#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 16:50 GMT TreeBASE (cc) 1994-2008 Study reference: Limkaisang S., Cunnington J., Liew K., Salleh B., Sato Y., Divarangkoon R., Fangfuk W., To-anun C., & Takamatsu S. 2006. Molecular phylogenetic analyses reveal a close relationship between powdery mildew fungi on some tropical trees and Erysiphe alphitoides, an oak powdery mildew. Mycoscience, 46(4): 220 - 226. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1616] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=79; TAXLABELS Erysiphe_alphitoides_MUMH242_Japan Erysiphe_alphitoides_MUMH960_UK Erysiphe_aquilegiae_AB000944 Erysiphe_aquilegiae_AB015929 Erysiphe_aquilegiae_AF154322 Erysiphe_baeumleri_AB015919 Erysiphe_baeumleri_AB015933 Erysiphe_betae Erysiphe_blasti Erysiphe_castaneigena Erysiphe_convolvuli_AF011298 Erysiphe_convolvuli_AF154327 Erysiphe_cruciferarum 'Erysiphe euonymi-japonici MUMH133 Japan' 'Erysiphe euonymi-japonici MUMH2470 Argentina' Erysiphe_friesii Erysiphe_glycines_AB015927 Erysiphe_glycines_AB015934 Erysiphe_helwingiae Erysiphe_heraclei Erysiphe_howeana Erysiphe_huayinensis Erysiphe_juglandis Erysiphe_katumotoi Erysiphe_lespedezae_AB015921 Erysiphe_lespedezae_AB015923 Erysiphe_liriodendri Erysiphe_macleayae Erysiphe_magnifica Erysiphe_pisi_AF011306 Erysiphe_pisi_AF073348 Erysiphe_polygoni_AF011307 Erysiphe_polygoni_AF011308 Erysiphe_pseudolonicerae Erysiphe_pulchra_var._japonica_AB000941 Erysiphe_pulchra_var._japonica_AB015924 Erysiphe_pulchra_var._pulchra Erysiphe_sp._ex_Q._phillyraeoides_MUMH885_Japan Erysiphe_sp._ex_Quercus_phillyraeoides_AB193590_Japan Erysiphe_staphyleae 'Erysiphe syringae-japonicae' Erysiphe_trifolii Erysiphe_vanbruntiana Erysiphe_viburni Erysiphe_wallrothii Erysiphe_weigelae_AB015931 Erysiphe_weigelae_AB015932 Oidium_anacardii_MUMH781_Tanzania Oidium_bixae_MUMH2606_Thailand Oidium_bixae_MUMH3165_Argentina Oidium_bixae_MUMH3230_Thailand Oidium_bixae_MUMH3231_Thailand Oidium_citri_MUMH3210_Malaysia Oidium_citri_VPRI30172_East_Timor Oidium_citri_VPRI30173_East_Timor Oidium_heveae_AB193587_Malaysia Oidium_heveae_AB193588_Malaysia Oidium_heveae_AB193589_Thailand Oidium_heveae_AB193606_Brazil Oidium_heveae_AB193607_Brazil Oidium_mangiferae_MUMH3188_Argentina Oidium_mangiferae_MUMH3267_Thailand Oidium_mangiferae_MUMH3268_Thailand Oidium_mangiferae_MUMH3705_Thailand Oidium_mangiferae_VPRI18420_Australia Oidium_mangiferae_VPRI19251_Australia Oidium_mangiferae_VPRI20332_Australia Oidium_mangiferae_VPRI20364_Australia Oidium_mangiferae_VPRI20379_Australia Oidium_sp._ex_A._auriculiformis_MUMH1805_Thailand Oidium_sp._ex_A._auriculiformis_MUMH2546_Malaysia Oidium_sp._ex_A._auriculiformis_MUMH3241_Thailand Oidium_sp._ex_A._holosericea_VPRI20468_Australia Oidium_sp._ex_A._mangium_VPRI20374_Australia Oidium_sp._ex_A._mangium_VPRI20907_Australia Oidium_sp._ex_Acacia_mangium_MUMH1183_Japan Oidium_sp._ex_Acacia_sp._MUMH3227_Indonesia Oidium_sp._ex_Convolvulus_AF154328 Oidium_sp._ex_Glycine_AB078800 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=38; TAXLABELS Erysiphe_alphitoides_MUMH242_Japan Erysiphe_alphitoides_MUMH960_UK Erysiphe_aquilegiae Erysiphe_convolvuli Erysiphe_cruciferarum Erysiphe_friesii Erysiphe_glycines Erysiphe_heraclei Erysiphe_pulchra Erysiphe_sp._AB197135_Japan Erysiphe_sp._MUMH885_Japan Erysiphe_trifolii Oidium_anacardii_MUMH781_Tanzania Oidium_bixae_MUMH3165_Argentina Oidium_bixae_MUMH3230_Thailand Oidium_bixae_MUMH3231_Thailand Oidium_citri_MUMH_3210_Malaysia Oidium_citri_VPRI30172_Indonesia Oidium_citri_VPRI30173_Indonesia Oidium_heveae_MUMH2418_Brazil Oidium_heveae_MUMH2419_Brazil Oidium_heveae_MUMH2545_Malaysia Oidium_heveae_MUMH2602_Thailand Oidium_mangiferae_MUMH3188_Argentina Oidium_mangiferae_MUMH3267_Thailand Oidium_mangiferae_MUMH3268_Thailand Oidium_mangiferae_MUMH3705_Thailand Oidium_mangiferae_VPRI18420_Australia Oidium_mangiferae_VPRI20332_Australia Oidium_mangiferae_VPRI20346_Australia Oidium_mangiferae_VPRI20364_Australia Oidium_mangiferae_VPRI20379_Australia Oidium_sp._MUMH1183_Japan Oidium_sp._MUMH1805_Thailand Oidium_sp._MUMH2546_Malaysia Oidium_sp._MUMH3229_Indonesia Oidium_sp._MUMH3241_Thailand Oidium_sp._VPRI20907_Australia ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3496] TITLE ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=607; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Erysiphe_alphitoides_MUMH242_Japan CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_alphitoides_MUMH960_UK CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_aquilegiae_AB000944 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTCGTCT-CAG-GTTTATTA----TAGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_aquilegiae_AB015929 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTCGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_aquilegiae_AF154322 CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTCGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_baeumleri_AB015919 CAGAGTGCGAGGCTCAGT-CGC-GGCGTCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-TCGCAAGG--ACCTGC---GTCGGCC-GCCC--ACCGGTC--TTGAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTACTTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_baeumleri_AB015933 CAGAGTGCGAGGCTCAGT-CGC-GGCGTCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-TCGCAAGG--ACCTGC---GTCGGCC-GCCC--ACCGGTC--TTGAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCGTCTTTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_betae ---------AGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGTCGTC--GCTGT-CCGCCTGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAAA---CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAAA--TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAAT-GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTATTG-----GGTCCAGTCA-CATGGA--TCACATG Erysiphe_blasti CAGAGCGTGAGGCTCAGT-CGT-GGCGTCT-GCTACGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GTGGAC--GCTGC-CCGTAAGG--ATATGC---GTCGGCT-GCCC--ACCGGTT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AATCAAAAA---CTCATGTT-GTCTTT-GCAGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGCA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-AGTGGCCTGCCAAAACCCCGTTT---------GTTCCAGTCA-TATGGA--TCACAGG Erysiphe_castaneigena CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCATCGTC--GCTGC-CCGCAAGG--ACCAGC---GTCGGCC-GCCC--ACCGGTC--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAAAGAACCCACTT------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_convolvuli_AF011298 --GAGTGCGAGGCTC-GT-CGT-GGCATCA-GCTGCGTGACTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGCCGTTGTCGTC--GCTGC-CCGCATGG--GCATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGTGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCGCT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACACGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCATAACAACCTCTTTTG-----GTTCCAGTCA-CATGGA--TCATAGG Erysiphe_convolvuli_AF154327 CAGAGTGCGAGGCTCCGT-CGT-GGCATCA-GCTGCGTA-CTGGGCCGACCCTCCCACCCGTGTCGATTTTGTATCTTGTTGCTTTGGCGAGCCGGGCCGTTGTCGTC--GCTGC-CCGCATGG--GCATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGTGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCGCT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCTCTTTTG-----GTTCCAGTCA-CATGGA--TCATAGG Erysiphe_cruciferarum CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCGCATGGG-ACATGC---GTCGGCC-GCCC--ACCGGTTTCACGA-CTGGAGCAGGTCCGCCAAA-GACCC-AACCAAAAA---CTCATGTT-GTCTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGGATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAAACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCTTTA-----GCTCCAGTCA-CATGGA--TCACAGG 'Erysiphe euonymi-japonici MUMH133 Japan' CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCCAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG 'Erysiphe euonymi-japonici MUMH2470 Argentina' CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCCAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_friesii CCGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-CCGCATGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAAA---CTCATGTT-GTTTGT-GTCGTCT-TAG-TTTGATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAC--GCGGCGGCCCTTAAAGACAGTGCCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCCCTTTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_glycines_AB015927 CAGAGCGTGAGGCTCAGT-CGCTGGCATCT-GCCACGTG-CTGGGCCGACCCTCCCACCCGTGTCGATTTTATAGATTGTTGCTTTGGCGGGCCGGGAC-C-GTCCAC--GTCGT-TCACAGTG--ACGCGT---GCGAGCT-GCCC--ACCGGCT--TTGG-CTGGAGCGTGTCCGCCAAA-GACCC-AACCCAAAACT-CTTATATTTGTCATG-GTAGTCT-AAG-TAAAAGTA----TATAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCGAGCTACCGTTGT--GTGGCTGTGGTGTTGGGGCTCGCCGCGTCTCGCGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GATTCTCGCGACAGAGTGACGAC-GATGATCAGCCAAAAAACCCCCTTTTAA--CCAAGTCCGGTCATACGGATTTTACAGG Erysiphe_glycines_AB015934 CAGAGCGTGAGGCTCAGT-CGC-GGCGTCT-GCCATGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATTGATTGTTGCTTTGGCGGGCCGGGAC-C-GTCCAC--GTCGC-TCGCAGTG--ACGTGT---GCGAACT-GCCC--ACCGGCT--TTGG-CTGGAGCGTGCCCGCCAAA-GACCC-ATCCCCAAA---CTCATATT-GTCCT--GCAGTCT-AAG-TGATATTA----TATAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCGAGCTACAATTGT--GTGGCTGTGGTGTTGGGGCTCGCCGCGCCTCGCGGTGGCTCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTACTTTTGATTCTCGCGACAGAGTGACGAC-GAAGATCAGCCAAAACCCCCCAACCTTTAATCAAGTCCGGTAAATACGGATTTACAGG Erysiphe_helwingiae CAGAGCGTGAGGCTCAGT-CGC-GGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGT-GTCGATGTGCTGG-CCGCGAGG--ACATGC---ATCGGCC-GCCC--ACCGGCC--TCGG-CTGGAGCGCGCCCGCCAGA-GATCT-AACCAAAA----CTCATGTT-GTCTTTTGCAGTCT-AAG-CTTAATTT---ATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CAACCCCCGTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAAACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGAA-TCACAGG Erysiphe_heraclei CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGCG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGTCGTC--GCTGT-CCGCCTGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAAAA--CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTATTG-----GGTCCAGTCA-CATGGA--TCACAGG Erysiphe_howeana -AGA-TGCGAGGCTCAGT-CGT-GGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGCTGTC--GCTGT-CCGCATGG--ACATGC---GTTGGCC-GCCC--ACCGGTT--TTCAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGATAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAA-CCTCATTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_huayinensis CAGAGCGCGAGGCTCAGT-CGT-AGCATGT-GCTGCGCG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGC-GTCGAC--CCTGC-CCGTACGG--ACAAGC---GTCGGCCCGCCC--ACTGTCTATTCGG-CTGGAGCGCGTTCGCCAAA-GACCC-AACCACAAA---CTCATGTT-GTCTTTTGTCGTCT-AAG-GTATATATCTAATTGAATTGACAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAGAAACA-CCCCCCTCGAGCTACCTTTGTTGGTGGCTGTGGTGTTGGGGCACGTCGCGGA--GCGGCGGCCCTTAAAGACAGTGGCGGTCTCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCT-GGTGGCTTGCCAACAATAACCCGCTC------GTTCCAGTCA-CATGGGA-TCACAGG Erysiphe_juglandis CAGAGCGTGAGGTTCAGT-CGT-GGCATCT-GCCGTGTC-CTGAGCCGACCCTCCCACCCGTGTCGACTTTATATCATGTTGCTTTGGCGGGCCGGGTTAT-GTCCAG--GTCGC-CCGTAAGG--GTGCGT---ATGGGCA-GCCC--ACCGGCT--TCGG-CTGGAGCGTGTCCGCCAGA-GACCT-ATCCAAA-----CTCATGTT-GTCTTT-GCAGTCT-AAG-GTTTATTA----TGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCGAGCCATC-TAGT--GTGGTTACGGTGTTGGGGCTCGTCGGGTTTC-CGGCGGCCCTTAAAGACAGTGGCGGTCCTGACGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAGAAGCCTTTTT--------G-TCCAGTCT-TCTGGA--TCATAGG Erysiphe_katumotoi CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGTTGC-GTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGCCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAAA---CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGTGGTCCCGACGTGGACTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCTTTT---------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_lespedezae_AB015921 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCCGTC--GCTGT-CCGCACGG--ATATGC---ATCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CCCAAGTT-GTTAAT-GTCGTCT-TAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCCTGCCAGAACAACCCACATTT-----GTCCCAGTCA-CATGGGATTCATAGG Erysiphe_lespedezae_AB015923 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCCGTC--GCTGT-CCGCACGG--ATATGC---ATCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCAAGTT-GTTTTT-GTCGTCT-TAG-CATTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCGCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACGTTT-----GTCCCAGTCA-CATGGGATTCATAGG Erysiphe_liriodendri CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TGTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGCC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT-TTCGG-CTGGAGCGTGCCCGCCAAA-GACCCCAATCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCCCTCCAGCTACCTTTGT--GTGGCTGCGGCGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCGAACTTT-----GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_macleayae CAGAGCGTGAGGCTCAGT-CGT-GGCGTCA-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTCTATCTTGTTGCTTTGGCGGGCCGGGCTAC-GTCGTC--GCTGC-CCGTACGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CGCATGTT-GTCTTT-GTCGTCT-CAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGTTGCGGTGTTGGGGCCCGTCGCGTT--GCGGCAGCTCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_magnifica ------------------------CCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTCGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAACGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-AGCGGCTTGCCAGAACAATCTACTTT------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_pisi_AF011306 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCTGTC--GCTGT-CCGCATGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TTCAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCATCT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_pisi_AF073348 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCTGTC--GCTGT-CCGCATGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TTCAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCATCT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_polygoni_AF011307 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTACCGTCGTC--GCTGT-CCGCAGGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAA--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAATGACGCCTGGTGGCTTGCCAGAACAACCCCTATTG-----GGTCCAGTCA-CATGGA--TCACAGG Erysiphe_polygoni_AF011308 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTACCGTCGTC--GCTGT-CCGCAGGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCGCGCCAAA-GACCC-AACCAAAA----CTCATGTA-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAC--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCAATTG-----GGTCCAGTCA-CATGGA--TCACAGG Erysiphe_pseudolonicerae CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCATGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_pulchra_var._japonica_AB000941 CAGAGCGTGAGGCTCAGT-CGT-GGCATTT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGCTGC-GCCGAC--GCTGT-CCGCAAGGAAAGATGC---GTCGGTC-GCCCCCGCCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAAAAAACTCATGTT-ATCATT-GCAGTCT-AAGTCTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCCAGCTGCCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGACGGCCCTGAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_pulchra_var._japonica_AB015924 CAGAGCGTGAGGCTCAGT-CGT-GGCATTT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTATATCTTGTTGCTTTGGCGGGCCGGGCTGC-GCCGAC--GCTGT-CCGCAAGGAAAGATGC---GTCGGTC-GCCCCCGCCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAAAAAACTCATGTT-ATCATT-GCAGTCT-AAGTCTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACA-CCCCC-TCCAGCTGCCTTTGC--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGACGGCCCTGAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTTGGCTTGCCAAAAGCCCGTTT---------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_pulchra_var._pulchra CAGAGCGTGAGGTTCAGT-CGT-GGCATCTTGCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGC-TCCATC--GCTGC-CCGCAAGG--ACATGC---G{GT}TGAGC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAGA-GACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCTC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCTTTTT--------GTTCCAGTCA-CATGGA--TCATAGG Erysiphe_sp._ex_Q._phillyraeoides_MUMH885_Japan CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_sp._ex_Quercus_phillyraeoides_AB193590_Japan CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_staphyleae CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GTCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGC-GTCGTC--GCGAT-CCGCAAGG--ACTGGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTAT-GCAGTCT-AAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCTTTGT--GTGGTTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAGCCCTATT---------GTTCCAGTCA-CATGGA--TCACAGG 'Erysiphe syringae-japonicae' CAGAGTGCGAGGCTCAGT-CGT-AGCATCT-GCTGCGTG-CTGGGCCAACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGC-CCACACGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-TTTTTTCGTCGTCT-CAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-GGCGGCTTGCCAGAACAACCCACTTT------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_trifolii CAGAGTGCGAGGCTCAGT-CGC-GGCGTCG-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGT-TCGCAAGG--ACGTGC---GTCGGCC-GCCC--ACCGGTT--TAGAACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-GTCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCACGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACACCCCTCTTTT-----GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_vanbruntiana CAGAGCGTGAGGCTCAGC-CAC-GACATCT-GCCGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTGC-GTCGAT--GCTGG-CCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAGA-GACCG-AACCAAAA----CTCATGTT-ATCTTG-GCAGTCT-AAG-CTTTATTT---ATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CACCCCCCCTCCAGCTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGGGTGACGAC-GGCGGCTTGCCAAAAGCCCATTT---------GTTCCAGTCA-TATGGAT-CCACAGG Erysiphe_viburni CAGAGCGTGAGGCTCAGT-TGT-GGCATCT-GCCGCGCG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGACCGGGCTGT-GTCGAC--GCTGC-CCGCAAGG--ACATGC---GACGGCC-GCCC--ACCGGCT--TCGG-CTGGAGCGCGTCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTCTTT-GCAGTCTTAAG-CTTTATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCA-TCCAGCTACCTTTGC--GTGGCTGCGGT?TTGGGGCACGTCGCGGT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGACGGTCGGCCTGCCAGAAAGCTCATTT--------GTTCCAGTCA-CATGGA--TCATAGG Erysiphe_wallrothii CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Erysiphe_weigelae_AB015931 CAGAGTGTGAGGCTCAGGGCGT-AGCATCT-GCTGCGTG-CTGGGCCAATCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GCCGTC--GCTGG-CCGCAAGG--ACATGCGTAGGCTGCC-GCCC--ACTGGCT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTAGTCT-CAG-TTATATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTACCTTTGA--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCTCTAAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAAAGCCTATTT-------GTTCCAGTCA-CATGGA--TCACAGG Erysiphe_weigelae_AB015932 CAGAGCGTGAGGCTCAGGGCGT-AGCATCT-GCTGCGTG-CTGGGCCAATCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGTTAC-GCCGTC--GCTGG-CCGCAAGG--ACATGCGTAGGCTGCC-GCCC--ACTGGCT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCT-AACCAAAA----CTCATGTT-GTCTTT-GTAGTCT-CAG-TTATATTA----TTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTAC-TTTGA--GTGGCTGCGGTGTTGGGGCACGTCGCGGT--GCGGCGGCTCTAAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGCAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAAAAA-GCCTATTT-------GTTCCAGTCA-CATGGA--TCACAGG Oidium_anacardii_MUMH781_Tanzania CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_bixae_MUMH2606_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAAGACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCACGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_bixae_MUMH3165_Argentina CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_bixae_MUMH3230_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAAGACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCACGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_bixae_MUMH3231_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAAAGACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCACGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_citri_MUMH3210_Malaysia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_citri_VPRI30172_East_Timor CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_citri_VPRI30173_East_Timor CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_heveae_AB193587_Malaysia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCAACATGGA--TCACAGG Oidium_heveae_AB193588_Malaysia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCAACATGGA--TCACAGG Oidium_heveae_AB193589_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCAACATGGA--TCACAGG Oidium_heveae_AB193606_Brazil CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_heveae_AB193607_Brazil CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_MUMH3188_Argentina CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_MUMH3267_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_MUMH3268_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_MUMH3705_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_VPRI18420_Australia CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_VPRI19251_Australia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGA------------------------------------------------------------------- Oidium_mangiferae_VPRI20332_Australia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_VPRI20364_Australia CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTTT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_mangiferae_VPRI20379_Australia CAGAGTGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCTCCGCAAGG--ACATGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_A._auriculiformis_MUMH1805_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_A._auriculiformis_MUMH2546_Malaysia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_A._auriculiformis_MUMH3241_Thailand CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_A._holosericea_VPRI20468_Australia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_A._mangium_VPRI20374_Australia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_A._mangium_VPRI20907_Australia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_Acacia_mangium_MUMH1183_Japan CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_Acacia_sp._MUMH3227_Indonesia CAGAGCGTGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGC-GTCGTC--GCTGCCCCGCAAGG--ACAAGC---GTCGGCC-GCCC--ACCGGTT--TCGG-CTGGAGCGCGCCCGCCAAA-GACCC-CATCAAAA----CTCATGTT-GTTTAT-GTCGTCT-TAG-CTTTATTA---TTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGTTACCTTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGTGAT--ACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGCGGCTTGCCAGAACAACCCACTT-------GCTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_Convolvulus_AF154328 CAGAGTGCGAGGCTCAGT-CGT-GGCATCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCTGCCGTCGTC--GCTGT-CCGCCTGG--ACACGC---GTCGGCC-GCCC--ACCGGTT--TCGA-CTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAAAA--CTCATGTT-GTCTGT-GTCGTCT-TAG-CTTTATAA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAGTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCGTTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGCCTGGTGGCTTGCCAGAACAACCCCTATTG-----GGTCCAGTCA-CATGGA--TCACAGG Oidium_sp._ex_Glycine_AB078800 CAGAGTGCGAGGCTCAGT-CGT-GGCGTCT-GCTGCGTG-CTGGGCCGACCCTCCCACCCGTGTCGA-TTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCCGCTGTT--GCAGT-CCGCATGG--ACATGC---GTCGGCC-GCCCC-CCCGGTG--TTCCACTGGAGCGCGCCCGCCAAA-GACCC-AACCAAAA----CTCATGTT-GTTTGT-ATCGTCT-CAG-CTTTATTA---TGAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAA-CA-CCCCC-TCCAGCTGCCATTGT--GTGGCTGCGGTGTTGGGGCTCGTCGCGAT--GCGGCGGCCCTTAAAGACAGTGGCGGTTCCGACGTGGGCTCTACGCGTAGTAACTT-GCTTCTCGCGACAGAGTGACGAC-GGTGGCTTGCCAGAACAACCCTCTTTT-----GCTCCAGTCA-CATGGA--TCACAGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS) = N: 1-607; CODONPOSSET CodonPositions (CHARACTERS = ITS) = N: 1-607; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M3497] TITLE 28S; LINK TAXA = Taxa2; DIMENSIONS NCHAR=667; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_alphitoides_MUMH242_Japan TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACG-------------------------------------------------- Erysiphe_alphitoides_MUMH960_UK TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCA-------------------- Erysiphe_aquilegiae TAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAG-TTCTCTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTCGGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_convolvuli TAACAGCTCAAATTTGAAATCTGGCTCCCCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATATAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGTCGATCACCTTGAGTTCCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCG-TCCTGATGTCTT Erysiphe_cruciferarum TAACAGCTCAAATTTGAAATCTGGCTCCTTTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTATGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGTTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGGAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_friesii TAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCTACGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_glycines TAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGGTTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATCTAGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTTGGGGAGTGTTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCC-TTT-GGGGTGCATCATCGACCGATCCTGATGTCTT Erysiphe_heraclei TAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGAGGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTTGGGGGCGCATCATCGACCGATCCTGA------ Erysiphe_pulchra TAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCAGAG-TTTTCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_sp._AB197135_Japan TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCC--------- Erysiphe_sp._MUMH885_Japan TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Erysiphe_trifolii TAACAGCTCAAATTTGAAATCTGGCTCCTCTGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCACCTTGCGGTCTCCGCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_anacardii_MUMH781_Tanzania TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_bixae_MUMH3165_Argentina TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_bixae_MUMH3230_Thailand TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_bixae_MUMH3231_Thailand TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_citri_MUMH_3210_Malaysia TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_citri_VPRI30172_Indonesia TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_citri_VPRI30173_Indonesia TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_heveae_MUMH2418_Brazil TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGA------ Oidium_heveae_MUMH2419_Brazil TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_heveae_MUMH2545_Malaysia TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_heveae_MUMH2602_Thailand TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_mangiferae_MUMH3188_Argentina TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_mangiferae_MUMH3267_Thailand TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATACAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_mangiferae_MUMH3268_Thailand TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_mangiferae_MUMH3705_Thailand TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_mangiferae_VPRI18420_Australia TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_mangiferae_VPRI20332_Australia TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGG---------------------------------------------- Oidium_mangiferae_VPRI20346_Australia TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACACGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_mangiferae_VPRI20364_Australia TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_mangiferae_VPRI20379_Australia TAACAGCTCAAATTTGAAATCTGGCTCTTCCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAG-TTCTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_sp._MUMH1183_Japan TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_sp._MUMH1805_Thailand TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATACAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_sp._MUMH2546_Malaysia TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCGC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_sp._MUMH3229_Indonesia TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCGC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_sp._MUMH3241_Thailand TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCTTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCGC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT Oidium_sp._VPRI20907_Australia TAACAGCTCAAATTTGAAATCTGGCTCTTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCGTGAG-TTTTCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCGC-TTT-GGGGCGCATCATCGACCGATCCTGATGTCTT ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 28S) = N: 1-667; CODONPOSSET CodonPositions (CHARACTERS = 28S) = N: 1-667; END; BEGIN TREES; TITLE Tb7934; LINK TAXA = Taxa1; TRANSLATE 1 Oidium_sp._ex_Glycine_AB078800, 2 Oidium_sp._ex_Convolvulus_AF154328, 3 Oidium_sp._ex_Acacia_sp._MUMH3227_Indonesia, 4 Oidium_sp._ex_Acacia_mangium_MUMH1183_Japan, 5 Oidium_sp._ex_A._mangium_VPRI20907_Australia, 6 Oidium_sp._ex_A._mangium_VPRI20374_Australia, 7 Oidium_sp._ex_A._holosericea_VPRI20468_Australia, 8 Oidium_sp._ex_A._auriculiformis_MUMH3241_Thailand, 9 Oidium_sp._ex_A._auriculiformis_MUMH2546_Malaysia, 10 Oidium_sp._ex_A._auriculiformis_MUMH1805_Thailand, 11 Oidium_mangiferae_VPRI20379_Australia, 12 Oidium_mangiferae_VPRI20364_Australia, 13 Oidium_mangiferae_VPRI20332_Australia, 14 Oidium_mangiferae_VPRI19251_Australia, 15 Oidium_mangiferae_VPRI18420_Australia, 16 Oidium_mangiferae_MUMH3705_Thailand, 17 Oidium_mangiferae_MUMH3268_Thailand, 18 Oidium_mangiferae_MUMH3267_Thailand, 19 Oidium_mangiferae_MUMH3188_Argentina, 20 Oidium_heveae_AB193607_Brazil, 21 Oidium_heveae_AB193606_Brazil, 22 Oidium_heveae_AB193589_Thailand, 23 Oidium_heveae_AB193588_Malaysia, 24 Oidium_heveae_AB193587_Malaysia, 25 Oidium_citri_VPRI30173_East_Timor, 26 Oidium_citri_VPRI30172_East_Timor, 27 Oidium_citri_MUMH3210_Malaysia, 28 Oidium_bixae_MUMH3231_Thailand, 29 Oidium_bixae_MUMH3230_Thailand, 30 Oidium_bixae_MUMH3165_Argentina, 31 Oidium_bixae_MUMH2606_Thailand, 32 Oidium_anacardii_MUMH781_Tanzania, 33 Erysiphe_weigelae_AB015932, 34 Erysiphe_weigelae_AB015931, 35 Erysiphe_wallrothii, 36 'Erysiphe syringae-japonicae', 37 Erysiphe_staphyleae, 38 Erysiphe_sp._ex_Quercus_phillyraeoides_AB193590_Japan, 39 Erysiphe_sp._ex_Q._phillyraeoides_MUMH885_Japan, 40 Erysiphe_pulchra_var._pulchra, 41 Erysiphe_pulchra_var._japonica_AB015924, 42 Erysiphe_pulchra_var._japonica_AB000941, 43 Erysiphe_pseudolonicerae, 44 Erysiphe_polygoni_AF011308, 45 Erysiphe_polygoni_AF011307, 46 Erysiphe_pisi_AF073348, 47 Erysiphe_pisi_AF011306, 48 Erysiphe_magnifica, 49 Erysiphe_macleayae, 50 Erysiphe_liriodendri, 51 Erysiphe_lespedezae_AB015923, 52 Erysiphe_lespedezae_AB015921, 53 Erysiphe_katumotoi, 54 Erysiphe_juglandis, 55 Erysiphe_huayinensis, 56 Erysiphe_howeana, 57 Erysiphe_heraclei, 58 Erysiphe_helwingiae, 59 Erysiphe_glycines_AB015934, 60 Erysiphe_glycines_AB015927, 61 Erysiphe_friesii, 62 'Erysiphe euonymi-japonici MUMH2470 Argentina', 63 'Erysiphe euonymi-japonici MUMH133 Japan', 64 Erysiphe_cruciferarum, 65 Erysiphe_convolvuli_AF154327, 66 Erysiphe_convolvuli_AF011298, 67 Erysiphe_castaneigena, 68 Erysiphe_blasti, 69 Erysiphe_betae, 70 Erysiphe_baeumleri_AB015933, 71 Erysiphe_baeumleri_AB015919, 72 Erysiphe_aquilegiae_AF154322, 73 Erysiphe_aquilegiae_AB015929, 74 Erysiphe_aquilegiae_AB000944, 75 Erysiphe_alphitoides_MUMH960_UK, 76 Erysiphe_alphitoides_MUMH242_Japan, 77 Erysiphe_viburni, 78 Erysiphe_vanbruntiana, 79 Erysiphe_trifolii; TREE Fig._1 = [&R] ((((((((((((((((((2,57),69),(44,45)),61),(((((47,46),56),1),((70,71),79)),64)),(66,65)),(52,51)),36),(50,67)),((((24,23,22,21,20,38,39,32,14,13,19,18,(31,29,28),30,(27,26,25),4,10,8,9,3,6,7,5),17,16),11),15,12,76,75,(63,62),43,35)),48),((34,33),55)),((73,72,74,49),68)),((53,37),40)),((42,41),77)),(58,78)),54),(60,59)); END; BEGIN TREES; TITLE Tb7935; LINK TAXA = Taxa2; TRANSLATE 1 Oidium_sp._VPRI20907_Australia, 2 Oidium_sp._MUMH3241_Thailand, 3 Oidium_sp._MUMH3229_Indonesia, 4 Oidium_sp._MUMH2546_Malaysia, 5 Oidium_sp._MUMH1805_Thailand, 6 Oidium_sp._MUMH1183_Japan, 7 Oidium_mangiferae_VPRI20379_Australia, 8 Oidium_mangiferae_VPRI20364_Australia, 9 Oidium_mangiferae_VPRI20346_Australia, 10 Oidium_mangiferae_VPRI20332_Australia, 11 Oidium_mangiferae_VPRI18420_Australia, 12 Oidium_mangiferae_MUMH3705_Thailand, 13 Oidium_mangiferae_MUMH3268_Thailand, 14 Oidium_mangiferae_MUMH3267_Thailand, 15 Oidium_mangiferae_MUMH3188_Argentina, 16 Oidium_heveae_MUMH2602_Thailand, 17 Oidium_heveae_MUMH2545_Malaysia, 18 Oidium_heveae_MUMH2419_Brazil, 19 Oidium_heveae_MUMH2418_Brazil, 20 Oidium_citri_VPRI30173_Indonesia, 21 Oidium_citri_VPRI30172_Indonesia, 22 Oidium_citri_MUMH_3210_Malaysia, 23 Oidium_bixae_MUMH3231_Thailand, 24 Oidium_bixae_MUMH3230_Thailand, 25 Oidium_bixae_MUMH3165_Argentina, 26 Oidium_anacardii_MUMH781_Tanzania, 27 Erysiphe_trifolii, 28 Erysiphe_sp._MUMH885_Japan, 29 Erysiphe_sp._AB197135_Japan, 30 Erysiphe_pulchra, 31 Erysiphe_heraclei, 32 Erysiphe_glycines, 33 Erysiphe_friesii, 34 Erysiphe_cruciferarum, 35 Erysiphe_convolvuli, 36 Erysiphe_aquilegiae, 37 Erysiphe_alphitoides_MUMH960_UK, 38 Erysiphe_alphitoides_MUMH242_Japan; TREE Fig._2 = [&R] ((((((((34,33),(31,27)),35),(((17,16),23,24,22,21,20,(5,14),(2,4,3,1),6,29,28),19,18,25,26,15,10,(13,12))),(9,11,8,7,38,37)),36),30),32); END;