#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:59 GMT TreeBASE (cc) 1994-2008 Study reference: Coburn R.A., Griffin R.H., & Smith S.D. 2015. Genetic basis for a rare floral mutant in an Andean species of Solanaceae. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16161] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=8; TAXLABELS Iochroma_calycinum_KF955587 Iochroma_calycinum_KJ094360 Iochroma_cyaneum_KJ094348 Iochroma_cyaneum_KJ094349 Nicotiana_benthamiana_EF421432 Petunia_hybrida_X14591 Solanum_lycopersicum_NM001247107 Solanum_tuberosum_U47738 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=7; TAXLABELS Iochroma_calycinum_KJ094347 Iochroma_calycinum_KJ094358 Iochroma_cyaneum_KJ094352 Nicotiana_benthamiana_V0.4.2Scf2714_ Petunia_hybrida_AF022142 Solanum_lycopersicum_HQ008775 Solanum_tuberosum_AY102035 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=7; TAXLABELS Iochroma_calycinum_JN593314_ Iochroma_calycinum_KJ094357 Iochroma_cyaneum_GU595064 Nicotiana_benthamiana_V0.4.2._Scf51239 Petunia_hybrida_KC140107 Solanum_lycopersicum_NM001247479 Solanum_tuberosum_AF449422 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=7; TAXLABELS Iochroma_calycinum_KJ094345 Iochroma_calycinum_KJ094346 Iochroma_cyaneum_KJ094354 Nicotiana_benthamiana_V0.4.2.Scf45423 Petunia_hybrida_D14588 Solanum_lycopersicum_SL2.40sc03876 Solanum_tuberosum_AY675558 ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=7; TAXLABELS Iochroma_calycinum_KJ094343 Iochroma_calycinum_KJ094344 Iochroma_cyaneum_KJ094353 Nicotiana_benthamiana_V0.4.2.Scf26509 Petunia_hybrida_AF155332 Solanum_lycopersicum_XM004235959 Solanum_tuberosum_PGSC0003DMC400042656 ; END; BEGIN TAXA; TITLE Taxa6; DIMENSIONS NTAX=7; TAXLABELS Iochroma_calycinum_KJ094342 Iochroma_calycinum_KJ094355 Iochroma_cyaneum_KJ094350 Nicotiana_benthamiana_V0.4.2.Scf28382_ Petunia_hybrida_X14589 Solanum_lycopersicum_XM04238946 Solanum_tuberosum_XM006348549 ; END; BEGIN TAXA; TITLE Taxa7; DIMENSIONS NTAX=7; TAXLABELS Iochroma_calycinum_KJ094356_ Iochroma_calycinum_KJ094359 Iochroma_cyaneum_KJ094351 Nicotiana_benthamiana_V0.4.2_Scf1236 Petunia_hybrida_X70786 Solanum_lycopersicum_AC244195 Solanum_tuberosum_HQ337900 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23373] TITLE Andean_species_of_Solanaceae_ANS_Alignment; LINK TAXA = Taxa7; DIMENSIONS NCHAR=2369; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Iochroma_calycinum_KJ094356_ ATGGTG------AGTGAAGTGGTTCCAACTCCTTCAAGAGTTGAAAGCTTGGCTAAAAGTGGAATCAAGGCCATACCTAAAGAGTATGTGAGGCCACAAGAAGAGTTGAATGGAATAGGAAACATCTTTGAGGAAGAGAAGAAAGATGAAGGACCTCAAGTACCAAAGATTGATCTTAAAGAAATCGACTCAGAGGACAAGGAAATTCGCGAGAGATGCCACCAGGATTTGAAGAAAGCAGCCATGGAGTGGGGTGTGATGCACCTCGTCAACCATGGCATATCGGATGAGTTAATCAATCGTGTCAAGGTTGCCGGAGGTACCTTCTT{CT}GATCTACCTGTTGAAGAGAA{AG}GAGAAGTATGCTAATGATCAACCCTCTGGTAATGTCCAAGGCTATGGCAGCAAGCTAGCAAATAGTGCTTGTGGTCAGCTTGAGTGGGAGGATTACTTCTTTCATTGTGTTTTCCCTGAGGACAAGCGCGACTTGGCCATCTGGCCTAACACCCCTACTGACTACATCCCAGCAACAAGTGAATATGCCAAGCAGATCAGGACCCTAGCAACAAAGATATTTGCAGTGCTATCTATTGGGCTGGGATTGGAAGAAGGAAGACTAGAGAAGGAAGTTGGAGGCACGGAAGACTTGCTGCTTCAAATGAAGATTAACTACTACCCCAAATGCCCCCAACCAGAACTAGCACTTGGCGTCGAAGCTCATACTGATGTGAGTGCACTGACTTTCATCCTCCACAATATGGTACCTGGCTTGCAACTCTTCTATGAAGGAAAATGGGTAACTGCAAAGTGTGTGCCTAATTCCATCATCATGCACATTGGGGATACCATTGAAATCCTAAGCAATGGAAAGTACAAGAGCATTCTTCATAGAGGGGTTGTGAACAAAGAGAAGGTAAGGATTTCATGGGCGATTTTCTGTGAGCCTCCAAAGGAGAAAATCATCCTTAAGCCCCTAGCTGAGATTGTTACCGAGGCTGATCCACCTCGATTCCCACCTCGCACCTTTGCACAGCATATGGCGCACAAGCT{CT}TTCAAGAAGGATGATCAAGATGCTACTGCTGAACACAAAGCATTC---AAGGATGATCAGGATTCTGCTGCTGAACAGAAAGCCTTCAAGAAGGATGATCAGGATGTTGTTGCTGAGCACAAAGTCCTCAAGGAGGACGAACAGGATTCTGCTTTTGAACAGAAAGCCTCCAAAAAGGATGATCAGGATGTTGTT---GCTGAGCACAAAGTCCTCAAGGAGGACGAACAGGATGCTGCTGCTGAACAAAGTCTTCAAGGAGGACGGACAAGATGCTGATGCTGAGCACGAAGTCTTCAAGATGGATGATCAGGATGTTGTTGCGGCATAAAGTCCTCAA{AG}G-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Iochroma_calycinum_KJ094359 ATGGTG------AGTGAAGTGGTTCCAACTCCTTCAAGAGTTGAAAGCTTGGCTAAAAGTGGAATCAAGGCCATACCTAAAGAGTATGTGAGGCCACAAGAAGAGTTGAATGGAATAGGAAACATCTTTGAGGAAGAGAAGAAAGATGAAGGACCTCAAGTACCAAAGATTGATCTTAAAGAAATCGACTCAGAGGACAAGGAAATTCGCGAGAGATGCCACCAGGATTTGAAGAAAGCAGCCATGGAGTGGGGTGTGATGCACCTCGTCAACCATGGCATATCGGATGAGTTAATCAATCGTGTCAAGGTTGCCGGAGGTACCTTCTTTGATCTACCTGTTGAAGAGAAGGAGAAGTATGCTAATGATCAACCCTCTGGTAATGTCCAAGGCTATGGCAGCAAGCTAGCAAATAGTGCTTGTGGTCAGCTTGAGTGGGAGGATTACTTCTTTCATTGTGTTTTCCCTGAGGACAAGCGCGACTTGGCCATCTGGCCTAACACCCCTACTGACTACATTCCAGCAACAAGTGAATATGCCAAGCAGATCAGGAACCTAGCAACAAAGATATTTGCAGTGCTATCTATTGGGCTGGGATTGGAAGAAGGAAGACTAGAGAAGGAAGTTGGAGGCACGGAAGACTTGCTGCTTCAAATGAAGATTAACTACTACCCCAAATGCCCCCAACCAGAACTAGCACTTGGCGTCGAAGCTCATACTGATGTGAGTGCACTGACTTTCATCCTCCACAATATGGTACCTGGCTTGCAACTCTTCTATGAAGGAAAATGGGTAACTGCAAAGTGTGTGCCTAATTCCATCATCATGCACATTGGGGATACCATTGAAATCCTAAGCAATGGAAAGTACAAGAGCATTCTTCATAGAGGGGTTGTGAACAAAGAGAAGGTAAGGATTTCATGGGCGATTTTCTGTGAGCCTCCAAAGGAGAAAATCATCCTTAAGCCCCTAGCTGAGATTGTTACCGAGGCTGATCCACCTCGATTCCCACCTCGCACCTTTGCACAGCATATGGCGCACAAGCTCTTCAAGAAGGATGATCAAGATGCTACTGCTGAACACAAAGCATTC---AAGGATGATCAGGATTCTGCTGCTGAACAGAAAGCCTTCAAGAAGGATGATCAGGATGTTGTTGCTGAGCACAAAGTCCTCAAGGAGGACGAACAGGATTCTGCTTTTGAACAGAAAGCCTCCAAAAAGGATGATCAGGATGTTGTT---GCTGAGCACAAAGTCCTCAAGGAGGACGAACAGGATGCTGCTGCTGAACAAAGTCTTCAAGGAGGACGGACAAGATGCTGATGCTGAGCACGAAGTCTTCAAGATGGATGATCAGGATGTTGTTGCGGCATAAAGTCCTCAGAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Iochroma_cyaneum_KJ094351 ATGGTG------AGTGAAGTGGTTCCAACTCCTTCAAGAGTTGAAAGCTT{AG}{AG}CTAAAGTAGGAATCAAGGCCATACCTAAAGAGTATGTGAGGCCACAAGAAGAGTTAAATGGAATAGGAAACATCTTTGAGGAAGAGAAGAAAGATGAAGGACCTCAAGTACCGACGATTGATCTTAAAGAAATCGACTCAGAGGACAAGGAAATTCGCGAAAAATGCCACCAGGAGTTGAAGAAAGCAGCCATGGAGTGGGGTGTCATGCACCTTGTCAACCATGGCATATCGGATGAGCTAATCAATCGTGTCAAGGTTGCCGGAGGTACCTTCTTTGATCTACCTGTTGAAGAAAAGGAGAAGTATGCTAATGATCAACCCTCTGGTAATGTCCAAGGCTATGGCAGCAAGCTAGCAAATAGTGCTTGTGGTCAGCTTGAGTGGGAGGATTACTTCTTTCATTGTGTTTTCCCCGAGGACAAGCGCGACTTGGCCATCTGGCCTAACACCCCTACTGACTACATTCCAGCAACAAGTGAATATGCCAAGCAGATCAGGAACCTAGCAACAAAGATATTTGCAGTGCTATCTATTGGGCTGGGATTGGAAGAAGGAAGACTAGAGAAGGAAGTTGGAGGCACGGAAGACTTGCTGCTTCAAATGAAGATTAACTACTACCCCAAATGCCCCCAACCAGAACTAGCACTTGGCGTCGAAGCTCATACTGATGTGAGTGCACTGACTTTCATCCTCCACAATATGGTGCCTGGCTTGCAACTCTTCTATGAAGGAAAGTGGGTAACTGCAAAGTGTGTGCCTAATTCCATAATCATGCACATTGGGGATACCATTGAAATCCTAAGCAATGGAAAGTACAAGAGCATTCTTCATAGAGGGGTTGTGAATAAAGAGAGAGTAAGGATTTCATGGGCGATTTTCTGTGAGCCTCCAAAGGAGAAAATCATTCTTAAGCCCCTACCTGAGACTGTCACCGAAGTTAAGCCGCCTCGATTCCCACCTCGCACCTTTGCACAGCATATGGCGCACAAGCTCTTCAAGAAGGATGATCACGATGTTACTGCTGAACACAAAGTATTCAGGAAGGATGATCAGGATTCTGCTGCTGAACAGAAAGCCTTCAAGAAGGATGATCAGGATGTTGTTGCTGAGCACAAAGTCCTCAAGGAGAACGAACAGGATTCTACTTTTGAACAGAAAGCCTCCAAAAAGGATGATCGGGATGTTGTT---GCTGAGCACAAAGTCCTCAAGGAGGACGAACAGGATGCTGCTGCTGAGCACAAAGTCTTCAAGAAGGACGATCAGGATGTTGTTGCGGCATAAAGTCCTCAAGGATGTTGCTGCTGACGAATCTAAATAGTTTATCTTGTTGTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Nicotiana_benthamiana_V0.4.2_Scf1236 ATGGTGGTGATAAGTGCAGTAGTTCCAACTCCTTCAAGAGTTGAAAGCTTGGCTAAAAGTGGAATTCAGGCCATCCCTAAAGAGTATGTGAGGCCACAAGAAGAGTTAAATGGAATAGGAAACATATTTGAGGAAGAGAAGAAAGATGAAGGACCTCAAGTACCGACGATTGATCTGAAAGAAATCGACTCAGAGGACAAGGAAATTCGAGAGAAATGCCACCAAGAGTTGAAGAAAGCAGCTGTGGAATGGGGTGTTATGCACCTTGTTAACCATGGTATATCAGGTCAGCTAATTGATCGCGTCAAGTTTGCCGGAGAGACCTTCTTTGATCAACCTGTTGAAGAAAAGGAGAAATATGCTAATGACCAACCCTCTGGCAATGTCCAACGCTATGGCAGCAAGCTAGCAAATAGTGCGTGTGGTCAGCTTGAATGGGAGGATTATTTCTTCCATTGTATTTTCCCTGAGGACAAGCGCGACTTATCCATTTGGCCGAAAACCCCTCCTGACTACATTCCAGCAACAAGTGAATATGCCAAGCAGATCAGGAACCTAGCAACAAAGATTTTGGCAGTGCTTTCTATTGGGTTGGGACTAGAAGAAGGAAGACTAGAGAAGGAAGTCGGGGGCATGGAGGACCTGCTACTTCAAATGAAGATTAATTACTATCCCAAATGCCCCCAACCAGAACTAGCACTTGGTGTCGAAGCTCATACTGATGTCAGTGCACTGACTTTTATCCTCCACAATATGGTGCCTGGGTTACAACTTTTCTATGAAGGAAAGTGGGTAACGGCAAAATGTGTGCCTAATTCCATAATCATGCATATTGGGGACACCCTTGAAATCCTAAGCAATGGAAAGTACAAGAGCATTCTTCACAGAGGGGTTGTGAATAAAGAGAAAGTAAGAATCTCATGGGCGATTTTCTGTGAGCCGCCAAAGGAGAAGATCATCCTTAGGCCCCTACCTGAGATTATCACTGAGGCTGAGCCAACTCGATTCCCACCTCGCACCTTTGCACAGCATATGGCCCATAAGCTCTTCAAGAAGGATGATCAGGATGCTGCTGTTGAACACAAAGTCTCCAATAAGGTTGACCTGGATTCCGCTGCTGAACACAAACCCTTCAAGGAGGATGATCAGGATGCTGTTGCTCAGTAAAAAGTCCTCAAGGAGGATGAACAGGATGGCGCTGCTGAGCACGAAGTCTTCTAGAAGGATAATCAGGATGCTGCT---------------------------------------------GCTGAAGAATCTAAATGGCTTCTATTGTTGTCATTCTGAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Petunia_hybrida_X70786 ATGGTG------AATGCAGTAGTTACAACTCCTTCAAGAGTTGAAAGCTTGGCTAAAAGTGGAATCCAGGCCATCCCTAAGGAGTATGTGAGGCCACAAGAAGAGTTGAATGGAATCGGAAACATCTTCGAGGAAGAGAAGAAAGATGAAGGGCCTCAAGTACCAACAATTGATTTGAAAGAAATTGACTCCGAGGACAAGGAGATTCGCGAGAAATGCCACCAG---TTGAAGAAAGCAGCCATGGAATGGGGTGTCATGCACCTTGTGAATCATGGCATATCCGATGAGCTAATCAATCGTGTCAAGGTTGCTGGAGAGACCTTCTTTGATCAACCTGTTGAAGAAAAGGAGAAGTATGCTAATGACCAAGCCAATGGCAATGTCCAAGGCTACGGCAGCAAGCTAGCAAATAGTGCTTGTGGTCAGCTTGAGTGGGAGGATTATTTCTTCCATTGTGCTTTCCCTGAAGACAAGCGCGACTTGTCCATCTGGCCTAAAAATCCTACTGACTACACTCCAGCAACAAGTGAATATGCCAAGCAGATCAGGGCCCTAGCAACAAAGATTTTGACAGTGCTTTCTATTGGGCTGGGGCTGGAAGAAGGAAGACTAGAGAAGGAAGTTGGAGGCATGGAGGATCTGCTGCTTCAAATGAAGATTAACTACTATCCCAAGTGCCCCCAACCAGAACTAGCACTTGGCGTCGAAGCTCATACAGATGTCAGCGCACTGACTTTCATCCTCCACAATATGGTGCCCGGCTTGCAACTCTTCTATGAAGGCCAGTGGGTAACTGCTAAGTGTGTGCCTAATTCTATCATCATGCACATAGGGGACACCATTGAAATCCTAAGCAATGGTAAGTACAAGAGCATCCTTCATAGAGGGGTTGTGAATAAAGAGAAAGTAAGGTTCTCATGGGCCATTTTCTGCGAGCCACCTAAGGAGAAGATCATCCTTAAGCCCCTACCTGAGACTGTCACTGAGGCTGAGCCACCTCGATTCCCACCTCGCACCTTTGCACAGCATATGGCACACAAGCTCTTCAGGAAGGATGACAAGGATGCCGCTGTTGAACACAAAGTCTTCAATGAGGATGAACTGGATACTGCTGCTGAACATAAGGTCCTCAAGAAGGATAATCAGGATGCTGTTGCTGAGAATAAAGACATCAAGGAGGATGAACAGTGTGGCCCTGCTGAGCACAAAGATATCAAGGAGGATGGACAGGGTGCCGCT---GCTGAGAACAAAGTCTTCAAGGAGAATAATCAGGATGTTGCTGCTGAAGAATCTAAATAGTTTCTCTTGCTGTCATAGTTTGATGGCTTAATATGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Solanum_lycopersicum_AC244195 ATGGTG------AGTGAAGTGGTTTCAATTCCTTCAAGAGTTGAAAGCTTGGCTAAAAGTGGAATCCAAGTCATTCCTAAAGAGTATGTGAGGCCACAAGAAGAGTTAAATGGTATAGGAAACATCTTTGAGGAAGAGAAGAAAGATGAAGGACCTCAAGTACCGACGATTAATCTAAAAGAAATTGACTCAGAGGACAAGGAAATTCGCAAAAAATGCCACCAGGAGTTGAAGAAAGCAGCGGTAGAGTGGGGTGTTATGCACCTCGTTAACCATGGGATATCGGATGAGCTAATTGAACGTGTCAAGGTTGCTGGAAGGACCTTTTTTGATCTACCTGTTGAAGAGAAGGAGAAGTATGCTAATGATCAAGCTTCTGGTAATGTCCAAGGCTATGGAAGCAAGCTAGCAAATAGTGCTTGTGGTCAGCTTGAGTGGGAGGATTACTTCTTTCATTGTGTTTTCCCCGAGGACAAGCGCGATTTGGCCATCTGGCCTAAAACCCCTGCTGACTACAGTCCAGCAACAAGTGAATATGCCAAGCAGATCAGGAACCTAGCAACAAAGATTTTTGCAGTGCTTTCGATTGGGTTGGGATTGGAGGAAGGAAGACTAGAGAAGGAAGTTGGAGGCATGGAAGACTTGCTGCTTCAAATGAAGATTAACTACTACCCCAAATGTCCCCAACCAGAACTAGCACTTGGCGTCGAAGCTCATACTGATGTGAGTGCACTGACGTTCATCCTCCACAATATGGTGCCTGGCTTGCAACTCTTTTATGAAGAGAAGTGGGTAACTGCAAAGTGTGTGCCTAATTCCATAATTATGCACATTGGGGATACAATTGAAATCCTAAGCAACGGAAAGTACAAGAGCATTCTTCACAGAGGGGTTGTGAACAAAGAGAAAGTAAGGATTTCATGGGCTATTTTCTGTGAGCCTCCAAAGGAGAAGATTATGCTTAAGCCCCTACCTGAGACTGTCACCGCGGCTGAGCCATCTCAATTCCCACCTCGCACCTTTGCACAACATATGGCACACAAGCTTTTCAAGAAGGATAATAACGATGCTGTTGTTGAACAAAAAGTATTCACGAAGGATGATCAGGATTCTGCTGCTGTACATAAAGCCTCCGAAAAGGATGAACGTGATATTGTTGCTGAGCACATAGTCCTCAAGGAAGACGAACAGGATTTTGCTGCTGAACAGAAAGCCTTCAAGAAGGTTGATCAGGATATTGTTCTTGCTGAGCGCAAAGTTCTCAAGGAGGATGAGCAGGATGCAGTTGCTGAGCTCAAAGTTTTTCAAGAAGGATGATCAGGATGTTGTTACTGAGCATAAAGTCCTCAAGGATGTTCCTGCTGAAGAATCTGAATAGTTTCTCTTATT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Solanum_tuberosum_HQ337900 ATGGTG------AGTGAAGTGGTTCCAACTCCTTCAAGAGTTGAAAGCTTGGCTAAAAGTGGAATCCAAGTCATTCCTAAAGAGTATGTGAGGCCACAAGAAGAGTTAAATGGTATAGGAAACATCTTTGAGGATGAGAAGAAAGATGAAGGACCTCAAGTACCGACAATTAATCTGAAAGAAATCGACTCAGAGGACAAGGAAATTCGCGAAAAATGCCACCAGGAGCTGAAGAAAGCAGCAGTGGAGTGGGGTGTCATGCACCTCGTTAACCATGGGATATCGGATGAGCTAATTGAACGTGTCAAGGTTGCTGGAAGTACCTTTTTTGATTTACCTGTTGAAGAGAAGGAGAAGTATGCTAATGATCAAGCTTCTGGTAATGTCCAAGGCTATGGCAGCAAGCTAGCAAATAGTGCTTGTGGTCAGCTTGAGTGGGAGGATTACTTCTTTCATTGTGTTTTCCCCAAGGACAAGCGCGACTTGGCCATCTGGCCTAAAACCCCTGCTGACTACATTCCAGCAACAAGTGAATATGCCAAGCAGATCAGGAACCTAGCAACAAAGATTTTTGCAGTGCTTTCGATTGGGTTGGGATTGGAAGAAGGAAGACTAGAGAAGGGAGTTGGAGGCATGGAAGACTTGCTGCTTCAAATGAAGATTAACTACTACCCCAAATGTCCCCAACCAGAACTAGCACTTGGCGTCGAAGCTCATACTGATGTGAGTGCACTGACTTTCATTCTCCACAATATGGTCCCTGGCTTGCAACTCTTTTATGAAGGGAAGTGGGTAACTGCAAAGTGTGTGCCTAATTCCATAATCATGCACATTGGGGATACCATTGAAATCCTAAGCAATGGAAAGTACAAGAGCATTCTTCACAGAGGGGTTGTGAACAAAGAGAAAGTAAGGATTTCATGGGCTATTTTCTGTGAGCCTCCAAAGGAGAAGATTATGCTTAAGCCCCTACCTGAGACTGTCACCGAGGCTGAGCCATCTCAATTCCCACCTCGCACCTTTGCACAGCATATGGCACACAAGCTTTTCAAGAAGGATGATAACGATGCTGCTGCTGAACAAAAAGTATTCAAGAAGGATGATCAGGATTCTGCTGCTGTACACAAAGCCTCTGAAAAGGATGATCGCGTTATTGTTGCGGAGCACATAGTCCTCAAGGAGGACAAACAAGATTCTGCTGCTGAACAGAAAGCCTTCAAGAAGGTTGATCAGGTTATTGTT---GCTGAGTGCAAAGTCCTCAAGGAGGACGAGCAGGATGCAGTTGCTGAGCACAAAGTCTTCAAGAAGGATGATCAGGATGTTGTTACTGAGCATAAAGTCCTCAAACATGTTCCTGTTGAAGAATCTGAATAG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = Andean_species_of_Solanaceae_ANS_Alignment) = N: 1390-2369, 1: 1-1389\3, 2: 2-1390\3, 3: 3-1391\3; CODONPOSSET CodonPositions (CHARACTERS = Andean_species_of_Solanaceae_ANS_Alignment) = N: 1390-2369, 1: 1-1389\3, 2: 2-1390\3, 3: 3-1391\3; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23382] TITLE Andean_species_of_Solanaceae_CHS_Alignment; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1170; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Iochroma_calycinum_KF955587 ATGATGACGGTGGAGGAGGTTCGAAGGGCGCAACGTGCCAAGGGGCCAGCCACCATCATGGCCATTGGCACGGCGACTCCTTCGAATTGTGTTGATCAAAGCACCTATCCTGACTATTATTTTCGAATTACTAATAGTGAACATATGACTGAGCTTAAGGAGAAATTTAAGCGCATGTGTGATAAATCAATGATTAAGAAGAGATATATGCACTTAACGGAAGAAATCCTGAAAGAAAACCCTAATATATGTGAATACATGGCTCCTTCTCTTGATGCTAGGCAAGACATAGTGGTGGTTGAAGTGCCAAAACTTGGCAAAGAAGCAGCCCAAAAGGCCATTAAAGAATGGGGCCAGCCCAAGTCCAAGATTACCCATTTAGTCTTTTGCACCACTAGTGGGGTGGACATGCCCGGGGCCGACTACCAACTCACTAAGCTGCTTGGGCTTAGGCCCTCAGTCAAGCGACTCATGATGTACCAACAAGGTTGCTTTGCTGGTGGGACCGTTATCCGACTAGCAAAGGACTTGGCCGAAAACAACAAGGGTGCTCGAGTCCTTGTTGTTTGCTCAGAGATCACTGCAGTTACTTTTCGTGGCCCAAGTGATACTCACTTGGATAGTATGGTGGGACAAGCCCTTTTTGGTGATGGGGCAGCCGCGATCATTATAGGTTCTGACCCATTACCAGGGGTTGAAAGGCCTTTGTTTGAGCTTGTCTCTGCGGCCCAAACTCTTCTCCCCGATAGCGAGGGGGCTATCGATGGTCACCTTCGTGAAGTTGGGCTAACATTTCACTTACTTAAAGATGTTCCTGGATTGATCTCACAGAACATTGAGAAGAGTTTGATAGAAGCATTCCAACCATTGGGCATTTCTGATTGGAATTCTGTCTTTTGGATCGCGCACCCTGGTGGGCCGGCCATTCTGGACCAAGTTGAATTAAAGTTGGGCCTAAAGCCCGAAAAACTTCGGGCTACTAGGCAAGTCTTGAGTGACTATGGAAACATGTCTAGTGCTTGTGTTCTGTTTATTTTGGATGAAATCAGGAAGGCCTCAGCCAAAGAAGGGCTTAGTACTACTGGTGAAGGCCTTGATTGGGGTGTGCTTTTTGGATTTGGGCCTGGGCTTACAGTTGAGACTGTTGTACTCCATAGTGTCTCTACTTAG Iochroma_calycinum_KJ094360 ATGATGACGGTGGAGGAGGTTCGAAGGGCGCAACGTGCCAAGGGGCCAGCCACCATCATGGCCATTGGCACGGCGACTCCTTCGAATTGTGTTGATCAAAGCACCTATCCTGACTATTATTTCCGAATTACTAATAGTGAACATATGACTGAGCTTAAGGAGAAATTTAAGCGCATGTGTGATAAATCAATGATTAAGAAGAGATATATGCACTTAACGGAAGAAATCCTGAAAGAAAACCCTAATATATGTGAATACATGGCTCCTTCTCTTGATGCTAGGCAAGACATAGTGGTGGTTGAAGTGCCAAAACTTGGCAAAGAAGCAGCCCAAAAGGCCATTAAAGAATGGGGCCAGCCCAAGTCCAAGATTACCCATTTAGTCTTTTGCACCACTAGTGGGGTGGACATGCCCGGGGCCGACTACCAACTCACTAAGCTGCTTGGGCTTAGGCCCTCAGTCAAGCGACTCATGATGTACCAACAAGGTTGCTTTGCTGGTGGGACCGTTATCCGACTAGCAAAGGACTTGGCCGAAAACAACAAGGGTGCTCGAGTCCTTGTTGTTTGCTCAGAGATCACTGCAGTTACTTTTCGTGGCCCAAGTGATACTCACTTGGATAGCATGGTGGGACAAGCCCTTTTTGGTGATGGGGCAGCCGCGATCATTATAGGTTCTGACCCATTACCAGGGGTTGAAAGGCCTTTGTTTGAGCTTGTCTCTGCGGCCCAAACTCTTCTCCCCGATAGCGAGGGCGCTATCGATGGTCACCTTCGTGAAGTTGGGCTAACATTTCACTTACTTAAAGATGTTCCTGGATTGATCTCACAGAACATTGAGAAGAGTTTGATAGAAGCATTCCAACCATTGGGCATTTCTGATTGGAATTCTGTCTTTTGGATCGCGCACCCTGGTGGGCCGGCCATTCTGGACCAAGTTGAATTAAAGTTGGGCCTAAAGCCCGAAAAACTTCGGGCTACTAGGCAAGTCTTGAGTGACTATGGAAACATGTCTAGCGCTTGTGTTCTGTTTATTTTGGATGAAATCAGGAAGGCCTCAGCCAAAGAAGGGCTTAGTACTACTGGTGAAGGCCTTGATTGGGGTGTGCTTTTTGGATTTGGGCCTGGGCTAACAGTTGAGACTGTTGTACTCCATAGTGTCTCTACTTAG Iochroma_cyaneum_KJ094348 ATGGTCACGGTGGAGGAGGTTCGAAGGGCGCAACGTGCCAAGGGGCCAGCCACCATCATGGCCATTGGCACGGCGACTCCTTCGAATTGTGTTGATCAAAGCACCTATCCTGACTATTATTTTCGAATTACTAATAGTGAACATATGACTGAGCTTAAGGAGAAATTTAAGCGCATGTGTGATAAATCAATGATTAAGAAGAGATATATGCACTTAACGGAAGAAATCCTGAAAGAAAACCCTAATATTTGTGAATATATGGCTCCTTCTCTTGATGCTAGGCAAGACATAGTGGTGGTTGAAGTGCCAAAACTTGGCAAAGAAGCAGCCCAAAAGGCCATTAAAGAATGGGGCCAGCCCAAGTCCAAGATTACCCATTTAGTCTTTTGCACCACTAGTGGGGTGGACATGCCCGGGGCCGACTACCAACTCACTAAGCTTCTTGGGCTTAGGCCCTCAGTCAAGCGACTCATGATGTACCAACAAGGTTGCTTTGCTGGTGGGACCGTTATCCGACTAGCAAAGGACTTGGCCGAAAACAACAAGGGTGCTCGAGTCCTTGTTGTTTGCTCGGAGATCACTGCAGTTACTTTTCGTGGCCCAAGTGATACTCACTTGGATAGCATGGTCGGACAAGCCCTTTTTGGTGATGGGGCAGCCGCGATCATTATAGGTTCTGACCCATTACCAGGAGTTGAAAGGCCTTTATTTGAGCTTGTCTCTACGGCCCAAACTCTTCTCCCCGATAGCGAGGGCGCTATCGATGGTCACCTTCGTGAAGTTGGGCTAACATTTCACTTACTTAAAGATGTTCCTGGATTGATCTCAAAGAACATTGAGAAGAGTTTGATAGAAGCATTCCAACCATTGGGCATTTCTGATTGGAATTCTGTCTTTTGGATCGCGCACCCTGGTGGGCCGGCCATTCTGGACCAAGTTGAATTAAAGTTGGGCCTAAAGCCCGAAAAACTTCGGGCTACTAGGCAAGTCTTGAGTGACTATGGAAACATGTCTAGTGCTTGTGTTCTATTTATTTTGGATGAAATGAGAAAGGCCTCAGCCAAAGAAGGGCTTAGTACTACTGGTGAAGGCCTTGATTGGGGTGTGCTTTTTGGATTTGGGCCTGGGCTAACAGTTGAGACTGTTGTACTCCATAGTGTCTCTACTTAG Iochroma_cyaneum_KJ094349 ATGGTCACGGTGGAGGAGGTTCGAAGGGCGCAACGTGCCAAGGGGCCAGCCACCATCATGGCCATTGGCACGGCGACTCCTTCGAATTGTGTTGATCAAAGCACCTATCCTGACTATTATTTTCGAATTACTAATAGTGAACATATGACTGAGCTTAAGGAGAAATTTAAGCGCATGTGTGATAAATCAATGATTAAGAAGAGATATATGCACTTAACGGAAGAAATCCTGAAAGAAAACCCTAATATTTGTGAATACATGGCTCCTTCTCTTGATGCTAGGCAAGACATAGTAGTGGTTGAAGTGCCAAAACTTGGCAAAGAAGCAGCCCAAAAGGCCATTAAAGAATGGGGCCAGCCCAAGTCCAAGATTACCCATTTAGTCTTTTGCACCACTAGTGGGGTGGACATGCCCGGGGCCGACTACCAACTCACTAAGCTTCTTGGGCTTCGGCCCTCGGTCAAGCGACTCATGATGTACCAACAAGGTTGCTTTGCTGGTGGGACCGTTATCCGACTAGCAAAGGACTTGGCCGAAAACAACAAGGGTGCTCGAGTCCTTGTTGTTTGCTCGGAGATCACTGCAGTTACTTTTCGTGGCCCAAGTGATACTCACTTGGATAGCATGGTCGGACAAGCCCTTTTTGGTGATGGGGCAGCCGCGATCATTATAGGTTCTGACCCATTACCAGGGGTTGAAAGGCCTTTGTTTGAGCTTGTCTCTGCGGCCCAAACTCTTCTCCCCGACAGCGAGGGCGCTATCGATGGTCACCTTCGTGAAGTTGGGCTAACATTTCACTTACTTAAAGATGTTCCTGGATTGATCTCAAAGAACATTGAGAAGAGTTTGATAGAAGCATTCCAACCATTGGGCATTTCTGATTGGAATTCTGTCTTTTGGATCGCGCACCCTGGTGGGCCGGCCATTCTGGACCAAGTTGAATTAAAGTTGGGCCTAAAGCCCGAAAAACTTCGGGCTACTAGGCAAGTCTTGAGTGACTATGGAAACATGTCTAGTGCTTGTGTTCTATTTATTTTGGATGAAATGAGAAAGGCCTCAGCCAAAGAAGGGCTTAGTACTACTGGTGAAGGCCTTGATTGGGGTGTGCTTTTTGGATTTGGGCCTGGGCTAACAGTTGAGACTGTTGTACTCCATAGTGTCTCTACTTAG Nicotiana_benthamiana_EF421432 ATGGTGACCGTCGAGGAATTTCGTAGGGCGCAACGTGCGGAGGGTCCAGCCACAGTCATGGCCATCGGAACAGCCACACCTTTCAACTGTGTTGATCAAAGCACTTACCCTGATTATTATTTTCGTATCACTAATAGCGAGCATAAGACTGAGCTTAAGGAGAAATTTAAGCGCATGTGTGAAAAATCGATGATTAAGAAGAGGTACATGCACTTAACTGAGGAAATCTTGAAAGAGAACCCTAATATTTGTGCATACATGGCACCTTCTCTTGATGCTAGACAAGACATAGTGGTGGTTGAAGTGCCAAAACTTGGTAAAGAGGCAGCCCAAAAGGCCATCAAAGAATGGGGCCAGCCCAAATCCAAAATTACTCATTTGGTCTTTTGTACAACTAGTGGTGTAGACATGCCCGGGTGTGACTACCAACTCACTAAGCTACTCGGACTCCGTCCGTCGGTCAAGCGGTTCATGATGTACCAACAAGGTTGCTTTGCCGGTGGGACGGTACTCCGGATGGCTAAGGACTTGGCAGAAAATAACAAGGGCGCTCGAGTCCTTGTTGTTTGCTCAGAGATCACCGCTGTCACGTTCCGTGGGCCCAATGACACCCACTTGGATAGTTTGGTTGGGCAAGCCCTCTTTGGTGATGGGGCAGCCGCGGTCATTATAGGTTCTGATCCAATTCCAGAAGTCGAGAGGCCTTTGTTCCAGCTTGTCTCTGCAGCCCAAACTCTCCTCCCCGATAGCGAAGGCGCTATCGATGGTCACCTTCGTGAAGTTGGCCTTACATTCCACTTACTCAAAGATGTTCCTGGGCTTATCTCAAAAAACATTGAGAAAAGCCTTGTGGAAGCATTTCAACCATTGGGAATTTCTGATTGGAACTCTTTATTTTGGATTGCTCACCCTGGTGGGCCTGCAATTTTGGACCAAGTTGAACTAAAATTGGGCCTAAACCAAGAGAAACTTAAGGCTACAAGAAATGTATTAACCAACTATGGCAACATGTCAAGTGCTTGTGTATTGTTTATCTTGGATGAAATGAGAAAGGCCTCTGCAAAAGAAGGTTTAGGAACTACTGGTGAAGGGCTTGAATGGGGTGTACTTTTTGGATTTGGGCCTGGGCTTACAGTTGAGACTGTTGTTCTCCACAGTGTTGCTACTTAG Petunia_hybrida_X14591 ATGGTGACAGTCGAGGAGTATCGTAAGGCACAACGTGCTGAAGGTCCAGCCACTGTCATGGCCATTGGAACAGCCACACCTACAAACTGTGTTGATCAAAGCACTTACCCTGATTATTATTTTCGTATCACTAACAGTGAGCACAAGACTGATCTTAAGGAGAAATTTAAGCGCATGTGTGAAAAATCAATGATTAAGAAAAGGTACATGCACTTAACAGAGGAAATCTTGAAAGAGAATCCTAGTATGTGTGAATACATGGCACCTTCTCTTGATGCTAGGCAAGACATAGTGGTGGTTGAAGTGCCCAAACTTGGCAAAGAGGCAGCCCAAAAGGCTATCAAGGAATGGGGCCAGCCCAAGTCCAAAATTACCCATTTGTTCTTTTGCACAACTAGTGGTGTGGACATGCCTGGGTGTGACTATCAACTCACTAAGCTACTTGGGCTTCGTCCATCGGTCAAGAGGCTCATGATGTACCAACAAGGTTGCTTTGCTGGTGGCACGGTTCTTCGGTTAGCCAAGGACTTGGCGGAAAACAACAAGGGCGCTCGAGTCCTTGTTGTTTGTTCAGAAATCACCGCGGTCACCTTCCGTGGGCCAAATGATACTCATTTGGATAGTTTAGTTGGCCAAGCCCTTTTTGGTGATGGGGCAGGCGCGATCATTATAGGTTCTGATCCAATTCCAGGAGTCGAGAGGCCTTTGTTCGAGCTCGTTTCAGCAGCCCAAACTCTTCTCCCAGATAGCCATGGTGCTATTGATGGCCATCTCCGTGAAGTTGGGCTTACATTCCACTTACTCAAAGATGTTCCTGGGCTGATCTCAAAAAATATTGAGAAGAGCCTTGAGGAAGCATTTAAACCTTTGGGCATTTCTGATTGGAACTCTCTATTCTGGATTGCTCATCCAGGTGGGCCTGCAATTTTGGACCAAGTTGAAATAAAGTTGGGCCTAAAGCCCGAGAAACTTAAGGCTACAAGGAATGTGTTAAGTGACTATGGTAACATGTCAAGTGCTTGTGTACTGTTTATTTTGGATGAAATGAGAAAGGCCTCAGCCAAAGAAGGTTTAGGAACTACTGGTGAAGGGCTTGAGTGGGGTGTTCTTTTTGGATTTGGGCCTGGGCTAACAGTTGAGACTGTTGTCCTCCACAGTGTTGCTACTTAA Solanum_lycopersicum_NM001247107 ATGGTCACCGTTGAGGAGGTTCGAAGGGCGCAACGTGCAAAGGGACCAGCTACTATCATGGCCATAGGCACGGCGACTCCTTCGAACTGTGTTGATCAAAGCACTTATCCTGATTATTATTTTCGAATCACTAATAGTGAACATATGACTGAGCTTAAGGAGAAATTTAAGCGCATGTGTGATAAATCGATGATTAATAAGAGATATATGCATTTAACTGAAGAAATTTTAAAAGAAAACCCAAATATTTGTGAATACATGGCTCCTTCTTTGGATGCTAGACAAGATATAGTGGTGGTTGAAGTGCCAAAACTTGGCAAAGAAGCAGCCCAAAAGGCCATTAAAGAATGGGGTCAGCCCAAGTCCAAGATCACCCATGTGGTCTTTTGCACCACTAGTGGGGTGGACATGCCTGGGGCCGACTACCAACTCACCAAGCTTCTTGGGCTTCGACCTTCGGTTAAGCGGCTCATGATGTATCAACAAGGTTGCTTTGCTGGTGGGACCGTTATCCGACTGGCAAAGGACTTAGCTGAGAACAACAAGGGTGCTCGAGTTCTTGTTGTTTGCTCAGAGATCACTGCAGTTACTTTTCGTGGTCCAAGTGATACTCATTTGGATAGTATGGTTGGACAAGCCCTTTTTGGTGATAGGGCAGCCGCAATGATTATAGGTTCAGATCCATTACCAGAAGTTGAAAGGCCTTTGTTTGAACTCGTCTCTGCAGCCCAAACTCTACTCCCTGATAGCGAAGGTGCTATTGATGGTCACCTTCGCGAAGTTGGGCTAACATTTCACTTGCTCAAAGATGTTCCTGGATTGATCTCGAAAAACATTGAAAAGAGTTTAATTGAAGCATTCCAACCGTTAGGCATTTCTGATTGGAATTCCATCTTTTGGATCGCGCACCCTGGTGGGCCGGCGATTCTAGATCAAGTTGAACTAAAACTGAGCCTAAAGCCCGAAAAACTTCGGGCTACTAGGCAAGTTTTAAGTGACTATGGAAATATGTCTAGTGCTTGTGTTCTATTTATTTTAGATGAAATGAGAAAGGCCTCATCCAAAGAAGGGCTTAGTACCACAGGTGAAGGCCTTGATTGGGGTGTACTTTTTGGATTTGGGCCTGGGCTTACTGTTGAGACTGTTGTGCTCCATAGTGTGTCTACTTAG Solanum_tuberosum_U47738 ATGGTCACCGTAGAGGAGGTTCGAAAGGCGCAACGTGCAAAGGGGCCGGCTACTATCATGGCCATAGGCACGGCGACTCCTTCGAACTGTGTTGATCAAAGCACTTATCCTGATTATTATTTTCGAATTACTAATAGCGAGCATATGACTGAGCTTAAAGAGAAATTTAAGCGCATGTGTGATAAATCAATGATTAATAAGAGATATATGCACTTAACAGAGGAAATTCTGAAAGAGAACCCAAATATTTGTGAATACATGGCTCCTTCGCTTGATGCTAGGCAAGATATAGTGGTGGTTGAAGTGCCAAAACTTGGCAAAGAAGCAGCCCAAAAGGCCATTAAAGAATGGGGCCAGCCCAAGTCCAAGATTACCCATGTGGTCTTTTGCACCACTAGTGGGGTGGACATGCCTGGGGCTGACTACCAACTCACTAAGCTTCTTGGTCTTCGACCTTCGGTCAAGCGACTCATGATGTACCAACAAGGTTGCTTTGCTGGTGGGACTGTTATCCGACTGGCAAAGGACTTAGCTGAAAACAACAAGGGTGCTCGAGTCCTTGTTGTTTGCTCAGAGATCACTGCAGTTACTTTTAGTGGCCCAAGTGATACTCACTTGGATAGTATGGTTGGACAAGCCCTTTTTGGTGATGGGGCAGCTGCGATGATTATAGGTTCAGATCCATTACCAGAAGTTGAAAGGCCTTTGTTTGAACTCGTCTCTGCAGCCCAAACTCTCCTCCCTGATAGCGAAGGTGCTATTGATGGTCACCTTCGCGAAGTTGGGCTAACATTTCATTTACTCAAAGATGTTCCTGGATTGATCTCAAAAAACATCGAAAAGAGTTTGATTGAAGCATTCCAACCGTTAGGCATTTCTGATTGGAACTCTATCTTTTGGATCGCTCACCCTGGTGGGCCGGCAATTCTTGACCAAGTTGAACTAAAATTGGGCCTAAAGCCCGAAAAACTTCAGGCTACTAGGCAAGTTTTAAGTGACTATGGAAATATGTCTAGTGCTTGTGTTCTATTTATTTTAGATGAAATGAGAAAGGCCTCATCCAAAGAAGGGCTTAGTACCACTGGTGAAGGCCTTGATTGGGGTGTACTTTTTGGATTTGGGCCTGGGCTTACAGTTGAGACTGTTGTGCTCCATAGTGTGTCTACTTAG ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = Andean_species_of_Solanaceae_CHS_Alignment) = 1: 1-1168\3, 2: 2-1169\3, 3: 3-1170\3; CODONPOSSET CodonPositions (CHARACTERS = Andean_species_of_Solanaceae_CHS_Alignment) = 1: 1-1168\3, 2: 2-1169\3, 3: 3-1170\3; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23379] TITLE 'Andean species of Solanaceae F3''H Alignment'; LINK TAXA = Taxa5; DIMENSIONS NCHAR=1565; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Iochroma_calycinum_KJ094343 ATGGCAATCTTTTTCATAATTCTATACACTATTATTTTTTCTTTTCTTCTACACTCCATTCTTAGCTTATTTTTTCTTAAACGTTACCCAGTGCCACTACCACCTGGTCCAAAACCATGGCCAATAATTGGAAACATAGTCCATCTAGGTCCCAAACCGCACCAATCCATTGCAGACATGGCGCGAACTTACGGGCCATTCATGCACCTACGCATGGGGTTCGTGGACGTGGTGGTTGCGGCTTCGGCTTCAGTTGCAGCTCAGTTCTTGAAAACCCATGATGCTAACTTCTCGAGCCGCCCACCGAACTCTGGCGCTAAGCACTTGGCTTATAATTACCATGACCTTGTTTTTGCACCTTATGGACCACGGTGGCGTATGCTTAGGAAAATATGTTCTGTTCATCTTTTCTCCGCCAAGGCTTTAGATGACTTCCGCCATGTCCGTCAGGAAGAAGTCAGAACACTTACCCGCGCCCTAGCAAATGCTAGCCAAAAGCCAGTCAAATTAGGGCAGCTGTTAAACGTGTGCACCACGAATTCCCTTGCGCGAGTGATGCTAGGGAAGCGGGTATTCGCCGACGGCACCGGCGGTATTGATCCACAGGCGGAGGAGTTCAAGTCAATGGTGGTGGAGATGATGGTACTCGCCGGCGTTTTCAACATCGGCGATTTTATTCCGGCACTTGATTGGATGGACATTCAAGGGGTAGCTGGAAAAATGAAGAAGCTCCACGCGCGTTTCGACGCGTTTTTGACCTCGATCCTCGAAGAGCATAAGGGGAAGAGAATTGGAGAAATGAAGGAACAGGGGGACTTGTTGAGTACGTTGATCTCTTTGAAAAATGAAGATGATGATGATAACGGAGGAAAGCTTACTGATACAGAAATTAAAGCTTTACTTTTGAACTTGTTTGTAGCTGGTACAGACACGTCCTCTAGCACAGTGGAATGGGCCATTGCAGAGCTTATTCGTAACCCAAGAATACTGGCCCAGGTCCAGCAGGAGATTGACAAGGTAGTTGGAAGAAACCGGCTCGTTATGGAATCTGACCTGGCCCAATTGACTTATTTGGAAGCCATAGTCAAGGAAACCTTTAGGCTTCATCCATCAACCCCTCTCTCCCTCCCTAGAATTGCATCCGAGAGCTGTGAGATAAATGGCTACTTCATTCCAAAAGGCTCGACACTTCTCGTTAACGTTTGGGCCATTGCTCGTGATCCAAATGAATGGGCTGATCCATTAGAGTTTAGGCCCGAAAGATTCTTGCCTGGAGGTGAGAAGCCCAAAGTTGATGTCAAAGGAAATGACTTCGAAGCAATTCCATTTGGTGCTGGGCGTAGAATATGTGCTGGAATGAGTTTGGGTATACGCATGGTCCAGTTGATGACTGCAACTTTGATCCATTCATTTAACTGGGATTTGCCCAATGGACAATTGCCAGAGAAACTAAACATGGAGGAAGCATATGGGCTGACATTACAACGCGCTGATCCATTAGTGGTGCACCCAAGGCCTCGGTTAGAAGCCCAAGTATACGGCAGTGAATAG-------------- Iochroma_calycinum_KJ094344 ATGGCAATCTTTTTCATAATTCTATACACTATTATTTTTTCTTTTCTTCTACACTCCATTCTTAGCTTATTTTTTCTTAAACGTTACCCAGTGCCACTACCACCTGGTCCAAAACCATGGCCAATAATTGGAAACATAGTCCATCTAGGTCCCAAACCGCACCAATCCATTGCAGACATGGCGCGAACTTACGGGCCATTCATGCACCTACGCATGGGGTTCGTGGACGTGGTGGTTGCGGCTTCGGCTTCAGTTGCAGCTCAGTTCTTGAAAACCCATGATGCTAACTTCTCGAGCCGCCCACCGAACTCTGGCGCTAAGCACTTGGCTTATAATTACCATGACCTTGTTTTTGCACCTTATGGACCACGGTGGCGTATGCTTAGGAAAATATGTTCTGTTCATCTTTTCTCCGCCAAGGCTTTAGATGACTTCCGCCATGTCCGTCAGGAAGAAGTCAGAACACTTACCCGCGCCCTAGCAAATGCTAGCCAAAAGCCAGTCAAATTAGGGCAGCTGTTAAACGTGTGCACCACGAATTCCCTTGCGCGAGTGATGCTAGGGAAGCGGGTATTCGCCGACGGCACCGGCGGTATTGATCCACAGGCGGAGGAGTTCAAGTCAATGGTGGTGGAGATGATGGTACTCGCCGGCGTTTTCAACATCGGCGATTTTATTCCGGCACTTGATTGGATGGACATTCAAGGGGTAGCTGGAAAAATGAAGAAGCTCCACGCGCGTTTCGACGCGTTTTTGACCTCGATCCTCGAAGAGCATAAGGGGAAGAGAATTGGAGAAATGAAGGAACAGGGGGACTTGTTGAGTACGTTGATCTCTTTGAAAAATGAAGATGATGATGATAACGGAGGAAAGCTTACTGATACAGAAATTAAAGCTTTACTTTTGAACTTGTTTGTAGCTGGTACAGACACGTCCTCTAGCACAGTGGAATGGGCCATTGCAGAGCTTATTCGTAACCCAAGAATACTGGCCCAGGTCCAGCAGGAGATTGACAAGGTAGTTGGAAGAAACCGGCTCGTTATGGAATCTGACCTGGCCCAATTGACTTATTTGGAAGCCATAGTCAAGGAAACCTTTAGGCTTCATCCATCAACCCCTCTCTCCCTCCCTAGAATTGCATCCGAGAGCTGTGAGATCAATGGCTACTTCATTCCAAAAGGCTCGACACTTCTCGTTAACGTTTGGGCCATTGCTCGTGATCCAAATGAATGGGCTGATCCATTAGAGTTTAGGCCCGAAAGATTCTTGCCTGGAGGTGAGAAGCCCAAAGTTGATGTCAAAGGAAATGACTTCGAAGCAATTCCATTTGGTGCTGGGCGTAGAATATGTGCTGGAATGAGTTTGGGTATACGCATGGTCCAGTTGATGACTGCAACTTTGATCCATTCATTTAACTGGGATTTGCCCAATGGACAATTGCCAGAGAAACTAAACATGGAGGAAGCATATGGGCTGACATTACAACGCGCTGATCCATTAGTGGTGCACCCAAGGCCTCGGTTAGAAGCCCAAGTATACGGCATTGAATAG-------------- Iochroma_cyaneum_KJ094353 ATGGCAATCTTTTTCATAATTCTATGCACTATTATTATCTCTTTTCTTCTACACACCATTCTTAGCTTATTTTTTCTTAAACGTTACCCAGTGCCACTACCACCGGGTCCAAAACCATGGCCAATAATTGGAAACATAGTCCATCTAGGTCCCAAACCGCACCAATCCACTGCAGACATGGCGCGAACTTACGGGCCACTCATGCACCTACGCATGGGGTTCGTGGACGTGGTGGTTGCGGCTTCGGCTTCAGTTGCAGCTCAGTTCTTGAAAACCCATGATGCTAACTTCTCGAGCCGCCCACCGAACTCTGGCGCTAAGCACTTGGCTTATAATTACCATGACCTTGTTTTTGCACCTTATGGACCACGGTGGCGTATGCTTAGGAAAATATGTTCTGTTCATCTTTTCTCCGCCAAGGCTTTAGATGACTTCCGCCATGTCCGTCAGGAAGAAGTCAGAACACTTACCCGCGCCCTAGCAAATGCTAGCCAAAAGCCAGTCAAGTTAGGGCAGCTGTTAAACGTGTGCACCACGAATTCCCTTGCGCGAGTGATGCTAGGGAAGAGGGTATTCGCCGACGGCACCGGCGGTATTGATCCACAGGCGGAGGAATTCAAGTCAATGGTGGTGGAGATGATGGTACTCGCCGGCGTTTTCAACATCGGCGATTTTATTCCGGCACTTGATTGGATGGACATTCAAGGCGTAGCTGGAAAAATGAAGAAGCTCCACGCGCGTTTCGACGCCTTTTTGACCTCGATCCTCGAAGAGCATAAGGGGAAGAGAATTGGAGAAATGAAGGAACAGGGGGACTTGTTGAGTACGTTGATCTCTTTGAAAAATGAAGATGATGAT---AATGGAGGAAAGCTTACTGATACAGAAATTAAAGCTTTACTTTTGAACTTGTTTGTAGCTGGTACAGACACGTCCTCTAGCACAGTGGAATGGGCCATTGCAGAGCTTATTCGTAACCCAAGAATACTGGCCCAGGTCCAGCAGGAGATCGACAAGGTAGTTGGAAGAAACCGGCTCGTTATGGAATCTGACCTGGCCCAATTGACTTATTTGGAAGCCATAGTCAAGGAAACCTTTAGGCTTCATCCATCAACCCCTCTCTCCCTCCCTAGAATTGCATCCGAGAGCTGTGAGATCGATGGCTACTTCATTCCAAAAGGCTCGACACTTCTCGTTAACGTTTGGGCCATTGCTCGTGATCCAAATGAATGGGCTGATCCATTAGAGTTTAGGCCCGAAAGATTCTTGCCTGGAGGTGAGAAGCCCAAAGTTGATGTCAAAGGAAATGACTTCGAAGTAATTACATTTGGTGCTGGGCGTAGAATATGTGCTGGAATGAGTTTGGGTATACGCATGGTCCAGTTGATGACTGCAACTTTGATCCATTCATTTAACTGGGATTTGCCCAATGGACAATTGCCAGAGAAACTAAACATGGAGGAAGCATATGGGCTGACGTTACAACGAGCTGATCCATTAGTGGTGCACCCAAGGCCTCGGTTAGAAGCCCAAGTATACGGCAGTGAATAG-------------- Nicotiana_benthamiana_V0.4.2.Scf26509 ---------------CTAATTCTCTACACTGTCTTTTTCTCTTTTCTTCTTCATTCCATCCTCAGCTTATTTTTTCGCAAACGTTACCCATTGCCACTACCACCAGGTCCAAAACCATGGCCAATAATCGGAAACCTAGTCCATATGGGTCCAAAGCCACACCAATCAACTGCAGCCATGGCTCGAACTTACGGTCCACTCATGCACCTTAAGATGGGATTCGTGGACTTGGTGGTTGTGGCGTCGGCATCGGTGGCGGCTCAGTTCTTAAAAGCTCATGACGCTAACTTCTCGAGCCGCCCTCCGAACTCGGGTGCAAAACACTTGGCTTACAATTATCAGGATCTTGTTTTTGCACCCTACGGACCAAGGTGGCGTATGCTTAGGAAAATTTGTTCTGTTCATCTTTTCTCTGCCAAGGCTTTAGATGACTTCAGCCATGTCCGCCAGGATGAAGTAAAAACACTTACGCGCGCCCTAGCGAGTGCTGGGCAAAAGCCGGTCAAGCTAGGGCAACTGTTGAACGTGTGCACCACGAATGCACTTGCGCGAGTGATGCTAGGGAGGCGGGTGTTCGCTGACGCAAGTGGCGGTGTTGATCCTCGGGCGGAAGAGTTTAAGTCAATGGTGGTTGAGGCAATGGTGCTCGCCGGCATTTTCAATATTGGCGATACTATTCCGGCACTTGATTGGTTGGATATTCAAGGTGTAGCTGCAAAGATGAAAAAGCTCCACGCGCGTTTCGACGCGTTCTTGACG---------------------------------------------------------------------------------------------------------------------------------------------------AACTTATTTATAGCTGGAACAGACACGTCCTCAAGCACAGTAGAATGGGCCATAGCGGAACTTATTTGTAATCCAAGAATACTGGCCCAAGCCCAACAGGAGATTGACAAAGTGGTTGGAAAGAACCGGCTCGTGATGGAATCTGACCTAGCCCAATTAACTTATTTGGAAGCCATAGTCAAGGAAACCTTAAGGCTTCATCCATCCACCCCTCTCTCCCTCCCTAGAATTGCATCCGAGAGTTGTGAGATTAATGGCTTTTTCATTCCAAAAGGCTCAACACTTCTTGTTAACGTTTGGGCTATCGCTCGTGATCCGAATGAATGGGTTGATCCATTAAAGTTTAGGCCCGAAAGATTTTTGCCGGGTGGTGAGAAGCCCAATGTTGATGTGCGAGGAAATAACTTTGAAGTCATCCCATTTGGAGCTGGGCGTAGAATCTGTGCTGGAATGAATTCGGGCATACGAATGGTCCAGTTGATGACTGCAACTTTAATTCATGCATTTAAGTGGGATTTGCCCATTGGACAATCACCAGAGAAACTAAACATGGAGGAAGCATTTGGGCTGACTTTACAACGGGCTGATCCATTAGTGGTACACCCAGGTCCTCGCCTAGAAGCCCAAG------------------------------- Petunia_hybrida_AF155332 ATGGAAATCTTAAGCCTAATTCTGTACACCGTCATTTTCTCATTTCTTCTACAATTCATTCTTAGATCATTTTTCCGTAAACGTTACCCTTTACCATTACCACCAGGTCCAAAACCATGGCCAATTATAGGAAACCTAGTCCATCTTGGACCCAAACCACATCAATCAACTGCAGCCATGGCTCAAACTTATGGACCACTCATGTATCTTAAGATGGGGTTCGTAGACGTGGTGGTTGCAGCCTCGGCATCGGTTGCAGCTCAGTTCTTGAAAACTCATGATGCTAATTTCTCGAGCCGTCCACCAAATTCTGGTGCAGAACATATGGCTTATAATTATCAGGATCTTGTTTTTGCACCTTATGGACCTAGATGGCGTATGCTTAGGAAAATTTGCTCAGTTCACCTTTTCTCTACCAAGGCTTTAGATGACTTCCGCCATGTCCGCCAGGATGAAGTGAAAACACTGACGCGCGCACTAGCAAGTGCAGGCCAAAAGCCAGTCAAATTAGGTCAGTTATTGAACGTGTGCACGACGAACGCACTCGCGCGAGTAATGCTAGGTAAGCGAGTATTTGCCGACGGAAGTGGCGATGTTGATCCACAAGCGGCGGAGTTCAAGTCAATGGTGGTGGAAATGATGGTAGTCGCCGGTGTTTTTAACATTGGTGATTTTATTCCGCAACTTAATTGGTTAGATATTCAAGGTGTAGCCGCTAAAATGAAGAAGCTCCACGCGCGTTTCGACGCGTTCTTGACTGATATACTTGAAGAGCATAAGGGTAAAATTTTTGGAGAAATGAAA---------GATTTGTTGAGTACTTTGATCTCTCTTAAAAATGATGATGCGGATAATGATGGAGGGAAACTCACTGATACAGAAATTAAAGCATTACTTTTGAACTTGTTTGTAGCTGGAACAGACACATCTTCTAGTACAGTTGAATGGGCCATTGCTGAGCTTATTCGTAATCCAAAAATACTAGCCCAAGCCCAGCAAGAGATCGACAAAGTCGTTGGAAGGGACCGGCTAGTTGGCGAATTGGACCTAGCCCAATTGACATACTTGGAAGCTATAGTCAAGGAAACCTTTCGGCTTCATCCATCAACCCCTCTTTCACTTCCTAGAATTGCATCTGAGAGTTGTGAGATCAATGGCTATTTCATTCCAAAAGGCTCAACGCTTCTCCTTAATGTTTGGGCCATTGCTCGTGATCCAAATGCATGGGCTGATCCATTGGAGTTTAGGCCTGAAAGGTTTTTGCCAGGAGGTGAGAAGCCCAAAGTTGATGTCCGTGGGAATGACTTTGAAGTCATACCATTTGGAGCTGGACGTAGGATTTGTGCTGGAATGAATTTGGGTATACGTATGGTCCAGTTGATGATTGCAACTTTAATACATGCATTTAACTGGGATTTGGTCAGTGGACAATTGCCGGAGATGTTGAATATGGAAGAAGCATATGGGCTGACCTTACAACGGGCTGATCCATTGGTTGTGCACCCAAGGCCTCGCTTAGAAGCCCAAGCGTACATTGGG---TGA-------------- Solanum_lycopersicum_XM004235959 ATGGCTATATTTTTCTTAATACTATACACTATTATTTCCTCTATTATTCTACATTTCTCTCTTAGTTTATTTTTTCGTAAACGTTACCCAGTGCCACTACCACCCGGTCCAAAACCATGGCCTATAATCGGAAACATAATCCAATTAGGTCCGAAGCCGCACCAGTCCACTGCATCAATGGCCCGAACTTACGGGCCATTGATGCACCTTCGCATGGGGTTCGTGGACGTGGTGGTTGCAGCCTCAGCTTCGGTGGCGGCTCAATTTTTGAAAAATCATGACGCTAACTTCTCGAGCCGCCCACCGAACTCTGGGGCGAAACACATGGCTTATAATTACCATGACCTTGTTTTCGCACCTTACGGACCACGGTGGCGTATGCTAAGGAAAATTTGTTCTGTTCATCTTTTTTCAACTAAAGCTTTAGATGACTTCCGCCATGTCCGACAGGAAGAAGTCAGAACACTTACACGCGCCTTAGCGAATGCTGGTCAAAATCCAATCAAACTAGGGCAGCTGTTGAACGTGTGCACCACGAATGCACTTGCGCGTGTGATGCTCGGGAAGCGGGTATTCGCCGACGGTACTAACGGCATGGATCCACAAGCGGAGGAGTTCAAGTTAATGGTGGTGGAGATGATGGTTCTCGCCGGCGTTTTCAACATCGGCGATTTTATTCCGGCGCTTGATTGGATGGACATTCAAGGCGTAGCTGAAAAAATGAAGAAGCTCCACGCGCGTTTCGACGCGTTCTTAACCACGATCCTCGAAGAACACAAGGAAAAGCGAGTTGGAGAATCGAAGGAACAGGGGGATTTGTTGAATACGTTGATCTCTTTGAAAAATGAAGAAGACGAT---AATGGCGGAAAACTTACTGATACAGAAATTAAAGCTTTACTTTTGAACTTATTTATAGCTGGGACAGACACATCCTCTAGCACAGTAGAATGGGCCATTGCAGAGCTTATTCGTAACCCGAAAATACTGGCCCAGGCCCAACAGGAGATCGACAAAGTAGTTGGAAAGAACCGGCTCGTTATGGAATCTGACCTGGCCCAATTGACTTATTTGGAAGCCATAGTCAAGGAAATCTTTAGGCTTCATCCATCAACACCCCTCTCCCTCCCTAGAATTGCATCCGAGAGCTGTGAGATCAATGGCTACTTCATTCCAAAAGGCTCGACACTTCTCGTCAACGTTTGGGCCATTGCTCGTGATCCAAACCAATGGGCTGATCCAATAGAGTTCAGGCCCGAAAGATTCTTGCCCGGAGGTGAAAAGCCCAAAGTTGATGTAAAAGGAAATGACTTTGAAGTAATTCCGTTTGGTGCTGGTCGAAGAATATGCCCCGGAATGAGTTTGGGTATCCGCATGGTCCAGTTGATGACTGCAACTTTGATCCATTCGTTTAACTGGGCTTTGCCCACTGGACAATTGCCAGATAAGTTAAATATGGAGGAAGCATTTGGGCTGACTTTACAACGGGCTGATCCATTAGTGGTCCACCCGATCCCACGGTTAGAAGCCCAAGTATACGGTGGGTGAACAGCCGAATAAGCAG- Solanum_tuberosum_PGSC0003DMC400042656 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGCCCGAACTTACGGGCCACTCATGCACCTTCGCATGGGGTTCGTGGACGTGGTGGTTGCGGCCTCAGCTTCAGTGGCGGCTCAATTTTTGAAAAATCATGACGCTAACTTCTCGAGCCGCCCACCGAACTCTGGGGCGAAACACATGGCTTATAATTACCATGACCTTGTGTTTGCACCTTACGGACCACGGTGGCGTATGCTAAGGAAAATTTGTTCTGTTCATCTTTTTTCGGCTAAAGCTTTAGATGACTTCCGCCATGTCCGACAGGAAGAAGTCAGAACACTTACGCGCGCCTTGGCAAATGCTGGCCAAAAGCCAATCAAATTAGGGCAGCTGTTGAACGTGTGCACCACGAATGCACTTGCGCGTGTGATGCTCGGGAAGCGGGTATTCGCCGACGGCACTAACGGTATCGATCCACAAGCGGAGGAGTTCAAGTTAATGGTGGTGGAGATGATGGTGCTCGCCGGCGTTTTCAACATCGGCGATTTTATTCCGGCGCTTGATTGGATGGACATTCAAGGCGTAGCAGGAAAAATGAAGAAACTCCACGCGCGTTTCGACGCGTTCTTAACCACGATCCTCGAAGAACACAAGGGAAAGCGAGTTGGAGAATCGAAGGAACAGGGGGATTTGTTGAATACGTTGATCTCTCTGAAAAATGAAGAAGACGAT---AATGGTGGAAAGCTTACTGATACAGAAATTAAAGCTTTACTTTTGAACTTGTTTATAGCTGGGACAGACACATCTTCTAGCACAGTGGAATGGGCCATTGCAGAGCTTATTCGTAACCCGAAAATACTGGCTCAGGCCCAACAGGAGATCGACAAAGTAGTTGGAAAGAACCGGCTCGTTGTGGAATCTGACCTGGCCCAATTGACTTATTTGGAAGCCATAGTCAAGGAAACCTTTAGGCTTCATCCATCAACACCCCTCTCCCTCCCTAGAATTGCATCCGAGAGCTGTGAGATCAATGGCTACTTCATTCCAAAAGGATCAACACTTCTCGTCAACGTTTGGGCCATTTCTCGTGATCCAAATGAATGGGCTGATCCATTGGAGTTTAGGCCCGAAAGATTCTTGCCCGGAGGTGAAAAGCCCAAAGTTGATGTGAAAGGAAATGACTTTGAAGTAATTCCATTTGGTGCTGGTCGAAGAATATGCCCCGGAATGAGTTTGGGTATACGCATGGTCCAATTGATGACTGCAACTTTGATCCATTCATTTAACTGGGCTTTGCCCACTGGACAATTGCCAGAGAAGTTAAATATGGAGGAAGCATTTGGGCTGACTTTACAACGGGCTGATCCATTAGTGGTCCACCCGATCCCACGGTTAGAAGCCCAAGTATACGGTGGGTG------------------ ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23766] TITLE Andean_species_of_Solanaceae_F3H_Alignment; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1113; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Iochroma_calycinum_KJ094347 ATGGCACCTTCAACACTAACGGCTTTGGCAGATGAAAAGACCCTTCAAACAAGTTTCATAAGGGATGAAGAAGAGCGTCCAAAAGTGGCATACAATAAATTCAGTGACGAGATACCAGTCATATCGTTGAAGGGGCTTGGTGAG---------------AGTGGAAAAAGAGGTGAAATATGTGAAAAGATTGTAAAGGCATGTGAAGATTGGGGGGTTTTTCAGGTAGTTGATCATGGGGTGGATGATGAATTAATCTCACAAATGACAAAATTTGCTAAAGAATTCTTCGCGTTGCCTCCTGAGGAGAAGCTCCGGTTTGATATGTCTGGTGGCAAGAAAGGTGGCTTCATTGTCTCTAGCCATCTACAGGGTGAAGTGGTCCAAGACTGGCGTGAAATAGTGACTTATTTCTCATACCCAGTTGGGGCTAGAGATTGCTCTAGATGGCCAGACAAACCACAAGGATGGATAGCTGTAACTGAGAAGTACAGTGAAAAGTTAATGGACTTGGCTTGCAAATTACTAGAAGTATTATCAGAAGCAGTGGGCTTGGAGAAGGAGGGCTTAACTAAGGCATGTGTGGATATGGATCAAAAAGTGGTTGTCAATTTTTACCCAAAGTGTCCACAGCCTGACCTTACCCTTGGGCTGAAACGACACACTGATCCAGGAACCATTACCCTCTTGTTACAAGATCAAGTTGGTGGGCTTCAAGCCACTAAAGATAATGGCAAAACATGGATCACTGTTCAGCCTGTTGAAGGCGCTTTTGTTGTCAATCTTGGTGATCATGGTCATTATTTGAGCAACGGGAGGTTCAAGAACGCTGATCATCAAGCAGTGGTGAACTCGAATAGCTGCAGATTATCGATAGCCACTTTCCAGAATCCAGCACCGGAGGCAATAGTGTATCCATTAAAAATTAGGGAAGGGGAGAAGGCAGTAATGGATGAGCCCATAACATTTGCAGAAATGTACAGGAGGAAAATGAGTAAGGATCTTGAGCTTGCTAGGCTCAAGAAACTGGCCAAAGAACAACAGATTCAA---------GCTGCTGAAAAGGCCAAGTTGGAATCCAAGCCCATTGAGGAAATTCTTGCTTAA Iochroma_calycinum_KJ094358 ATGGCACCTTCAACACTAACGGCTTTGGCAGATGAAAAGACCCTTCAAACAAGTTTCATAAGGGATGAAGAAGAGCGTCCAAAAGTGGCATACAACAAATTCAGTGACGAGATACCAGTCATATCGTTGAAGGGGCTTGGTGAG---------------AGTGGAAAAAGAGGTGAAATATGTGAAAAGATTGTAAAGGCATGTGAAGATTGGGGGGTTTTTCAGGTAGTTGATCATGGGGTGGATGATGAATTAATCTCACAAATGACAAAATTTGCTAAAGAATTCTTCGCGTTGCCTCCTGAGGAGAAGCTCCGGTTTGATATGTCTGGTGGCAAGAAAGGTGGCTTCATTGTCTCTAGCCATCTACAGGGTGAAGTGGTCCAAGACTGGCGTGAAATAGTGACTTATTTCTCATACCCAGTTGGGGCTAGAGATTACTCTAGATGGCCAGACAAACCACAAGGATGGATAGCTGTAACTGAGAAGTACAGTGAAAAGTTAATGGACTTGGCTTGCAAATTACTAGAAGTATTATCAGAAGCAGTGGGCTTGGAGAAGGAGGGCTTAACTAAGGCATGTGTGGATATGGATCAAAAAGTGGTTGTCAATTTTTACCCAAAGTGTCCACAGCCTGACCTTACCCTTGGGCTGAAACGACACACTGATCCAGGAACCATTACCCTCTTGTTACAAGATCAAGTTGGTGGGCTTCAAGCCACTAAAGATAATGGCAAAACATGGATCACTGTTCAGCCTGTTGAAGGCGCTTTTGTTGTCAATCTTGGTGATCATGGTCATTATTTGAGCAACGGGAGGTTCAAGAACGCTGATCATCAAGCAGTGGTGAACTCGAATAGCTGCAGATTATCGATAGCCACTTTCCAGAATCCAGCACCGGAGGCAATAGTGTATCCATTAAAAATTAGGGAAGGGGAGAAGGCAGTAATGGATGAGCCCATAACATTTGCAGAAATGTACAGGAGGAAAATGAGTAAGGATCTTGAGCTTGCTAGGCTCAAGAAACTGGCCAAAGAACAACAGATTCAA---------GCTGCTGAAAAGGCCAAGTTGGAATCCAAGCCCATTGAGGAAATTCTTGCTTAA Iochroma_cyaneum_KJ094352 ATGGCACCTTCAACACTAACGGCTTTGGCAGATGAAAAGACCCTCCAAACAAGTTTCATAAGGGATGAAGAAGAGCGTCCAAAAGTGGCATACAACAAATTCAGTGACGAGATACCAGTCATATCGTTGAAGGGACTTGGTGAG---------------AGTGGAAAAAGAGGTGAAATATGTGAAAAGATTGTAAAGGCATGTGAAGATTGGGGGGTTTTTCAGGTAGTTGATCATGGGGTGGATGATGAATTAATCTCACAAATGACAAAATTTGCTAAAGAATTCTTCGCGTTGCCTCCTGAGGAGAAGCTCCGGTTTGATATGTCTGGTGGCAAGAAAGGTGGCTTCATTGTCTCTAGCCATCTACAGGGTGAAGTGGTCCAAGACTGGCGTGAAATAGTGACTTATTTCTCATACCCAGTTGGGGCTAGAGATTACTCTAGATGGCCAGACAAACCACAAGGATGGATAGCTGTAGCTGAGAAGTACAGTGAAAAGTTAATGGACTTGGCTTGCAAATTACTAGAAGTATTATCAGAAGCAATGGGCTTGGAGAAGGAGGCCTTAACTAAGGCATGTGTGGATATGGATCAAAAAGTGGTTGTCAATTTTTACCCAAAGTGTCCACAGCCTGACCTTACCCTTGGGCTGAAACGACACACTGATCCAGGAACCATTACCCTCTTGTTACAAGATCAAGTTGGTGGGCTTCAAGCCACTAAAGATAATGGCAAAACATGGATCACTGTTCAGCCTGTTGAAGGCGCTTTTGTTGTCAATCTTGGTGATCATGGTCATTATTTGAGCAACGGGAGGTTCAAGAACGCTGATCATCAAGCAGTGGTGAACTCGAATAGCAGCAGATTATCGATAGCCACTTTCCAGAATCCAGCACCGGAGGCAATAGTGTATCCATTAAAAATTAGGGAAGGGGAGAAGGCAGTAATGGATGAGCCCATAACATTTGCAGAAATGTACAGGAGGAAAATGAGTAAGGATCTTGAGCTTGCTAGGCTCAAGAAACTGGCCAAAGAACAACAGATTCAA---------GCTGCTGAAAAGGCCAAGTTGGAATCCAAGCCCATTGAGGAAATTCTTGCTTAA Nicotiana_benthamiana_V0.4.2Scf2714_ ATGGCACCTTCGACATTAACAGCTCTAGCAGAGGAAAAGACACTTGAAACAAGTTTCATAAGAGATGAAGATGAGCGTCCAAAAGTGGCATACAACCAATTCAGCAACGAGATTCCGGTCATATCGTTGAAGGGTATTGATGATGAGAGTGGAGTTAATAGTGAAAGAAGAGGTGATATATGTGAAAAGATTGTCAAGGCATGTGAAGATTGGGGCATTTTCCAGGTAGTTGATCATGGTGTTGATGCTCAACTTATCTCACAAATGACAACTCTCGCTAAACAATTCTTCGCTTTGCCTCCTGAGGAAAAGTTACGCTTTGACATGTCTGGTGGCAAGAAAGGTGGCTTTATAGTCTCTAGCCATTTACAGGGTGAAGTGGTCCAAGATTGGCGTGAAATAGTGACCTATTTCTCATACCCAATTCGGGCTAGAGACTACTCTAGATGGCCAGACAAACCAGAGGGATGGATGGATGTGACTCAGAAGTACAGTGAAAAGTTAATGGAGTTGGCTTGCAAATTATTGGAAGTACTATCAGAGGCTATGGGCTTAGAGAATGATGCCTTAACCAAGGCCTGTGTGGATATGGACCAAAAAGTGGTTGTCAATTTTTACCCAAAGTGTCCACAGCCCGACCTTACCCTTGGGCTGAAACGACACACTGATCCAGGAACCATTACCCTCTTGTTACAAGACCAAGTTGGTGGGCTTCAAGCCACTAAAGATAAGGGCAAAACTTGGATTACTGTTCAGCCCGTTGAAGGCGCTTTTGTTGTCAATCTTGGGGACCATGGTCAGTTTTTGAGCAATGGAAGGTTTAAGAACGCTGATCATCAAGCAGTGGTGAACTCGAATAGCAGCAGATTATCGATAGCTACGTTTCAGAATCCAGCACCGGAGGCTATTGTGTACCCATTGAAAATTAGGGAAGGAGAGAAGGCAGTAATGAACGAGGCCATAACATTTGCAGAAATGTACAGGAGGAAAATGAGTAAGGACCTTGAGCTTGCTAGGCTCAAGAAACTGGCCAAGGAGCAGCAAATACAAGCTGAAGAAGCCACTGAGAAGGCCAAGTTGGAAACTAAGCCCATTGAAGAAATTCTTGCTTAA Petunia_hybrida_AF022142 ATGGCACCTTCAACATTAACAGCATTAGCAGAAGAAAAGACCCTTCAAACAAGTTTCATTAGGGATGAAGATGAACGTCCAAAAGTGGCTTACAACCAATTCAGCAATGAGATCCCAATTATCTCGTTAGAGGGCATTGATGATGAA------------ACTGGTAAAAGAGCTGAAATATGTGACAAGATTGTTAAGGCATGTGAAGATTGGGGCGTTTTTCAAGTTGTGGATCATGGGGTTGATGCTGAACTTATTTCCCAAATGACAACTTTTGCTAAAGAATTCTTTGCTTTGCCTCCTGAGGAAAAGCTGCGGTTTGACATGTCTGGTGGCAAGAAAGGTGGATTTATTGTCTCTAGCCATCTACAGGGTGAAGTGGTCCAAGATTGGCGTGAAATTGTGACCTACTTTTCGTACCCAACAAGGGCAAGAGACTACTCTAGATGGCCAGACAAACCAGAAGGATGGATAGCTGTGACTCAGAAATATAGTGAAAAGTTAATGGAGTTAGCTTGCAAGTTATTGGATGTCCTATCAGAGGCTATGGGCTTGGAGAAGGAGGCCTTAACCAAGGCATGTGTGGATATGGACCAAAAAGTGGTTGTCAATTTTTACCCAAAGTGTCCTGAGCCTGACCTTACCCTTGGACTGAAAAGACACACTGATCCAGGAACCATCACTCTCTTGTTACAAGACCAAGTTGGTGGGCTTCAAGCTACTAAAGATAATGGCAAAACTTGGATCACTGTTCAGCCTGTTGAAGGTGCTTTTGTTGTCAATCTTGGTGACCACGGTCATTTTTTGAGCAATGGACGGTTCAAGAATGCTGATCATCAAGCAGTGGTGAACTCAAATAGCAGCAGGTTATCGATAGCCACGTTTCAGAATCCGGCACCAGAGGCGATAGTGTATCCATTGAAAATTAGGGAAGGAGAGAAGTCAATAATGGATGAGCCCATAACATTTGCAGAAATGTACAGAAGGAAAATGAGCAAGGATTTAGAACTTGCTAGGCTCAAGAAGCAGGCCAAGGAGCAGCAGTTACAAGCTGAAGTTGCTGCTGAGAAGGCTAAGTTGGAGTCCAAGCCCATTGAGGAAATTCTTGCTTAA Solanum_lycopersicum_HQ008775 ATGGCACCTTCAACACTAACAGCTTTAGCTAATGAAAAGACCCTTGAAACAAGTTTTATTAGGGATGAAGAAGAACGTCCAAAAGTTGCTTACAATAAATTTAGTGACGAAATTCCAGTAATATCGTTGCAAGGTATTGATGAT---------GTTAAT---GGAAGAAGAAGTGAAATATGTGAGAGAATCGTAAATGCTTGTGAAGATTGGGGTGTTTTTCAGGTAATTGATCATGGGGTTGATGCTCAATTAATATCACAAATGACAAAATTAGCGAAGGAATTTTTCGAATTGCCTCCTGAGGAAAAGCTTCGGTTTGACATGTCTGGTGGCAAGAAAGGTGGCTTCATTGTCTCAAGCCACTTACAGGGTGAAGTGGTTCAAGACTGGCGTGAAATAGTGACTTACTTTTCATACCCCATTCGAGCTAGAGACTATTCTAGATGGCCAGACAAACCACAAGGCTGGATAGGTGTAACTGAGCAATACAGTGAAAAGTTGATGGATTTGGCTTGCAAATTATTAGAAGTACTATCAGAGGCAATGGGCTTAGAGAAAGAGGCTTTAACCAAGGCATGTGTCGATATGGACCAAAAAGTAGTTGTGAATTTTTACCCAAAGTGTCCAGAGCCTGACCTTACTCTTGGGCTCAAACGACACACCGATCCAGGAACCATTACCTTATTGTTACAAGACCAAGTTGGTGGGCTTCAAGCCACTAAAGATAATGGCAAAACATGGATCACTGTTCAGCCCGTTGAAGGTGCTTTTGTGGTTAATCTTGGCGATCACGGTCATTATTTGAGCAATGGAAGGTTCAAGAATGCTGATCATCAAGCAGTGGTGAATTCGAATAGCAGTAGATTATCGATAGCCACATTCCAGAATCCAGCACCAGATGCAAAAGTGTATCCGTTAAAAATTAGAGAAGGAGAGAAGTCAATAATGGATGAGCCGATTACATTTGCAGATATGTACAGGAGGAAAATGAGTAAGGATCTTGAGCTAGCTAGGCTGAAGAAACTGGCCAAGGAAGAGAAGATACAA------------ACTGAAGAGGCCAAGTTGGAGTCCAAGCCCATTGAGGAAATTCTTGCTTAA Solanum_tuberosum_AY102035 ATGGCT---TCAACACTAACAGCTCTAGCTAATGAAAAGACCCTTCAAACAAGTTTTATTAGGGATGAAGAAGAACGTCCAAAAGTGGCTTACAATAAATTTAGTGACGAAATTCCAGTAATATCGTTGCAAGGTATTGATGAT---------ATTAAT---GGAAGAAGAAGTGAAATATGTGAGAAAATTGTAAATGCTTGTGAAGATTGGGGAGTTTTTCAGGTAATTGATCATGGGGCCGATGCTCAATTAATATCAGAAATGACAAAATTGGCTAAGGAATTTTTCGAATTGCCTCCTGACGAAAAGCTTCGGTTTGACATGTCTGGTGGCAAGAAAGGCGGCTTTATTGTCTCAAGCCATTTACAGGGTGAAGTGGTTCAAGACTGGCGTGAAATAGTGACCTACTTTTCTTACCCAATTCGAGCTAGAGACTACTCCAGATGGCCAGACAAACCACAAGGCTGGATAGCTGTAACTGAGAAATACAGTGAAAAATTAATGGACTTGGCTTGCAAATTATTAGAAGTATTATCAGAGGCAATGGGCTTAGAGAAAGAGGCTTTAACCAAGGCATGTGTGGATATGGACCAAAAAGTAGTTGTCAATTTTTACCCAAAGTGTCCAGAGCCTGACCTTACCCTTGGGCTGAAACGACATACTGATCCAGGAACCATCACCCTCTTGTTACAAGACCAAGTTGGTGGGCTTCAAGCCACTAAAGATAATGGCAAAACTTGGATCACTGTTCAGCCCGTTGAAGGCGCTTTTGTTGTTAATCTTGGTGATCATGGTCATTATTTGAGCAATGGGAGGTTCAAGAATGCTGATCATCAAGCAGTTGTGAATTCGAATAGCAGCAGATTATCGATAGCCACTTTTCAGAATCCAGCACCGGATGCAAAAGTGTATCCGTTAAAAATTAGGGAAGGAGAGAAGGCAATAATGGATGAGCCGATTACATTTGCAGAAATGTACAGGAGGAAAATGAGTAAGGATCTTGAGCTTGCTAGGCTCAAGAAACTGGCCAAGGAACAG---------------------ACTGAAGAGGCCAAGTTGGAGTCCAAGCCCATTGAGGAAATTCTTGCTTAA ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = Andean_species_of_Solanaceae_F3H_Alignment) = 1: 1-1111\3, 2: 2-1112\3, 3: 3-1113\3; CODONPOSSET CodonPositions (CHARACTERS = Andean_species_of_Solanaceae_F3H_Alignment) = 1: 1-1111\3, 2: 2-1112\3, 3: 3-1113\3; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23377] TITLE 'Andean species of Solanaceae F3''5''H Alignment'; LINK TAXA = Taxa4; DIMENSIONS NCHAR=1549; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Iochroma_calycinum_KJ094345 ATGGTGTTACTACTTAATAGTGAGTTGTGT---GCAGCAGCTATAATATTTATCATAGTACATATTATTATTTCAAACTTAATAGCCACCGTC------CGGGGGCAGCGT------CTGCCCCCAGGTCCGATGGGGTGGCCGGTGGTCGGAGCACTTCCCCTTTTAGGTGCCATGCCACATGTTGCACTTGCAAAAATGGCCAAAAAATATGGACCTATTATGTATCTCAAAGTTGGAACATGTGGGATGGTTGTTGCTTCTACTCCTAATGCTGCTAAAGCTTTCTTGAAAACACTTGATAGTAATTTCTCCAATCGTCCACCTAATGCAGGTGCCACACACTTGGCCTATAATGCCCAAGACATGGTTTTTGCACACTATGGACCACGTTGGAAGTTGCTAAGGAAATTGAGCAACTTACACATGCTAGGTGGAAAAGCCTTAGAAGATTGGGCCAATGTCCGCGCCAATGAGCTAGGCCACATGCTAAAATCAATGTTCGACGCCAGCCGAGAGGGCGAGCGGGTGGTGGTGGCGGATATGTTGACGTTCGCAATGGCAAACATGATTGGCCAAGTGGTATTAAGTAAGAGAGTGTTCGTGGAAAAAGGAGCAGAAGTCAACCAATTTAAAGACATGGTTGTGGAATTGATGACCGTAGCAGGGTATTTTAATATCGGAGATTTTATTCCTATATTAGCTTGGATGGATTTACAAGGGATTGAAAGAGGCATGAAAAGTTTGCACAAAAAGTTTGATGATCTATTGACAAAAATGTTTGAGGAACATAAAGCAACTAGCTATGAAAGAAAGGGGAAGCCTGATTTTCTTGATTTTGTTATGGCAAATAGGGACAATTCTGAAGGAGAAAGGCTCAGTACAACCAATATCAAAGCACTTTTGCTGAATTTGTTTACTGCCGGTACAGACACTTCATCAAGTGCAATAGAATGGGCACTTGCAGAAATGATGAAAAATCCTAAAATTCTCAAAAAAGCACAAGAAGAAATGGATCAAACCATTGGCAAAAACAGACGTTTAATTGAATCTGACATTCCAAATCTCCCTTATTTACGTGCAATTTGTAAAGAAGCATTTCGAAAACACCCTTCAACACCATTAAATCTCCCTAGGATATCGAACGAGCCATGCACAGTCGATGGTTACTACATACCAAAAAACACCAGGCTCAGTGTTAACATATGGGCGATTGGACGAGACCCTAATGTGTGGGAGAATCCACTCGAGTTCAACCCCGAGAGGTTCTTGAGTGGGAAAAATGCAAAGATTGACCCTCGAGGAAATGATTTCGAGTTGATTCCATTTGGTGCAGGACGAAGAATTTGTGCAGGGACAAGGATGGGAATAGTGATGGTGGAGTATATATTGGGAACTTTGGTTCATTCATTTGATTGGAAATTACCAAATGATGTAATTGATATTAATATGGAGGAGTCTTTTGGATTAGCTTTGCAAAAGGCTGTCCCTCTTGAAGCTATGGTTACTCCAAGGCTACCTTTGGATGTTTATTATGCAAATTGA---- Iochroma_calycinum_KJ094346 ATGGTGTTACTACTTAATAGTGAGTTGTGT---GCAGCAGCTATAATATTTATCATAGTACATATTATTATTTCAAACTTAATAGCCACCGTC------CGGGGGCAGCGT------CTGCCCCCAGGTCCGATGGGGTGGCCGGTGGTCGGAGCACTTCCCCTTTTAGGTGCCATGCCACATGTTGCACTTGCAAAAATGGCCAAAAAATATGGACCTATTATGTATCTCAAAGTTGGAACATGTGGGATGGTTGTTGCTTCTACTCCTAATGCTGCTAAAGCTTTCTTGAAAACACTTGATAGTAATTTCTCCAATCGTCCACCTAATGCAGGTGCCACACACTTGGCCTATAATGCCCAAGACATGGTTTTTGCACACTATGGACCACGTTGGAAGTTGCTAAGGAAATTGAGCAACTTACACATGCTAGGTGGAAAAGCCTTAGAAGATTGGGCCAATGTCCGCGCCAATGAGCTAGGCCACATGCTAAAATCAATGTTCGACGCCAGCCGAGAGGGCGAGCGGGTGGTGGTGGCGGATATGTTGACGTTCGCAATGGCAAACATGATTGGCCAAGTGGTATTAAGTAAGAGAGTGTTCGTGGAAAGAGGAGCAGAAGTCAACCAATTTAAGGACATGGTTGTGGAATTGATGACCGTAGCAGGGTATTTTAATATCGGAGATTTTATTCCTATATTAGCTTGGATGGATTTACAAGGGATTGAAAGAGGCATGAAAAGTTTGCACAAAAAGTTTGATGATCTATTGACAAAAATGTTTGAGGAACATAAAGCAACTAGCTATGAAAGAAAGGGGAAGCCTGATTTTCTTGATTTTGTTATGGCAAATAGGGACAATTCTGAAGGAGAAAGGCTCAGTACAACCAATATCAAAGCACTTTTGCTGAATTTGTTTACTGCCGGTACAGACACTTCATCAAGTGCAATAGAATGGGCACTTGCAGAAATGATGAAAAATCCTAAAATTCTCAAAAAAGCACAAGAAGAAATGGATCAAACCATTGGCAAAAACAGACGTTTAATTGAATCTGACATTCCAAATCTCCCTTATTTACGTGCAATTTGTAAAGAAGCATTTCGAAAACACCCTTCAACACCATTAAATCTCCCTAGGATATCGAACGAGCCATGCACAGTCGATGGTTACTACATACCAAAAAACACCAGGCTCAGTGTTAACATATGGGCGATTGGACGAGACCCTAATGTGTGGGAGAATCCACTCGAGTTCAACCCCGAGAGGTTCTTGAGTGGGAAAAATGCAAAGATTGACCCTCGAGGAAATGATTTCGAGTTGATTCCATTTGGTGCAGGACGAAGAATTTGTGCAGGGACAAGGATGGGAATAGTGATGGTGGAGTATATATTGGGAACTTTGGTTCATTCATTTGATTGGAAATTACCAAATGATGTAATTGATATTAATATGGAGGAGTCTTTTGGATTAGCTTTGCAAAAGGCTGTCCCTCTTGAAGCTATGGTTACTCCAAGGCTACCTTTGGATGTTTATTATGCAAATTGA---- Iochroma_cyaneum_KJ094354 ATGGTGTTACTACTTAATAGTGAGTTGTGT---GCAGCAGCTATAATATTTATCATAGTACATATTATTATTTCAAAATTAATAGCCACCGCC------CGGGGGCAGCGT------CTGCCCCCAGGTCCGATGGGGTGGCCGGTGGTCGGAGCACTTCCGCTTTTAGGTGCCATGCCACATGTTGCACTTGCAAAAATGGCCAAAAAATATGGACCTATTATGTATCTCAAAGTTGGAACATGTGGGATGGTTGTTGCTTCTACTCCTAATGCTGCTAAAGCTTTCTTGAAAATACTTGATATCAATTTCTCCAATCGTCCACCTAATGCAGGTGCCACACACTTGGCCTATAATGCCCAAGACATGGTTTTTGCACACTATGGACCACGTTGGAAGTTGCTAAGGAAATTGAGCAACTTACACATGCTAGGTGGAAAAGCCTTAGAAGATTGGGCCAATGTCCGCGCCAATGAGCTAGGCCACATGCTAAAATCAATGTTCGACGCGAGCCGAGAGGGCGAGCGGGTTGTGGTGGCGGATATGTTGACGTTCGCAATGGCAAACATGATTGGCCAAGTGATATTAAGTAAGAGAGTGTTCGTGGAAAAAGGAGCAGAAGTCAACGAATTTAAGGACATGGTTGTGGAATTGATGACCGTAGCAGGGTATTTTACTATCGGCGATTTTATTCCTATATTAGCTTGGATGGATTTACAAGGGATTGAAAGAGGCATGAAAAGTTTGCACAAAAAGTTTGATGATCTATTGACAAAAATGTTTGAGGAACATAAAGCAACTAGCTATGAAAGAAAGGGGAAACCTGATTTTCTTGATTTTGTTATGGCAAATAGGGACAATTCTGAAGGAGAAAGGCTCAGTACAACCAATATCAAAGCACTTTTGCTGAATTTGTTTACTGCCGGTACAGACACTTCATCAAGTGCAATAGAATGGGCACTTGCAGAAATGATGAAAAATCCTAAAATTCTCAAAAAAGCACAACAAGAAATGGATCAAATCATTGGCAAAAACAGACGTTTTATTGAATCTGACATTCCAAATCTCCCTTATTTACGTGCAATTTGTAAAGAAGCATTTCGAAAACATCCTTCAACACCATTAAATCTCCCTAGGATATCGAACGAGCCGTGCACGATCGATGGTTACTACATACCAAAAAACACCAGGCTCAGCGTTAACATATGGGCGATTGGACGAGACCCTGATGTGTGGGAGAATCCACTCGAGTTCAACCCCGAGAGGTTCCTGAGTGGGAAAAACGCAAAGATTGACCCTCGAGGAAATGATTTCGAGTTAATTCCATTTGGTGCAGGACGAAGAATTTGTGCAGGGACAAGGATGGGAATAGTGATGGTGGAGTATATATTGGGAACTTTGATTCATTCATTTGATTGGAAATTACCAACTGATGTTATTGATATTAATATGGATGAATCTTTTGGATTGGCTTTGCAAAAGGCTATCCCTCTTGAAGCTATGGTTACTCCAAGGCTACCTTTGGATGTTTATTATGCAAATTGA---- Nicotiana_benthamiana_V0.4.2.Scf45423 ATGGTACCATTTACT------GACCTTACTACAGCAGCT---ACAATTTTCCTTATATCACATATTCTCATTTCAATTCTTCTTTCAAAAACT------ACCCGGCGCCGCTGT---CTCCCGCCGGGCCCAAGGGGGTGGCCGGTGATCGGCGCACTACCATACTTAGGAGCCATGCCACATGTTTCACTTGCAAAAATGGCCAAAAAATATGGACCTGTTATGTATTTAAAAGTTGGCACATGTGGTATGGCTGTTGCTTCTACTCCTGATGCTGCTAAAGCATTCTTGAAAACACTTGATATCAACTTCTCCAATCGTCCACCTAATGCAGGTGCCACGCACTTGGCCTATGATGCACAAGACATGGTTTTTGCACATTATGGACCACGTTGGAAGTTGCTAAGGAAATTGAGCAACTTGCATATGCTAGGGGGAAAAGCCTTAGAAAATTGGGCAAATGTACGTGCCAATGAGCTAGGGCACATGCTAAAATCGATGTTCGAAATGAGCCGAGAAGGCGAGCGAGTGGTGCTGGCGGAGATGCTGACATTCGCTATGGCGAATATGATAGGACAAGTGATATTAAGCAAGAGAGTTTTCACGAAAAAAGGTGCTGAGGTTAATGAATTTAAGGATATGGTGGTAGAGTTAATGACAGTAGCAGGGTATTTTAACATTGGAGATTTTATTCCTTCATTAGCTTGGTTGGATTTACAAGGGATTGAAAGTGGGATGAAGAATTTACACAAGAAATTTGATGCTTTGTTGACAAAGATGTTTGATGAACACAAGGAAACTAGCTATGAACGTAAAGGGAAAGAGGATTTTCTTGATGTTGTTATGGCAAATAGGGATAATTCTCAAGGAGAAACGCTCAGTACTACTAATATCAAAGCACTTTTGCTGAATTTGTTCACTGCTGGTACAGACACTTCTTCTAGTGTAATAGAATGGGCACTTGCTGAAATGATGAAAAATCCAAAAATTCTCAAAAAAGCACAAGCAGAAATGGATCAAGTCATTGGAAAAGATAGACGTTTACTTGAATCGGATATCCCAAATCTTCCTTATCTTCGAGCAATTTGCAAAGAAACATTTCGAAAACATCCATCTACACCATTAAATCTCCCCAGAATCTCGAACGAACCATGTGAAGTGAATGGTTATTACATACCAAAAAATACTAGGCTCAGTGTTAATATTTGGGCGATTGGAAGAGACCCTGATGTGTGGGAAAAACCGCTAGAATTTAATCCTGAAAGGTTCTTGAGTGGGAAAAATACAAAGATTGATCCACGAGGGAATGACTTTGAGCTAATTCCATTTGGTGCAGGACGGAGAATTTGTGCAGGAACAAGAATGGGAATAGTAATGGTGGAATATATATTGGGAACTTTGGTTCATTCATTTAATTGGAAATTACCAAATGATGTTATTGAGTTAAATATGGAGGAAGCTTTTGGATTAGCTTTGCAGAAAGCTGTCCCTCTTGAAGCTATGGTTACTCCAAGATTAACTTTGGATGTTTAT---GCACCTTAATAT- Petunia_hybrida_D14588 ATGATGCTACTTACT------GAGCTTGGT---GCAGCAACTTCAATCTTTCTAATAGCACACATAATCATTTCAACTCTTATTTCAAAAACT------ACCGGCCGGCAT------CTACCGCCGGGGCCAAGAGGGTGGCCGGTGATCGGAGCACTTCCACTTTTAGGAGCCATGCCACATGTTTCCTTAGCTAAAATGGCAAAAAAATATGGAGCAATCATGTATCTCAAAGTTGGAACATGTGGCATGGCAGTTGCTTCTACCCCTGATGCTGCTAAAGCATTCTTGAAAACACTTGATATCAACTTCTCCAATCGTCCACCTAATGCAGGTGCCACTCACTTAGCTTATAATGCTCAAGACATGGTTTTTGCACATTATGGACCACGATGGAAGTTGCTAAGGAAATTAAGCAACTTGCATATGCTAGGGGGAAAAGCCTTAGAGAATTGGGCAAATGTTCGTGCCAATGAGCTAGGGCACATGCTAAAATCAATGTCCGATATGAGTCGAGAGGGCCAGAGGGTTGTGGTGGCGGAGATGTTGACATTTGCCATGGCCAATATGATCGGACAAGTGATGCTAAGCAAAAGAGTATTTGTAGATAAAGGTGTTGAGGTAAATGAATTTAAGGACATGGTTGTAGAGTTAATGACAATAGCAGGGTATTTCAACATTGGTGATTTTATTCCTTGTTTAGCTTGGATGGATTTACAAGGGATAGAAAAACGAATGAAACGTTTACATAAGAAGTTTGATGCTTTATTGACAAAGATGTTTGATGAACACAAAGCAACTACCTATGAACGTAAGGGGAAACCAGATTTTCTTGATGTTGTTATGGAAAATGGGGACAATTCTGAAGGAGAAAGACTCAGTACAACCAACATCAAAGCACTTTTGCTGAATTTGTTCACAGCTGGTACGGACACTTCTTCTAGTGCAATAGAATGGGCACTTGCAGAAATGATGAAGAACCCTGCCATTTTGAAAAAAGCACAAGCAGAAATGGATCAAGTCATTGGAAGAAATAGGCGTTTACTCGAATCCGATATCCCAAATCTCCCTTACCTCCGAGCAATTTGCAAAGAAACATTTCGAAAACACCCTTCTACACCATTAAATCTTCCTAGGATCTCGAACGAACCATGCATAGTCGATGGTTATTACATACCAAAAAACACTAGGCTTAGTGTTAACATATGGGCAATTGGAAGAGATCCCCAAGTTTGGGAAAATCCACTAGAGTTTAATCCCGAAAGATTCTTGAGTGGAAGAAACTCCAAGATTGATCCTCGAGGGAACGATTTTGAATTGATACCATTTGGTGCTGGACGAAGAATTTGTGCAGGAACAAGAATGGGAATTGTAATGGTGGAATATATATTAGGAACTTTGGTTCATTCATTTGATTGGAAATTACCAAGTGAAGTTATTGAGTTGAATATGGAAGAAGCTTTTGGCTTAGCTTTGCAGAAAGCTGTCCCTCTTGAAGCTATGGTTACTCCAAGGTTACAATTGGATGTTTAT---GTACCATAGCTA- Solanum_lycopersicum_SL2.40sc03876 ATGGCGTTACGTATTAAT---GAGTTATTT---GTTGCGGCTATAATATATATCATAGTACATATTATTATTTCAAAATTAATAACCACCGTCCGGGAGCGGGGGCGGCGACTACCGCTACCGCCGGGTCCGACGGGGTGGCCGGTGATCGGAGCACTACCACTTTTAGGTTCAATGCCACATGTTGCACTTGCAAAAATGGCCAAAAAATATGGACCTATTATGTATTTAAAAGTTGGTACATGTGGGATGGTTGTTGCTTCTACCCCTAATGCTGCTAAAGCTTTCTTGAAAACACTTGATATTAATTTCTCTAATCGTCCACCTAATGCAGGTGCCACACATTTGGCCTATAATGCCCAAGACATGGTTTTTGCACCCTATGGACCACGTTGGAAGTTGCTAAGAAAATTGAGCAACTTACACATGCTAGGTGGAAAAGCTTTAGAAAATTGGGCCAACGTTCGTGCCAATGAGCTAGGTCACATGCTAAAATCGATGTTCGATGCAAGCCAGGATGGCGAATGTGTGGTGATTGCTGATGTGTTAACGTTTGCGATGGCAAATATGATTGGTCAAGTAATGTTGAGTAAAAGAGTGTTTGTTGAAAAAGGGGTTGAGGTTAATGAATTTAAGAATATGGTTGTGGAATTAATGACGGTTGCAGGATATTTTAATATTGGTGATTTTATACCTAAGTTAGCTTGGATGGATATACAAGGAATTGAAAAAGGGATGAAAAATTTGCATAAAAAATTTGATGATTTATTGACAAAAATGTTTGATGAACATGAAGCAACTAGCAATGAAAGAAAAGAAAATCCTGATTTTCTTGATGTTGTTATGGCAAATAGGGATAATTCAGAAGGAGAAAGGCTAAGTACAACAAATATAAAAGCACTTTTGCTGAATTTATTCACTGCTGGTACAGACACTTCATCAAGTGTAATAGAATGGGCCCTTGCAGAAATGATGAAAAATCCTAAAATTTTCGAAAAAGCACAACAAGAAATGGACCAAGTAATTGGCAAAAACAGACGTTTAATTGAGTCTGATATTCCAAATCTTCCTTATTTACGTGCAATTTGCAAAGAAACATTTCGAAAACATCCCTCAACGCCACTAAATCTCCCTAGGGTATCGAGCGAGCCATGCACGGTCGATGGTTACTACATACCAAAAAATACTAGGCTTAGTGTCAACATATGGGCAATTGGACGAGATCCTGACGTGTGGGAGAATCCGCTCGAGTTCACTCCCGAGAGGTTCCTTAGCGGGAAAAACGCAAAGATTGAACCTCGTGGGAATGATTTCGAGTTAATTCCATTTGGTGCGGGACGAAGGATTTGCGCGGGGACAAGGATGGGAATAGTGATGGTGGAATATATATTGGGAACTTTGGTTCATTCATTTGATTGGAAATTACCAAATAATGTTATTGATATTAATATGGAGGAATCTTTTGGATTAGCTTTGCAAAAAGCTGTCCCTCTAGAAGCTATGGTTACTCCAAGGCTATCTTTGGACGTTTAT---CGTTGCTGATCG- Solanum_tuberosum_AY675558 ATGACGTTACGTATT---AGTGAGTTGTTT---GCCGCGGCAATAATATACATCATAGTACATATTATTATTTCAAAATTAATAGCCACCGTCCGGGAGCGGGGGCGGCGG------CTACCGCCGGGTCCGACGGGGTGGCCGGTGATCGGAGCACTATCACTTTTAGGTTCAATGCCACATGTTGCACTTGCAAAAATGGCCAAAAATTATGGACCTATTATGTATTTAAAAGTTGGTACATGTGGGATGGTTGTTGCCTCTACCCCTAATGCTGCAAAAGCTTTCTTGAAAACACTTGATATTAATTTTTCCAATCGTCCACCTAATGCAGGTGCCACACATTTGGCCTATAATGCCCAAGACATGGTTTTTGCACCCTATGGACCTCGTTGGAAGTTGCTAAGGAAATTGAGCAACTTACAGATGCTAGGTGGAAAAGCCTTAGAAAATTGGGCCAATGTTCGTGCCAATGAGCTAGGTCACATGATAAAGTCGATGTTCGATGCAAGCCACGTGGGCGAATGTGTGGTGATTGCTGATATGTTGACGTTCGCGATGGCAAATATGATTGGTCAAGTGATGTTAAGTAAGAGAGTGTTCGTGGAAAAAGGGGCAGAGGTTAATGAATTTAAGAATATGGTTGTGGAATTAATGACGGTTGCAGGGTATTTTAATATTGGTGATTTTATTCCTAAATTAGCTTGGATGGATTTACAAGGAATTGAAAAAGGGATGAAAAGTTTGCATAAAAAATTTGATGATTTATTGACAAAAATGTTTGATGAACATGAAGCAACTACCTATGAAAGAAAAGAAAATCCTGATTTTCTTGATGTTGTTATGGCAAATAAGGATAATTCTGAAGGAGAAAGGCTTAGTACAACAAATATCAAAGCACTTTTGCTGAATTTGTTCACAGCTGGTACAGACACTTCATCTAGTGTAATAGAATGGGCCCTTGCAGAAATGATGAAAAATCCTAAAATTTTCAAAAAAGCACAAGAAGAAATGGACCAAGTAATTGGCAAAAATAGACGTTTAATTGAATCTGATATTCCAAATCTTCCTTATTTACGTGCAATTTGCAAAGAAACATTTCGGAAACATCCTTCAACACCACTAAATCTCCCTAGAGTATCGACCGAGCCGTGCACGGTCGATGGTTACTACATACCGAAAAATACTAGACTCAGTGTCAACATATGGGCAATCGGACGAGATCCTGACGTGTGGGAGAATCCACTTGAGTTCAATCCCGAGAGGTTCCTGAGCGGGAAAAACGCAAAGATTGAACCTCGTGGGAACGATTTCGAGTTAATTCCATTTGGGGCAGGACGAAGGATTTGCGCGGGGACAAGGATGGGAATAGTGATGGTGGAATATATATTGGGAACTTTGGTTCATTCATTTGATTGGAAATTACCAAATGATGTTATTGATATTAATATGGAGGAATCTTTTGGATTAGCTTTGCAAAAAGCTGTCCCTCTTGAAGCTATGGTTACTCCAAGGCTATCTTTGGACGTTTAT---TGTTGCTGATCG- ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = 'Andean species of Solanaceae F3''5''H Alignment') = N: 1549, 1: 1-1548\3, 2: 2-1547\3, 3: 3-1548\3; CODONPOSSET CodonPositions (CHARACTERS = 'Andean species of Solanaceae F3''5''H Alignment') = N: 1549, 1: 1-1548\3, 2: 2-1547\3, 3: 3-1548\3; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23773] TITLE Andean_species_of_Solanaceae_DFR_Alignment; LINK TAXA = Taxa3; DIMENSIONS NCHAR=2112; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Iochroma_calycinum_JN593314_ ATGGCAAGTGAAGCT---CATGCAGTTGTTGATGCCCCTTCTCCA------GTGGGGGGGACGGTTTGCGTCACTGGAGCAGCTGGATTTATTGGTTCTTGGCTTGTCATGAGACTCCTTGAACGCGGTTATAATGTCCATGCTACTGTTCGTGATCCTGAAAACAAGAAGAAGGTGAAACATCTGTTGGAATTGCCAAAAGCTGATACAAACTTAACGCTGTGGAAAGCGGACTTAACAGTGGAAGGAAGCTTTGATGAAGCCATTCAAGGCTGTCAAGGAGTATTTCATGTGGCTACACCTATGGATTTCGAGTCCAACGACCCTGAGAACGAAGTAATTAAACCAACAGTCAGGGGAATGTTAAGCATCATAGAATCATGTGCTAAAGCTAACACAGTGAAGAGGCTGGTTTTTACTTCATCTGCTGGAACTGTTGATGTCCAAGAGCACCAAAAACTCTTCTATGACGAGACCAGCTGGAGCGACTTGGACTTCATATATGCTAAGAAGATGACAGGATGGATGTATTTTGTTTCCAAGATACTGGCAGAGAAAGCTGCAATGGAAGAAGCTAAAAAGAATAACATTGATTTCATTAGCATCATACCACCACTGGTTGTTGGTCCATTCATCACACCTACGTTCCCACCTAGCTTAATCACTGCCCTTTCAATAATTACCGGGAATGAAGCTCATTACTGCATCATTAAACAAGGCCAATATGTGCATTTGGATGATCTTTGTGAGGCTCATATATTCCTGTATGAGCACACCAAGGCAGAGGGAAGATTCATTTGCTCGTCCCATCATGCTATCATCTACGATGTGGCTAAGATGGTGCGAGAAAAATGGCCAGAGTACTATGTTCCTACTGAG---TTTAAAGGCATTGATAAGGACTTGCCCATAGTATCTTTTTCGTCAAAGAAGCTAATGGATATGGGGTTTCAATTCAAATACACTTTGGAGGATATGTATAAAGGGGCCATTGAGACTTGCCGACAGAAGCAGTTGCTTCCCTTTTCTACTGGAAGCACTGCAGACAACGGACAAAACAAAGAAGCCATTCCCATTTCTACTGAAAACTATGCAAGTGGCAAAGAGAATGCACCAGTTGCAAATCGTACAGGAAAGTTAATCAACGGCGAAATCTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Iochroma_calycinum_KJ094357 ATGGCAAGTGAAGCT---CATGCAGTTGTTGATGCCCCTTCTCCA------GTGGGGGGGACGGTTTGCGTCACTGGAGCAGCTGGATTTATTGGTTCTTGGCTTGTCATGAGACTCCTTGAACGCGGTTATAATGTCCATGCTACTGTTCGTGATCCTGAAAACAAGAAGAAGGTGAAACATCTGTTGGAATTGCCAAAAGCTGATACAAACTTAACGCTGTGGAAAGCGGACTTAACAGTGGAAGGAAGCTTTGATGAAGCCATTCAAGGCTGTCAAGGAGTATTTCATGTGGCTACACCTATGGATTTCGAGTCCAACGACCCTGAGAACGAAGTAATTAAACCAACAGTCAGGGGAATGTTAAGCATCATAGAATCATGTGCTAAAGCTAACACAGTGAAGAGGCTGGTTTTTACTTCATCTGCTGGAACTCTTGATGTCCAAGAGCACCAAAAACTCTTCTATGACGAGACCAGCTGGAGCGACTTGGACTTCATATATGCTAAGAAGATGACAGGATGGATGTATTTTGTTTCCAAGATACTGGCAGAGAAAGCTGCAATGGAAGAAGCTAAAAAGAATAACATTGATTTCATTAGCATCATACCACCACTGGTTGTTGGTCCATTCATCACACCTACGTTCCCACCTAGCTTAATCACTGCCCTTTCAATAATTACCGGC---------------------------------CAATATGTGCATTTGGATGATCTTTGTGAGGCTCATATATTCCTGTATGAGCACACCAAGGCAGAGGGAAGATTCATTTGCTCGTCCCATCATGCTATCATCTACGATGTGGCTAAGATGGTGCGAGAAAAATGGCCAGAGTACTATGTTCCTACTGAG---TTTAAAGGCATTGATAAGGACTTGCCCATAGTATCTTTTTCGTCAAAGAAGCTAATGGATATGGGGTTTCAATTCAAATACACTTTGGAGGATATGTATAAAGGGGCCATTGAGACTTGCCGACAGAAGCAGTTGCTTCCCTTTTCTACTGGAAGCACTGCAGACAACGGACAAAACAAAGAAGCCATTCCCATTTCTACTGAAAACTATGCAAGTGGCAAAGAGAATGCACCAGTTGCAAATCGTACAGGAAAGTTAATCAACGGCGAAATCTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Iochroma_cyaneum_GU595064 ATGGCAAGTGAAGCT---CATGCAGTTGTTGATGCCCCTTCTCCA------GTGGGGTGGACGGTTTGTGTCACTGGAGCAGCTGGATTTATTGGTTCTTGGCTTGTCATGAGACTCCTTGAACGCGGTTATAATGTCCATGCTACTGTTCGTGATCCTGAAAACAAGAAGAAGGTGAAACATCTGTTGGAATTGGCAAAAGCTGATACAAACTTAACGCTGTGGAAAGCGGACTTAACAGTGGAAGGAAGCTTTGATGAAGCCATTCAAGGCTGTCAAGGAGTATTTCATGTGGCTACACCTATGGATTTCGAGTCCAACGACCCTGAGAACGAAGTAATTAAACCAACACTCAGGGGAATGTTAAGCATCATAGAATCATGTGCTAAAGCTAACACAGTGAAGAGGCTGGTTTTTACTTCATCTGCTGGAACTCTTGATGTCCAAGAGCACCAAAAACTCTTCTATGACGAGACCAGCTGGAGCGACTTGGACTTCATATATGCTAAGAAGATGACAGGATGGATGTATTTTGTTTCCAAGATACTGGCAGAGAAAGCTGCAATGGAAGAAGCTAAAAAGAATAACATTGATTTCATTAGCATCATACCACCACTGGTTGTTGGTCCATTCGTCACACCAACGTTCCCACCAAGCTTAATCACTGCCCTTTCAATAATTACCGGGAATGAAGCTCATTACTGCATCATTAAACAAGGCCAATATGTGCATTTGGATGATCTTTGTGAGGCTCATATATTCCTGTATGAGCACCCCAAGGCTGAGGGACGATTCATTTGCTCGTCCCATCATGCTATCATCTACGATGTGGCTAAGATGGTGCGAGAAAAATGGCCAGAGTACTATGTTCCTACTGAG---TTTAAAGGCATTGATAAGGACTTGCCCATAGTATCTTTTTCGTCAAAGAAGCTAATGGATATGGGGTTTCAATTCAAATACACTTTGGAGGATATGTATAAAGGGGCCATTGAGACTTGCCGACAGAAGCAGTTGCTTCCCTTTTCTACCCGAAGCACTGCAGACAACGGACAAAACAAAGAAGCCATTCCCATTTCTACTGAAAACTATGCAAGTGGCAAAGAGAATGCACCAGTGGCAAATCGTACAGGAAAGTTAATCAATAGAGAAATCTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Nicotiana_benthamiana_V0.4.2._Scf51239 ATGGCAAGTGAAGCT---CATGCAGCTGTTCATACCTCTTCTCCTCCG---GCAACGCCAACAGTTTGCGTCACTGGAGCTGCTGGATTTATTGGCTCTTGGCTTGTGATGAGACTCATTGAACGTGGTTATAATGTTCACGCTACTGTTCGTGATCCTGAGAACAACAAGAAGGTCAAGCATCTATTGGAATTGCCAAAAGCTGACACGAACTTAACGCTGTGGAAAGCGGACTTGTCAGTGGAAGGAAGTTTTGATGAAGCCATTCAAGGCTGTCAAGGGGTATTTCATGTGGCAACACCTATGGATTTCGAGTCCAAGGATCCTGAGAATGAAGTAATTAAACCAACAGTCAGGGGAATGTTGAGCATCATAGAATCATGTGCTAAAGCAAACACAGTGAAGAGGCTGGTTTTCACTTCATCTGCTGGAACTCTCGATGTCCAAGAGCACCAAAAACTCTTCTACGACGAGACCAGCTGGAGCGACTTGGACTTTATATATGCTAAGAAGATGACAGGATGGATGTATTTTGTTTCTAAGATACTGGCAGAGAAGGCCGCAATGGAAGCAGCTAAACAGAATAACATTGATTTTATTAGCATCATACCGCCGCTGGTTGTTGGTCCATTCCTCACGCCTACATTCCCACCTAGCTTAATCACTGCACTTTCACTAATTACTGGTAATGAAACTCACTACTGCATCATTAAACAAGGTCAATATGTGCATTTGGATGATCTTTGTGAGGCACATATTTTCCTATATGAGCACCCAAAGGCAGAGGGAAGATTCATCTGCGCATCCCATCATGCGATCATCTATGATGTGGCAAAGATGGTCCGAGAGAAATGGCCGGAGTACTACATCCCTACTGAGTGGTTTAAAGGTATCGATAAGGACTTGCCTGTGGTGTATTTTTCATCAAAGAAGCTGATGGATATGGGGTTTCAATTCAAGTACACTTTGGAGGATATGTATAAAGGGGCCATTGAGACTTGTCGACAGAAACAGTTGCTTCCCTTTTCTACCCAAAGCACAACAGCTAATGGACGTGACAAAGAAGCCATTCCCCTTTCTGCTGAAAACTATGCAAGTGGCAAGGAGAATTCACCAGTTGCAAATGGAACAGGAAAGTCAACCAATGGTGAAATCTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Petunia_hybrida_KC140107 ATGGCAAGTGAAGCAGTTCATGCC------------CCTTCACCTCCGGTGGCAGTGCCGACAGTTTGCGTCACTGGAGCTGCTGGATTTATTGGCTCTTGGCTTGTCATGAGACTCCTTGAACGCGGTTACAATGTTCACGCTACTGTTCGTGATCCTGAGAACAAGAAGAAGGTGAAACATCTGCTGGAACTGCCAAAGGCTGATACGAACTTAACACTGTGGAAAGCGGACTTGACAGTAGAAGGAAGCTTTGACGAGGCCATTCAAGGCTGTCAAGGAGTATTTCATGTAGCAACACCTATGGATTTCGAGTCCAAAGACCCTGAGAATGAAGTAATCAAGCCAACAGTCCGGGGAATGCTAAGCATCATTGAATCATGTGCTAAAGCAAACACAGTGAAGAGGCTGGTTTTCACTTCATCTGCTGGAACTCTCGATGTGCAAGAGCAACAAAAACTTTTCTATGACCAGACCAGCTGGAGCGACTTGGACTTCATATATGCTAAGAAGATGACAGGATGGATGTATTTTGCTTCCAAGATACTGGCAGAGAAAGCCGCAATGGAAGAAGCTAAAAAGAAGAACATTGATTTCATTAGCATCATACCACCACTGGTTGTTGGTCCATTCATCACACCTACATTTCCCCCTAGTTTAATCACTGCCCTTTCACTAATTACTGGGAATGAAGCTCATTACTGCATCATTAAACAAGGTCAATATGTGCATTTGGATGATCTTTGTGAGGCTCACATATTCCTGTATGAGCACCCCAAGGCAGATGGAAGATTCATTTGCTCGTCCCACCATGCTATCATCTACGATGTGGCTAAGATGGTCCGAGAGAAATGGCCAGAGTACTATGTTCCTACTGAG---TTTAAAGGGATCGATAAAGACCTGCCAGTGGTGTCTTTTTCATCAAAGAAGCTGACAGATATGGGTTTTCAGTTCAAGTACACTTTGGAGGATATGTATAAAGGGGCCATCGATACTTGTCGACAGAAGCAGCTGCTTCCCTTTTCTACCCGAAGTGCTGAAGACAATGGACATAACCGAGAAGCCATTGCCATTTCTGCTCAAAACTATGCAAGTGGCAAAGAGAATGCACCAGTTGCAAATCATACAGAAATGTTAAGCAATGTTGAAGTCTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Solanum_lycopersicum_NM001247479 ATGGCAAGTGAAGCT---CATGCAGTTGTTGATGCCCACTCTCCTCCG---AAGACGACAACGGTTTGGGTCACAGGAGGAGCTGGATTTATCGGCTCTTGGCTTGTCATGAGACTCCTTGAACGCGGTTATAATGTCCACGCTACTGTTCGTGATCCTGAGAACCAGAAGAAGGTGAAACATCTGTTGGAATTGCCAAAAGCTGATACAAACTTAACGCTGTGGAAAGCTGACTTGGCAGTGGAAGGAAGCTTTGATGAAGCCATTCAAGGCTGTCAAGGAGTATTTCATGTGGCTACACCCATGGATTTCGAGTCCAAGGATCCAGAGAACGAAGTAATCAAACCAACAGTCAGGGGAATGTTAAGTATCATAGAATCATGTGCTAAAGCTAACACAGTGAAGAGGCTGGTTTTCACTTCATCTGCTGGAACTCTTGATGTCCAAGAGGACCAAAAACTCTTCTATGACGAGACCAGCTGGAGCGATTTGGACTTCATATATGCTAAGAAGATGACAGGCTGGATGTATTTTGTTTCCAAGATACTGGCAGAGAAGGCTGCAATGGAAGAAGCTAGAAAGAATAACATTGATTTCATTAGCATCATACCACCACTGGTTGTTGGTCCATTCATCACATCTACGTTCCCACCAAGCTTAATCACTGCCCTTTCACTAATTACC---------GCTCACTACGGCATCATTAAACAAGGTCAATATGTGCATTTGGATGATCTTTGTGAGGCTCATATATTCCTGTATGAGCACCCCAAGGCAGAGGGAAGATTCATTTGCTCATCCCATCATGCTATCATCTACGATGTGGCTAAGATGGTGCGACAGAAATGGCCAGAGTACTATGTTCCTACTGAG---TTTAAGGGTATCGATAAGGACTTGGCCCTAGTGTCTTTTTCATCAAAGAAGCTTATGGATATAAAATTTCAATTCAAACACACTTTGGAGGATATGTATAAAGGGGCCATTGAGACTTGCCGACAGAAGCAATTGCTTCCCTTTTCTACCCGAAGCACTGCAGACAATGGAAAAGACAAAGAAGCAATTCCCATTTCTACTGAAAACTATTCAAGTGGCAAGGAGAATGCACCAGTTGCCAATTGTACAGGGAAGTTTACCAATGGTGAAATCTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Solanum_tuberosum_AF449422 ATGGCAAGTGAAGTT---CATGCAGTTGTTGATGCCCATTCTCCCCCG---AAGACGCCAACGGTTTGCGTCACAGGAGCAGCTGGATTTATCGGCTCTTGGCTTGTCATGAGACTCCTTGAACGCGGTTATAATGTCCATGCTACTGTTCGTGATCCTGAGAACCAGAAGAAGGTGAAACATCTGTTGGAATTGCCAAAAGCTGATACAAACTTAACGCTGTGGAAAGCAGACTTGGCAGTGGAAGGAAGCTTTGATGAAGCCATTAAAGGTTGTCAAGGAGTATTTCATGTGGCTACACCGATGGATTTCGAGTCCAAGGATCCAGAGAACGAAGTAATTCAACCAACAGTCAGGGGAATGTTAAGTATCATAGAATCATGTGCTAAAGCTAAAACAGTGAAGAGGCTGGTTTTCACTTCATCTGCTGGAACTCTTGATGTCCAAGAGGACCAAAAACTCTTCTATGACGAGACCAGCTGGAGCGATTTGGACTTCATATATGCTAAGAAGATGACAGGATGGATGTATTTTGTTTCCAAGATACTGGCAGAGAAGGCTGCAATGGAAGAAGCTAAAAAGAACAACATTAATTTCATTAGCATCATACCACCACTGGTTGTTGGTCCATTCATCACACCTACGTTCCCACCTAGCTTAATCACTGCCCTTTCACTAATTACCGGGAATGAAGCTCACTACGGCATCATTAAACAAGGTCAATATGTGCATTTGGATGATCTTTGTGAGGCTCATATATTCCTGTATGAGCACCCCAAGGCAGAGGGAAGATTCATTTGCTCATCTCATCATGCTATCATCTACGATGTGGCTAAGATGGTGCGACAGAAATGGCCAGAGTACTATGTTCCTACTGAG---TTTAAGGGTATCGATAAGGACTTGCCCATAGTGTCTTTTTCATCAAAGAAGCTTATGGACATGGGGTTTCAATTCAAATACACTTTGGAGGATATGTATAAAGGGGCCATTGAGACTTGCCGACAGAAGCAGTTGCTTCCTTTTCATACCCGAAGCACTGCAGCCAATGGAAAAGACAAAGAAGCAATTCCCATTTTTACTGAAAACTATTCAAGTGGCAAGGAGAATGCACCAGTTGCCAATTGTACAGGAAAGTTTACCAATGGTGAAATTTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = Andean_species_of_Solanaceae_DFR_Alignment) = N: 1159-2112, 1: 1-1158\3, 2: 2-1159\3, 3: 3-1160\3; CODONPOSSET * UNTITLED (CHARACTERS = Andean_species_of_Solanaceae_DFR_Alignment) = N: 1159-2112, 1: 1-1158\3, 2: 2-1159\3, 3: 3-1160\3; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23381] TITLE Andean_species_of_Solanaceae_CHI_Alignment; LINK TAXA = Taxa6; DIMENSIONS NCHAR=962; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Iochroma_calycinum_KJ094342 ATG---------GCGTGTGTTACTAAATTGCAGGTTGAGAATTACGTGTTTCCACCAACAGTTGTGAAACCTCCTGGTTCCAACAATATCTTGCTCCTTGGTGGCGCAGGGAATAGAGGTTTGGAGATTGAAGGAAAATTTGTGAAGTTCACTGTGATCGGAGTGTACTTGGAAGAGAGTGCTATTCCATTTCTCGCTGCTAAATGGAAAGGCAAAAGCTCCGAGGAGTTGACCCATTCAGTTGAATTCTTCAGGGATATCGTTGCAGGTCCCTTTGAGAAATTCACTCGAGTAACTATGATAATGCCCTTGAC{GT}GGTAAGCAATACTCTGAGAAGGTGGCAGAAAATTGTGTTGCCTATTGGAAAGCAATAGGAACCTACAGTGATGCAGAGAGTCAGTCCATCGAAAAGTTTCTCAATGTTTTCCAGAGTGAAAACTTCCCACCTGGTGCCTCCATCCTTTTTACTCAATCACCACTTGGGTCATTGACGATTAGCTTCTCTAAAGATGATTCAGTTCCTGTCACTGGGAATGCTGTTATAGAGAACAAACTATTGGCAGAAGCAGTGCTGGAATCCATAATTGGCAAGCACGGAGTTTCCCCTGCCGCAAAATTTAGTCTTGCCAAAAGAGTATCAGAACTGTTAGAAAAGAGCAATGCTGAGGCGCCG---GTTTGCGAAAAACCAGGAAGTGAAGAATCTGC----TATTCAGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Iochroma_calycinum_KJ094355 ATG---------GCGTGTGTTACTAAATTGCAGGTTGAGAATTACGTGTTTCCACCAACAGTTGTGAAACCTCCTGGTTCCAACAATATCTTGCTCCTTGGTGGCGCAGGGAATAGAGGTTTGGAGATTGAAGGAAAATTTGTGAAGTTCACTGTGATCGGAGTGTACTTGGAAGAGAGTGCTATTCCATTTCTCGCTGCTAAATGGAAAGGCAAAAGCTCCGAGGAGTTGACCCATTCAGTTGAATTCTTCAGGGATATCGTTGCAGGTCCCTTTGAGAAATTCACTCGTGTAACTATGAT{AC}ATGCCCTTGAC{GT}GGTAAGCAATACTCTGAGAAGGTGGCAGAAAATTGTGTTGCCTATTGGAAAGCAATAGGAACCTACAGTGATGCAGAGAGTCAGTCCATCGAAAAGTTTCTCAATGTTTTCCAGAGTGAAAACTTCCCACCTGGTGCCTCCATCCTTTTTACTCAATCACCACTTGGGTCATTGACGATTAGCTTCTCTAAAGATGATTCAGTTCCTGTCACTGGGAATGCTGTTATAGAGAACAAACTATTGGCAGAAGCAGTGCTGGAATCCATAATTGGCAAGCACGGAGTTTCCCCTGCCGCAAAATTTAGTCTTGCCAAAAGAGTATCAGAACTGTTA?AAAAGAGCAATGCTGAGGCGCCG---GTTTGCGAAAAACCAGGAAGTGAAGAATCCGC----AATCCAGTAACTGGACTACAGAAATTGAAGAGAAAATCTACCATTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Iochroma_cyaneum_KJ094350 ATG---------GCGTGTGTTACTAAATTGCAGGTTGAGAATTACGTGTTCCCACCAACAGTTGTGAAACCTCCTGGTTCCAACAATCTCTTGTTCCTTGGTGGCGCAGGGAGTAGAGGTTTGGAGATTGAAGGAAAATTTGTGAAGTTCACTGTGATCGGAGTGTACTTGGAAGAGAGCGCTATTCCATTTCTCGCTGCTAAATGGAAAGGCAAAAGCTCCGAGGAGTTGACCCATTCAGTTGAATTCTTCAGGGATATCGTTACAGGTCCCTTTGAGAAATTCACTCGTGTGACTATGATCTTGCCCTTGACTGGTAAGCAATTCTCTGAGAAGGTGGAAGAAAATTGTGTTGCCTATTGGAAAGCAATGGGAACCTACAGTGATGCAGAGAGTCAGTCCATCGAAAAGTTTCTCAATGTTTTCCAGAGTGAAAACTTCCCACCTGGTGCCTCCATCCTTTTTACTCAATCACCACTTGGGTCATTGACGATTAGCTTCTCTAAAGATGATTCAGTTCCTGTCACTGGGAATGCTGTTATAGAGAACAAACTATTGGCAGAAGCAGTGCTGGAATCCATAATTGGCAAGCACGGAGTTTCCCCTGCCGCAAAATTTAGTCTTGCCAAAAGAGTATCAGAACTGTTAGAAAAGAGCAATGCTGAGGCGCCG---GTTTGCGAAAAACCAGGAAGTGAAGAATCCGC----AATCCAGTAACTGGACTACAGAAATTGAAGAGAAAATCTACCATTCCAGAAATTGGAGTCTACTT-GGGATAA-TAAAAAAGA-TTCTAGTACTGAAACTCCCTTGTCAACTTGGTCTGATGTTGTCAAGGTTG-CCTGATTATACTAGAGGAATGATTT-AGCCTAGTTTTT-CTAGATTCTCTACTATGCA---------------------------------------------------------- Nicotiana_benthamiana_V0.4.2.Scf28382_ ATG---------GAGTCCATTACC---------ATTGAGAATTACGTATTCCCATCAACAATGGTGAAGCCTCCTGGTTCTACTAATTCCTTTTTCCTTGCCGGCGCAGGAAATAGAGGTTTGGATATTGAAGGGAAGTTCGTGAAGTTCACTGCGATCGGCGTGTATTTGGAAGAGACTGCTCTTCCTTTTCTCGCCACTAAATGGAAAAGCAAAAGCTCCGAGGAGTTGGCTAATTCACTCGACTTTTTCAGGGATATTGTCACAGGTCCCTTTGAGAAATTCATTCGAGTGACTATGATCTTGCCTTTGACGGGTAAGCAATACTCAGAGAAGGTGGCAGAAAATTGTGTTGCCCATTGGAAAGCAATAGGAACCTACACCGATGCAGAGAGTCAGGCCATTGAAGAGTTCCTCAACATTTTCCAGAATGAAACCTTCCCGCTGGGTGCCTCCATCCTTTTTACTCAATCACCTGTTGGGGCATTGACGATTAGCTTCATTAAAGATGATACAATTACTGGCACTGGAAATGCTGTTATAGAGAACAAACAATTGTCTGAAGCAGTGCTGGAATCCATAATTGGCAAACATGGAGTTTCCCCTGCAGCAAAGTGTAGTATTGCCGAAAGAGTATCATCGCTATTGAAAAAGAGCTATGGAGAGGTGCCT---GTTTGTGAAAAACCAGGAAACGGGAAATCCTCC-GATCCAGTGAATGAGGAC-----------------AAACCTACCATTGCAGAAATTGGAGTCTAGTT-AGGACAA-CAAAAAAGG-TTATAGTGCTGAAAATCCTTTGTCAACTGACCCTGATGTTGTCAACGTTG-CATGAGTATACTAGAGGAATGATTTT-GCCTAGGCTTTTCTTGCTTCTTTACTATGTAGTAGTATTCAACAAGGTTCCATCTCTGAAACTGTGTTAGCTATGTAATGTGGGAGGCT Petunia_hybrida_X14589 ATGTCTCCTCCAGTGTCCGTTACTAAAATGCAGGTTGAGAATTACGCTTTCGCACCGACC---GTGAACCCTGCTGGTTCCACCAATACCTTGTTCCTTGCTGGTGCTGGGCATAGAGGTCTGGAGATAGAAGGGAAGTTTGTTAAGTTTACGGCGATAGGTGTGTATCTAGAAGAGAGTGCTATTCCTTTTCTGGCCGAAAAATGGAAAGGCAAAACCCCCCAGGAGTTGACTGACTCGGTCGAGTTCTTTAGGGATGTTGTTACAGGTCCATTTGAGAAATTTACTCGAGTTACTATGATCTTGCCCTTGACGGGCAAGCAGTACTCGGAGAAGGTGGCGGAGAATTGTGTTGCGCATTGGAAGGGGATAGGAACGTATACTGATGATGAGGGTCGTGCCATTGAGAAGTTTCTAGATGTTTTCCGGAGTGAAACTTTTCCACCTGGTGCTTCCATCATGTTTACTCAATCACCCCTAGGGTTGTTGACGATTAGCTTCGCTAAAGATGATTCAGTAACTGGCACTGCGAATGCTGTTATAGAGAACAAGCAGTTGTCTGAAGCAGTGCTGGAATCAATAATTGGGAAGCATGGAGTTTCTCCTGCGGCAAAGTGTAGTGTCGCTGAAAGAGTAGCGGAACTGCTCAAAAAGAGCTATGCTGAAGAGGCATCTGTTTTTGGAAAACCGGAGACCGAGAAATCTACT---------------------------------------------ATTCCAGTGATTGGAGTCTAGTTTAGGACAAGTAAAATG---TTTTAGTGCTGAA-TTCCCTTGTCAAATGGGCCTGATGTTGTAAACTGTTACCTTAATATAGTAGATGAATGGTTGT-GGCTAGTCTTTTCTAGCTTCTATACTATGCCGTAGTATGCAACAAAATGTATCTGTACTGGCTATTTA--------------------- Solanum_lycopersicum_XM04238946 ATG---------GCGGTTGTTACAAAATTGCAGGTAGAGAATCACGTGTTCCCACCAACAATGGTGAATCCTCTGGGCTCCAACAATATGTTTTTTCTCGCCGGCGCAGGGAATAGAGGTTTGGAGATTGAAGGAAAATTTGTGAAGTTTACTGCGATCGGTGTGTACTTGGAAGAGAGTGCTATTCCATTTCTAGCTGATAAATGGAAAGGGAAAAGCTCTGAGGAGTTGGAACATTCAGTCGAATTCTTCAGGGATATCGTTACAGGTCCATTTGAGAAATTCACTCGAGTGACTATGATCTTGCCCTTGACGGGTAAGCAATACTCTGAGAAGGTAGCAGAAAATTGTGTTGCATATTGGAAAGCAATAGGAACCTACAGTGATGCAGAGATGCAGGCCATTGAGAAGTTCCTCGATGTTTTCCAGAGTGAAACCTTCCCACCTGGTGCCTCCATCCTTTTTACTCAATCACCGCTTGGATCATTGACAATTAGCTTCTCTGAAGATGATTCAGTTCCTTGTGTTGGGAATGCTGTTATAGAGAACAAACAATTGTCAGAAGCAGTGCTGGATTCCATAATTGGCGAGCACGGAGTTTCCCCTGCAGCAAAGTGTAGTATTGCAAAAAGAGTATCAGAACTGTTG---------------------------GTTTGTGAAAAACCAGGAAGTGAGCTATCGTCA----GTCCAGTAACTGGACTACAGAAATCGAAGAGAAA-TAGACCATGTCAGAAAGTGGAGTCTACTT-AGGACAA-TAAAAGAGCTTTCTGGTGCTGAAACGCCCTTGTCAACTCGGTCTAATGT-GTCAAGGTAT-CTTGAGGATATTAGACAAATGATTTTAGCCTAGCTTTT----------CTACTATGCAATAGTGTGCAATAAGGTCCCA-CTTTAAGTCTGT--TAATTATGTAAATGTGAGAGAT Solanum_tuberosum_XM006348549 ATG---------GCGCTCGTTACAAAATTGCAGGTTGAGAATTATGTGTTCCCACCAACAGTGGTGAAACCTCCGGGCTCCAACAATACGTTTTTCCTCGCCGGCGCAGGGAATAGAGGTTTGGAGATTGAAGGAAAATTTGTGAAGTTTACTGCGATCGGTGTGTACTTGGAAGAGAGTGCTATTCCATTTCTAGCTGATAAATGGAAAGGGAAAAGCTCTGAGGAGTTGGAACATTCAGTCGAATTCTTCAGGGATATCGTTACAGGTCCCTTTGAGAAATTCACTCGAGTGACTATGATCTTGCCCTTGACGGGTAAGCAATACTCTGAGAAGGTGGCAGAAAATTGTGTTGCCTATTGGAAAGCAATAGGAACCTACAGTGATGCAGAGAGGGAGGCCATTGAAAAGTTCCTCAATGTTTTCCAGAGTGAAACCTTCCCACCTGGTGCCTCCATCATTTTTACTCAATCACCGCTTGGATCATTGACGATTAGCTTCTCTAAAGATGATTCAGTTCCTTGTGTTGGGAATGCTGTTATAGAGAACAAACAATTGTCAGAAGCAGTGCTGGATTCCATAATTGGCGAGCACGGAGTTTCCCCTGCAGCAAAGTGTAGTATTGCCAAAAGAGTATCAGAACTGTTG---------------------------ATTTGTGAAAAGCCAGGAAGTGAGCTATCTATCCTCAGTCCAGTAACTGAACTACAGAAATCGAAAAGAAA-TCCACCATGTCAGAAATTGGAGTCTACTT-AGGACAA-TAAAAGAGG-TTCTAGTGCTGAAACTCCCTTGTCAACGCGGTCTGATGT-GTCAAGGTAT-CTTGAGGATACTAGACGAATGATTT-AGCCTAGCTTTT-CTAGATTCTCTACTATGCAATAGTGTGCAATAAGGTCCCATCTCTAAGTCTGTGTTAATTATGTAAATGTGAGAAAC ; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = Andean_species_of_Solanaceae_CHI_Alignment) = N: 849-962, 1: 1-849\3, 2: 2-850\3, 3: 3-848\3; CODONPOSSET CodonPositions (CHARACTERS = Andean_species_of_Solanaceae_CHI_Alignment) = N: 849-962, 1: 1-849\3, 2: 2-850\3, 3: 3-848\3; END; BEGIN TREES; TITLE Andean_species_of_Solanaceae_DFR; LINK TAXA = Taxa3; TRANSLATE 1 Petunia_hybrida_KC140107, 2 Nicotiana_benthamiana_V0.4.2._Scf51239, 3 Solanum_lycopersicum_NM001247479, 4 Solanum_tuberosum_AF449422, 5 Iochroma_cyaneum_GU595064, 6 Iochroma_calycinum_KJ094357, 7 Iochroma_calycinum_JN593314_; TREE DFR_Tree = [&R] (1:0.0295155,(2:0.060068,((3:0.018125,4:0.015913):0.025766,(5:0.010458,(7:0.001757,6:8.97E-4):0.00422):0.021744):0.018498):0.0295155); END; BEGIN TREES; TITLE 'Andean species of Solanaceae F3''5''h'; LINK TAXA = Taxa4; TRANSLATE 1 Petunia_hybrida_D14588, 2 Nicotiana_benthamiana_V0.4.2.Scf45423, 3 Solanum_lycopersicum_SL2.40sc03876, 4 Solanum_tuberosum_AY675558, 5 Iochroma_cyaneum_KJ094354, 6 Iochroma_calycinum_KJ094346, 7 Iochroma_calycinum_KJ094345; TREE 'F3''5''H ML Tree' = [&R] (1:0.046479,(2:0.075515,((3:0.031956,4:0.020593):0.059751,(5:0.010626,(6:6.45E-4,7:6.51E-4):0.011074):0.030611):0.098965):0.046479); END; BEGIN TREES; TITLE Andean_species_of_Solanaceae_F3H; LINK TAXA = Taxa2; TRANSLATE 1 Petunia_hybrida_AF022142, 2 Nicotiana_benthamiana_V0.4.2Scf2714_, 3 Solanum_lycopersicum_HQ008775, 4 Solanum_tuberosum_AY102035, 5 Iochroma_cyaneum_KJ094352, 6 Iochroma_calycinum_KJ094347, 7 Iochroma_calycinum_KJ094358; TREE F3H_ML_Tree = [&R] (1:0.073273,2:0.054559,((3:0.041111,4:0.014368):0.05241,(5:0.001923,(6:0.001833,7:0.003999):0.003679):0.037243):0.028977); END; BEGIN TREES; TITLE 'Andean species of Solanaceae F3''H'; LINK TAXA = Taxa5; TRANSLATE 1 Petunia_hybrida_AF155332, 2 Nicotiana_benthamiana_V0.4.2.Scf26509, 3 Solanum_lycopersicum_XM004235959, 4 Solanum_tuberosum_PGSC0003DMC400042656, 5 Iochroma_cyaneum_KJ094353, 6 Iochroma_calycinum_KJ094344, 7 Iochroma_calycinum_KJ094343; TREE 'F3''H ML Tree' = [&R] (1:0.061676,(2:0.082723,((3:0.027536,4:0.009836):0.062389,(5:0.007057,(6:6.47E-4,7:6.46E-4):0.005593):0.028947):0.048035):0.061676); END; BEGIN TREES; TITLE Andean_species_of_Solanaceae_ANS; LINK TAXA = Taxa7; TRANSLATE 1 Petunia_hybrida_X70786, 2 Nicotiana_benthamiana_V0.4.2_Scf1236, 3 Solanum_lycopersicum_AC244195, 4 Solanum_tuberosum_HQ337900, 5 Iochroma_cyaneum_KJ094351, 6 Iochroma_calycinum_KJ094356_, 7 Iochroma_calycinum_KJ094359; TREE ANS_ML_Tree = [&R] (1:0.049804,(2:0.069152,((3:0.054851,4:0.042797):0.056436,(5:0.035505,(6:0.002264,7:0.0):0.059265):0.020781):0.083925):0.049804); END; BEGIN TREES; TITLE Andean_species_of_Solanaceae_CHI; LINK TAXA = Taxa6; TRANSLATE 1 Petunia_hybrida_X14589, 2 Nicotiana_benthamiana_V0.4.2.Scf28382_, 3 Solanum_lycopersicum_XM04238946, 4 Solanum_tuberosum_XM006348549, 5 Iochroma_cyaneum_KJ094350, 6 Iochroma_calycinum_KJ094355, 7 Iochroma_calycinum_KJ094342; TREE CHI_ML_Tree = [&R] (1:0.0978545,(2:0.114205,((3:0.035978,4:0.013573):0.051472,(5:0.008488,(6:0.0,7:0.006516):0.007664):0.045044):0.041765):0.0978545); END; BEGIN TREES; TITLE Andean_species_of_Solanaceae_CHS_Alignment; LINK TAXA = Taxa1; TRANSLATE 1 Petunia_hybrida_X14591, 2 Nicotiana_benthamiana_EF421432, 3 Solanum_lycopersicum_NM001247107, 4 Solanum_tuberosum_U47738, 5 Iochroma_cyaneum_KJ094349, 6 Iochroma_cyaneum_KJ094348, 7 Iochroma_calycinum_KJ094360, 8 Iochroma_calycinum_KF955587; TREE CHS_ML_tree = [&R] (1:0.0301955,(2:0.057865,((3:0.034444,4:0.015969):0.035949,(5:0.001773,(6:0.003373,(7:0.00169,8:0.002628):0.008981):0.001785):0.025745):0.125227):0.0301955); END;