#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 4:05 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., Siahaan S.A., & Takamatsu S. 2015. Notes on powdery mildews (Erysiphales) in Japan: IV. Phyllactinia, Parauncinula and Sawadaea. Mycoscience, 56(6): 590-596. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16275] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=6; TAXLABELS Phyllactinia_mali_ex_Crataegus_AB080523 Phyllactinia_mali_ex_Crataegus_AB080559 Phyllactinia_mali_ex_Mespilus_AB080556 Phyllactinia_moricola_ex_Morus_AB080540 Phyllactinia_pyri_serotinae_ex_Aria_MUMH3511 Phyllactinia_pyri_serotinae_ex_Pyrus_AB080521 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=13; TAXLABELS Parauncinula_septata_ex_Q._cuspidata_var._horikawae_AB022421 Parauncinula_septata_ex_Q._robur_MUMH4146 Parauncinula_septata_ex_Q._serrata_AB183533 Parauncinula_septata_ex_Q._serrata_MUMH4403 Parauncinula_septata_ex_Q._serrata_MUMH4435 Parauncinula_septata_ex_Q._serrata_MUMH4840 Parauncinula_septata_ex_Q._serrata_MUMH4868 Parauncinula_septata_ex_Q._serrata_MUMH4928 Parauncinula_septata_ex_Q._serrata_MUMH5223 Parauncinula_septata_ex_Q._variabilis_MUMH4113 Parauncinula_septata_ex_Q._variabilis_MUMH4131 Parauncinula_septata_ex_Q._variabilis_MUMH4187 Parauncinula_septata_ex_Q._variabilis_MUMH4189 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=30; TAXLABELS Leveillula_cylindrospora_ex_Noaea_AB080468 Leveillula_duriaei_ex_Salvia_AB080475 Leveillula_elaeagni_ex_Elaeagnus_AB048350 Leveillula_saxaouli_ex_Haloxylon_AB080469 Leveillula_taurica_ex_Helianthus_AB080472 Leveillula_taurica_ex_Impatiens_AB080473 Ovulariopsis_sp._ex_Senna_AB691228 Phyllactinia_actinidiae_ex_Actinidia_AB080500 Phyllactinia_actinidiae_ex_Actinidia_AB080508 Phyllactinia_actinidiae_latifoliae_ex_Actinidia_MUMH5514 Phyllactinia_angulata_ex_Quercus_AB080566 Phyllactinia_antarctica_ex_Embothrium_AB080568 Phyllactinia_betulae_ex_Betula_AB080505 Phyllactinia_broussonetiae_kaempferi_ex_Broussonetia_AB080492 Phyllactinia_cassiae_fistulae_ex_Cassia_AB691227 Phyllactinia_chubutiana_ex_Lycium_AB243690 Phyllactinia_enkianthi_ex_Lyonia_AB080504 Phyllactinia_fraxini_ex_Fraxinus_AB080549 Phyllactinia_fraxini_ex_Fraxinus_AB080550 Phyllactinia_fraxinicola_ex_Fraxinus_AB080537 Phyllactinia_fraxinicola_ex_Fraxinus_AB080585 Phyllactinia_guttata_ex_Corylus_avellana_AB080558 Phyllactinia_hemipteleae_ex_Hemiptelea_AB080538 Phyllactinia_juglandis_ex_Juglans_AB080531 Phyllactinia_mali_ex_Crataegus_AB080523 Phyllactinia_moricola_ex_Morus_AB080561 Phyllactinia_pyri_serotinae_ex_Pyrus_AB080521 Phyllactinia_roboris_ex_Castanea_AB080516 Phyllactinia_roboris_ex_Castanopsis_AB080546 Pleochaeta_shiraiana_ex_Celtis_D84381 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23778] TITLE 'Phyllactinia pyri-serotinae ITS'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=591; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Phyllactinia_mali_ex_Crataegus_AB080523 CAGAGCGTGAAGACTCTCGGCCCCCTCCCATCCATGGCGCAAGCCGGTGCGAAGGCAGGGG--AAACATGCCGGAGTCGACCCTCCCACCCGTGTCGATGTTATCTCCTGTTGCTTTGGTGGGCCGGGGGCCGCCTAGCGGACCCCGCTGGCCCTGCGAGGGGCTAGAGCGTGCCTGCCAGAGAAAATTTTGACAA-TCGTTTGATTGGAGGAAGTCTGAGCA-GCCCCAGTGGGGGAACACACAATTTAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAACCCCTCAAGCCAGTCTGGCTTGGTCTTGGGGTCCGCCCGCGGCTGTGCGGCGGCCCTTAAATCCAGTGGCGGTACCGGTAGTGCTCTCCGCGTAGTCACGATCTCGCGATAGGGTGGCGCTGGATCCAGCCAGAAGACGA?GACGCCGCCCCTGTGCGGTGCCTTCTTTCA-ATGG Phyllactinia_mali_ex_Crataegus_AB080559 CAGAGCGTGAAGACTCTCGGCCCCCTCCCATCCATGGCGCAAGCCGGTGCGAAGGCAGGGGG-AAACATGCCGGAGTCGACCCTCCCACCCGTGTCGATGTTATCTCCTGTTGCTTTGGTGGGCCGGGGGCCGCCTAGCGGACCCCGCTGGCCCTGCGAGGGGCTAGAGCGTGCCTGCCAGAGAAAATTTTGACAA-TCGTTTGATTGGAGGAAGTCTGAGCA-GCCCCAGTGGGGGAACACACAATTTAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAACCCCTCAAGCCAGTCTGGCTTGGTCTTGGGGTCCGCCCGCGGCTGCGCGGCGGCCCTTAAATCCAGTGGCGGTACCGGTAGTGCTCTCCGCGTAGTCACGATCTCGCGATAGGGTGGCGCTGGATCCAGCCAGAAGACGACGACGCCGCCTT-GTGCGGTGCCTTCTTTCA-ATGG Phyllactinia_mali_ex_Mespilus_AB080556 CAGAGCGTGAAGACTTT-GGCCCCCTCCCATCCATGGCGCAAGCCGGTGCGAAGGCAGGGGG-AAACATGCCGGAGTCGACCCTCCCACCCGTGTCGATGTTATCTCCTGTTGCTTTGGTGGGCCGGGGGCCGCCTAGCGGACCCCGCTGGCCCTGCGAGGGGCTAGAGCGTGCCTGCCAGAGAAAATTTTGACAA-TCGTTTGATTGGAGGAAGTCTGAGCA-GCCCCAGTGGGGGAACACACAATTTAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAACCCCTCAAGCCAGTCTGGCTTGGTCTTGGGGTCCGCCCGCGGCTGCGCGGCGGCCCTTAAATCCAGTGGCGGTACCGGTAGTGCTCTCCGCGTAGTCACGATCTCGCGATAGGGTGGCGCTGGATCCAGCCAGAAGACGACGACGCCGCCTTTGTGCGGTGCCTTCTTTCA-ATGG Phyllactinia_moricola_ex_Morus_AB080540 CTGAGCGTGAAGACTCTCGGTCCCCCGCCCCATTGG-TGCAAGCCAGTGCGAGGGGGG-----AGCATGGCCGGAGTCGACCCTCCCACCCGTGTCGATAAAAACGTCTGTTGCTTTGGTAGGCCGGGGCCCGCCTGGCGGATCCCGCTGGCCTTTGAT--GGCTGGAGCGTGCCTGCCAGAGAAA-GTTGGACAA-TCGTGTGATT-GATGAAGTCTGAGCAA---CC-AAGTGGGAAA------TT-AGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAACCCCTCAAGTCGCTCTGGCTTGGTCTTGGGGCCCGCCCGCGACAGCGTGGCGGCCCTTAAATCTAGTGGCGGTGCCGGTGGTGCTCTCCGTGTAGTCACGTTCTCGCGACAGGGCAGCACTGGACCCAGCCAAAA--GACA-AC-C-TG-TGCGTCTGTCGCACGCTATCT-ATGG Phyllactinia_pyri_serotinae_ex_Aria_MUMH3511 -----CGTGAAGACTCTCGGGCCCCCCA--GCCATGGCGCAAGCCAGTGCGGCGAGGGGGGGGAATCATGCCGGAGTCGACCCTCCCACCCGTGTCGATGTTATCTCCTGTTGCTTTGGTGGGCCGGGGGCCGCCTAGCGGACCCCGCTGGCCCTGCGC-GGGCTAGAGCGTGCCTGCCAGAGAAA-TCTTGACAACTCGTTTGATTTGAGGAAGTCTGAGCAA-CCCCAGTGGGGGAACACACAATTTAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAACCCCTCAAGCCAGTCTGGCTTGGTCTTGGGGTCCGCCCGCGGCTGCGCGGCGGCCCTTAAAGCCAGTGGCGGTACCGGTAGTGCTCTCCGCGTAGTCACGATCTCGCGGCAGGGTGGCACTGGATCCAGCCAGAAGACGATGACGCCGCCCTCGGTGCGGTGTCTGTTTCACATGG Phyllactinia_pyri_serotinae_ex_Pyrus_AB080521 CTGAGCGTGAAGACTCTCGGGCCCCCCC--GCCATGGCGCAAGCCAGTGCGGCGAGGGGGGCGAATCATGCCGGAGTCGACCCTCCCACCCGTGTCGATGTTATCTCCTGTTGCTTTGGTGGGCCGGGGGCCGCCTAGCGGACCCCGCTGGCCCTGCGC-GGGCTAGAGCGTGCCTGCCAGAGAAA-TCTTGACAA-TCGTTTAATTTGAGGAAGTCTGAGCAAGCCCCCATGGGCGAACACACAATTTAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAACCCCTCAAGCCAGTCTGGCTTGGTCTTGGGGTCCGCCCGCGGCTGCGCGGCGGCCCTTAAAGCCAGTGGCGGTACCGGTAGTGCTCTCCGCGTAGTCACGATCTCGCGGCAGGGTAGCACTGGATCCAGCCAGAAGACGATGACGCCGCCTTCGGTGCGGTGTCTGTTTCA-ATGG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'Phyllactinia pyri-serotinae ITS') = N: 1-591; CODONPOSSET CodonPositions (CHARACTERS = 'Phyllactinia pyri-serotinae ITS') = N: 1-591; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23777] TITLE 'Phyllactinia ITS+28S'; LINK TAXA = Taxa3; DIMENSIONS NCHAR=1022; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Leveillula_cylindrospora_ex_Noaea_AB080468 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCTTCGAGCCG-ACTA--GGCTTGGTCTTGGGGCTCGCCCGCGTTTGGCGCGGCGGCTCTCAAACGCAGTGG-CGGTGCCGG-TGGTGCTTTCCGCGTAGT-CACATTTCTC------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATACGGCCGG-GGCG-CCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Leveillula_duriaei_ex_Salvia_AB080475 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCGTCGAGCCG-ACTA??GGCTTGGTCTTGGGGCTCGCCCGCATTTGGCGCGGCGGCTCTTAAACGCAGTGG-CGGTGCCGG-TGGTGCTTTCCGCGTAGT-CACATTTCTCTTGACCTCAAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCG-CCTGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Leveillula_elaeagni_ex_Elaeagnus_AB048350 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCGTCGAGCCG-ACTA--GGCTTGGTCTTGGGGCTCGCCCGCATTTGGCGCGGCGGCTCTTAAACGCAGTGG-CGGTGCCGG-TGGTGCTTTCCGCGTAGT-CACATTTCTCTTGACCTCAAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCG-CCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Leveillula_saxaouli_ex_Haloxylon_AB080469 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCTTCGAGCCG-ACTA--GGCTTGGTCTTGGGGCTCGCCCGCGTCTGGCGCGGCGGCTCTCAAACGCAGTGG-CGGTGCCGG-TGGTGCTTTCCGCGTAGT-CACATTTCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAATGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCG-CCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Leveillula_taurica_ex_Helianthus_AB080472 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCGTCGAGCCG-ACTA--GGCTTGGTCTTGGGGCTCGCCCGCATTCGGCGCGGCGGCTCTTAAACGCAGTGG-CGGTGCCGG-TGGTGCTTTCCGCGTAGT-CACATTTCTC------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCG-CCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Leveillula_taurica_ex_Impatiens_AB080473 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCGTCGAGCCG-ACTA--GGCTTGGTCTTGGGGCTCGCCCGCATTTAGCGCGGCGGCTCTTAAACACAGTGG-CGGTGCCGG-TGGTGCTTTCCGCGTAGT-CACATTTCTCTTGACCTC?AATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCG-CCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGAAACGTAGCTCCTTTCGGGGAGTGTTATAGCCTGCGACGCAATACCACCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Ovulariopsis_sp._ex_Senna_AB691228 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACAACCCTTCGGGCCC-GCGG-TGGCTTGGTGTTGGGGCTCGCCCGC-GCCCGCGCGGCGGCCCTTAAATGTAGTGG-CGGTGCCCG-TGGTACTCTCCGCGTAGT-CACAG-TCTC----------------------------------------------------------------------------------------------------------------------------------------AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTTCGGGCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCT-GATACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGCTGATCATCCGAAG--TTTTCTTTGGTGCACTCGACGACACACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTAGGAACGTGGCTTCCCTCGGGGAGTGTTATAGCCTGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGACCCCT-TCAAGGGCG Phyllactinia_actinidiae_ex_Actinidia_AB080500 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCCG-CTCT--GGCTTGGTCTTGGGGCTCGCCCGC-ATCTGCGCGGCGTCCCTTAAACCCAGTGG-CGGAACCGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTTC-GACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TTAAGGGGG Phyllactinia_actinidiae_ex_Actinidia_AB080508 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCCG-CTCT--GGCTTGGTCTTGGGGCTCGCCCGC-ATCTGCGTGGCGTCCCTTAAACCCAGTGG-CGGAACCGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTTC-GACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TTAAGGGGG Phyllactinia_actinidiae_latifoliae_ex_Actinidia_MUMH5514 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCCG-CTTC-TGGCTTGGTCTTGGGGCTCGCCCGCAATCTGCGTGGCGTCCCTTAAACGCAGTGG-CGGTACCAGCGGTTGCTCTCCGCGCAGT-CACGTTTCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGTTCGGCGCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-CGGC-GGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCGGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGCGCAATACTGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_angulata_ex_Quercus_AB080566 AAAACTTTCAACAACGGATCTCT?GGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTATTCCCAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCTCTCGAGCCG-CTCT--GGCTTGGTCTTGGGGCTCGCCCGC-GCTCGCGCGGCGTCTCCTAAACACAGTGG-CGGTGCCGGGTGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGCACGCGGCTCAGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGG-GGCG-CACGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGTTGATCATCCAACG--TTCTCGTTGGTGCACTCGGCGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCCGCGGCGTAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCAAAA-CCCATGCGCGAAATGAAAGTGAACATAGGTGAGAACCCGATCAAGGGGG Phyllactinia_antarctica_ex_Embothrium_AB080568 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAA-CCCCTCAAGCCG-CTCT--GGCTTGGTCTTGGGGCGCGCCCGC-GAGAGCGCGGCGGCCCTTAAATCGAGTGG-CGGTACCGG-TGGTGCTCTCCGCGTAGT-CACGTTTCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA?A?????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TGTC-GGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-ACTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTCGGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGCG Phyllactinia_betulae_ex_Betula_AB080505 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCCG-CTCT--GGCTTGGTCTTGGGGCTCGCCCGC-ATCTGCGCGGCGTCCCTTAAACCCAGTGG-CGGAACCGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTTC-GACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TTGAGGGGG Phyllactinia_broussonetiae_kaempferi_ex_Broussonetia_AB080492 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAA-CCTCTCAAGTCG-CTCT--GGCTTGGTCTTGGGGCCCGCCCGC-GACTGCGTGGCGGCCCTTAAATCCAGTGG-CGGTGCCGG-TGGTGCTCTCCGTGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAG-TGTCCGGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-ACACTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTCGGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTTGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_cassiae_fistulae_ex_Cassia_AB691227 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAAACAACCCTTCGAGCCC-GCGG-TGGCTTGGTGTTGGGGCTCGCCCGC-GCCCGCGCGGCGGCCCTTAAATGTAGTGG-CGGTGCCCG-TGGTACTCTCCGCGTAGT-CACAG-TCTC----------------------------------------------------------------------------------------------------------------------------------------AGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGTTCGGGCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCT-GATACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGTCGCTGATCATCCGAAG--TTTTCTTTGGTGCACTCGACGACACACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTAGGAACGTGGCTTCCCTCGGGGAGTGTTATAGCCTGCGGCGCAATACTGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAGCTATGCGAGTGTTTGGGTGTGAAA-CCCATACGCGAAATGAAAGTGAACGTAGGTGAGACCCCT-TCAAGGGCG Phyllactinia_chubutiana_ex_Lycium_AB243690 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTATTCCCAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCTCTCGAGCCG-ATCT--GGCTTGGTCTTGGGGCTCGCCCGC-GATAGCGTGGCGTCCCTTAAACCCAGTGG-CGGTGCTGA-TAGTGTTCTCCGCGTAGT-CACAG-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATTTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCA-CACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTTGATCATCCAACG--TTTTCGTTGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGGCGCAATACCGCCTACTCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCAAGTGTTTGGGTGCAAAA-CCCATGCGCGGAATGAAAGTGAACGC----------------------- Phyllactinia_enkianthi_ex_Lyonia_AB080504 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCCG-CTCT--GGCTTGGTCTTGGGGCTCGCCCGC-ATCTGCGCGGCGTCCCTTAAACCCAGTGG-CGGAACCGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TTTC-GACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TTAAGGGGG Phyllactinia_fraxini_ex_Fraxinus_AB080549 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAGGCCG-CTCA--GGCTTGGTCTTGGGGCTCGCCCGC-CTTGGCGCGGCGGCCCTTAAACACCGTGG-CGGTGCTGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAA????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGTG-GGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_fraxini_ex_Fraxinus_AB080550 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAGGCCG-CTCA--GGCTTGGTCTTGGGGCTCGCCCGC-CTTGGCGCGGCGGCCCTTAAACACCGTGG-CGGTGCTGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAA????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGTG-GGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTCGGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_fraxinicola_ex_Fraxinus_AB080537 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAGGCCG-CTCA--GGCTTGGTCTTGGGGCTCGCCCGC-CTTGGCGCGGCGGCCCTTAAACACAGTGG-CGGTGCCGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGTG-GGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTGGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_fraxinicola_ex_Fraxinus_AB080585 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAGGCCG-CGCA--GGCTTGGTCTTGGGGCTCGCCCGC-CTTGGCGCGGCGGCCCTTAAACACAGTGG-CGGTGCCGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGTG-GGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTTTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TTGAGGGGG Phyllactinia_guttata_ex_Corylus_avellana_AB080558 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAA-CCCCTCAAGCCG-CTCT--GGCTTGGTCTTGGGGCGCGCCCGC-GAGAGCGCGGCGGCCCTTAAACCGAGTGG-CGGTACCGG-TGGTGCTCTCCGCGTAGT-CACGTTTCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA??????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-TGTC-GGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-ACACTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTCGGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGCG Phyllactinia_hemipteleae_ex_Hemiptelea_AB080538 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCCCCTTTTGTGGCTTGGTCTTGGGGTTCGCCCGCGATCTGTGTGGCGTCCCTTAAACGCAGTGGGCGGTACCGG-CGATGCTCTCCGCGTAGT-CATAT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-GGCA-GGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-TTTTTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGCGGGAACGTAGCTCTTCTCGGAGAGTGTTATAGCCTGCGGCGCAATACCGCCCACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_juglandis_ex_Juglans_AB080531 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCCG-CTCT--GGCTTGGTCTTGGGGCTCGCCCGC-AGCTGCGCGGCGTCCCTTAAACCCAGTGG-CGGAACCGG-TGGTGCTCTCCGCGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGACCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGG-CGTC-GACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGTAGGAACGTAGCTCTTTTCGGAGAGTGTTATAGCCTGCGGTGCAATACTGCCTACCTCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCGAAA-CCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCT-TTGAGGGGG Phyllactinia_mali_ex_Crataegus_AB080523 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAA-CCCCTCAAGCCA-GTCT--GGCTTGGTCTTGGGGTCCGCCCGC-GGCTGTGCGGCGGCCCTTAAATCCAGTGG-CGGTACCGG-TAGTGCTCTCCGCGTAGT-CACGA-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA?????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCCGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTACTTGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTTGTC-GGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-ACTCTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTCTTCGGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_moricola_ex_Morus_AB080561 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAA-CCCCTCAAGTCG-CTCT--GGCTTGGTCTTGGGGCCCGCCCGC-GACAGCGTGGCGGCCCTTAAATCTAGTGG-CGGTGCCGG-TGGTGCTCTCCGTGTAGT-CACGT-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAA????????????????????TAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCAG-TGTC-GGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-ACACTCTTTGGTGCACTCGACGACGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTTTTCGGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_pyri_serotinae_ex_Pyrus_AB080521 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCAAAACAA-CCCCTCAAGCCA-GTCT--GGCTTGGTCTTGGGGTCCGCCCGC-GGCTGCGCGGCGGCCCTTAAAGCCAGTGG-CGGTACCGG-TAGTGCTCTCCGCGTAGT-CACGA-TCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCCGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTACCTGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-TGTC-GGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG-ACTCTCT{CT}TGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGTTGCCGGAACGTGGCTCTCTTCGGAGAGTGTTATAGCCGGCGACGCAATACCGCCTACCCTGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_roboris_ex_Castanea_AB080516 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCTG-CTCC--GGCTTGGTCTTGGGGCTCGCCCGC-GCAAGCGTGGCGACCCTTAAACACAGTGG-CGGTACCGG-TGGTGCTCTCCGCGTAGT-CACGTTTCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-CGTC-GACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTCTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTTGGAACGTGGCTCTTTTCGGAGAGTGTTATAGCCTGCAACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Phyllactinia_roboris_ex_Castanopsis_AB080546 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCCTCAAGCTG-CTCC--GGCTTGGTCTTGGGGCTCGCCCGC-GGAAGCGTGGCGACCCTTAAACACAGTGG-CGGTACCGG-TGGTGCTCTCCGCGTAGT-CACGTTTCTCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA?????????????????????TAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCCTGCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-CGTC-GACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAG--TTCTCTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTTGGAACGTGGCTCTTTTCGGAGAGTGTTATAGCCTGCAACGCAATACCGCCTACCCCGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAA-CCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TCGAGGGGG Pleochaeta_shiraiana_ex_Celtis_D84381 AAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAA-CCCATCAAGCCA-CCAT--GGTTTGGTCTTGGGGCTCGCC-G-ATTT--TCTGGCGTCCCTTAAATAGAGTGG-CAGTGCCGC--GGGGCTCTACGCGTAGTAAGCATTTTCTTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTCACCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGG-TGCC-TGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTTGGTGATCATCCGGAG--TTTTCTCTGGTGCACTCGGCAATGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCT-TT-AGGGTG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'Phyllactinia ITS+28S') = N: 1-1022; CODONPOSSET CodonPositions (CHARACTERS = 'Phyllactinia ITS+28S') = N: 1-1022; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M23779] TITLE Parauncinula_septta_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=518; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Parauncinula_septata_ex_Q._cuspidata_var._horikawae_AB022421 CCAGTGGCCCAGTAGGGCCTCCCGGGTCTCCGCCCGCGAGTGTCCCGAACCGCTCAACCCGTGTCGACCCTATCGCGTTGCTTTGGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAACCCCCTCCTTAGG----------------- Parauncinula_septata_ex_Q._robur_MUMH4146 ------------------------------------------------------------------------------------GGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGG----------------- Parauncinula_septata_ex_Q._serrata_AB183533 CCAGTGGCCCAGTAGGGCCTCGCGGGTTTCCGCCCGCGAGTGTCCCGAACCGCTCAACCCGTGTCGACCCTCTCGCGTTGCTTTGGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGC-TTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGG----------------- Parauncinula_septata_ex_Q._serrata_MUMH4403 --------------------------------------------------------------------------------CTTTGGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAA-CCCCTCCTTAGG----------------- Parauncinula_septata_ex_Q._serrata_MUMH4435 --------------------------------------------------------------------------------CTTTGGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGG----------------- Parauncinula_septata_ex_Q._serrata_MUMH4840 --------------------------------------------------------------------------------CTTTGGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGG----------------- Parauncinula_septata_ex_Q._serrata_MUMH4868 --------------------------------------------------------------------------------CTTTGGCGAGTCGAGCCCTGCTCCACCGGCC-CCGGCTGGTGCGCGCTCGCCAGAGACCCCCCCAACTCTTCTGTATTTTAGTGTCGTCTGAGTCGTGAGAAAATGATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCTCGGCTTGGTGTTGGGAGCCGCCGCCCGCGGCGCTCCTTAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACGTGTCTCGCTCCAGGGCTCGCGTAGGGCTCGCCAGCAACCCCCTCAACCCCCCTCCAGG----------------- Parauncinula_septata_ex_Q._serrata_MUMH4928 --------------------------------------------------------------------------------CTTTGGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAA-CCCCTCCTTAGG----------------- Parauncinula_septata_ex_Q._serrata_MUMH5223 -------------------------GTCTCCGCCCGCGAGTGTCCCGAACCGCTCAACCCGTGTCGACCCTATCGCGTTGCTTTGGCGAGTCGAGCCTGGCTCCACCGGCCGCCGGCTGGTGTGCGCTCGCCAGAGA-CCCCCCAACTCCACTGTA-TTTAGTGTTGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGCCGCTCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAGATTCGTCTCGCTCCAGGGCACGCGTAGGGCCTGCCAG-AACCCTTCAACCCCCTCCTTAGG----------------- Parauncinula_septata_ex_Q._variabilis_MUMH4113 ---------------------------------------------------------------------------------TTTGGCGAGTCGAGTCCTGCTCCACCGGCCCCCGGCTGGTGCGCGCTCGCCAGAGA-CCCCCCAACT---CTGTA-TTTAGTGTCGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGTCGCCCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACTCGTCTCGCTCCAGGGTTCGCGTAGGGCTTGCCAG-AACCCTTCAACCCCCCCTCCAGG----------------- Parauncinula_septata_ex_Q._variabilis_MUMH4131 --------------------------------------------------------------------------------------CGAGTCGAGTCCTGCTCCACCGGCCCCCGGCTGGTGCGCGCTCGCCAGAGA-CCCCCCAACT---CTGTA-TTTAGTGTCGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGTCGCCCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACTCGTCTCGCTCCAGGGTTCGCGTAGGGCTTGCCAG-AACCCTTCAACCCCCCCTCCAGG----------------- Parauncinula_septata_ex_Q._variabilis_MUMH4187 --------------------------------------------------------------------------------CTTTGGCGAGTCGAGTCCTGCTCCACCGGCCCCCGGCTGGTGCGCGCTCGCCAGAGA-CCCCCCAACT---CTGTA-TTTAGTGTCGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGTCGCCCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACTCGTCTCGCTCCAGGGTTCGCGTAGGGCTTGCCAG-AACCCTTCAACCCCCCCTCCAGG----------------- Parauncinula_septata_ex_Q._variabilis_MUMH4189 ------------------------------------------------------------------------------------GGCGAGTCGAGTCCTGCTCCACCGGCCCCCGGCTGGTGCGCGCTCGCCAGAGA-CCCCCCAACT---CTGTA-TTTAGTGTCGTCTGAGTCTTGATAGAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGCATTCCGCGGGGCATGCCTGTCCGAGCGTCATAACACCCCTCAAGCTCTGCTTGGTCTTGGGAGCCGTCGCCCGCGGCGCTCCTCAAAGGCAGTGGCGGTGCTACCCGTAGCCCTGAGCGCAGTAAACTCGTCTCGCTCCAGGGTTCGCGTAGGGCTTGCCAG-AACCCTTCAACCCCCCCTCCAGG----------------- ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Parauncinula_septta_ITS) = N: 1-518; CODONPOSSET CodonPositions (CHARACTERS = Parauncinula_septta_ITS) = N: 1-518; END; BEGIN TREES; TITLE 'Phyllactinia pyri-serotinae ITS'; LINK TAXA = Taxa1; TRANSLATE 1 Phyllactinia_moricola_ex_Morus_AB080540, 2 Phyllactinia_pyri_serotinae_ex_Aria_MUMH3511, 3 Phyllactinia_pyri_serotinae_ex_Pyrus_AB080521, 4 Phyllactinia_mali_ex_Crataegus_AB080523, 5 Phyllactinia_mali_ex_Mespilus_AB080556, 6 Phyllactinia_mali_ex_Crataegus_AB080559; TREE Fig._5 = [&R] (1,((2,3),(4,5,6))); END; BEGIN TREES; TITLE 'Phyllactinia ITS+28S'; LINK TAXA = Taxa3; TRANSLATE 1 Phyllactinia_antarctica_ex_Embothrium_AB080568, 2 Phyllactinia_guttata_ex_Corylus_avellana_AB080558, 3 Phyllactinia_broussonetiae_kaempferi_ex_Broussonetia_AB080492, 4 Phyllactinia_moricola_ex_Morus_AB080561, 5 Phyllactinia_mali_ex_Crataegus_AB080523, 6 Phyllactinia_pyri_serotinae_ex_Pyrus_AB080521, 7 Phyllactinia_roboris_ex_Castanea_AB080516, 8 Phyllactinia_roboris_ex_Castanopsis_AB080546, 9 Phyllactinia_fraxini_ex_Fraxinus_AB080549, 10 Phyllactinia_fraxini_ex_Fraxinus_AB080550, 11 Phyllactinia_fraxinicola_ex_Fraxinus_AB080537, 12 Phyllactinia_fraxinicola_ex_Fraxinus_AB080585, 13 Phyllactinia_enkianthi_ex_Lyonia_AB080504, 14 Phyllactinia_actinidiae_ex_Actinidia_AB080500, 15 Phyllactinia_actinidiae_ex_Actinidia_AB080508, 16 Phyllactinia_betulae_ex_Betula_AB080505, 17 Phyllactinia_juglandis_ex_Juglans_AB080531, 18 Phyllactinia_hemipteleae_ex_Hemiptelea_AB080538, 19 Phyllactinia_angulata_ex_Quercus_AB080566, 20 Phyllactinia_actinidiae_latifoliae_ex_Actinidia_MUMH5514, 21 Phyllactinia_chubutiana_ex_Lycium_AB243690, 22 Phyllactinia_cassiae_fistulae_ex_Cassia_AB691227, 23 Ovulariopsis_sp._ex_Senna_AB691228, 24 Leveillula_cylindrospora_ex_Noaea_AB080468, 25 Leveillula_saxaouli_ex_Haloxylon_AB080469, 26 Leveillula_taurica_ex_Impatiens_AB080473, 27 Leveillula_duriaei_ex_Salvia_AB080475, 28 Leveillula_elaeagni_ex_Elaeagnus_AB048350, 29 Leveillula_taurica_ex_Helianthus_AB080472, 30 Pleochaeta_shiraiana_ex_Celtis_D84381; TREE Fig._3 = [&R] (((((((((1,2),(3,4)),(5,6)),(7,8)),((((13,14,15),16),17),(18,20))),((9,10),(11,12))),((19,21),(((24,25),(27,28,29)),26))),(22,23)),30); END; BEGIN TREES; TITLE Parauncinula_septta_ITS; LINK TAXA = Taxa2; TRANSLATE 1 Parauncinula_septata_ex_Q._variabilis_MUMH4189, 2 Parauncinula_septata_ex_Q._variabilis_MUMH4113, 3 Parauncinula_septata_ex_Q._variabilis_MUMH4131, 4 Parauncinula_septata_ex_Q._variabilis_MUMH4187, 5 Parauncinula_septata_ex_Q._cuspidata_var._horikawae_AB022421, 6 Parauncinula_septata_ex_Q._serrata_MUMH5223, 7 Parauncinula_septata_ex_Q._serrata_MUMH4403, 8 Parauncinula_septata_ex_Q._serrata_MUMH4928, 9 Parauncinula_septata_ex_Q._robur_MUMH4146, 10 Parauncinula_septata_ex_Q._serrata_MUMH4435, 11 Parauncinula_septata_ex_Q._serrata_MUMH4840, 12 Parauncinula_septata_ex_Q._serrata_MUMH4868, 13 Parauncinula_septata_ex_Q._serrata_AB183533; TREE Fig._7 = [&R] (((1,2,3,4),(((5,7),8),6)),(9,10,11,12,13)); END;