCAGTATCGCGCCCTGACGGTGCCGGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCTCGTCATGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGGATGAGCACGAAGGAGGTGGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCTTCATACTTCGTGGAGTGGATCCCGAACAACATCAAGGCTAGTGTGTGTGATATCCCGCCGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGATGAG Phytophthora_macrochlamydospora TAGTACGGCGAGTGAAGCGGGAGGAGCTCAAGCTTAAAATCTCCGCGCCAGTTTGGCGTGGCGAATTGTAGTCTATGGACGCATGGTCAGCGCGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTGATTCCCTGGGTTGCTGTGCGTACGACCCGTGGTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCTGCATATTTCATTGGGGGCGTGTGCGTGTGTGGCTTTGGCAGTTTTTCTGCGCTGGGTCTGGCTGTGCGTGTGTCTGGCGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGGGAATCTCTGTGTGCGCGGTGTGCGGATAGCTTGCTATGCGTGTGCTGTTGTGCGTGGATTGAGGCCTGCTGTAGCTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTTTTGGGGACTCTATCGCGAAGTCGGGGCCAGTAGTTTTTAAACCATCGAATACTGACATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATGAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGACGTGAAGTGTCTTGGCGGTTCGGGGCGCGAGTCCTTTGAAATGTAAGACCTGTTCTCTCTTTGCCCGAAAAGTTCGAGTGGTTGTGGCTGCCGGCATGTCGGCGACTTTTGCTGAGGCGGGGGAGAGCTCGATTCGCGGTATGGTTGGCTTCGGCTGAACTGCTTATTGGTCTTTTTTCGCGCTTTGGCGTCGGTGTACCGGCTTGGCCTTTGAACGTTGTGCAGCGATAAGGTGGACTGTAGTCGGCAATTTGGGAAATGCCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCAGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTAATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTATATCCACCTTTATCAAGTGTTCAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCAATTAATTTCATATCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCAGGTGGGGGGGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCCGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACGCTGGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACTCGCAGTCCCGCTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGAGACAACATGATTGAGCGCTCTACCAACATGCCGTGGTACAAGGGCCCGTTCCTGCTCGAGGCCCTCGACAACCTCAACGCGCCCAAGCGCCCGGTCGACAAGCCGCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCTACCTTCGGCCCTGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTGCCCGGCGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGCACTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGATCACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGATCTCCAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTCTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAAGTCATGTGCCTGGACAACGAGGCTCTGTACGATATCTGCTTCCGTACGCTCAAGCTGACCACCCCCACGTACGGCGACCTGAACCACCTCGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGCCAGCTCAACTCGGACCT{AG}CGTAAGCTGGCCGTCAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATTGGCTTCGCGCCGCTCACGTCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTTCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTCAAGATGTCCACGACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGCATGGATGAG Phytophthora_meadii TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCCTGGTGTGGTGGTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTGCTATCGCGAGGTCTGGGCTAGTAGTGTTTTAACCATAACATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGTTTGTTCGGCGAGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGTATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTATTGTTACTGCTCACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGGGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATATCATCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCTCCTGGTCACCGTGA{CT}TTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCAGATGAT{CT}GT{CT}GCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACGACCTACCTGAAGAAGGTTGGTTACAAGCCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGATCGACCGTTCCACCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTGGACAACCTGAACGCCCCCAAGCGTCCGTCTGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGA{CT}TTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCT{GT}CCGGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGATGTCGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGCTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCTGGTATGGGTACGCTTCTTATCTCGAAGATCCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACTGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTACGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACTACGTGCCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGTTGGCTGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAACAGTTTGATGCCAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAATTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAG Phytophthora_megakarya TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGTAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGACTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGAACTAGTAGTTTTTAAACCATATTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACCTCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATATGCCAGATGTGAGGTGTCTTGCTGGTTCGGCGGGTGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTAAGTGTTGTTGTGGCTGCTAACCAGTCGGCGACTTTTGCTGTGGCGGAGGAGTGTTCGATTCGCGGTATGATTGGCTTCGGCTGAACAGCTTATTGGGCGTTTTTCCTGCTATGGCGTTAGTGAACCGGCTTGGCTTTTGAATGTGTCGCTGCGATAGAGTGGACTTTGGTCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTAGGTACAACTTTATCTCTATTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAATTATATAATGTTGTAGTTACTGCTCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAGGCACACTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCTTCAGGTGGTGGAGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGATTGCGCCATCCTTGTGGTGGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGAGACAACATGATCGACCGCTCCA{CG}CAACATGCCGTGGTACAAGGGACCTTACCTCCT{CT}GAGGCCCTCGACAACCTGAACGCCCCCAAGCGCCCGTCGGACAAGCCGCTCCGTCTGCCCCTTCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGTAAGGAGGCAGAGAGCTGTGACTGTCTGCAGGGTTTCCAGATCACACACTCGCTCGGTGGTGGCACTGGTTCTGGTATGGGAACGCTCCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCGTACAACGCGACGCTGTCAGTGCACCAGCTGGTCGAAAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTATACGACATTTGCTTCCGTACACTGAAGCTCACGACTCCCACGTACGGTGACTTGAACCACTTGGTGTGCGCTGCCATGTCTGGTATCACCACGTGCCTCCGTTTCCCGGGTCAGTTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACTTCGCGTGGCTCGCAGCAGTACCGTGCCTTGACGGTCCCTGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCTGCCGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACTGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAA Phytophthora_megasperma TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGCGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGTGTGTGCGCGCGTGCCTGTGGCAGTTTTTCTGCGCTCGGTGCGGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTACCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCTCGAGCTAGTAGATTTTAAACCTTTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATATGCCAGACGTGAAGTGTCTTGGCGGTTCGACTGGTGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCGCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGTGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACCGCTTATTGGGTGCTTTTCCTGTCATGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCTTTGCTGCGATAGTGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACCTTATCACTTTTAATCCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTCCCACGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCGTTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCCGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCCTTTCTTTTATTATTAACATTACCCGTATTAGCTGGTGCCATTACCATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCTGGGGGGGGGGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCTGACTGCGCCATTCTGGTCGTCGCCTCGGGTGTGGGTGAGTTTGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACGACCTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGTGACAACATGATCGAGCGCTCCACTAACATGCCGTGGTACAAGGGACCCTTCCTTCTTGAGGCTCTTGACCTGCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCTGGCATGATCGCCACCTTCGGCCCTGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGGCCGAGGCTCTTCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCTTCGGACTCCAAGAACGACCCGGCCAAGGCCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCATCGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGCAAGGAAGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGCGGTGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCATCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCTCGTCTCCACTTCTTCATGATCGGTTTCGCCCCATTGACGTCGCGCGGCTCGCAGCAGTACCGTGCCTTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGCTATTTAACTGCCGCCTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATTAAGGCTAGCGTGTGTGACATCCCGCCGGCCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGACGAG Phytophthora_melonis TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGGATCATGAGCTTTTAAACCATTTGATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAGGTGTCTTGGCGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGTGTTGGTGAACCGGCTTGCCTTTTGAACGCGGTGTAGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGGTTGACAAGCCTCT{CT}CGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCTTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGTCGCACTTCCTGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTTGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACTGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCATCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACTACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_mexicana TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCTGTGGCGGTTTTTCTGCGCCTGGCGTGGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGGGCGAGTAGGTTTTAAACCATCACATTCTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGTTGTTTCGGCGGGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGAATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGGGTGGGCTTCGGCCGTCGATTTTGGGAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGC{CT}GATTGCGCCATTCTGGTGGT{CT}GCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTTGG{CT}TACAAGCCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGATTGACCG{CT}TCCACCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCC{CT}AAGCG{CT}CCG{AG}TTGACAAGCCGCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACTGGTGTCAT{CT}AAGCC{AT}GGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGATTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGATGT{CT}GTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGG{CT}GGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGA{AG}GAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCATCGCC{CT}AAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTG{CT}CTGGATAACGA{AG}GCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCC{AC}ACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACCACGTGTCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGCTGGCCGT{AG}AACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCCGAGCTGACCCAACAACAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGAC{CT}GCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGG{CT}AGGGTATGGATGAG Phytophthora_multivesiculata TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGCGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGCGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAATGTTTGCGTGCGTGTCTATGGCAGTTTTTCTGCGCCTGGCGTGGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGCGGATTGATGCAGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGGTTTTAAACCATTTTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGACGTCAGATGTGAAGTGTCTTGTTGGTTCGGCGTGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGTATGTGGTTGTGACTGCCGGCCAGTCGGCGACCTTTGCTACGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGACGTTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGTCTTTGAATGCTTTGCTGCGATAGAGCGGGCTTCGGCCGTCGATTTGGGAAGTGTCTTAATCATAAAGATATAGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAGTTATCTCAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTTTTTCTAGTTATGCCTGCTTTAATTGGCGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTCCCTCGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACCTTACCTGTATTAGCTGGTGCAATTACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGAGGAGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACTTCGCAGGCCGATTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGATGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCGGAGGTCACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATTGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCCCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTCGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAATCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCTAAGGCTACCCAGGACTTCACGGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATCCGCGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACCGTTGTGGAGCCCTACAATGCCACGTTGTCAGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAATGAGGCCCTGTACGACATTTGCTTCCGTACGCTTAAGCTCACCACCCCCACCTACGGTGACCTGAATCACCTGGTGTGTGCCGCCATGTCTGGTATCACCACGTGTCTGCGTTTCCCTGGTCAGCTGAACTCGGATCTGCGTAAGCTGGCCGTGAATCTGATTCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACATCGCGTGGCTCGCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAATTCGTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCTCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGACGAG Phytophthora_multivora TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCCTGGTGTGGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGGTCTGGGCTAGTAGGTTTTAAACCATTACATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGGTGTTTCGGCGTGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGTATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTCCGGCCGTCGATTTGGGAACTGTCCTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTTTATTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACATTCTGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCTACTATTTATAATATGCGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCAGGAGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACGTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTA{CT}GGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATTTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGATGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACTCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACCGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTACGGTGACCTGAACCATCTGGTGTGCGCCGCCATGTCTGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCGCTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAG Phytophthora_multivora_NBRC_31016 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGCGTTTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCCTGGTGTGGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGGTCTGGGCTAGTAGGTTTTAAACCATTACATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGGTGTTTCGGCGTGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGTATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTCCGGCCGTCGATTTGGGAACTGTCCTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTTTATTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACATTCTGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCTACTATTTATAATATGCGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCAGGAGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACGTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATTTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGATGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACTCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACCGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTACGGTGACCTGAACCATCTGGTGTGCGCCGCCATGTCTGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCGCTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAG Phytophthora_nemorosa TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGCTTTACTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACTGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGTTTTTAAACCATTTTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAAGTGTCTTGCGAATTCGATTGGTGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGTAGCGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAACGGCTTATTGGATGTTCTTCTTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTTTTTT?AGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCCTTAATGATTGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGAACAGGTTGGACAGTTTATCCACCTTTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTGGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCAGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAAGGTCATCGACGCCCC{CT}GG{AC}CACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGCGTGAAGCAGATGGTCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCCGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGTCAAGATCCCCTTCGTGCCCATCTCCGGATGGGAGGGAGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTGGACAACCTGAACGCCCCCAAGCGCCCGCTTGACAAGCCCCT{CG}CGTCT{GT}CCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGCGTGGAGACCGGTGTCATCAAGCCTGGCATGATCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGC{CT}TCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTG{CT}AAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCACTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTTGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTTCGTAAGCTTGCAGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_nicotianae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTACGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGAGCTTTAACTGTTGCCGTTCCCACAATAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGCCTGATTTAGTAGCTTTTAAACCATCTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGTCAGATGTGAAGTGTCTTGTTGGTTCGGCGGGCGAGTCCTTTTAAATGTACAAACTGAACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCTGGCAAATTGGCGACTTTTGCTGCGGCAGAAGAGTGTTCGATTCGTGGTATGGTTGGCTTCGGCTGAACGACTTATTGGACGTTTTTCCTGCTGTGGCGTTGGTGAACCAGCTTGGCTTTTGAATGCTTTGCTGCGATAGGGTGGGCTTCGGTCGTCGATTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTTGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGG{CT}CAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGC{CT}AAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGG{CT}CCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCCCCTAAGCGCCCGGTTGACAAGCCGCTGCGTCTTCCCCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCCGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGTAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTATCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTTACCACTCCCACCTACGGTGACCTGAACCACCTCGTGTGTGCCGCCATGTCTGGTATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCTGCTTGTATGTTCCGTGGACGTATGAGCACAAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_nictianae_GF468 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGAGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGCCTGATTTAGTAGCTTTTAAACCATCTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGTCAGATGTGAAGTGTCTTGTTGGTTCGGCGGGCGAGTCCTTTTAAATGTACAAACTGAACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCTGGCAAATTGGCGACTTTTGCTGCGGCAGAAGAGTGTTCGATTCGTGGTATGGTTGGCTTCGGCTGAACGACTTATTGGACGTTTTTCCTGCTGTGGCGTTGGTGAACCAGCTTGGCTTTTGAATGCTTTGCTGCGATAGGGTGGGCTTCGGTCGTCGATTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTTGTGGTGGCCTCGGGTGTTGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGTCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCTAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCCCCTAAGCGCCCGGTTGACAAGCCGCTGCGTCTTCCTCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCCGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGTAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTATCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTTACCACTCCCACCTACGGTGACCTGAACCACCTCGTGTGTGCCGCCATGTCTGGTATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCTGCTTGTATGTTCCGTGGACGTATGAGCACAAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_nictianae_MAFF_235794 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTACGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGAGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGCCTGATTTAGTAGCTTTTAAACCATCTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGTCAGATGTGAAGTGTCTTGTTGGTTCGGCGGGCGAGTCCTTTTAAATGTACAAACTGAACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCTGGCAAATTGGCGACTTTTGCTGCGGCAGAAGAGTGTTCGATTCGTGGTATGGTTGGCTTCGGCTGAACGACTTATTGGACGTTTTTCCTGCTGTGGCGTTGGTGAACCAGCTTGGCTTTTGAATGCTTTGCTGCGATAGGGTGGGCTTCGGTCGTCGATTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTTGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCCCCTAAGCGCCCGGTTGACAAGCCGCTGCGTCTTCCTCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCCGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGTAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTATCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTTACCACTCCCACCTACGGTGACCTGAACCACCTCGTGTGTGCCGCCATGTCTGGTATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCTGCTTGTATGTTCCGTGGACGTATGAGCACAAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTA{AG}GGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_niederhauserii TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGGATCATGAGTTTTTAAACCATTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAGGTGTCTTGGCGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATAGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGC{CT}GACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTC{CT}GGCTGGGAGGGTGACAACATGATCGAGAAGTC{ACG}GGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGC{CT}CT{CT}GACAACCTGAACCCGCCCAAGCGCCCGTCCGACAAGCCCCT{CG}CGTCTGCCCCTCCAGGA{CT}GTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTC{CT}GTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGT{CT}AAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTAGACGTTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTCCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_niederhauserii_CH96HE1 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGGATCATGAGTTTTTAAACCATTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAGGTGTCTTGGCGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGTCCGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTAGACGTTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTCCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_niederhauserii_CH96HE2 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGGATCATGAGTTTTTAAACCATTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAGGTGTCTTGGCGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGTCCGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTAGACGTTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTCCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_palmivora TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGAACTAGTAGTTTTTAAACCATTTTAAACTGATATACTGTAGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGTGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCCAAAAGTGCGTGTGATTGTGGCTGCTAGCCAGTCGGCGACCTTTGCTGTGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGAATATTTCTTCAGCTGTGGTGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAAGGTCATTGACGCCCCTGGCCACCGTGATTTCATCAAGAACATGATCACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGTGACAACATGATTGACCGCTCCAGCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCTAAGCGTCCGGTTGACAAGCCGCTCCGTCTGCCTCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGT{CT}GGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCAGTCCTGGATGTCGTCCGTAAGGAGGCAGAGAGCTGTGACTGTCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATTTCTAAGATTCGTGAGGAGTATCCCGATCGTATCATGTGCACGTACTCGGTGTGCCCATCGCCTAAGGTGTCGGACACCGTCGTGGAGCCTTACAACGCTACGCTGTCGGTCCACCAGCTCGTCGAGAACGCTGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACTTGAACCACCTGGTGTGTGCTGCCATGTCCGGCATCACCACGTGCCTTCGTTTCCCAGGTCAATTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACTTCTCGTGGCTCACAGCAGTACCGTGCTCTGACGGTGCCTGAGCTGACCCAACAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTCGATGAGCAGATGCTCAATGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACCACGTTCATTGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTATCCGAACAGTTCACAGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAG Phytophthora_palmivora_GF534 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGAACTAGTAGTTTTTAAACCATTTTAAACTGATATACTGTAGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCTGTAGTCGGTGGGGATGTGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGTGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCCAAAAGTGCGTGTGATTGTGGCTGCTAGCCAGTCGGCGACCTTTGCTGTGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGAATATTTCTTCAGCTGTGGTGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAAGGTCATTGACGCCCCTGGCCACCGTGATTTCATCAAGAACATGATCACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGTGACAACATGATTGACCGCTCCAGCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCTAAGCGTCCGGTTGACAAGCCGCTCCGTCTGCCTCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTTAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCAGTCCTGGATGTCGTCCGTAAGGAGGCAGAGAGCTGTGACTGTCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATTTCTAAGATTCGTGAGGAGTATCCCGATCGTATCATGTGCACGTACTCGGTGTGCCCATCGCCTAAGGTGTCGGATACCGTCGTGGAGCCTTACAACGCTACGCTGTCGGTCCACCAGCTTGTCGAGAATGCTGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACTTGAACCACTTGGTGTGTGCTGCCATGTCCGGCATCACCACGTGCCTTCGTTTCCCGGGTCAATTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACTTCTCGTGGCTCACAGCAGTACCGTGCTCTGACGGTGCCTGAGCTGACCCAACAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTCGATGAGCAGATGCTCAACGTGCAAAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACCACGTTCATTGGTAACTCGACTGCTATCCAGGAGATGTTCAAGCGTGTATCCGAACAGTTCACAGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGGAGGGTATGGATGAG Phytophthora_parvispora TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGCGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGGTGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGAGCTAGTAGATTTTAAACCATTGTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGGCGCCAGACGTGAGGTGTCTTGGCGGTTCGGTGTGTGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGTTCTTCCTGCTGTGGCGCCGGTGAACCGGCTTGGCGTTTGAACGCGGTGTGGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAACTGTTTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCATTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCAATCGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGCGTTCAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCCATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAAGGTCATCGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGCGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGCCCTTACCTCCTCGAGGCTCTCGACAACCTGAACCCCCCCAAGCGCCCGGTCGACAAGCCGCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACCTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCGCTGCCCGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTGCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCTAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGTCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGACAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCTGGCCAGCTGAACTCGGACCTGCGTAAGCTCGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCCCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCCACGGCCATCCAGGAGATGTTCAAGCGCGTGTCTGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAG Phytophthora_phaseoli TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGATTTTAAACCTTCTTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGTTGGTTCGGCGAGCGAGTCCTTTTAAATGTACAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGCTGCTAGCGAGTTGGCGACCTTTGCTGCGGCGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGGTGATTTTCCTGCTGTGGCGTTGGTGAACCAGCTTGGCATTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATAGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCGGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTGCCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGAT{CT}ACCGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTTTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTA{CT}GGCCAGGCCCGTTACGAGGAGATCAA{AG}TCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGAT{CT}CCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGTCTGACAAGCCGCTGCGTCT{AG}CC{CG}CTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTC{CT}GTCGAGATGCACCACGAGTCTCTGCC{GT}GAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCTGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATTACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTCGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGACAATGAGGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCCACTTATGGTGACCTGAACCACTTGGTTTGTGCCGCCATGTCCGGTATTACCACGTGCCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGCAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACAGCCGCGTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACTGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_pistaciae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGGATCATGAGTTTTTAAACCATTTGATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGGGGTGTCTTGGCGGTTCGGTGCGCGAGTCCCTTGAAATGTACAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTCTATGATCCATCAGGTGGGGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCCGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGCGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCT{CT}GACAACCTGAACCCGCCCAAGCGCCCGGTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACATTTGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACTACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_porri TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCCTGAGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATTGGGAGTGTGTGCGTGTGTGTCTGTGGCAGTTTTACTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTAGCGCGAGGCTTGGGCTAGTAGATTTTAAACCATTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGATGCCAGATGTGAAGTGTCTTGCTGGTTCGGTGGGCGAGTCCTTTTAAATGTACAAACTGTATTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGTGGAGAAGTGTTTGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTAAATGTTTTTCTTACTGCGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCGATATTGCGATAGAGTGAGTTCCGGCCGTCGATTTGGGAAATGCCCTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAACTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCTATTGTTGAATCGGGTGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCGGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCGATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATTTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGG{AT}ACCTCGCAGGCTGATTGCGCCATTCT{CG}GTTGTCGCCTC{AG}GGTGTCGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCG{CT}GAGCACGCTCTGCTTGCTTTCAC{CT}CTGGGTGTGAAGCAGATGATTGTGGCCATCAACAAGATGGACGACTCTTCTGT{CT}ATGTACGG{CT}CAGGCCCGTTACGAGGAGAT{CT}AAGGCTGAGGT{CT}ACCACCTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCAT{CT}TCCGGCTGGGAGGGTGACAACATGATTGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACC{GT}TACCTTCTCGAGGCTCTTGACACC{CT}TGAACGCCCCCAAGCGTCCCTCGGACAAGCCTCT{GT}CGTCTGCCCCT{CT}CA{AG}GA{CT}GTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACCGGTGT{CT}ATTAAGCCGGGCATGATCGCCACTTTCGGCCCCGT{GT}GGTCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCT{AC}CCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCTTC{CG}GACTCCAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGG{CT}CGGCCTGCC{AG}GTGCTTGACTGCCACACGGCCCACGT{CT}GCCTG{CT}AAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCCGG{AC}AAGGTGACTCGGTGTTGGATGTCGTCCGCAAGGAGGCTGAGAGCTGCGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGAGGTACTGGTTCCGGTATGGGAACGCTTTTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACATACTCCGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCTGATGAAGTCATGTGCCTTGATAACGAGGCCTTGTACGACATTTGCTTCCGCACGCTTAAGCTCACCACCCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGCATCACCACTTGTCTGCGTTTCCCGGGTCAGTTGAACTCGGACTTGCGAAAGCTGGCCGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTGAAGATGAGTACAACATTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAAGGTATGGACGAG Phytophthora_primulae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCATGCAAGTTTTGTATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTTAGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCCTGAGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGGAGTGTGTGCGTGTGTGTCTGTGGCAGTTTTACTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTGTCGCCGTTCCCACACTAAAATCCCCCGTGACCGTCTTGGGGGCTCTAGCGCGAGGCTTGGGCTAGTAGTTTTTAAACCATTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGATGCCAGATGTGAAGTGTCTTGCTGGTTTGATAGGCGAGTCCTTTTAAATGTACAAACTGTATTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGTGGAGAAGTGTTTAATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTAAATGTTTTTCTTACTGTGGCGTTGGTGAACCGGCTTGGCCTTTGAACGTGATATTGCGATAGAGTGAGTTCCGGCCGTCGATTTGGGAAATGCCCTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTAGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCCGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCAATTGTTGAATCCGGCGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATCTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGCTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTAC{CT}TCGCAGGCTGATTGCGCCATTCTGGTTGTCGC{CT}TCGGGTGT{CT}GGAGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACACG{CT}GAGCACGCTCTGCTTGCTTTCAC{CT}CTGGGTGTGAAGCAGATGATTGTGGCCAT{CT}AACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATTAAGGCTGAGGTCACCAC{CT}TACCTGAAGAAGGTTGGCTACAAACCCGCCAAGATCCCGTTCGTGCC{CT}AT{CT}TCCGGCTGGGAGGGTGACAACATGATTGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACCTTACCTTCTCGAGGCTCTTGACACCCTGAACGCCCCCAAGCGTCCCTCGGACAAGCCTCTGCGTCTTCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTTGGCCGTGTCGAGACCGGTGTTATTAAGCCGGGCATGATCGCCACTTTCGGCCCCGT{GT}GGTCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTCTCCC{CT}GGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCG{CT}CGTGGATTCGT{CT}GCTTCGGACTCCAAGAACGACCCTGC{CT}AAGGG{AT}ACGCAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCT{CT}GA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCCGGAAAGGTGACTCAGTGCTGGACGTCGTCCGCAAGGAGGCGGAGAGCTGTGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGAGGTACTGGTTCCGGTATGGGAACGCTTTTGATTTCCAAGATTCGTGAAGAGTACCCAGACCGTATCATGTGCACATACTCTGTGTGTCCGTCGCCCAAAGTGTCAGACACAGTTGTGGAGCCCTACAACGCCACCCTCTCTGTACACCAGCTTGTCGAAAACGCTGATGAAGTCATGTGCCTGGATAACGAGGCCTTGTACGACATTTGCTTCCGTACGCTTAAGCTCACCACCCCTACGTACGGTGACCTGAACCACTTGGTGTGTGCTGCCATGTCCGGCATCACCACGTGTCTGCGTTTCCCTGGTCAGTTGAACTCGGACTTGCGAAAGCTGGCTGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAACTGACCCAACAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGCCGTTATTTAACTGCCGCGTGTATGTTCCGCGGGCGTATGAGTACGAAGGAAGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCAAGTGTGTGTGACATCCCGCCGGACTGAAGATGAGCACCACATTCATTGGTAACTCCACCGCTATCCAAGAGATGTTCAAGCGTGTGTCTGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAAGGTATGGACGAG Phytophthora_pseudosyringae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGCTTTACTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACTGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGTTTTTAAACCATTTTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAAGTGTCTTGCGAATTCGATTGGTGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCTGTCGGCGACCTTTGCTGTGGCGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAACGGCTTATTGGATGTTCTTCTTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACGGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACTGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACCATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTACGACCCTTCTGGTGGGGGAGATCCTGTATTATATCAAGGTCATCGACGCCCCTGG{AC}CACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGCGTGAAGCAGATGGTCGTCGC{CT}ATCAACAAGATGGACGACTCCTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCCGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGTCAAGATCCCCTTCGTGCCCATCTCCGGATGGGAGGGAGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCGCTTGACAAGCCCCTCCGTCTGCC{CT}CTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGCGTGGAGACCGGTGTCATCAAGCCTGGCATGATCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCTCACGTTGCCTGTAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCATCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGACGAGGTCATGTGCCTTGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCTATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTTCGTAAGCTTGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_pseudotsugae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTAATCCCTGAGTTGCTGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGCCTGAGCTAGTAGCTTTTAAACCATCTTATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGATGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGAGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCTAGCAAGTTGGCGACCTTTGCTGCGGCGGAAGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGATTTTTCTGCTGTGGCGTCGGTGAACCAGCTTGGCTTTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGGGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATATACAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCTATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGG{CT}ACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTT{CT}ACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTC{CG}GGCTGGGAGGGTGACAACATGATCGACCGCTCCTCCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGT{CT}GGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGC{CT}TCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCAGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAAGGTATGGACGAG Phytophthora_psychrophila TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGCTTTACTGCGCTCGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACTGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGTTTTTAAACCATTTTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATG{CT}CTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAAGTGTCTTGCGAATTCGATTGGTGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAA{AG}TGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGTGGCGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAACGGCTTATTGGATGTTCTTCTTGCTGTGGCGTTGGTGAACCGGCTTGGC{CT}TTTGAATGCTTTGCTGCGATAGAGTGGGCTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTGTATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTTTTTCTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCATTAATGATTGGTGCACCCGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCAGGAACAGGTTGGACAGTTTATCCACCTTTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACGGCATTTCTTTTATTATTAACTTTACCAGTATTAGCGGGTGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAAGGTCATCGACGCTCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGCGTGAAGCAGATGGTCGTCGCCATCAACAAGATGGACGACTCCTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCCGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGTCAAGATCCCCTTCGTGCCCATCTCCGGATGGGAGGGAGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGCTTGACAAGCCCCTCCGTCTGCC{AC}CTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGCGTGGAGACCGGTGTCATCAAGCCTGGCATGATCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTTGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTTCGTAAGCTTGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_ramorum TAGTACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGTGT{AG}TGCTTGTTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTACTGTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGTCTGAGCTAGTAGTTTTTAAACCATCTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGTCAGACGTGAAGTGTCTTGTTGGTTCGGCGGGCGAGTCCTTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAATGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAACGGCTTATTGGATGCTTTTTCTGCTGTGGCGATGGTGAACCGGCTTGGCTTTTGAATACGGTGTTGCGATAGAGTGGGGTTCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACCTTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATCATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCAGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCGGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGAGCTGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGCGGAGGTGATCCTGTGTTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTCGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGC{CT}CGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACACGCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCG{CT}CTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGAC{CT}GGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCCGGCGCAACGCCGGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGGTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCTGGTATGGGCACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCCTGGATAACGAGGCGCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCTATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGGAAGCTGGCGGTGAACTTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCAAAGAACATGATGTGCGCCGCCGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGA{CT}GAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGCCTGAAGATGAGCACTACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGACGAG Phytophthora_sansomeana TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGCTTTTAAACCATCTAAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCGCTGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGTGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGG{CG}GTGAAGCAGATGATCGT{CG}GCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGAT{CT}CCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAATGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAA{CT}GACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCGAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTCGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGAC{CT}TGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCG{CT}GGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_sansomeana_CH95PHG7 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGCTTTTAAACCATCTAAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCGCTGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGTGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACTGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTCCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGTTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCGAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTCGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGTGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_sansomeana_CH95PHG8 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGCTTTTAAACCATCTAAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCGCTGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGTGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACTGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTCCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGTTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGCGCACGTACTCCGTGTGCCCGTCCCCGAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGCTTCGCCCCGCCGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGGACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_sansomeana_NBRC_31624 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGCTTTTAAACCATCTAAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCGCTGGTGAACCGGCTTGGCGTTTGAACGTGGTGTTGCGATAGGGTGTGTCTTGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAATGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCGAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTCGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGTGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_sojae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGGATCATGAGTTTTTAAACCATTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAGGTGTCTTGGTGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCATCTGGTGGGGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTTGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGG{AC}CCCTACCTCCTTGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCCGCTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTAT{CT}GGCACGGTACCGGTCGGCCGTGT{GT}GAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTT{CT}AACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCTAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGT{GT}ATCGTGCTGAACCACCGGCCGCACTGCCCGTGCT{CG}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCG{CT}TCGGGCAAGGTGACTCGGTTCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTCGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACCCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATTACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGCGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG 'Phytophthora sojae Pm-1' TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCGAGAACTGGATCATGAGTTTTTAAACCATTTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAGGTGTCTTGGTGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGCGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCATCTGGTGGGGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGCCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTTGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCCGCTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTTAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGCTCGGGCAAGGTGACTCGGTTCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTCGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACCCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATTACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGCGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_sp._kelmania TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGTTTTTAAACCATCTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGATCGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCTTTGGTGAACCGGCTTGGCTTTTGAACGCGGTGTTGCGATAGGGTGTGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGCACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCAC{CG}TCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTC{GT}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTC{CT}GGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCTCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_sp._kelmania_GF433 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTGGCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTATGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGTTTTTAAACCATCTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGATTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCTTTGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGTGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCCTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCAGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTGCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGCCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTAAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCTTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_sp._kelmania_GF543 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGTTTTTAAACCATCTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGATCGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCTTTGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGTGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCTGGCGCAACGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCAGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCTATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGTGTGTGTGACATCCCGCCGGGCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_sp._kelmania_GF649 TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGGGCTAGTAGTTTTTAAACCATCTAATACTGAAATACTGTGGGGAC{AGT}AAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGATCGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGCTTTGGTGAACCGGCTTGGCTTTTGAACGTGGTGTTGCGATAGGGTGTGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGCATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCTCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAG Phytophthora_syringae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGAGAGTGTGTGTGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGCGTGGTGCTGCGTGTGCTTGTTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGTGCTTTAGCTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGGCCTGAGCTAGTAGTTTTTAAACCATTTAATACTGAAAAACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGATGCCAGACGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTTAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTTTATATGGTTGTGGCTGCCGGCAAGTCGGCGACCTTTACTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGATGGCTTCGGCTGAACAGCTTATTGAGTACTTTTCCTGCTGTGGTGCTGGTGAACCGGCTTGGCTTTTGAACGCGATGTTGCGATAGAGTGAGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACGGCACACGCATTTATAATGGTTTTCTTCTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATTGGTGCTCCAGATATGGCCTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCTGCAATTGTAGAATCTGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCCGGTCACCGCGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGG{CT}GTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGC{CT}CTGCTCGCCTTCACGCTGGG{AC}GTGAAGCAGATGATCGT{CG}GC{CT}ATCAACAAGATGGACGACTCGTC{CT}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACCACCTACCTGAAGAAGGT{CG}GGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGATGGGAGGGCGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACAGCCTGAACGCCCCCAAGCGCCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACCGGTGTCAT{CT}AAGCCTGGCATGATGGCCACCTTCGGCCCCGTGGG{AT}CTGACCACGGAAGT{CT}AAGTCCGT{CT}GAGATGCACCACGAGTCCCTGGCCGAGGCCACCCCCGGTGACAACGTCGGATTCAACGTCAAGAACGTTTCCGTCAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCCAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGAT{CT}GTGCTGAACCACC{CT}GGCCAAACGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTG{CT}AAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCCGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAAGCCGAGAGCTGTGACTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGAGGCGGTACCGGGTCCGGTATGGGAACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTCTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCCTGGACAATGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGCTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGGTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCTGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATTCCGCCGGCCTGAAGATGAGCACGACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAAGGTATGGACGAG Phytophthora_tentaculata TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGGAGTGTGTGCGTGCGTGTCTATGGCAGTTTTTCTGCGCTTGGCGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCATGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTTGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGTCCTATCGCGAGGTCTGAGCTAGTAGATTTTAAACCATCTTATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTTCTTCCTGTAGTCGGTGGGGAGATGTCAGATATGAAGTGTCTTGTTGGTTCGGCGAGTGAGTCCTTTTAAATGTACAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGCTGTTGGCCAATTGGCGACCTTTGCTGCGGCGGAAGAGTGCTTGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGGTGTTTATCCTGCTGTGGCGTTGGTGAACCAACTTGGCCTTTGAATGCTTTGCTGCGATAGAGTGGACTTCGGTCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTGGGAACAACATTATCTCTTTTAATTAGGATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCGTTAATTGGTGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCTCGTATGAACAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCAATTACTATGTTATTAACTGATAGAAACTTAAATACTTCTTTCTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGC{CT}GATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTC{AC}AAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCAC{CT}CTGGGTGT{CG}AA{AG}CAGATGATCGTCGCCAT{CT}AACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGA{AG}GAGATCAAGTCTGAGGTCACCAC{CG}TACCTGAAGAAGGT{CT}GGCTACAAGCCCGCCAAGATCCC{AG}TTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCCTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCC{AC}CTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGG{AC}CGTGTGGA{AG}ACCGGTGT{CG}ATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGT{CT}TGTCGACTGAAGTCAAGTCCGT{CT}GAGATGCACCACGAGTCT{CT}TGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTT{CT}GTCGCTTCGGACTCCAAGAACGACCCGGC{CT}AAGGGCACCCAGGACTTCACCGCCCAGGT{GT}AT{CT}GTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTCGACGTCGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTATACGACATTTGTTTTCGCACGCTGAAGCTTACCACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCTGGTCAGTTGAACTCGGACTTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCTCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTACCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAAGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGACTGAAGATGAGCACCACGTTCATCGGTAACTCTACTGCTATCCAGGAGATGTTTAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAG Phytophthora_trifolii TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAATGTGTGCGTGCGTGTCTTTGGCAGTTTTTCTGCGCTGGGCGTGGTGCTGCGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGTGCTTTAGCTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGAGCTCTATCGCGAGGCTTGGGCTAGTAGCTTTTAAACCATCTAATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGATGTGAAGTGTCTTGCTGGTTCGGCGGGCGAGTCCTTTGAAATGTACAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCATGTCGGCGACTTTTGCTGCAGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGCTTATTGGGTGCTTTTCCTGCTGTGGTATTGGTGAACCGGCTTGGCGTTTGAACGCGGTGTTGCGATAGGGTGTGTTCCGGCCGTCGATTTGGGAAATGTCTTAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTGTTGGTACAACATTATCCCTTTTAATCCGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACTGTTTACCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCACAGATTACCCTTATTCGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTACTAACATTACCGGTATTAGCTGGAGCAATTACTATGCTGCTAACTGATAGAAATTTAAATACTTCGTTTTATGACCCATCAGGTGGAGGTGATCCAGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCGTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCAC{CG}ACGTACCTGAAGAAGGT{CT}GGCTACAAACCCGC{CT}AAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGAGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCGCTTGACACCCTGAACGCTCCCAAGCGTCCCAG{CT}GACAAGCCTCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCTGGTGACAACGTTGGCTT{CT}AACGTCAAGAACGTGTCGGTGAA{AG}GAGCTGCGTCGTGGTTTCGT{CT}GCTTC{GT}GACTCGAAGAACGACCCCGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACC{CT}GGCGCAACGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACACACTCACTCGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACGACATGCCTACGTTTCCCGGGTCAGCTGAACTCAGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGGGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCATGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAAGAGATGTTCAAGCGAGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAAGGTATGGATGAG Phytophthora_uliginosa TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGCTTTTTTGCGCTCGGTGCGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTTGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCTCTATCGCGAGAACTGAGCCAGTAGCTTTTAAACCATTTGATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGGGACGCCAGACGTGAGGTGTCTTGTCGGTTCGGTGCGCAAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGACGTTCTTCCTGCTGTGGCGCCGGTGAACCGGCTTGGCTTTTGAACGCGGTGTCGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATCGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCGGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCGGGGGGGGGGGATCCGGTATTATATCAAGGTCATCGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTC{CG}GG{CT}GTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGG{CT}CAGGCCCGTTACGAGGAGATCAAGAGCGA{AG}GTGTCGACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGCCCGTACCTCCTTGAGGCTCTCGACAACCTGAACCC{CG}CCCAAGCGCCCGTCGGACAAGCC{CT}CTGCGTCTGCCCCTCCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAA{CT}GACCCGGCCAAGGCCACCCAGGACTTCATGGCCCAGGTCATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACAC{AG}GCCCACGTCGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTCGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTCCGTTTCCCCGGCCAGCTGAACTCAGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCACGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCGAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAAGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytophthora_vignae TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGGAGTGTGCGCGTGCGTGTCTGTGGCAGTTTTTCTGCGCTCGGTGTGGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTGTCGCCGTTCCCACACTAAAATTCCACGTGACCGTCTTGGGGGCCCTATCGCAAGAACTAGATCATGAGTTTTTAAACCATTTGATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCTGTAGTCGGTGGGGAGACGCCAGACGTGAGGTGTCTTGGCGGTTCGGTGCGCGAGTCCCTTGAAATGTACGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGCTGCCGGCCAGTCGGCGACCTTTGCTGCGGCGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACGGCTTATTGGATGCTTTTCCTGCTGTGGCGTTGGTGAACCGGCTTGGCTTTTGAACGTGGTGTTGCGATAGGGTGGGCTTCGGCCGTCGATTTGGGAACTGTCTGAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTCTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTATTGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACATCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGG{CT}GTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTC{GT}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGGT{CT}GACAAGCC{CT}CTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTAT{CT}GGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGT{CT}GCCTCGGACTC{CT}AAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTTGACGTTGTCCGAAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAATGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACGTACGGTGACCTAAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCTCTGACGGTGCCCGAGCTTACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAG Phytopythium_vexans TAGTACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCATGGCGAATTGTAGTCTATGGATGCGTTATCAGTGCAGCCGCGCGGGCCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCCTGCCTGTGCGTGTGTGCGTACGATGCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGGTCGTTGCCAGTGTCTATAATCTGCGGCATATTTCATTGTGGATGCGGCCGTGCGGCGGTTTGGTAGTCGTCCTGCACC--GCGTGTTGCTGTGTGTGTTTGGTGGTGCCCTGTGCTGTGGTGGGACGTCAGAGTCAGTTCGTATGCTGCGGGAAATGGCTGCTGGGGAGGTAGGTCGGGGGTTCGCCCTCGGCTGTTATATCCTGGTGGACTAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGAGGTTTCTTCGTTTGCGCGTCGGTTGGATAGCTTGCTATGCAGTTGGCGTTGTGTGCGGATGGATGTCTTTGCTAACTGTTGCCGTTCCCACACTTTCATTCCACGTGACCGTTTCGAGTGCTCCATCGCGTGCTTGGCATTTTGAACTTTTAAACCATTTGAAACTGAGATACTGTGGGGACGAAAGTCCTCGCTTTGACTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAACTTTTGAACGCATATTGCACTTTCGGGTTACCCCTGGAAGTATGTCTGTATCAGTGTCCGTACACTAAACTTGCGTCTCTTCCGTCCTGTAGTCCTCGGGTTTGATTCAGATGTGAGGTGTCTCGTATATTTGGAGGGCGAGTCCCTTTAAACGGACGTGTTTTTCCTTTTGTGCTTGATGGGTGGGTGTGGCCGTGTCTGCTGACGGGTCGGTGACCTTTGCGATGGCAGTGGATTGCTCGATTTGCGGTATGTTAGGCTTCGGCTTGACGGCTTATTGGGTGTTTCGCTTGCTGTTGCTTGGGTGAGCTGGGTTGGTGGGTGCGTTTGCTGGTTTCATTGAGTGCGTTTCGGTCGTCGATTTGGGAATTGATCTAATCATAAAGATAATGGTACTTTATATTTAATTTTTGGTGCTTTTTCAGCAATAGTTGCAACAGTAATGTCAGTATTAATTAGAATTGAATTAGCACAGCCAGGTAATCAAATCTTTATGGGAAACCATCAAGTATATAATGTTATGATTACAGCACACGGTTTATTAATGATATTTTTTGTGGTTATGCCTATATTAGTTGGTGGTTTTGGTAACTGGTTTGTACCTATAATGGTAGGAGCACCTGATATGGCTTTTCCTCGTTTAAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTACTATTAGTATCTTCTGCTTTAGTTGAATCAGGTGCAGGTACTGGTTGGACAGCTTATCCACCTTTATCAAGTGTAGCTGCACACTCAGGACCTTCGATAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTGTTACTATTTTTAATATGAGAGCTCCTGGATTAAGTATGCATAGAATGCCTTTATTTGTATGGTCTCTTTTAATTACAGCTTTTCTTTTAGTTATAACTTTACCAGTATTTTCAGGTTCAATAACTATGTTATTAACTGATAGAAATTTTAATACTTCTTTTTATGATCCTGCAGGAGTAGGAGATCCAGTATTATTCCAAGGTGATCGACGCTCCGGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTTGTGGTTGCGTCGGGTGTTGGCGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACGCTCGGCGTGAAGCAGATGATCGTTGCGATCAACAAGATGGACGACTCGTCGGTGATGTACGGCGAGGCTCGTTACACGGAGATCAAGAACGAGGTGACTGCTTACCTGAAGAAGGTTGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCTATTTCGGGCTGGGAGGGCGACAACATGATTGAGCGCTCGAGCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCGCTCGACAGCCTGAACGCGCCTAAGCGTCCGTCGGACAAGCCGCTCCGTCTGCCGCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTTGAGACGGGTGTGCTGAAGCCTGGCATGGTTGCGACGTTCGGCCCTGTGGGTCTGTCGACGGAAGTGAAGTCTGTGGAGATGCACCACGAGTCGCTGCCGGAGGCTGTCCCGGGTGACAACGTTGGCTTCAACGTGAAGAACGTGTCGGTGAAGGAGCTCCGCCGTGGCTTCGTTGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGGCTGACTTCACGGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCGTCCGGTGCTCGACTGCCACACGGCCCACGTTGCTTGCAAGTTCAAGGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGTGACTCGGTGCTGGACGTTGTCCGGAAGGAGGCGGAGAGCTGCGATTGCCTCCAGGGTTTCCAGATCACGCACTCGCTCGGCGGTGGTACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGCGAGGAGTACCCGGACCGTATTATGTGCACGTACTCGGTGTGTCCGTCGCCGAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTCTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGACAACGAGGCTCTGTACGACATTTGCTTCCGTACGCTCAAGCTGACGACCCCGACGTACGGTGACCTCAACCACCTTGTGTGCGCTGCGATGTCGGGCATCACGACCTGTCTGCGATTCCCCGGTCAGCTGAACTCTGACCTCCGGAAGCTGGCTGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGGTTCGCGCCGCTGACGTCGCGCGGCTCGCAGCAGTACCGTGCTCTGACCGTTCCGGAGCTGACCCAGCAGCAGTTCGACGCGAAGAACATGATGTGCGCCGCGGATCCTCGCCACGGTCGTTACCTGACCGCCGCGTGTATGTTCCGTGGCCGCATGAGCACGAAGGAGGTGGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGTGTGTGTGACATTCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGCAACTCGACTGCGATTCAGGAGATGTTCAAGCGCGTCTCGGAGCAGTTCACGGCGATGTTCCGCCGCAAGGCCTTCTTGCACTGGTACACGGGCAGGGCATGGATGAG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M25154] TITLE Phytophthora_COX1; LINK TAXA = Taxa3; DIMENSIONS NCHAR=623; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phytophthora_bisheria GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCATTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTGATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCAGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_boehmeriae GTATTGTTGGTACAACATTCTCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATAATGGTATTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCGGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCATTATTATTATTAGTTTCATCTGCTTTAGTTGAATCAGGTGCAGGTACCGGTTGGACAGTTTATCCACCTTTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATATCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_botryosa GTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCGATTACTATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_brassicae GTATTATTGGTACAACATTATCCCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGGGCACCTGATATGGCATTTCCGCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTGGCAATCTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCCCCGGGTTTAAGTTTCCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACGGCTTTCCTTTTATTATTAACTTTACCTGTTTTTGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACGTCTTTTTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_cactorum GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATATACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGGGGTGATCCAGTATTATATCAA Phytophthora_cajani GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACGGCACATGCTTTTATCATGGTTTTCTTTCTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAA Phytophthora_cambivora GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGAGCAATTACAATGTTATTGACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGGGGAGATCCTGTACTATATCAA Phytophthora_capsici GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAA Phytophthora_captiosa GTATCGTTGGTACAACATTTTCACTTTTAATTAGGATGGAATTAGCACAACCAGGTAACCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCCTTAATAGGTGGATTCGGTAATTGGTTTGTACCTTTAATGATTGGAGCTCCAGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCGCCCTCATTATTATTATTAGTTTCATCTGCTTTAGTTGAATCAGGTGCTGGTACCGGTTGGACAGTATATCCACCTTTATCGAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCGGGTTTAAGTTTTCATAGATTACCTCTATTTGTATGGTCTGTATTAATTACAGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTTAATACATCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_cinnamomi GTATAGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATCTTAATGGGAAATCATCAATTATATAATGTAATTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCAATTGTTGAGTCTGGTGCAGGTACAGGTTGGACAGTTTATCCACCTTTATCAAGTGTTCAAGCACACTCTGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCCGGTTTAAGTTTTCATAGATTACCATTATTTGTATGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGGGGTGATCCAGTATTATATCAA Phytophthora_clandestina GTGTTGTTGGGACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCTCGTATGAATAATATAAGCTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCGGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_colocasiae GTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCTCACTCAGGTCCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTCTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_cryptogea GTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_cuyabensis GAATTGTGGGTACAACTTTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCCTTTATCATGGTATTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATAGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTCTTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCACAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_drechsleri GTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCGGGTGCCGGTACCGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACGTCTTTTTATGATCCATCAGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_erythroseptica GTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_europaea GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTGTTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACGGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACAATGTTATTGACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGGGGAGGAGATCCTGTACTATATCAA Phytophthora_fallax GTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAACTTGCACAACCGGGTAATCAAATTTTAATGGGGAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTCTTTTTAGTTATGCCTGCCTTAATAGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATTGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCCTTAGTTGAATCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCTAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGGATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCGGGTGCAATTACAATGTTATTAACTGATAGAAATTTTAATACATCTTTTTATGACCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_foliorum GTATTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATAATGGTTTTTTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCCTTTCCACGAATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCGGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCCTTTCTTTTATTATTAACATTACCCGTTTTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCATCTGGGGGGGGTGATCCAGTATTATATCAA Phytophthora_fragariae GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTATTTGGTCTGTATTAATTACAGCATTTCTTTTATTACTAACTTTACCGGTATTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGGGGAGATCCAGTACTATATCAA Phytophthora_glovera GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATCTTTATGGGAAATCATCAATTATATAATGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACGGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGGCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAA Phytophthora_gonapodyides GTATTGTTGGTACAACCTTATCACTTTTAATCCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGAAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTGTCATCAGCTATTGTCGAATCTGGTGCTGGGACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCATCATTATTGGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCACAGATTACCCCTATTTGTTTGGTCTGTGTTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGTGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCGTTTTACGATCCATCTGGAGGAGGTGATCCGGTATTATATCAA Phytophthora_gregata GTATTGTTGGTACAACTTTATCACTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTATTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGGGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTAGCAAGTGCACAAGCACACTCAGGACCTTCCGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTGTTAGCAGGTGCTATTACAATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGACCCATCCGGTGGGGGAGATCCCGTATTATATCAA Phytophthora_hedraiandra GTGTTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_hedraiandra_MAFF_235099 GTGTTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCGAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCCGTATTATATCAA Phytophthora_heveae GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCACCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTACGATCCTTCTGGTGGAGGAGATCCAGTATTATATCAA Phytophthora_hibernalis GTATTGTTGGTACAACTTTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCCCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTCGTTCCTTTAATGATAGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCCGCTTTATTATTATTAGTATCATCAGCTATTGTGGAATCTGGAGCAGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCGGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTTTTAGCAGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCCTCTGGAGGTGGTGATCCCGTATTATATCAA Phytophthora_humicola GTATTGTTGGTACAACTTTATCACTTTTAATTCGAATGGAATTAGCACAACCGGGTAATCAAATTTTTATGGGGAATCATCAATTATATAATGTTATTGTTACAGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_idaei GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTGATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATCACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGTGATCCAGTATTATATCAA Phytophthora_ilicis GTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTGGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCGCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCATTAATGATTGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCCGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACAATGTTGTTAACCGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_infestans GTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTATTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_insolita GTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACACGCTTTTATTATGGTATTCTTTTTAGTTATGCCTGCATTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCTGGTATTTCTTCTTTATTAGGTGCTATCAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCATTATTTGTTTGGTCTGTTTTAATTACAGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTCTATGATCCTTCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_inundata GTATTGTTGGTACAACTTTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTATTGTTACAGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCAAGTGTACAGGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGGGGTGATCCTGTATTATATCAA Phytophthora_ipomoeae GTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAGTTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACGGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCGGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTATGATCCATCAGGTGGAGGTGATCCCGTATTATATCAA Phytophthora_iranica GTGTTGTTGGGACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_katsurae GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCATCATTATTAGGTGCTATTAACTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_kernoviae GTATTGTTGGTACAACATTTTCACTTTTAATTCGTATGGAATTATCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTCTTAGTTATGCCTGCTTTAATTGGTGGCTTTGGTAATTGGTTTATTCCTTTAATGATAGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCATCAGCTTTAGTTGAATCAGGTGCGGGTACAGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCGGTAGATTTAGCTATTTTTAGTTTACATTTATCCGGAATGTCTTCACTGTTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATTTTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCATTTTATGATCCTTCAGGCGGAGGTGATCCGGTATTATATCAA Phytophthora_macrochlamydospora GTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTAATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTATATCCACCTTTATCAAGTGTTCAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCAATTAATTTCATATCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCAGGTGGGGGGGATCCAGTATTATATCAA Phytophthora_meadii GTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTATTGTTACTGCTCACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGGGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATATCATCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_megakarya GTGTTGTAGGTACAACTTTATCTCTATTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAATTATATAATGTTGTAGTTACTGCTCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAGGCACACTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCTTCAGGTGGTGGAGATCCTGTATTATATCAA Phytophthora_megasperma GTATTGTTGGTACAACCTTATCACTTTTAATCCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTCCCACGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCGTTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCCGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCCTTTCTTTTATTATTAACATTACCCGTATTAGCTGGTGCCATTACCATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCTGGGGGGGGGGATCCAGTATTATATCAA Phytophthora_melonis GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAA Phytophthora_mexicana GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_multivesiculata GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAGTTATCTCAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTTTTTCTAGTTATGCCTGCTTTAATTGGCGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTCCCTCGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACCTTACCTGTATTAGCTGGTGCAATTACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGAGGAGATCCTGTATTATATCAA Phytophthora_multivora GTGTTGTTGGTACAACATTATCTTTATTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACATTCTGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCTACTATTTATAATATGCGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCAGGAGGAGGTGATCCTGTATTATATCAA Phytophthora_multivora_NBRC_31016 GTGTTGTTGGTACAACATTATCTTTATTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACATTCTGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCTACTATTTATAATATGCGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCAGGAGGAGGTGATCCTGTATTATATCAA Phytophthora_nemorosa GTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTTTTTT?AGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCCTTAATGATTGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGAACAGGTTGGACAGTTTATCCACCTTTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTGGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCAGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_nicotianae GTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_nicotianae_GF468 GTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_nicotianae_MAFF_235794 GTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_niederhauserii GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_niederhauserii_CH96HE1 GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_niederhauserii_CH96HE2 GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_palmivora GTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAA Phytophthora_palmivora_GF534 GTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAA Phytophthora_parvispora GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCAATCGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGCGTTCAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCCATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_phaseoli GTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATAGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCGGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTGCCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_pistaciae GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTCTATGATCCATCAGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_porri GTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAACTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCTATTGTTGAATCGGGTGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCGGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCGATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATTTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_primulae GTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTAGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCCGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCAATTGTTGAATCCGGCGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATCTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGCTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_pseudosyringae GTGTTGTAGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACGGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACTGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACCATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTACGACCCTTCTGGTGGGGGAGATCCTGTATTATATCAA Phytophthora_pseudotsugae GTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGGGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATATACAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCTATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_psychrophila GTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTGTATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTTTTTCTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCATTAATGATTGGTGCACCCGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCAGGAACAGGTTGGACAGTTTATCCACCTTTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACGGCATTTCTTTTATTATTAACTTTACCAGTATTAGCGGGTGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_ramorum GTATTGTTGGTACAACCTTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATCATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCAGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCGGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGAGCTGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGCGGAGGTGATCCTGTGTTATATCAA Phytophthora_sansomeana GTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sansomeana_NBRC_31624 GTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sansomiana_CH95PHG7 GTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACTGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sansomiana_CH95PHG8 GTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACTGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sojae GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCATCTGGTGGGGGTGATCCAGTATTATATCAA 'Phytophthora sojae Pm-1' GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCATCTGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_sp_kelmania GTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sp._kelmania_GF433 GTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCCTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCAGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sp._kelmania_GF543 GTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sp._kelmania_GF649 GTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_syringae GTATTGTTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACGGCACACGCATTTATAATGGTTTTCTTCTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATTGGTGCTCCAGATATGGCCTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCTGCAATTGTAGAATCTGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_tentaculata GTGTTGTGGGAACAACATTATCTCTTTTAATTAGGATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCGTTAATTGGTGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCTCGTATGAACAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCAATTACTATGTTATTAACTGATAGAAACTTAAATACTTCTTTCTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_trifolii GTATTGTTGGTACAACATTATCCCTTTTAATCCGAATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACTGTTTACCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCACAGATTACCCTTATTCGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTACTAACATTACCGGTATTAGCTGGAGCAATTACTATGCTGCTAACTGATAGAAATTTAAATACTTCGTTTTATGACCCATCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_uliginosa GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATCGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCGGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCGGGGGGGGGGGATCCGGTATTATATCAA Phytophthora_vignae GTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTCTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTATTGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAA Phytopythium_vexans CAATAGTTGCAACAGTAATGTCAGTATTAATTAGAATTGAATTAGCACAGCCAGGTAATCAAATCTTTATGGGAAACCATCAAGTATATAATGTTATGATTACAGCACACGGTTTATTAATGATATTTTTTGTGGTTATGCCTATATTAGTTGGTGGTTTTGGTAACTGGTTTGTACCTATAATGGTAGGAGCACCTGATATGGCTTTTCCTCGTTTAAATAATATTAGTTTTTGGTTATTACCACCATCTTTATTACTATTAGTATCTTCTGCTTTAGTTGAATCAGGTGCAGGTACTGGTTGGACAGCTTATCCACCTTTATCAAGTGTAGCTGCACACTCAGGACCTTCGATAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTGTTACTATTTTTAATATGAGAGCTCCTGGATTAAGTATGCATAGAATGCCTTTATTTGTATGGTCTCTTTTAATTACAGCTTTTCTTTTAGTTATAACTTTACCAGTATTTTCAGGTTCAATAACTATGTTATTAACTGATAGAAATTTTAATACTTCTTTTTATGATCCTGCAGGAGTAGGAGATCCAGTATTATTCCAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24037] TITLE Phytophthora_combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1714; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phytophthora_bisheria GACTCGGTGCTTGATGTCGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGCTCCGGTATGGGTACGCTTCTTATCTCGAAGATCCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCATCAGCTGGTTGAGAACGCCGATGAGGTTATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACCACCCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTAAACTCTGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGCGCCCTCACGGTTCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGTGCTGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAAGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGG{CT}CAGACCCGCGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATTGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCAC{GT}TACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATTTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGGTTGACAAGCCGCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTGGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTCGGTCTGTCGACTGAAGTCAAGTCCGTGGAAATGCACCACGAGTCCCTGCCCGAGGCTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTTTCCGTCAAGGAGCTGCGTCGTGGTTT{CT}GTCGCTTCGGACTCCAAGAACGACCCCGCCAAGGGCACCCAGGACTTCACCGCCCA{AG}GTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_boehmeriae GACTCGGTGCTGGATGTCGTCCGGAAGGAGGCCGAGTCCTGCGATTGCCTGCAGGGTTTCCAGATTACCCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGAACGCTGCTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCCCCCAAGGTGTCGGACACTGTGGTGGAGCCTTACAACGCGACGCTATCTGTGCACCAGCTTGTGGAGAACGCCGATGAAGTTATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACCTACGGTGATCTGAACCACCTGGTGTGTGCCGCCATGTCCGGTATCACGACGTGCCTTCGATTCCCAGGCCAGCTGAACTCCGACCTGCGTAAGCTGGCTGTGAACTTGATCCCATTCCCGCGTCTTCACTTCTTTATGATCGGTTTCGCGCCGCTGACATCACGTGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCGGAGCTGACCCAGCAGCAGTTCGACGCGAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGTGGACGGATGAGCACGAAGGAGGTGGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCATACTTTGTGGAATGGATCCCGAACAACATCAAGGCTAGTGTGTGTGATATCCCGCCGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACCGCTATCCAGGAGATGTTCAAGCGCGTGTCTGAGCAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACAGGCAGGGTATGGATGAAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCCTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGACGACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGAGACAACATGATTGAGAAGTCCCCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTGGACAACCTGAACCCCCCCAAGCGTCCGTCCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTCGAGACTGGTGTGATCAAGCCGGGCATGATCGCCACCTTCGGCCCCGTGGGTCTGACCACGGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTGGCTTCGGACTCGAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACTGCTCAGGTCATTGTGCTGAACCACCTGGCGCAACGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAAATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_botryosa GACTCAGTGCTTGATGTCGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACTGTGGTGGAGCCCTACAACGCCACGTTGTCGGTACACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTACGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACTACGTGTCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGTTGGCTGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAACAGTTCGATGCCAAGAACATGATGTGTGCCGCTGATCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGTGGACGGATGAGCACGAAGGAGGTCGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAGAGGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCAGATGATTGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACGACCTACCTGAAGAAGGTTGGTTACAAGCCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGATCGACCGTTCCTCCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACAACCTGAACCCCCCCAAGCG{CT}CCGTCGGACAAGCCCCTCCGTCTTCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGT{CT}AAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTTCCGGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_brassicae GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGAGGTACTGGTTCCGGTATGGGAACGCTTTTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCTCCCAAGGTGTCAGACACGGTTGTGGAGCCCTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCTGATGAAGTCATGTGCCTGGATAACGAGGCCTTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGCATCACCACCTGTCTGCGTTTCCCGGGTCAGTTGAACTCAGACTTGCGAAAGCTGGCCGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGTGTGTGTGACATCCCGCCGGACTGAAGATGAGCACTACATTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACAGGTAAGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCA{AG}GCTGATTGCGCCATTCTGGTTGTCGCCTCGGGTGTCGGCGAGTTCGAGGCTGGTATCTC{CT}AAGGAGGGCCAGAC{AG}CG{CT}GAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCA{AG}ATGATTGTGGCCAT{CT}AACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGA{AG}GTCACCACCTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCAT{CT}TCCGGCTGGGAGGGTGACAACATGATTGAGAAGTCTAGCAACATGCCGTGGTACAAGGGACC{GT}TACCTTCTCGAGGC{AT}CTTGACACCCTGAACGCCCCCAAGCGTCCCTCGGACAAGCCTCTGCGTCTGCC{CT}CTCCAAGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGT{CT}GGCCGTGT{CT}GAGACCGGTGTTATTAAGCCGGGCATGATCGC{CT}ACTTTCGGCCC{CT}GTGGGTCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCC{CT}GGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCTTCGGACTCCAAGAACGACCCCGC{CT}AAGGG{AC}ACGCAGGACTT{CT}ACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCT{AG}CCGGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCCGG{AC}AAGGT Phytophthora_cactorum GACTCAGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGGGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCCTGCACTGGTACACCGGGAAGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGCGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATTGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGATCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCTGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_cajani GACTCGGTGCTTGACGTTGTCCGAAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTCGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAATGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCAC{CG}CTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGGTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_cambivora GACTCGGTGCTGGACGTCGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTTGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATCGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGG{CT}CAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCCGAGGTGTCGACCTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTGGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCCACCCAGGACTTCCTGGCCCAGGTCATTGTGCTGAACCACCGGCCGCACTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_capsici GACTCGGTGCTTGATGTTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAAGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCATCGCCTAAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCCCACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACCACGTGTCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCCGAGCTGACCCAACAACAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACTGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGC{CT}GATTGCGCCATTCTGGTGGT{CT}GCTTCGGGTGTGGGTGAGTT{CT}GAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGC{CT}CTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGATTGACCGTTCCACCAACATGCCGTGGTACAAGGGACCTTACCTCCT{CT}GAGGCTCTTGACAACCTGAACGCCCC{CT}AAGCG{CT}CCGGTTGACAAGCCGCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGATTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_captiosa GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCGCTCGGTGGCGGCACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGCATCATGTGCACCTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCGTACAACGCGACGCTCTCGGTGCACCAGCTGGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACCACCCCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACGACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGTTTCGCCCCGCTCACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACTGTGCCGGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCGAACAACATCAAGGCGAGCGTGTGTGACATCCCGCCGGTCTGAAGATGTCGACCACGTTCATCGGTAACTCGACGGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAGAGGTCATTGACGCCCCCGGCCACCGCGACTTCATCAAGAACATGATTACGGGCACGTCGCAGGCTGATTGCGCCATCCTCGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCGCTGCTGGC{CT}TTCACGCTGGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGC{CT}GAGGTCAGCACGTACCTGAAGAAGGTGGGCTACAAGCCCGTCAAGATCCCGTTCGTGCCCATCTCCGGATGGGAGGGCGACAACATGATCGAGCGCTCTGGCAACATGCCGTGGTACAAGGGCCCGTTCCTGCTCGAGGCTCTGGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCCCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCTGGCATGGTCGCCACCTTCGGCCC{CG}GTCGGTCTGTCGACGGAAGTCAAGTCTGTCGAGATGCACCACGAGTCTCTGCCCCAGGCTGTCCCGGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGCACTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_cinnamomi GACTCGGTGCTCGATGTCGTCCGCAAGGAGGCGGAGAGCTGCGACTGCCTGCAGGGATTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCGACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGCCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGCTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGCAACTCCACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAGAGGTCATCGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCCGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACCCTGGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGCGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCGTACCTCCTTGAGGCTCTCGACAACCTGAACCCCCCCAAGCGCCCGGTTGACAAGCCGCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGT{GT}GAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGT{CG}AAGGAGCTGCGTCGTGGCTACGTGGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGTAAGGT Phytophthora_clandestina GACTCGGTGCTTGACGTCGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGCTTCCAGATCACGCACTCTCTTGGCGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCAGACACGGTTGTGGAGCCCTACAATGCTACGCTGTCGGTGCATCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTAAAGCTCACCACCCCCACCTACGGCGACCTTAACCACCTGGTTTGCGCTGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCTGGTCAGTTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGC{CT}CCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTACCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGTTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAGGTGGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACAGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGG{CT}ACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGA{AG}TTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACTCTGGGTGTGAAGCAGATGGT{CT}GTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGG{CT}CAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGT{GT}CCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCT{GT}GAGGC{CT}CTTGACAACTTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTTCAGGATGTTTACAAGATCGGCGG{GT}ATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGG{GT}CTGTCGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCTTCGGACTCCAAGAACGACCCTGCCAAGGGCACCCAGGACTTCACCGCCCAGGTTATCGTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCG{AT}TCGGGCAAGGT Phytophthora_colocasiae GACTCGGTGCTTGATGTCGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACTGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTATGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACTACGTGCCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGTTGGCTGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCTCCGTTGACCTCTCGTGGATCTCAGCAGTACCGTGCCCTCACGGTTCCTGAGCTGACCCAGCAACAGTTCGATGCCAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAAAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACTGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAGAGGTCATTGACGCCCCTGGTCACCGTGATTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGATTG{CT}GCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCAGATGATTGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTC{GT}GAGGTCACGACCTACCTGAAGAAGGTTGGTTACAA{AG}CCGGCCAAGATCCCGTTCGTGCC{CT}ATCTCCGGATGGGAGGGTGACAACATGATCGACCGTTCCACCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTGGACAACCTGAACCC{CT}CCCAAGCGTCCGTC{CG}GACAAGCC{AC}CTCCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGT{CT}AAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCAC{CG}CAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTTCCGGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGG{CT}AAGGT Phytophthora_cryptogea GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCAAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGTTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACAACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGTACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAAAGGTCATTGACGCTCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCCGGATGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCTCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCAT{CT}AAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGGCGGAGGCTCTCCCTGG{CT}GACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATTGTGCTCAACCACC{CT}GGCGCAACGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_cuyabensis GACTCGGTGCTGGATGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTACAGGGATTCCAGATCACCCACTCGCTCGGTGGCGGTACCGGCTCTGGTATGGGCACGCTTTTGATCTCCAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCTACGCTGTCGGTCCACCAGCTGGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACTACCCCCACCTACGGTGACCTGAATCACCTAGTGTGCGCCGCCATGTCGGGTATCACAACGTGCCTGCGTTTCCCGGGCCAGCTGAACTCGGACCTGCGTAAGCTGGCTGTGAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGTTTCGCTCCGTTGACGTCGCGTGGATCGCAGCAGTACCGTGCTCTGACCGTCCCGGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTTCAGAACAAGAATTCCTCGTACTTCGTGGAGTGGATTCCTAACAACATCAAGGCTAGCGTGTGTGACATTCCGCCGGCTTGAAGATGTCCACGACGTTCATTGGTAACTCAACGGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAATTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATCCTGGTCGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCTCGTTACGACGAGATCAAGAACGAGGTGACCACGTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGCGACAACATGAT{CT}GAGCGCTCGACCAACATGCCGTGGTACAAGGGACCTTACCTCCT{CT}GAGGCTCTTGACAACCTGAACCCCCCCAAGCGCCCGGTCGACAAGCCGCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCTACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCTGTCGAGATGCACCACGAGTCGCT{GT}CC{CT}GAGGCTGTGCCCGGTGACAACGTTGGCTTCAACGTGAAGAACGTGTCGGTGAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_drechsleri GACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTATCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCAC{CG}TCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCAC{CG}ACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATTGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGAC{CT}GGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGT{CT}GAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCGGTGCTTGACTGCCACACGGC{CT}CACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_erythroseptica GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCAAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACAACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGTACCACTTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAAAGGTCATTGACGCTCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCCGGATGGGAGGGTGACAACATGAT{CT}GAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCTCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCAT{CT}AAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTC{CT}GTTGAGATGCACCACGAGTCTCTGGCGGAGGCTCTCCCTGGCGACAACGTCGGTTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATTGTGCT{CG}AACCACC{CT}GGCGCAACGCCCGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_europaea GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAATGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAAGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGCTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCAT{CT}GACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGAC{CG}CGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTC{AG}TCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAGCGAGGTGTCCACCTACCTGAAGAAGGTCGGCTACAAGCCCGC{CT}AAGATCCCGTTCGTGCCCAT{CT}TCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCC{AG}TCGGACAAGCC{AC}CTCCGTCTGCCCCTCCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGT{CT}ATTAAGCCTGGCATGGTCGCCACGTTCGGCCCTGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCCGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCCACCCAGGACTTCCTGGCCCAGGTCATTGTGCTGAACCACCGGCCGCACTGCCCGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_fallax GACTCGGTGCTTGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCGCTCGGTGGCGGTACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGCATCATGTGCACCTACTCGGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCGTACAACGCGACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGCCTGGATAACGAGGCCTTGTACGACATTTGCTTCCGCACGCTGAAGCTCACCACCCCTACCTATGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACGACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATCGGGTTCGCCCCGCTCACGTCGCGTGGCTCACAGCAGTACCGTGCCCTAACGGTGCCGGAGTTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTCCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCGAACAACATCAAGGCGAGCGTGTGTGACATCCCGCCGGCCTGAAGATGTCGACCACGTTCATCGGTAACTCGACGGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAGAAGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACGTCGCAGGCTGATTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGC{GT}CT{AG}CTGGCCTTCACGCT{CT}GGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTC{CG}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGC{CT}GAGGTCAGCACGTACCTGAAGAAGGT{CG}GGCTACAAGCCCGTCAAGATCCCGTTCGTGCCCATCTCCGGATGGGAGGGCGACAACATGATCGAGCGCTCGACCAACATGCCGTGGTACAAGGGACCGTTCCTCCTCGAGGCT{CT}TGGACCTCCTGAACGCCCCCAAGCG{CT}CCGAGCGACAAGCCCCTGCGTCTGCC{CT}CTCCAGGA{CT}GTGTACAAGATCGGCGGTATCGGCACGGTACC{GT}GTCGGCCGTGTCGAGACGGGTGTGATCAAGCCTGGCATGGTCGCCACCTTCGGCCCGGTCGGTCTGTCGACGGAAGTCAAGTCTGTCGAGATGCACCACGAGTCTCTGCC{CG}GAGGCTGTCCCGGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCC{GT}GCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGCACTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTG{CT}AAGTTCAAAGAGATCAC{GT}GAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_foliorum GACTCGGTGCTCGACGTCGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGGTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGAATGGGTACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCCTGGATAACGAGGCTCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCCACCTACGGCGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGATTTGCGGAAGCTGGCGGTGAACTTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCGGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGGCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATCGAAAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACAACCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCCCTGCGTCTGCCTCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTGGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCGAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCTGGTGCAACGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_fragariae GACTCGGTGCTGGACGTCGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACCACGTGCCTCCGTTTCCCCGGCCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAAGGTATGGACGAGAGGTCATCGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGGTCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCCGAGGTGTCGACCTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACTGTACCTCCTCGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCCG{AT}CGGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCC{CG}GAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGT{CG}TCGGTCAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCCACCCAGGACTTCCTGGCCCAGGTCATTGTGCTGAACCACCGGCCGCACTGCCGGTCCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_glovera GACTCGGTGCTTGATGTTGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCATCGCCCAAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCCCACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACCACGTGTCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTTTTTATGATTGGTTTCGCCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCCGAGCTGACCCAACAGCAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACCGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGATGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCTGATTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGAT{CT}GTTGCCATCAACAAGATGGA{CT}GACTCGTC{CT}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTTGGCTACAA{AG}CCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGAT{CT}GACCG{CT}TC{CT}ACCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACA{AG}CCTGAACGCCCC{CT}AAGCGTCCGTCTGACAAGCCTCTTCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACTGGTGTCAT{CT}AAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_gonapodyides GACTCGGTGCTTGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGCTCCGGCATGGGCACGCTTCTTATTTCCAAGATCCGTGAAGAGTACCCGGATCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCAACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACCACGTGCCTGCGTTTCCCGGGCCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCGGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGACGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTGGATGAACAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCAAGCGTGTGCGACATCCCGCCGGCCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCCGACTGCGCCATTCTGGTGGTTGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCAC{CG}ACCTACCTGAAGAAGGTCGGCTACAAGCC{CT}GCCAAGATCCCGTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATTGACCGTTCGGCCAACATGCCGTGGTACAAGGGACCCTTCCTCCTCGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCC{CG}TCGGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTCATCAAGCCCGGCATGGTCGCCACCTTCGGCCCCGT{CG}GGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCT{CT}TGCCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCTAAGGCCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCATTGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_gregata GACTCGGTGCTCGATGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGCGGTGGTACCGGCTCGGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTA{CT}AACGCCACGCTGTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGAATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTAACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGCCTCAAGATGAGCACCACGTTCATCGGCAACTCGACCGCCATCCAGGAGATGTTTAAGCGCGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACCACCTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATTGACCGTTCGGCCAACATGCCGTGGTACAAGGGACCCTTCCTCCTCGAGGCTCTTGACAGCCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTCATCAAGCCCGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCTACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCATCGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_hedraiandra GACTCAGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCATCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTAAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAAGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACCGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_hedraiandra_MAFF235099 GACTCAGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTAAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAAGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACGGAAGTTAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTTCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACCGAGAAGATGGACCGTCGTTCGGGTAAGGT Phytophthora_heveae GACTCGGTGCTTGACGTCGTCCGTAAGGAGGCTGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATTTCCAAGATCCGAGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCGACGTTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGTATCACGACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAATCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTTACGGTGCCCGAGCTGACCCAGCAGCAATTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCCCCGGTCTCAAGATGAGCACCACGTTCATTGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCCTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCCTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATCGACCGCTCCAGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCCCTCGACAACCTGAACCCCCCCAAGCGCCCGCTCGACAAGCCGCTGCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_hibernalis GACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTGCAAGGGTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGCTCCGGAATGGGCACGCTCCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACATACTCCGTGTGCCCGTCGCCCAAGGTGTCGGACACCGTCGTGGAGCCCTACAACGCCACACTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCGCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGGTTCCCCGGTCAGCTGAACTCGGACCTGCGGAAACTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGCTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTCAAGATGAGTACCACGTTCATCGGTAACTCGACCGCTATCCAGGAAATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTGGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGGCCGTTACGAGGAGATCAAGGCCGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCGGGCTGGGAGGGAGACAACATGATTGAGAAGTCTAGCAACATGCCGTGGTACAAGGGACCGTACCTTCTCGAGGCGCTCGACTCCCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTTAAGAACGTGTCGGTGAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCCGTGCT{AG}GACTGCCACACGGCCCACGTTGCGTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_humicola GACTCGGTGCTTGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCTGACACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGCTTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACCACGTG{CT}CTGCGATTCCCCGGTCAGCTGAACTCGGATCTGCGTAAGCTAGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCCCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGTCACGGCCGTTATTTAACTGCAGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAAATGCTGAATGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCCAGCGTGTGTGACATTCCGCCGGACTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCACTGCTTGCCTTCACGCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCCTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATCGACCGCTCGGCGAACATGCCGTGGTACAAGGGACCCTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTTCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCCACCTTCGGCCCCGTGGGTCTGTCCACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCGCTGGCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCATCGAGAAGATGGACCGTCGTTCGGGCAAGAT Phytophthora_idaei GACTCGGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAAGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGG{CT}AC{CT}TCGCAAGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGG{AC}CAGAC{GT}CGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_ilicis GACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGAACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTTGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTTCGTAAGCTTGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCATTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGC{CG}TTCACCCTGGGCGTGAAGCAGATGGTCGT{CT}GCCATCAACAAGATGGACGACTCCTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCCGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGTCAAGATCCCCTTCGTGCCCATCTCTGGATGGGAGGGAGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGCTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGCGTGGAGACCGGTGTCATCAAGCCTGGCATGATCGCCACGTTCGGCCC{CT}GTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGA{CT}TTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTG{CT}AAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_infestans GACTCGGTGCTTGACGTCGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCCGTCGCCCAAGGTATCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGACAATGAGGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCCACTTATGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATTACCACGTGCCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCATGGCCGCTATTTAACTGCAGCTTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACTGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAA{AG}AACATGATTACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATG{AG}TCGTCGCCAT{CT}AACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCC{CT}ATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGTC{GT}GACAAGCCGCTGCGTCTGCCCCTTCAGGA{CT}GTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTC{CT}GTCGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTC{CG}AAGAACGACCCTGCTAAGGCAACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGG{CT}CGGCCTGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTT{CT}AAAGAGATTACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_insolita GACTC{GT}GTGCTGGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTG{CT}CCGTCCCC{CT}AAGGTCTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAA{CT}GAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACCACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGTATCAC{CT}ACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGATCTGCGTAAGCTGGCTGTCAACCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGC{AG}CCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGT{AG}CCGGAGCTGACGCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGTGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAATGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGACATCCCGCCGGTCTGAAGATGTCCACGACGTTCATCGGTAACTCTACGGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAAAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTCGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACGCTCGGCGTGAAGCAGATGATCGT{CT}GCCATCAACAAGATGGACGACTCTTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACGACCTACCTGAAGAAGGTGGGCTACAAGCC{AG}GCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGTGACAACATGATTGACCGCTCCAC{CT}AACATGCCGTGGTACAAGGGACCCTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCGATTGACAAGCCGCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCTACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCGAAGAACGACCCTGC{CT}AAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_inundata GACTCGGTGCTTGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCTGACACCGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGACGAGGTCATGTGCTTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCC{CT}ACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGATCTGCGTAAGCTAGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACGTCCCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGTCACGGCCGTTATTTAACTGCAGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAAATGCTGAATGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCCAGCGTGTGTGACATTCCGCCGGACTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTC{CT}AAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCCTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATCGACCGCTCGGCGAACATGCCGTGGTACAAGGGACCCTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTTCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCCACCTTCGGCCCCGTGGGTCTGTCCACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCGCTGGCGGAGGCTGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCCTCGGACTCCAAGAACGA{CT}CCGGCCAAGGCCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCTTGCAAGTTCAAAGAGATCATCGAGAAGATGGACCGTCGTTCGGGCAAGAT Phytophthora_ipomoeae GACTCGGTGCTTGACGTCGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTTATGTGCCTGGACAATGAGGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCCACTTATGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATTACCACGTGCCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCAGCTTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACTGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTC{AG}CAGGCCGATTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGAT{CT}GTCGCCAT{CT}AACAA{AG}ATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAA{AG}ATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTC{CG}ACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGTCGGACAAGCCGCTGCGTCT{GT}CCCCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTT{CT}GGCCCCGT{GT}GGTCTGTC{GT}ACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCC{GT}GAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTT{CT}GTCGCTTCGGACTC{CT}AAGAACGACCCTGCTAAGGCAACCCAGGACTTCACCGCCCAGGTGATTGTGT{CT}GAACCACCGGCCGGCCTGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATTACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_iranica GACTCGGTGCTCGACGTCGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCTGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAATGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTAAAGCTCACCACCCCCACGTACGGCGACCTAAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCTGGTCAGTTAAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCTCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTACCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACCACGTTCATTGGTAACTCTACTGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAAGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGT{AG}GTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGC{AC}ATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGT{CT}GGCTACAAGCCCGCCAAGAT{CT}CCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACCCCCCCAAGCGCCCAAGCGACAAGCCTCTGCGTCTGCCCCTTCAGGATGTTTA{CT}AAGATCGGCGGTAT{CT}GGCACGGTACC{GT}GT{CG}GGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGT{CT}AAGTCCGT{CT}GAGATGCACCACGAGTCT{CT}TGCCTGAGGC{CT}GTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTC{CG}GACTC{CT}AAGAACGACCC{CT}GCTAAGGGCACCCAGGACTTCACCGCCCAGGTTATCGTGCTGAACCACCGG{CT}CGGCCTGCCCGTGCTTGATTGCCACACGGCCCACGTTGCCTGCAAGTT{CT}AAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_katsurae GACTCGGTGCTTGACGTCGTCCGTAAGGAGGCTGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGCACGCTTCTTATTTCCAAGATCCGCGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCTTACAACGCGACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGTATCACGACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAATCTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTTACGGTGCCCGAGCTGACCCAGCAGCAATTCGATGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATTGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCCTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCCTTCGTGCCCATCTCGGGCTGGGAGGG{CT}GACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCCCTCGACAACCTGAACCCCCCCAAGCGCCCGGTCGACAAGCCGCTGCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCCGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_kernoviae GACTCGGTGCTGGACGTCGTCCGTAAGGAGGCCGAGTCCTGCGATTGCCTGCAGGGTTTCCAGATTACCCACTCCCTTGGTGGTGGTACCGGTTCCGGTATGGGAACGCTTCTAATCTCCAAGATTCGTGAAGAGTACCCAGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCCCCCAAGGTGTCGGACACTGTGGTGGAGCCTTACAACGCGACACTTTCCGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACACTCAAGCTCACGACCCCCACCTATGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCTGGTATCACAACGTGCCTGCGTTTCCCCGGTCAGCTCAACTCTGACCTGCGTAAGCTGGCTGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCGCCGCTGACGTCGCGTGGATCGCAGCAGTATCGCGCCCTGACGGTGCCGGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCTCGTCATGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGGATGAGCACGAAGGAGGTGGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCTTCATACTTCGTGGAGTGGATCCCGAACAACATCAAGGCTAGTGTGTGTGATATCCCGCCGGCCTGAAGATGAGCACCACGTTCATCGGTAACTCTACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGATGAGACGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATCCTGGTGGTCGCTTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCTTTCACTCTTGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCTTCGGTGATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACCACGTACCTGAAGAAGGTTGGTTACAAACCCGCTAAGATCCCGTTCGTGCCCATCTCTGGATGGGAGGGAGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCGTACCTCCTCGAGGCTCTGGACACCCTGAACGCCCCCAAGCGTCCGTCCGACAAGCCTCTCCGTCTTCCCCTCCAGGACGTTTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTCGAGACTGGTGTGATCAAGCCGGGCATGATCGCTACCTTCGGCCCCGTGGGTCTGTCCACGGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCTCTCCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTTGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCTCAGGTGATTGTGCTGAACCACCTGGCGCAACTCCGGTGCTTGACTGCCACACGGCCCACGTTGCGTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCG{CT}TCGGGCAAGGT Phytophthora_macrochlamydospora GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGCTTCCAGATCACCCACTCGCTGGGTGGCGGCACTGGCTCCGGTATGGGCACGCTTCTGATCTCCAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTCTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAAGTCATGTGCCTGGACAACGAGGCTCTGTACGATATCTGCTTCCGTACGCTCAAGCTGACCACCCCCACGTACGGCGACCTGAACCACCTCGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGCCAGCTCAACTCGGACCT{AG}CGTAAGCTGGCCGTCAACCTGATCCCGTTCCCGCGTCTGCACTTCTTCATGATTGGCTTCGCGCCGCTCACGTCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGTTATTTAACTTGCTCGTGCATGTTCCGCGGACGCATGAGCACGAAGGAGGTGGATGAGCAGATGCTGAACGTTCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTCAAGATGTCCACGACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGCATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCCGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACGCTGGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACTCGCAGTCCCGCTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGAGACAACATGATTGAGCGCTCTACCAACATGCCGTGGTACAAGGGCCCGTTCCTGCTCGAGGCCCTCGACAACCTCAACGCGCCCAAGCGCCCGGTCGACAAGCCGCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCCGGCATGGTCGCTACCTTCGGCCCTGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTGCCCGGCGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGCACTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_meadii GACTCGGTGCTTGATGTCGTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGCTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCTGGTATGGGTACGCTTCTTATCTCGAAGATCCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACTGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTTGTCGAGAACGCTGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTACGGTGACCTGAACCACTTGGTGTGCGCTGCCATGTCCGGTATCACTACGTGCCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGTTGGCTGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAACAGTTTGATGCCAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGGATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAATTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAGAGGTCATTGACGCTCCTGGTCACCGTGA{CT}TTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCTTTCACCCTGGGTGTGAAGCAGATGAT{CT}GT{CT}GCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACGACCTACCTGAAGAAGGTTGGTTACAAGCCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGATCGACCGTTCCACCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTGGACAACCTGAACGCCCCCAAGCGTCCGTCTGACAAGCCCCTCCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGA{CT}TTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCT{GT}CCGGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_megakarya GACTCGGTGCTGGACGTCGTCCGTAAGGAGGCAGAGAGCTGTGACTGTCTGCAGGGTTTCCAGATCACACACTCGCTCGGTGGTGGCACTGGTTCTGGTATGGGAACGCTCCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCGTACAACGCGACGCTGTCAGTGCACCAGCTGGTCGAAAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTATACGACATTTGCTTCCGTACACTGAAGCTCACGACTCCCACGTACGGTGACTTGAACCACTTGGTGTGCGCTGCCATGTCTGGTATCACCACGTGCCTCCGTTTCCCGGGTCAGTTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACTTCGCGTGGCTCGCAGCAGTACCGTGCCTTGACGGTCCCTGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCTGCCGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACTGCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAAAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGATTGCGCCATCCTTGTGGTGGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGAGACAACATGATCGACCGCTCCA{CG}CAACATGCCGTGGTACAAGGGACCTTACCTCCT{CT}GAGGCCCTCGACAACCTGAACGCCCCCAAGCGCCCGTCGGACAAGCCGCTCCGTCTGCCCCTTCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_megasperma GACTCGGTGCTCGACGTCGTCCGCAAGGAAGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGCGGTGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCGAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCATCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCGGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCTCGTCTCCACTTCTTCATGATCGGTTTCGCCCCATTGACGTCGCGCGGCTCGCAGCAGTACCGTGCCTTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCGCGCCACGGCCGCTATTTAACTGCCGCCTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATTAAGGCTAGCGTGTGTGACATCCCGCCGGCCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAGCAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATCACGGGTACCTCGCAGGCTGACTGCGCCATTCTGGTCGTCGCCTCGGGTGTGGGTGAGTTTGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACGACCTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGTGACAACATGATCGAGCGCTCCACTAACATGCCGTGGTACAAGGGACCCTTCCTTCTTGAGGCTCTTGACCTGCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACGGGTGTGATCAAGCCTGGCATGATCGCCACCTTCGGCCCTGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGGCCGAGGCTCTTCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCTTCGGACTCCAAGAACGACCCGGCCAAGGCCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCATCGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_melonis GACTCGGTGCTTGACGTTGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACTGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCATCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACTACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGGTTGACAAGCCTCT{CT}CGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCTTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGTCGCACTTCCTGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_mexicana GACTCGGTGCTTGATGT{CT}GTCCGTAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCTCTTGGTGG{CT}GGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGA{AG}GAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCATCGCC{CT}AAGGTGTCGGACACCGTTGTGGAGCCTTACAACGCTACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTG{CT}CTGGATAACGA{AG}GCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTTACTACTCC{AC}ACTTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACCACGTGTCTGCGTTTCCCCGGTCAGTTGAACTCGGACCTGCGTAAGCTGGCCGT{AG}AACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGTTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCCGAGCTGACCCAACAACAGTTCGATGCTAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTTTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGAC{CT}GCCATTCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGG{CT}AGGGTATGGATGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGC{CT}GATTGCGCCATTCTGGTGGT{CT}GCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTTGG{CT}TACAAGCCGGCCAAGATCCCGTTCGTGCCTATCTCCGGCTGGGAGGGTGACAACATGATTGACCG{CT}TCCACCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCC{CT}AAGCG{CT}CCG{AG}TTGACAAGCCGCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACTGGTGTCAT{CT}AAGCC{AT}GGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGATTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_multivesiculata GACTCGGTGCTTGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATCCGCGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACCGTTGTGGAGCCCTACAATGCCACGTTGTCAGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAATGAGGCCCTGTACGACATTTGCTTCCGTACGCTTAAGCTCACCACCCCCACCTACGGTGACCTGAATCACCTGGTGTGTGCCGCCATGTCTGGTATCACCACGTGTCTGCGTTTCCCTGGTCAGCTGAACTCGGATCTGCGTAAGCTGGCCGTGAATCTGATTCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACATCGCGTGGCTCGCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAATTCGTCGTACTTCGTGGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCTCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACTTCGCAGGCCGATTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTGGCCATCAACAAGATGGATGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCGGAGGTCACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATTGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCCCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTCGGTCTGTCGACTGAAGTTAAGTCCGTGGAGATGCACCACGAATCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCTAAGGCTACCCAGGACTTCACGGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_multivora GACTCGGTGCTTGATGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACTCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACCGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTACGGTGACCTGAACCATCTGGTGTGCGCCGCCATGTCTGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCGCTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACGTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTA{CT}GGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATTTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_multivora_NBRC31016 GACTCGGTGCTTGATGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACTCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACCGTCGTGGAGCCCTACAACGCCACGTTGTCGGTGCACCAGCTGGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAAGCCCTGTACGATATTTGCTTCCGTACGCTGAAGCTCACCACGCCCACCTACGGTGACCTGAACCATCTGGTGTGCGCCGCCATGTCTGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCGCTGACCTCGCGTGGATCTCAGCAGTACCGTGCCCTCACGGTGCCTGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCATCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATTCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACGTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTTGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCGGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCCATTTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTGGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_nemorosa GACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCACTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTTGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTTCGTAAGCTTGCAGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATCGACGCCCC{CT}GG{AC}CACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGCGTGAAGCAGATGGTCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCCGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGTCAAGATCCCCTTCGTGCCCATCTCCGGATGGGAGGGAGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTGGACAACCTGAACGCCCCCAAGCGCCCGCTTGACAAGCCCCT{CG}CGTCT{GT}CCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGCGTGGAGACCGGTGTCATCAAGCCTGGCATGATCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGC{CT}TCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTG{CT}AAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_nicotianae GACTCGGTGCTCGACGTCGTCCGTAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTATCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTTACCACTCCCACCTACGGTGACCTGAACCACCTCGTGTGTGCCGCCATGTCTGGTATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCTGCTTGTATGTTCCGTGGACGTATGAGCACAAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTTGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGG{CT}CAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGC{CT}AAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGG{CT}CCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCCCCTAAGCGCCCGGTTGACAAGCCGCTGCGTCTTCCCCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCCGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_nicotianae_GF468 GACTCGGTGCTCGACGTCGTCCGTAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTATCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTTACCACTCCCACCTACGGTGACCTGAACCACCTCGTGTGTGCCGCCATGTCTGGTATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCTGCTTGTATGTTCCGTGGACGTATGAGCACAAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTTGTGGTGGCCTCGGGTGTTGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGTCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCTAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCCCCTAAGCGCCCGGTTGACAAGCCGCTGCGTCTTCCTCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCCGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_nicotianae_MAFF235794 GACTCGGTGCTCGACGTCGTCCGTAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTATCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGTCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTTACCACTCCCACCTACGGTGACCTGAACCACCTCGTGTGTGCCGCCATGTCTGGTATCACCACGTGCCTGCGATTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCTGCTTGTATGTTCCGTGGACGTATGAGCACAAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTA{AG}GGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGCCGACTGCGCCATCCTTGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCTCTGCTTGCCTTCACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCCCCTAAGCGCCCGGTTGACAAGCCGCTGCGTCTTCCTCTCCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCTGAGGCCGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_niederhauserii GACTCGGTGCTAGACGTTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTCCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGC{CT}GACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTC{CT}GGCTGGGAGGGTGACAACATGATCGAGAAGTC{ACG}GGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGC{CT}CT{CT}GACAACCTGAACCCGCCCAAGCGCCCGTCCGACAAGCCCCT{CG}CGTCTGCCCCTCCAGGA{CT}GTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTC{CT}GTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGT{CT}AAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_niederhauserii_CH96HE1 GACTCGGTGCTAGACGTTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTCCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGTCCGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_niederhauserii_CH96HE2 GACTCGGTGCTAGACGTTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTCCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGTCCGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_palmivora GACTCAGTCCTGGATGTCGTCCGTAAGGAGGCAGAGAGCTGTGACTGTCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATTTCTAAGATTCGTGAGGAGTATCCCGATCGTATCATGTGCACGTACTCGGTGTGCCCATCGCCTAAGGTGTCGGACACCGTCGTGGAGCCTTACAACGCTACGCTGTCGGTCCACCAGCTCGTCGAGAACGCTGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACTTGAACCACCTGGTGTGTGCTGCCATGTCCGGCATCACCACGTGCCTTCGTTTCCCAGGTCAATTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACTTCTCGTGGCTCACAGCAGTACCGTGCTCTGACGGTGCCTGAGCTGACCCAACAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTCGATGAGCAGATGCTCAATGTGCAGAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACCACGTTCATTGGTAACTCGACTGCCATCCAGGAGATGTTCAAGCGTGTATCCGAACAGTTCACAGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGAGAGGGTATGGATGAGGGTCATTGACGCCCCTGGCCACCGTGATTTCATCAAGAACATGATCACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGTGACAACATGATTGACCGCTCCAGCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCTAAGCGTCCGGTTGACAAGCCGCTCCGTCTGCCTCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGT{CT}GGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_palmivora_GF534 GACTCAGTCCTGGATGTCGTCCGTAAGGAGGCAGAGAGCTGTGACTGTCTGCAGGGTTTCCAGATCACCCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATTTCTAAGATTCGTGAGGAGTATCCCGATCGTATCATGTGCACGTACTCGGTGTGCCCATCGCCTAAGGTGTCGGATACCGTCGTGGAGCCTTACAACGCTACGCTGTCGGTCCACCAGCTTGTCGAGAATGCTGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACTTGAACCACTTGGTGTGTGCTGCCATGTCCGGCATCACCACGTGCCTTCGTTTCCCGGGTCAATTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACTTCTCGTGGCTCACAGCAGTACCGTGCTCTGACGGTGCCTGAGCTGACCCAACAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTCGATGAGCAGATGCTCAACGTGCAAAACAAGAACTCATCGTACTTCGTTGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGTCTGAAGATGAGCACCACGTTCATTGGTAACTCGACTGCTATCCAGGAGATGTTCAAGCGTGTATCCGAACAGTTCACAGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGAGAGGGTATGGATGAGGGTCATTGACGCCCCTGGCCACCGTGATTTCATCAAGAACATGATCACGGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCTATCTCGGGCTGGGAGGGTGACAACATGATTGACCGCTCCAGCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCTAAGCGTCCGGTTGACAAGCCGCTCCGTCTGCCTCTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTGGGTCTGTCGACGGAAGTTAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_parvispora GACTCGGTGCTCGACGTCGTGCGCAAGGAGGCCGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTCGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCTAAGATCCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGTCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGACAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTGAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCTGGCCAGCTGAACTCGGACCTGCGTAAGCTCGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCTGACCCCCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCCACGGCCATCCAGGAGATGTTCAAGCGCGTGTCTGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGATGAGAGGTCATCGACGCCCCCGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGCGAGCACGCTCTGCTGGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGCGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGCCCTTACCTCCTCGAGGCTCTCGACAACCTGAACCCCCCCAAGCGCCCGGTCGACAAGCCGCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACCTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCGCTGCCCGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_phaseoli GACTCGGTGCTTGACGTCGTTCGCAAGGAGGCAGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGCATCATGTGCACATACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTATAACGCTACGCTATCGGTACACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGACAATGAGGCCCTGTACGACATTTGCTTCCGCACATTGAAGCTCACCACCCCCACTTATGGTGACCTGAACCACTTGGTTTGTGCCGCCATGTCCGGTATTACCACGTGCCTTCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGCAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTTATGATTGGTTTCGCTCCTCTGACATCGCGCGGCTCGCAGCAGTACCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACAGCCGCGTGTATGTTCCGCGGACGCATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCATACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACTACGTTCATTGGTAACTCTACTGCTATCCAAGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGAT{CT}ACCGGTACCTCGCAGGCCGATTGCGCCATTCTGGTGGTCGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTTCACTTTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTA{CT}GGCCAGGCCCGTTACGAGGAGATCAA{AG}TCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGAT{CT}CCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGTCTGACAAGCCGCTGCGTCT{AG}CC{CG}CTTCAGGATGTGTACAAGATCGGCGGTATTGGCACGGTACCTGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACTGAAGTCAAGTC{CT}GTCGAGATGCACCACGAGTCTCTGCC{GT}GAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCCAAGAACGACCCTGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATTACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_pistaciae GACTCGGTGCTTGACGTTGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGCGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACTACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCCGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGCGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCT{CT}GACAACCTGAACCCGCCCAAGCGCCCGGTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACATTTGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_porri GACTCGGTGTTGGATGTCGTCCGCAAGGAGGCTGAGAGCTGCGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGAGGTACTGGTTCCGGTATGGGAACGCTTTTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACATACTCCGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCTGATGAAGTCATGTGCCTTGATAACGAGGCCTTGTACGACATTTGCTTCCGCACGCTTAAGCTCACCACCCCCACGTACGGTGACCTGAACCACTTGGTGTGCGCCGCCATGTCCGGCATCACCACTTGTCTGCGTTTCCCGGGTCAGTTGAACTCGGACTTGCGAAAGCTGGCCGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAGCTGACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGTACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGACTGAAGATGAGTACAACATTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAGCAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGTAAGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGG{AT}ACCTCGCAGGCTGATTGCGCCATTCT{CG}GTTGTCGCCTC{AG}GGTGTCGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCG{CT}GAGCACGCTCTGCTTGCTTTCAC{CT}CTGGGTGTGAAGCAGATGATTGTGGCCATCAACAAGATGGACGACTCTTCTGT{CT}ATGTACGG{CT}CAGGCCCGTTACGAGGAGAT{CT}AAGGCTGAGGT{CT}ACCACCTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCAT{CT}TCCGGCTGGGAGGGTGACAACATGATTGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACC{GT}TACCTTCTCGAGGCTCTTGACACC{CT}TGAACGCCCCCAAGCGTCCCTCGGACAAGCCTCT{GT}CGTCTGCCCCT{CT}CA{AG}GA{CT}GTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACCGGTGT{CT}ATTAAGCCGGGCATGATCGCCACTTTCGGCCCCGT{GT}GGTCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCT{AC}CCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGATTCGTCGCTTC{CG}GACTCCAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGG{CT}CGGCCTGCC{AG}GTGCTTGACTGCCACACGGCCCACGT{CT}GCCTG{CT}AAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCCGG{AC}AAGGT Phytophthora_primulae GACTCAGTGCTGGACGTCGTCCGCAAGGAGGCGGAGAGCTGTGATTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGTGGAGGTACTGGTTCCGGTATGGGAACGCTTTTGATTTCCAAGATTCGTGAAGAGTACCCAGACCGTATCATGTGCACATACTCTGTGTGTCCGTCGCCCAAAGTGTCAGACACAGTTGTGGAGCCCTACAACGCCACCCTCTCTGTACACCAGCTTGTCGAAAACGCTGATGAAGTCATGTGCCTGGATAACGAGGCCTTGTACGACATTTGCTTCCGTACGCTTAAGCTCACCACCCCTACGTACGGTGACCTGAACCACTTGGTGTGTGCTGCCATGTCCGGCATCACCACGTGTCTGCGTTTCCCTGGTCAGTTGAACTCGGACTTGCGAAAGCTGGCTGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCTGAACTGACCCAACAGCAGTTCGACGCTAAGAACATGATGTGTGCCGCTGACCCTCGCCACGGCCGTTATTTAACTGCCGCGTGTATGTTCCGCGGGCGTATGAGTACGAAGGAAGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCTTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCAAGTGTGTGTGACATCCCGCCGGACTGAAGATGAGCACCACATTCATTGGTAACTCCACCGCTATCCAAGAGATGTTCAAGCGTGTGTCTGAGCAGTTCACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAAGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTAC{CT}TCGCAGGCTGATTGCGCCATTCTGGTTGTCGC{CT}TCGGGTGT{CT}GGAGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACACG{CT}GAGCACGCTCTGCTTGCTTTCAC{CT}CTGGGTGTGAAGCAGATGATTGTGGCCAT{CT}AACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATTAAGGCTGAGGTCACCAC{CT}TACCTGAAGAAGGTTGGCTACAAACCCGCCAAGATCCCGTTCGTGCC{CT}AT{CT}TCCGGCTGGGAGGGTGACAACATGATTGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACCTTACCTTCTCGAGGCTCTTGACACCCTGAACGCCCCCAAGCGTCCCTCGGACAAGCCTCTGCGTCTTCCCCTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTTGGCCGTGTCGAGACCGGTGTTATTAAGCCGGGCATGATCGCCACTTTCGGCCCCGT{GT}GGTCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTCTCCC{CT}GGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCG{CT}CGTGGATTCGT{CT}GCTTCGGACTCCAAGAACGACCCTGC{CT}AAGGG{AT}ACGCAGGACTTCACCGC{CT}CAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCT{CT}GA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCCGGAAAGGT Phytophthora_pseudosyringae GACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCATCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGACGAGGTCATGTGCCTTGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGCGACCTGAACCACCTGGTGTGCGCCGCTATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTTCGTAAGCTTGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATCGACGCCCCTGG{AC}CACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGCGTGAAGCAGATGGTCGTCGC{CT}ATCAACAAGATGGACGACTCCTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCCGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGTCAAGATCCCCTTCGTGCCCATCTCCGGATGGGAGGGAGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCGCTTGACAAGCCCCTCCGTCTGCC{CT}CTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGCGTGGAGACCGGTGTCATCAAGCCTGGCATGATCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCTCACGTTGCCTGTAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_pseudotsugae GACTCAGTGCTCGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACTACTCCCACCTACGGTGACTTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCTCGTCTCCACTTCTTTATGATTGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTATCGCGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGTTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCTCCGGTCTGAAGATGAGCACTACGTTCATCGGTAACTCTACTGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAAGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGG{CT}ACCTCGCAGGCCGACTGCGCCATCCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCTCTGCTTGCCTT{CT}ACTCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGTCTGAGGTCACCACGTACCTGAAGAAGGTTGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTC{CG}GGCTGGGAGGGTGACAACATGATCGACCGCTCCTCCAACATGCCGTGGTACAAGGGACCTTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACTGGTGTCATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCTGAGGCTGTCCCTGGTGACAACGT{CT}GGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGC{CT}TCGGACTCCAAGAACGACCCCGCTAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCTGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_psychrophila GACTCGGTGCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGCGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGATACCGTCGTGGAGCCCTACAACGCTACGCTCTCGGTGCACCAGCTGGTTGAGAACGCCGATGAGGTCATGTGCCTTGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTCTGTGCCGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTTCGTAAGCTTGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAATACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTCTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTCACGGCCATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATCGACGCTCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTCGGGCGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTCGCCTTCACCCTGGGCGTGAAGCAGATGGTCGTCGCCATCAACAAGATGGACGACTCCTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCCGAGGTGACGACCTACCTGAAGAAGGTGGGCTACAAGCCGGTCAAGATCCCCTTCGTGCCCATCTCCGGATGGGAGGGAGACAACATGATCGACCGCTCCGCCAACATGCCGTGGTACAAGGGACCGTACCTCCTCGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGCTTGACAAGCCCCTCCGTCTGCC{AC}CTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGCGTGGAGACCGGTGTCATCAAGCCTGGCATGATCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTTCGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGGCCTGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_ramorum GACTCGGTGCTCGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGGTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCTGGTATGGGCACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCCTGGATAACGAGGCGCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACCACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCTATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGGAAGCTGGCGGTGAACTTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGACGCAAAGAACATGATGTGCGCCGCCGACCCTCGTCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGA{CT}GAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGCCTGAAGATGAGCACTACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGCAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTCGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGC{CT}CGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACACGCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCG{CT}CTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGAC{CT}GGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGCGGCTTCGTCGCTTCGGACTCGAAGAACGACCCGGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCCGGCGCAACGCCGGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_sansomeana GACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCGAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTCGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGAC{CT}TGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCG{CT}GGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGG{CG}GTGAAGCAGATGATCGT{CG}GCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGAT{CT}CCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAATGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAA{CT}GACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_sansomeana_CH95PHG7 GACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCGAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTCGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGTGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTCCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGTTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_sansomeana_CH95PHG8 GACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATTTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGCGCACGTACTCCGTGTGCCCGTCCCCGAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGCTTCGCCCCGCCGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGGACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTCCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGTTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_sansomeana_NBRC31624 GACTCGGTGCTGGACGTTGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCGAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTCGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGTGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACCCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACGACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTCGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAATGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCTGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_sojae GACTCGGTTCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTCGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACCCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATTACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGCGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTTGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGG{AC}CCCTACCTCCTTGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCCGCTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTAT{CT}GGCACGGTACCGGTCGGCCGTGT{GT}GAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTT{CT}AACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCTAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGT{GT}ATCGTGCTGAACCACCGGCCGCACTGCCCGTGCT{CG}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCG{CT}TCGGGCAAGGT Phytophthora_sojae_Pm_1 GACTCGGTTCTCGACGTCGTCCGCAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTCCACCAGCTCGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACCCTGAAGCTCACGACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATTACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGCGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACCCAGCAGCAGTTCGATGCTAAGAACATGATGTGTGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGCCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTTGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTCGACAACCTGAACCCGCCCAAGCGCCCGCTTGACAAGCCCCTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTTAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGCTCGGGCAAGGT Phytophthora_sp_kelmania GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCTCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCAC{CG}TCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTC{GT}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTC{CT}GGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_sp_kelmania_GF433 GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCTACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTAAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCTTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCGGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTGCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGCCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_sp_kelmania_GF543 GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGATTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCAGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCTATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGTGTGTGTGACATCCCGCCGGGCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCTGGCGCAACGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_sp_kelmania_GF649 GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCCGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTGGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCTCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGTGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCGGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCGGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCACGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAGGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGCATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCGGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCACCACGTACCTGAAGAAGGTCGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGTCCCAGCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGTTTCGTCGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACCCGGCGCAACGCCGGTGCTCGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_syringae GACTCGGTGCTGGACGTCGTCCGCAAGGAAGCCGAGAGCTGTGACTGCCTGCAGGGATTCCAGATCACCCACTCGCTTGGAGGCGGTACCGGGTCCGGTATGGGAACGCTTCTGATCTCCAAGATCCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTGTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTCTCGGTGCACCAGCTTGTCGAGAACGCCGACGAGGTCATGTGCCTGGACAATGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACCACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGCTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTGGCCGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGGTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTCACCCAGCAGCAGTTCGACGCTAAGAACATGATGTGCGCTGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTGGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATTCCGCCGGCCTGAAGATGAGCACGACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGTGTGTCTGAGCAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAAGGTATGGACGAGAGGTCATTGACGCCCCCGGTCACCGCGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGG{CT}GTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGC{CT}CTGCTCGCCTTCACGCTGGG{AC}GTGAAGCAGATGATCGT{CG}GC{CT}ATCAACAAGATGGACGACTCGTC{CT}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGGCTGAGGTCACCACCTACCTGAAGAAGGT{CG}GGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATCTCCGGATGGGAGGGCGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACAGCCTGAACGCCCCCAAGCGCCCGTCGGACAAGCCTCTGCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTCGAGACCGGTGTCAT{CT}AAGCCTGGCATGATGGCCACCTTCGGCCCCGTGGG{AT}CTGACCACGGAAGT{CT}AAGTCCGT{CT}GAGATGCACCACGAGTCCCTGGCCGAGGCCACCCCCGGTGACAACGTCGGATTCAACGTCAAGAACGTTTCCGTCAAGGAGCTGCGTCGTGGCTTCGTCGCTTCGGACTCCAAGAACGACCCCGCCAAGGGCACGCAGGACTTCACCGCCCAGGTGAT{CT}GTGCTGAACCACC{CT}GGCCAAACGCCGGTGCT{CT}GACTGCCACACGGCCCACGTTGCCTG{CT}AAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCCGGCAAGGT Phytophthora_tentaculata GACTCGGTGCTCGACGTCGTTCGCAAGGAAGCTGAGAGCTGTGATTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGTGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCGAAGATTCGTGAGGAGTACCCCGATCGTATCATGTGCACATACTCGGTGTGCCCGTCGCCTAAGGTGTCGGACACGGTTGTGGAGCCCTACAACGCCACGCTGTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTATACGACATTTGTTTTCGCACGCTGAAGCTTACCACCCCCACCTACGGTGACCTGAACCACCTGGTGTGCGCTGCCATGTCCGGTATCACCACGTGCCTGCGTTTCCCTGGTCAGTTGAACTCGGACTTGCGTAAGCTGGCCGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTCGCTCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGCGCCCTGACGGTACCCGAGCTGACCCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCTGCTGACCCTCGTCACGGTCGCTATTTAACTGCCGCATGTATGTTCCGCGGACGTATGAGCACAAAGGAAGTTGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGATATCCCGCCGGACTGAAGATGAGCACCACGTTCATCGGTAACTCTACTGCTATCCAGGAGATGTTTAAGCGTGTGTCCGAACAGTTTACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACCGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACGGGTACCTCGCAGGC{CT}GATTGCGCCATTCTGGTGGTTGCTTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTC{AC}AAGGAGGGCCAGACCCGTGAGCACGCTCTGCTCGCCTTCAC{CT}CTGGGTGT{CG}AA{AG}CAGATGATCGTCGCCAT{CT}AACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGA{AG}GAGATCAAGTCTGAGGTCACCAC{CG}TACCTGAAGAAGGT{CT}GGCTACAAGCCCGCCAAGATCCC{AG}TTCGTGCCCATCTCTGGCTGGGAGGGTGACAACATGATCGACCGCTCCACCAACATGCCGTGGTACAAGGGACCCTTCCTCCTTGAGGCTCTTGACAACCTGAACGCCCCCAAGCGCCCGAGCGACAAGCCTCTGCGTCTGCC{AC}CTTCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGG{AC}CGTGTGGA{AG}ACCGGTGT{CG}ATCAAGCCTGGCATGGTCGCCACTTTCGGCCCCGTTGGT{CT}TGTCGACTGAAGTCAAGTCCGT{CT}GAGATGCACCACGAGTCT{CT}TGCCTGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGTTT{CT}GTCGCTTCGGACTCCAAGAACGACCCGGC{CT}AAGGGCACCCAGGACTTCACCGCCCAGGT{GT}AT{CT}GTGCTGAACCACCGGCCGGCCTGCCCGTGCTTGA{CT}TGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_trifolii GACTCGGTGCTGGACGTCGTCCGCAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACACACTCACTCGGTGGCGGTACCGGCTCCGGTATGGGCACGCTTCTTATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCCGTGTGCCCGTCCCCCAAGGTGTCGGACACGGTCGTGGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGCACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACTTGGTGTGTGCCGCCATGTCCGGTATCACGACATGCCTACGTTTCCCGGGTCAGCTGAACTCAGACCTGCGTAAGCTGGCGGTGAACCTGATTCCGTTCCCGCGTCTTCACTTCTTCATGATTGGTTTCGCCCCGCTGACCTCGCGTGGCTCGCAGCAGTACCGGGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCCAAGAACATGATGTGCGCCGCTGACCCTCGCCATGGTCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTCGATGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCTAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAAGAGATGTTCAAGCGAGTGTCCGAACAGTTTACGGCAATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACTGGCAAGGTATGGATGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCTGACTGCGCCATTCTGGTGGTCGCCTCGGGTGTGGGTGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACTCGTGAGCACGCCCTGCTCGCGTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTCAC{CG}ACGTACCTGAAGAAGGT{CT}GGCTACAAACCCGC{CT}AAGATCCCGTTCGTGCCCATCTCTGGCTGGGAGGGAGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCGCTTGACACCCTGAACGCTCCCAAGCGTCCCAG{CT}GACAAGCCTCTTCGTCTGCCCCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCTCTGCCGGAGGCTCTCCCTGGTGACAACGTTGGCTT{CT}AACGTCAAGAACGTGTCGGTGAA{AG}GAGCTGCGTCGTGGTTTCGT{CT}GCTTC{GT}GACTCGAAGAACGACCCCGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATTGTGCTGAACCACC{CT}GGCGCAACGCCGGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_uliginosa GACTCGGTGCTGGACGTCGTCCGTAAGGAGGCGGAGAGCTGTGACTGCCTGCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCCAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTGTCCGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGATAACGAGGCCCTGTACGACATTTGCTTCCGTACGCTCAAGCTCACGACCCCCACGTACGGTGACCTGAACCACCTGGTGTGCGCCGCCATGTCCGGTATCACCACGTGCCTCCGTTTCCCCGGCCAGCTGAACTCAGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCACGTCTCCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTGACGGTGCCCGAGCTGACGCAGCAGCAGTTCGATGCGAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAAGCTAGCGTGTGTGACATCCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGTAACTCGACCGCCATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATCGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACCTCGCAGGCCGACTGCGCCATCCTGGTGGTGGCCTC{CG}GG{CT}GTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTCTGTCATGTACGG{CT}CAGGCCCGTTACGAGGAGATCAAGAGCGA{AG}GTGTCGACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCCGGCAACATGCCGTGGTACAAGGGCCCGTACCTCCTTGAGGCTCTCGACAACCTGAACCC{CG}CCCAAGCGCCCGTCGGACAAGCC{CT}CTGCGTCTGCCCCTCCAGGATGTTTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGTCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCTGTCCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGTCGGTCAAGGAGCTGCGTCGTGGCTACGTCGCCTCGGACTCCAAGAA{CT}GACCCGGCCAAGGCCACCCAGGACTTCATGGCCCAGGTCATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTGGACTGCCACAC{AG}GCCCACGTCGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytophthora_vignae GACTCGGTGCTTGACGTTGTCCGAAAGGAGGCTGAGAGCTGTGACTGCCTTCAGGGTTTCCAGATCACGCACTCGCTTGGTGGCGGTACCGGTTCCGGTATGGGTACGCTTCTTATCTCCAAGATTCGTGAGGAGTACCCGGACCGTATCATGTGCACGTACTCGGTCTGCCCGTCGCCTAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCTACGCTGTCCGTGCACCAGCTTGTTGAGAACGCCGATGAGGTCATGTGCCTGGATAATGAGGCCCTGTACGACATTTGCTTCCGTACGCTGAAGCTCACGACCCCCACGTACGGTGACCTAAACCACCTGGTGTGCGCCGCCATGTCCGGCATCACCACGTGCCTGCGTTTCCCCGGTCAGCTGAACTCGGACCTGCGTAAGCTTGCCGTGAACCTGATCCCGTTCCCGCGTCTTCACTTCTTCATGATCGGTTTCGCCCCGCTGACGTCGCGTGGCTCGCAGCAGTACCGTGCTCTGACGGTGCCCGAGCTTACCCAGCAGCAGTTCGACGCCAAGAACATGATGTGCGCCGCCGACCCTCGCCACGGCCGCTATTTAACTGCCGCGTGTATGTTCCGCGGACGTATGAGCACGAAGGAGGTTGATGAGCAGATGCTCAACGTGCAGAACAAGAACTCGTCGTACTTCGTCGAGTGGATCCCCAACAACATCAAGGCTAGCGTGTGTGACATCCCGCCGGTCTCAAGATGAGCACCACGTTCATCGGTAACTCGACCGCTATCCAGGAGATGTTCAAGCGCGTGTCCGAACAGTTCACGGCTATGTTCCGTCGTAAGGCTTTCTTGCACTGGTACACGGGTAGGGTATGGACGAGAGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACATCGCAGGCCGACTGCGCCATTCTGGTGGTCGCCTCGGG{CT}GTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACCCTGGGTGTGAAGCAGATGATCGTCGCCATCAACAAGATGGACGACTCGTC{GT}GTCATGTACGGCCAGGCCCGTTACGAGGAGATCAAGAACGAGGTGTCCACGTACCTGAAGAAGGTCGGCTACAAGCCCGCCAAGATCCCGTTCGTGCCCATCTCCGGCTGGGAGGGTGACAACATGATCGAGAAGTCGGGCAACATGCCGTGGTACAAGGGCCCCTACCTCCTTGAGGCTCTTGACAACCTGAACCCGCCCAAGCGCCCGGT{CT}GACAAGCC{CT}CTCCGTCTGCCCCTCCAGGACGTGTACAAGATCGGCGGTAT{CT}GGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTTGGCCTGTCGACGGAAGT{CT}AAGTCCGTTGAGATGCACCACGAGTCCCTGCCGGAGGCCGTCCCCGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCGGTGAAGGAGCTGCGTCGTGGCTACGT{CT}GCCTCGGACTC{CT}AAGAACGACCCGGCCAAGGGCACCCAGGACTTCACCGCCCAGGTGATCGTGCTGAACCACCGGCCGCACTGCCCGTGCTTGACTGCCACACGGCCCACGTTGCCTGCAAGTTCAAAGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT Phytopythium_vexans GACTCGGTGCTGGACGTTGTCCGGAAGGAGGCGGAGAGCTGCGATTGCCTCCAGGGTTTCCAGATCACGCACTCGCTCGGCGGTGGTACCGGCTCCGGTATGGGCACGCTCCTGATCTCCAAGATCCGCGAGGAGTACCCGGACCGTATTATGTGCACGTACTCGGTGTGTCCGTCGCCGAAGGTGTCGGACACGGTCGTCGAGCCCTACAACGCCACGCTCTCGGTGCACCAGCTTGTCGAGAACGCCGATGAGGTCATGTGCCTGGACAACGAGGCTCTGTACGACATTTGCTTCCGTACGCTCAAGCTGACGACCCCGACGTACGGTGACCTCAACCACCTTGTGTGCGCTGCGATGTCGGGCATCACGACCTGTCTGCGATTCCCCGGTCAGCTGAACTCTGACCTCCGGAAGCTGGCTGTGAACCTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATTGGGTTCGCGCCGCTGACGTCGCGCGGCTCGCAGCAGTACCGTGCTCTGACCGTTCCGGAGCTGACCCAGCAGCAGTTCGACGCGAAGAACATGATGTGCGCCGCGGATCCTCGCCACGGTCGTTACCTGACCGCCGCGTGTATGTTCCGTGGCCGCATGAGCACGAAGGAGGTGGACGAGCAGATGCTGAACGTGCAGAACAAGAACTCGTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGTGTGTGTGACATTCCGCCGGTCTGAAGATGAGCACCACGTTCATCGGCAACTCGACTGCGATTCAGGAGATGTTCAAGCGCGTCTCGGAGCAGTTCACGGCGATGTTCCGCCGCAAGGCCTTCTTGCACTGGTACACGGGCAGGGCATGGATGAGAGGTGATCGACGCTCCGGGCCACCGTGACTTCATCAAGAACATGATCACGGGCACGTCGCAGGCCGACTGCGCCATCCTTGTGGTTGCGTCGGGTGTTGGCGAGTTCGAGGCTGGTATCTCGAAGGAGGGCCAGACGCGCGAGCACGCTCTGCTTGCCTTCACGCTCGGCGTGAAGCAGATGATCGTTGCGATCAACAAGATGGACGACTCGTCGGTGATGTACGGCGAGGCTCGTTACACGGAGATCAAGAACGAGGTGACTGCTTACCTGAAGAAGGTTGGCTACAAGCCGGCCAAGATCCCGTTCGTGCCTATTTCGGGCTGGGAGGGCGACAACATGATTGAGCGCTCGAGCAACATGCCGTGGTACAAGGGACCTTACCTCCTTGAGGCGCTCGACAGCCTGAACGCGCCTAAGCGTCCGTCGGACAAGCCGCTCCGTCTGCCGCTCCAGGATGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTTGAGACGGGTGTGCTGAAGCCTGGCATGGTTGCGACGTTCGGCCCTGTGGGTCTGTCGACGGAAGTGAAGTCTGTGGAGATGCACCACGAGTCGCTGCCGGAGGCTGTCCCGGGTGACAACGTTGGCTTCAACGTGAAGAACGTGTCGGTGAAGGAGCTCCGCCGTGGCTTCGTTGCTTCGGACTCGAAGAACGACCCCGCCAAGGGCACGGCTGACTTCACGGCCCAGGTGATTGTGCTGAACCACCGGCCGGCCGTCCGGTGCTCGACTGCCACACGGCCCACGTTGCTTGCAAGTTCAAGGAGATCACGGAGAAGATGGACCGTCGTTCGGGCAAGGT ; END; BEGIN TREES; TITLE Phytophthora_MP_BS_Combined; LINK TAXA = Taxa1; TRANSLATE 1 Phytophthora_palmivora, 2 Phytophthora_palmivora_GF534, 3 Phytophthora_nicotianae, 4 Phytophthora_nicotianae_MAFF235794, 5 Phytophthora_nicotianae_GF468, 6 Phytophthora_sp_kelmania_GF433, 7 Phytophthora_sp_kelmania_GF543, 8 Phytophthora_sp_kelmania_GF649, 9 Phytophthora_sojae_Pm_1, 10 Phytophthora_sojae, 11 Phytophthora_sansomeana, 12 Phytophthora_sansomeana_NBRC31624, 13 Phytophthora_sansomeana_CH95PHG7, 14 Phytophthora_sansomeana_CH95PHG8, 15 Phytophthora_niederhauserii_CH96HE1, 16 Phytophthora_niederhauserii_CH96HE2, 17 Phytophthora_niederhauserii, 18 Phytophthora_multivora_NBRC31016, 19 Phytophthora_multivora, 20 Phytophthora_gregata, 21 Phytophthora_cactorum, 22 Phytophthora_hedraiandra_MAFF235099, 23 Phytophthora_hedraiandra, 24 Phytophthora_bisheria, 25 Phytophthora_boehmeriae, 26 Phytophthora_botryosa, 27 Phytophthora_brassicae, 28 Phytophthora_cajani, 29 Phytophthora_cambivora, 30 Phytophthora_capsici, 31 Phytophthora_captiosa, 32 Phytophthora_cinnamomi, 33 Phytophthora_parvispora, 34 Phytophthora_clandestina, 35 Phytophthora_colocasiae, 36 Phytophthora_cryptogea, 37 Phytophthora_cuyabensis, 38 Phytophthora_drechsleri, 39 Phytophthora_erythroseptica, 40 Phytophthora_europaea, 41 Phytophthora_fallax, 42 Phytophthora_foliorum, 43 Phytophthora_fragariae, 44 Phytophthora_glovera, 45 Phytophthora_gonapodyides, 46 Phytophthora_heveae, 47 Phytophthora_hibernalis, 48 Phytophthora_humicola, 49 Phytophthora_idaei, 50 Phytophthora_ilicis, 51 Phytophthora_infestans, 52 Phytophthora_insolita, 53 Phytophthora_inundata, 54 Phytophthora_ipomoeae, 55 Phytophthora_iranica, 56 Phytophthora_katsurae, 57 Phytophthora_kernoviae, 58 Phytophthora_macrochlamydospora, 59 Phytophthora_meadii, 60 Phytophthora_megakarya, 61 Phytophthora_megasperma, 62 Phytophthora_melonis, 63 Phytophthora_mexicana, 64 Phytophthora_multivesiculata, 65 Phytophthora_nemorosa, 66 Phytophthora_phaseoli, 67 Phytophthora_pistaciae, 68 Phytophthora_porri, 69 Phytophthora_primulae, 70 Phytophthora_pseudosyringae, 71 Phytophthora_pseudotsugae, 72 Phytophthora_psychrophila, 73 Phytophthora_ramorum, 74 Phytophthora_syringae, 75 Phytophthora_tentaculata, 76 Phytophthora_trifolii, 77 Phytophthora_uliginosa, 78 Phytophthora_vignae, 79 Phytophthora_sp_kelmania, 80 Phytopythium_vexans; TREE PAUP_1 = [&R] (1,2,((((3,(4,5)75.5)100.0,(((21,(22,23)85.3,71)64.2,49)100.0,(((34,55)88.8,75)99.7,((51,54)93.2,66)100.0)66.6)50.7)79.8,(((6,(7,(8,79)63.5)68.2,((11,12)76.5,(13,14)63.5)99.2,(36,39)100.0,38,76)99.7,((27,68,69)100.0,74)70.2,(42,73)66.0,47)55.3,(((((9,10)100.0,(15,16,17)99.9)59.6,((28,78)99.0,(62,67)64.1)73.6)91.9,(((29,43)98.8,40)72.3,77)98.8)62.0,(32,33)92.6)93.3,(20,45,(48,53)100.0,61)99.1,((25,57)100.0,(31,41)100.0,37,52,58,80)55.5,(46,56)100.0,((50,65,72)84.3,70)100.0)67.7,(((18,19)100.0,(((26,35)61.9,59)100.0,((30,63)99.7,44)100.0)84.0)87.1,24,64)53.5)99.2,60)100.0)0; END; BEGIN TREES; TITLE Phytophthora_COX1_MP; LINK TAXA = Taxa3; TRANSLATE 1 Phytophthora_palmivora, 2 Phytophthora_palmivora_GF534, 3 Phytophthora_nicotianae, 4 Phytophthora_nicotianae_MAFF_235794, 5 Phytophthora_nicotianae_GF468, 6 Phytophthora_sp._kelmania_GF433, 7 Phytophthora_sp._kelmania_GF543, 8 Phytophthora_sp._kelmania_GF649, 9 'Phytophthora sojae Pm-1', 10 Phytophthora_sojae, 11 Phytophthora_sansomeana, 12 Phytophthora_sansomeana_NBRC_31624, 13 Phytophthora_sansomiana_CH95PHG7, 14 Phytophthora_sansomiana_CH95PHG8, 15 Phytophthora_niederhauserii_CH96HE1, 16 Phytophthora_niederhauserii_CH96HE2, 17 Phytophthora_niederhauserii, 18 Phytophthora_multivora_NBRC_31016, 19 Phytophthora_multivora, 20 Phytophthora_gregata, 21 Phytophthora_cactorum, 22 Phytophthora_hedraiandra_MAFF_235099, 23 Phytophthora_hedraiandra, 24 Phytophthora_bisheria, 25 Phytophthora_boehmeriae, 26 Phytophthora_botryosa, 27 Phytophthora_brassicae, 28 Phytophthora_cajani, 29 Phytophthora_cambivora, 30 Phytophthora_capsici, 31 Phytophthora_captiosa, 32 Phytophthora_cinnamomi, 33 Phytophthora_parvispora, 34 Phytophthora_clandestina, 35 Phytophthora_colocasiae, 36 Phytophthora_cryptogea, 37 Phytophthora_cuyabensis, 38 Phytophthora_drechsleri, 39 Phytophthora_erythroseptica, 40 Phytophthora_europaea, 41 Phytophthora_fallax, 42 Phytophthora_foliorum, 43 Phytophthora_fragariae, 44 Phytophthora_glovera, 45 Phytophthora_gonapodyides, 46 Phytophthora_heveae, 47 Phytophthora_hibernalis, 48 Phytophthora_humicola, 49 Phytophthora_idaei, 50 Phytophthora_ilicis, 51 Phytophthora_infestans, 52 Phytophthora_insolita, 53 Phytophthora_inundata, 54 Phytophthora_ipomoeae, 55 Phytophthora_iranica, 56 Phytophthora_katsurae, 57 Phytophthora_kernoviae, 58 Phytophthora_macrochlamydospora, 59 Phytophthora_meadii, 60 Phytophthora_megakarya, 61 Phytophthora_megasperma, 62 Phytophthora_melonis, 63 Phytophthora_mexicana, 64 Phytophthora_multivesiculata, 65 Phytophthora_nemorosa, 66 Phytophthora_phaseoli, 67 Phytophthora_pistaciae, 68 Phytophthora_porri, 69 Phytophthora_primulae, 70 Phytophthora_pseudosyringae, 71 Phytophthora_pseudotsugae, 72 Phytophthora_psychrophila, 73 Phytophthora_ramorum, 74 Phytophthora_syringae, 75 Phytophthora_tentaculata, 76 Phytophthora_trifolii, 77 Phytophthora_uliginosa, 78 Phytophthora_vignae, 79 Phytophthora_sp_kelmania, 80 Phytopythium_vexans; TREE PAUP_155 = [&R] (1:0.0,2:0.0,((((((((3:0.0,(4:0.0,5:0.0):1.0):14.0,(((21:2.0,71:4.0):3.0,(22:2.0,23:0.0):2.0):2.0,49:8.0):9.0):4.0,((34:5.0,75:15.0):3.0,55:2.0):4.0):5.0,((51:1.0,66:4.0):3.0,54:3.0):15.0):10.0,((((18:0.0,19:0.0):12.0,((30:0.0,63:2.0):3.0,44:4.0):7.0):2.0,((24:12.0,64:13.0):3.0,(((50:9.0,(65:6.0,72:7.0):3.0):6.0,70:11.0):5.0,60:14.0):5.0):5.0):4.0,(26:4.0,(35:5.0,59:6.0):4.0):7.0):3.0):4.0,((((((((6:3.0,(7:0.0,8:0.0,79:1.0):2.0):1.0,(36:0.0,39:0.0):9.0):7.0,((11:0.0,12:0.0,(13:0.0,14:0.0):1.0):6.0,76:18.0):4.0):6.0,38:6.0):9.0,42:18.0):4.0,(((27:15.0,(68:6.0,69:4.0):16.0):17.0,74:14.0):7.0,(47:16.0,73:13.0):10.0):6.0):7.0,((20:16.0,(48:6.0,53:7.0):6.0):5.0,(45:18.0,61:15.0):6.0):5.0):4.0,((((((9:0.0,10:0.0):6.0,((15:0.0,16:0.0,17:0.0):7.0,((28:1.0,78:2.0):3.0,62:3.0):11.0):4.0):2.0,67:6.0):5.0,33:14.0):3.0,((((29:3.0,43:7.0):5.0,40:6.0):4.0,77:6.0):6.0,32:18.0):4.0):8.0,(((25:16.0,57:16.0):7.0,80:76.0):10.0,((((31:15.0,41:14.0):13.0,58:16.0):10.0,52:6.0):8.0,37:10.0):6.0):12.0):4.0):5.0):4.0,46:3.0):4.0,56:5.0):25.0); END; BEGIN TREES; TITLE Phytophthora_MP_Combined; LINK TAXA = Taxa1; TRANSLATE 1 Phytophthora_palmivora, 2 Phytophthora_palmivora_GF534, 3 Phytophthora_nicotianae, 4 Phytophthora_nicotianae_MAFF235794, 5 Phytophthora_nicotianae_GF468, 6 Phytophthora_sp_kelmania_GF433, 7 Phytophthora_sp_kelmania_GF543, 8 Phytophthora_sp_kelmania_GF649, 9 Phytophthora_sojae_Pm_1, 10 Phytophthora_sojae, 11 Phytophthora_sansomeana, 12 Phytophthora_sansomeana_NBRC31624, 13 Phytophthora_sansomeana_CH95PHG7, 14 Phytophthora_sansomeana_CH95PHG8, 15 Phytophthora_niederhauserii_CH96HE1, 16 Phytophthora_niederhauserii_CH96HE2, 17 Phytophthora_niederhauserii, 18 Phytophthora_multivora_NBRC31016, 19 Phytophthora_multivora, 20 Phytophthora_gregata, 21 Phytophthora_cactorum, 22 Phytophthora_hedraiandra_MAFF235099, 23 Phytophthora_hedraiandra, 24 Phytophthora_bisheria, 25 Phytophthora_boehmeriae, 26 Phytophthora_botryosa, 27 Phytophthora_brassicae, 28 Phytophthora_cajani, 29 Phytophthora_cambivora, 30 Phytophthora_capsici, 31 Phytophthora_captiosa, 32 Phytophthora_cinnamomi, 33 Phytophthora_parvispora, 34 Phytophthora_clandestina, 35 Phytophthora_colocasiae, 36 Phytophthora_cryptogea, 37 Phytophthora_cuyabensis, 38 Phytophthora_drechsleri, 39 Phytophthora_erythroseptica, 40 Phytophthora_europaea, 41 Phytophthora_fallax, 42 Phytophthora_foliorum, 43 Phytophthora_fragariae, 44 Phytophthora_glovera, 45 Phytophthora_gonapodyides, 46 Phytophthora_heveae, 47 Phytophthora_hibernalis, 48 Phytophthora_humicola, 49 Phytophthora_idaei, 50 Phytophthora_ilicis, 51 Phytophthora_infestans, 52 Phytophthora_insolita, 53 Phytophthora_inundata, 54 Phytophthora_ipomoeae, 55 Phytophthora_iranica, 56 Phytophthora_katsurae, 57 Phytophthora_kernoviae, 58 Phytophthora_macrochlamydospora, 59 Phytophthora_meadii, 60 Phytophthora_megakarya, 61 Phytophthora_megasperma, 62 Phytophthora_melonis, 63 Phytophthora_mexicana, 64 Phytophthora_multivesiculata, 65 Phytophthora_nemorosa, 66 Phytophthora_phaseoli, 67 Phytophthora_pistaciae, 68 Phytophthora_porri, 69 Phytophthora_primulae, 70 Phytophthora_pseudosyringae, 71 Phytophthora_pseudotsugae, 72 Phytophthora_psychrophila, 73 Phytophthora_ramorum, 74 Phytophthora_syringae, 75 Phytophthora_tentaculata, 76 Phytophthora_trifolii, 77 Phytophthora_uliginosa, 78 Phytophthora_vignae, 79 Phytophthora_sp_kelmania, 80 Phytopythium_vexans; TREE PAUP_211 = [&R] (1:2.0,2:7.0,(((((3:1.0,(4:0.0,5:3.0):1.0):34.0,(((21:7.0,(22:6.0,23:1.0):2.0,71:1.0):1.0,49:2.0):14.0,(((34:20.0,55:10.0):5.0,75:14.0):22.0,((51:2.0,54:3.0):4.0,66:7.0):34.0):11.0):13.0):17.0,((((18:0.0,19:0.0):8.0,(((26:12.0,35:10.0):2.0,59:6.0):22.0,((30:0.0,63:0.0):9.0,44:7.0):33.0):21.0):24.0,64:35.0):18.0,24:30.0):15.0):9.0,(((((((((6:7.0,(36:1.0,39:3.0):17.0):1.0,(7:6.0,(8:1.0,79:0.0):1.0):2.0):2.0,(((11:0.0,12:1.0):1.0,(13:0.0,14:7.0):3.0):7.0,76:27.0):5.0):5.0,38:3.0):20.0,(((((27:10.0,69:39.0):5.0,68:10.0):49.0,74:42.0):25.0,47:27.0):16.0,(42:23.0,73:16.0):10.0):16.0):17.0,(((25:43.0,57:55.0):46.0,80:110.0):20.0,((((31:10.0,41:24.0):40.0,58:44.0):24.0,37:37.0):23.0,52:39.0):21.0):30.0):18.0,(((((9:1.0,10:1.0):14.0,(15:0.0,16:0.0,17:0.0):9.0):3.0,((28:1.0,78:5.0):6.0,(62:13.0,67:5.0):2.0):4.0):14.0,(((29:5.0,43:8.0):7.0,40:13.0):5.0,77:6.0):23.0):14.0,(32:20.0,33:22.0):8.0):22.0):23.0,(((20:18.0,61:34.0):7.0,(48:2.0,53:2.0):35.0):7.0,45:19.0):25.0):12.0,((46:6.0,56:4.0):37.0,((50:6.0,65:4.0,72:1.0):4.0,70:11.0):36.0):12.0):16.0):33.0,60:36.0):56.0); END; BEGIN TREES; TITLE Phytophthora_5_gene_MP; LINK TAXA = Taxa2; TRANSLATE 1 Phytophthora_palmivora, 2 Phytophthora_palmivora_GF534, 3 Phytophthora_nicotianae, 4 Phytophthora_nictianae_MAFF_235794, 5 Phytophthora_nictianae_GF468, 6 Phytophthora_sp._kelmania_GF433, 7 Phytophthora_sp._kelmania_GF543, 8 Phytophthora_sp._kelmania_GF649, 9 'Phytophthora sojae Pm-1', 10 Phytophthora_sojae, 11 Phytophthora_sansomeana, 12 Phytophthora_sansomeana_NBRC_31624, 13 Phytophthora_sansomeana_CH95PHG7, 14 Phytophthora_sansomeana_CH95PHG8, 15 Phytophthora_niederhauserii_CH96HE1, 16 Phytophthora_niederhauserii_CH96HE2, 17 Phytophthora_niederhauserii, 18 Phytophthora_multivora_NBRC_31016, 19 Phytophthora_multivora, 20 Phytophthora_gregata, 21 Phytophthora_cactorum, 22 Phytophthora_hedraiandra_MAFF_235099, 23 Phytophthora_hedraiandra, 24 Phytophthora_bisheria, 25 Phytophthora_boehmeriae, 26 Phytophthora_botryosa, 27 Phytophthora_brassicae, 28 Phytophthora_cajani, 29 Phytophthora_cambivora, 30 Phytophthora_capsici, 31 Phytophthora_captiosa, 32 Phytophthora_cinnamomi, 33 Phytophthora_parvispora, 34 Phytophthora_clandestina, 35 Phytophthora_colocasiae, 36 Phytophthora_cryptogea, 37 Phytophthora_cuyabensis, 38 Phytophthora_drechsleri, 39 Phytophthora_erythroseptica, 40 Phytophthora_europaea, 41 Phytophthora_fallax, 42 Phytophthora_foliorum, 43 Phytophthora_fragariae, 44 Phytophthora_glovera, 45 Phytophthora_gonapodyides, 46 Phytophthora_heveae, 47 Phytophthora_hibernalis, 48 Phytophthora_humicola, 49 Phytophthora_idaei, 50 Phytophthora_ilicis, 51 Phytophthora_infestans, 52 Phytophthora_insolita, 53 Phytophthora_inundata, 54 Phytophthora_ipomoeae, 55 Phytophthora_iranica, 56 Phytophthora_katsurae, 57 Phytophthora_kernoviae, 58 Phytophthora_macrochlamydospora, 59 Phytophthora_meadii, 60 Phytophthora_megakarya, 61 Phytophthora_megasperma, 62 Phytophthora_melonis, 63 Phytophthora_mexicana, 64 Phytophthora_multivesiculata, 65 Phytophthora_nemorosa, 66 Phytophthora_phaseoli, 67 Phytophthora_pistaciae, 68 Phytophthora_porri, 69 Phytophthora_primulae, 70 Phytophthora_pseudosyringae, 71 Phytophthora_pseudotsugae, 72 Phytophthora_psychrophila, 73 Phytophthora_ramorum, 74 Phytophthora_syringae, 75 Phytophthora_tentaculata, 76 Phytophthora_trifolii, 77 Phytophthora_uliginosa, 78 Phytophthora_vignae, 79 Phytophthora_sp._kelmania, 80 Phytopythium_vexans; TREE PAUP_9 = [&R] (1:2.0,2:7.0,((((((3:1.0,(4:0.0,5:4.0):3.0):70.0,((34:30.0,55:18.0):20.0,75:27.0):44.0):23.0,(((21:9.0,71:7.0):3.0,(22:9.0,23:4.0):5.0):4.0,49:13.0):29.0):16.0,((51:3.0,54:11.0):6.0,66:9.0):76.0):40.0,((((((((((6:11.0,((7:6.0,(8:2.0,79:2.0):2.0):6.0,(36:1.0,39:3.0):32.0):5.0):14.0,(((11:0.0,12:5.0):1.0,(13:0.0,14:7.0):4.0):17.0,76:57.0):11.0):10.0,38:28.0):56.0,42:54.0):11.0,(((27:26.0,(68:23.0,69:56.0):22.0):104.0,74:79.0):34.0,(47:93.0,73:42.0):28.0):19.0):30.0,(((25:74.0,57:100.0):80.0,(((31:29.0,41:45.0):100.0,58:126.0):36.0,(37:111.0,52:116.0):38.0):51.0):58.0,80:372.0):83.0):37.0,(((((9:1.0,10:1.0):22.0,((15:0.0,16:0.0):0.0,17:1.0):19.0):4.0,(((28:2.0,78:7.0):12.0,62:21.0):14.0,67:14.0):8.0):34.0,(((29:9.0,43:17.0):15.0,40:21.0):12.0,77:16.0):36.0):15.0,(32:42.0,33:42.0):21.0):45.0):34.0,(((20:44.0,61:64.0):16.0,45:45.0):18.0,(48:11.0,53:7.0):57.0):48.0):32.0,((46:18.0,56:13.0):59.0,((50:16.0,(65:11.0,72:8.0):3.0):12.0,70:21.0):65.0):15.0):24.0,((((18:0.0,19:0.0):26.0,((26:16.0,(35:19.0,59:18.0):10.0):37.0,((30:6.0,63:6.0):15.0,44:14.0):51.0):27.0):42.0,64:66.0):28.0,24:69.0):31.0):18.0):44.0,60:75.0):89.0); END;