#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 20:05 GMT TreeBASE (cc) 1994-2008 Study reference: Mal├ęcot V., Marcussen T., Munzinger J., Yockteng R., & Henry M. 2006. On the origin of the sweet-smelling parma violets cultivars (Violaceae): Wide intraspecific hybridization, sterility and sexual reproduction. American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1629] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=70; TAXLABELS Viola_Ash_Vale_Blue Viola_Gloire_de_Verdun Viola_Marie_Louise Viola_Parme_de_Toulouse_8 Viola_Parme_de_Toulouse_9 Viola_Parme_de_Toulouse_N Viola_affinis Viola_alba_MH043220 'Viola alba TM357-21' 'Viola alba TM469-5' 'Viola alba TM469-7' Viola_alba_TM496 Viola_alba_subsp._cretica 'Viola alba subsp. dehnhardtii TM342-1' 'Viola alba subsp. dehnhardtii TM397-2' 'Viola alba subsp. dehnhardtii TM494-1' 'Viola alba subsp. dehnhardtii TM494-2' Viola_beckwithii Viola_blanda_var._palustriformis Viola_calcarata Viola_canadensis Viola_capillaris Viola_cazorlensis Viola_chamissoniana_subsp._tracheliifolia Viola_clauseniana Viola_cucullata Viola_cuneata Viola_d_Udine Viola_dissecta Viola_domingensis Viola_fischerii Viola_flagelliformis Viola_helenae Viola_hemsleyana Viola_hirta Viola_hookeria Viola_incisa Viola_kauaensis Viola_langsdorffii Viola_lutea Viola_macloskeyi_subsp._pallens Viola_maviensis Viola_micranthella Viola_mirabilis_a Viola_mirabilis_b Viola_nagasawai Viola_nannei Viola_odorata_Fr Viola_odorata_Ge Viola_odorata_US Viola_parvula Viola_pedata Viola_pinnata Viola_praemorsa Viola_pubescens Viola_purpurea Viola_reichei Viola_reichenbachiana Viola_riviniana Viola_scandens Viola_sheltonii Viola_sintenisii Viola_striata Viola_suavis_a Viola_suavis_b Viola_tricolor Viola_umbraticola Viola_uniflora Viola_vallicola Viola_variegata ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2577] TITLE ITS1_and_ITS2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=507; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Viola_Ash_Vale_Blue TCTTAACACCTGCCCGACTAAGCGAC{AC}CG{AC}GAGCA{AC}GTTACAA{AT}CACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AATAGAAAA-C{AG}AATGAGAG{AC}GAGAG-{AC}GCCC{AC}CCCC{CG}CCCC{CG}{CG}AG-ACAGTGTGCGAAAGT-GGG--{GT}GC{CG}{CT}CTCTGTCC--ATTGAT--A{AT}ACT--AA{AC}{AG}TC{GT}CC{CG}CCAACCCCACCCCTA{GT}GGGCGG---------G{CG}AGTT-GGGGG{CG}GGACTTTT{GT}{CT}CTCCCCTG{CG}{GT}CCTCC{GT}C{CG}CG{CG}--{CG}GATGGT-{CG}{GT}-AA{AT}TT{CT}-{AT}TCTCCTGG-{CT}GA--GGAT{CG}A{CT}CACCA-CAA{AG}{AC}GG{GT}GGTTTTTT{GT}AA{AC}{AT}AA{AT}{AG}ACC{AT}C-C{GT}G{GT}G{GT}TGTCGT{CG}CGGCCTCC-C{CG}AG----------------------------- Viola_Gloire_de_Verdun --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-GAGGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AATAGAAAA-CAAATGAGAGAGAGAG-AGCCCCCCCCCCCCCGCAG-ACAGTGTGCGAAAGT-GGG--TGCCTCTCTGTCC--ATTTTT--AAAAT--AAAATCGCCGCCAAACCCACCCCTATGGGGGG---------G-AGCT-GGGGGGGGACTTTTTTCTCCCCCGGGGCTCCTCGGGG--GGATGGT-CTAAATTTT-TTCTCCTCG-TGA--GGATCATCCCCA-CAACCAGGGGTGTTTTTTACTAATGACCTCCTGGTGGTGTCGTGCGGCCTCC-C-------------------------------- Viola_Marie_Louise --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTA{GT}C-TGCGCGCACGCTGTCCGC{GT}CCACCTCCACTAACA{AG}-AACCC-CGGCGCGGACTGCGCCAAGG-AATAGAAAA-{AC}{AGT}{AC}{AG}{AT}G{AT}GAG{AC}GAGAG-{AC}GCCC{AC}C{AC}CC{CG}C{CG}CC{CG}{CG}A{GT}-AC{AG}{CG}TGTG{CT}GAA{AG}{AG}{GT}-G{GT}G--{GT}GC{CG}{CT}CTCT{CG}T{CG}C--AT{AT}{GT}{AT}T--A{AT}A{AC}{AT}--AA{AC}{AG}T{CG}{GT}CCGC{CG}AA{AC}{AC}CC{AC}C{AC}CCTAT{AG}GGGGG---------{CG}{CG}{AG}G{GT}{GT}-GGGGG{CG}GGAATTTT------------------------------------------------------------------------------------------------------------------------------------------------------------- Viola_Parme_de_Toulouse_8 --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-C-GGCC-CTGGCTTCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAGAAAA-CGAATGAGAGCGAGAG-CCCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGAACAGA-CCCTGTGCGCTCGCGCACC Viola_Parme_de_Toulouse_9 --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-C-GGCC-CTGGCTTCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAGAAAA-CGAATGAGAGCGAGAG-CCCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTCCAGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGAACAGA-CCCTGTGCGCTCGCGCACC Viola_Parme_de_Toulouse_N --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-C-GGCC-CTGGCTTCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAGAAAA-CGAATGAGAGCGAGAG-CCCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGAACAGA-CCCTGTGCGCTCGCGCACC Viola_affinis ------------------------------------------------GCG{CG}GGG-C-CCCC-TTGGCTGCATCC-C{GT}CGGGGG------TGCTGCGGCTGCTT----------GCGCA{AG}ACTAAC-TGCGCGCACTCTGTCCGC{GT}CCACCTCCGCTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAC-CGCCCCCCTCGCCCCGGA{AG}-ACGGTGTGCGATGGT-GGG--CGCCTC{CG}CTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCATTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-TT-AATTTC-AGCTCCTGG-CGA--GGATCGTCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCT-CGGAG{AG}GAACGGA-CCCTGTGCGCTGGCGCACC Viola_alba_MH043220 --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CGCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTAAGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGACAAGA-ACCTGTGCGCTCGCGCACC 'Viola alba TM357-21' --TCCAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CGCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGAACAGA-CCCTGTGCGCTCGCGCACC 'Viola alba TM469-5' --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CGCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGAACAGA-CCCTGTGCGCTCGCGCACC 'Viola alba TM469-7' --TCCAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGGGAGAG-CGCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCACCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGAACAGA-CCCTGTGCGCTCGCGCACC Viola_alba_TM496 --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CGCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGAACAGA-CCCTGTGCGCTCGCGCACC Viola_alba_subsp._cretica --TCGACACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CGCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATC{CG}CCACAA-CAAG{CG}GG{GT}GGTTTTTTGAACTAAGGACCTC-GGGTGTT{GT}GCG{GT}G{CG}GGCCTCC-CGGAA---------------------------- 'Viola alba subsp. dehnhardtii TM342-1' --TCCAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CGCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTA-GGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGAGAACAGA-CCCTGTGCGCTCGCGCACC 'Viola alba subsp. dehnhardtii TM397-2' ----------TGCCCGACAGAGCGACCCGCGAACACGTTACAAACACGGCGCGGG-C-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CTCCCCCCTCGCCCCGGAG-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCTGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATCTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCCCC-CGGAGGGAACGGA-CCCCGTGCGCTCGCGCACC 'Viola alba subsp. dehnhardtii TM494-1' --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACGGCGCGGG-C-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CTCCCCCCTCGCCCCGGAG-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCTGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATCTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCCCC-CGGAGGGAACGGA-CCCCGTGCGCTCGCGCACC 'Viola alba subsp. dehnhardtii TM494-2' --TCCAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACGGCGCGGGGC-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CTCCCCCCTCGCCCCGGAG-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCTGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CTAAATCTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCCCC-CGGAGGGAACGGA-CCCCGTGCGCTCGCGCACC Viola_beckwithii --TCGAAACCTGCCCGACAGAGCGACCCGTGAACATGTTACAAGCACAACGCGGGCC-AGG--TGGG-TGCCTCGGCCC--TGGCTGTCCCGC-ACGGTGGTGGCACGAACCGTTGGTGTGCATTCGTGTGCTCCTACGATTCGCGCCAG-ACCACTAACAG-AACCC-GGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAATGAGAGCGGGCG-CG-CCTCCTCGCCCCAGAA-ATGGTGCGCGATGGG-G-A--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACACATCCTTTCCTTAGGG-ATCGAGTGGTAGTT-GGGGGCGGATTATGGCCTCCCGTGCGCCCCGGCGCGCGCGGTTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAATTAAGGACCTC-GGGTGTTGTCGTGCGGCCTTG-CAGAGAGAAGGAA-CCCTGTGCGCTCACGCACT Viola_blanda_var._palustriformis --TCGAAACCTGCCCGACAGAACGACCCGAGAACACGTTACAAGCACAACGCGGGGC-AGC--TTGG-CGCCTCGGCCC--TGGCTGTCCAGC-GCGGTGGTGTCGCGGCCGTTCGTGCGCGTTTG-CGCGGGCCTACGGTTCGTGCCAC-GCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAA-CAA-CAAACGAGAGCGGGCG-CGCCCCCCTCGCCCCGGGA-ACGGTGCGCGATGGG-GGA--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAGCACACCCTCCCCTCTGGG-GTGGAGTGGTAGCT-GGGGGCGGATTCTGGCCTCCCGTGCGCCTCTGCGCGCGCGGCTGGC-CTAAATTTT-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GA{GT}TGTTGTCGTGAGGCCTCG-CGGGA{AG}AAAAGAA-CCCCGTGCGCTCGCGCACC Viola_calcarata --TCGAAACCTGCCCGACAGAGCGACCCGCGAACGCGTTACAAACACTGCGCTGG-C-GGCC-TCGGCCG-CTCG-CGCGGCTG------TGCTGCGGCTGCGT----------GCGCAA------------GCGCGCTGCCCGTTCCACGGCCACTTAAA{AG}-AACCCACGGCGCGGACTGCGCCAAGG-AACATAAAA-CTTACGAAAGCGAGCG-CTCCCTCCTCGCCCCGGAA-ACGGTGCGCGATGTTTGGG--CGCCTCGCTGTCC--AATGAT--AAACT--AACGTCGCCGCCAACGCCGCCCTTAGGGGCGC---------GCAGTT-GGGGGCGGAATATGGCCTCCCGTGCGCCTCGGCGCGC--GGTTGGC-CT-AATATC-A{CG}CCCCCGG-CGA--AGATCGCCACGA-CAAGCGGTGGTTTTTTCAACAAAAGAACTC-GGGTGTTGTCGTGCGGCCTTC-CCGAAGGAAAG---------------------- Viola_canadensis --TCGAAACCTGCCCCATCGAACGACCCGTGAACATGTTACAAGCACACCGCGGGGC-AGC--TCGG-TGCCTCGGCCC--TGGCTGTCCCGC-GCGGTGGTGTCGCGGCCGTGCGTGCGCGTTCG-CGCGCGCCCACGGTTCGTGCTGC-GCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAACGAGAGCGGGCG-CATCCCCCTCGCCCCGGGA-ACGGTGCGCGATGGG-GGA--CGCCTCGCTGTCC--AATGAT--AAACT--AACGTCGCCGCCAGCACACACTTTCCTTATGG-ATCGAGTGGTAGCT-GGGGGCGGATTCTGGCCTCCCGTGCGCCTCTGCGCGCGCGGCTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCG-CGGAGAGAAGGAA-CCCCGTGCGCTCGCGCACC Viola_capillaris --TCGAAACCTGCCCGACAGAGCGACCCGTGAACACGTTACAAATACACTGTGGGTC-AGC--TTGG-{AG}C{CG}GGGAGCCC--TGGCCGTCCAAC-CCGGTGGTGTTGCGGG{GT}G{GT}AGGCTTGCCTCCT-TGGAAACATGCTGTCCGCGGCAC-TCCATTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AATAAACAA-CAAATGAGAGCGTGCG-TGCC-TCCTCGCCCCGGGAAACGGTGAGTGA-GG--GGG--TGCCTCGCTGTCT--ATTGAT--AAACT---------------------------------G-AAT-------ATTT-CGTGGCGGATTCTAACCTCCC{CG}TGCGCGGGATCACGC--GGCTGGC-CTATATTTT-AGCGCGCGG-CGA--GTGTCTCCACTA-CAAGCGGTGGTTTTTTGAATTAAGGACCTC-TTTTGTTGTCGTGCGGCCTCC-TGTAGAGAAGGAA-CCCTGTGCGCTCGCGCACT Viola_cazorlensis --TCGAAACACGCCCGAGAGAGCGACCCGCGAATGAGTTACAAACAC{GT}AAGCGGGGC-GGCCATCGGCCTCCTCG-CGAGGCGG------TGCCGCGGGCG-------------------------------------TGCTCGCGTCACCGCCCCTAACAG-AACCC-CGGCGCGGAC-GCGTCAAGG-AATAAGAAA-CGAACGAGAACGGGAG-CGCCCCCCTCGCCCCGGGA-ACGGTGCGCGACGGA-GGG--CGCCCCGCTGTCC--AACGGT--TAAC------GTCGCTGCCAACTCCGCCCTATCGGGCGC---------GCTGTCTGGTGGCGGAGCTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CTAAATCTG-AGCCCGCGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTGAGGACCTC-GGGTGTTGTAGTGCGTCCTCC-CACGGGGAAAGAA-CCCCGCGCGCTCGCGCGCC Viola_chamissoniana_subsp._tracheliifolia --TCGAAACATGCCCGACAGAGCGACCCGTGAACACGTTACAAACACTGCGCGGG-T-GGCC-CCGGCTGCTTCG-CGCAGGGG------TGCTGCGGCTGCGT-------------------------------------CCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCGAGG-AACAAAAAA-C{AT}AATGAGAGCGAGAG-CACCCCC-TCGCCCCGGAG-ACGGTGTGCGACGGT-GGGA-TGCCTAGCTGTCC--ATTGAT--AAACT--ACCGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGG-CGGAATTTGGCCTCCCGTGTGCCTCGGCACGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCTTGCGGCCTCT-CG----GAACGGA-CCCTGTGCGCTCGCGCACC Viola_clauseniana --TCGAAACATGCCCCGCAGAGCGACCCGCGAACATGTTACAAACATTGCGCGGG-C-GGCC-TTGGCTGCCTCG-CGCGGGGG------TGCTGCGGCTGCGT----------GCGCAAAATGGT-TGCGCGCACGCTGTCCGCGCCACCTCCGCTAACAG-AACCC-CGGCGCGGAGTGCGCCATGG-AACAAA--------------------CCTCCCCCTTCGCCCAGGAG-ATTAATT{GT}{AC}GATGGT-GGG--CGCATCGCTTTCC--ATTGAT--A------AACGTCGCCGCCAACCCCACCCCTATGGGCGG---------GCAATT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-GAA--GGATCGTCACAA-CAAGCGGTGGTTTTTTGAACTATGGACCTC-GGGTGTTGTCGTGCGGCCTCT-CGGAAGGAACGGA-CCTGTTGTGCTTGCGCACC Viola_cucullata --TCGAATCTTGCCCCGCAAAGCAACCCGCAAACACTTTACAAACACTGCGCGGG-C-GGCC-TTGGCTGCCTCC-CGCGGGGG------TGCTGCGGCTGCTT----------GCGCG{AG}{AG}CTAAC-TGCGCGCACTCTGTCCGCGCCACCTCCGCTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AAACAAAAACCGAATGAGAGCGAGAC-CGCCCCCCTCGCCCCGGAA-GCGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-TT-AATTTC-AGCTCCTGG-CGA--GGATCGTCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCT-CGGAGGGAACGGA-CCCTGTGCGCTGGCGCACC Viola_cuneata --TCC{AC}{AC}ACCTGCCCCACCGAACGACC-G{GT}GA{CG}CACGTTACAA{AG}C{AG}{CG}{AG}{CG}CG{CG}GGGGC-AGC--TCGG-CGCCTCGGCCC--TCGCTGTCCCGC-TCGGTGGTGTCGCGGCCGT{GT}CGCG{CT}GCGTTCG-TGCGTGCCCACGGTTCGTGCCGCCGCCA{AC}TAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAAGGAGAGCGGGCG-CGCCCCCCTCGCCCCGGGA-ACGGTGCGCGACGGG-GGA--CTCCTCGCTGTCC--AATGAT--AAACT--AGCGTCGCCGCCAGCACACCCTTTCCTTAGGG-ATCGAGTGGTAGCT-GGGGGCGGATTCTGGCCTCCCGTGCGCCTCGGCGCGCGCGGGTGGC-CTAAATTTC-AGCTCATGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCG-CGGAGAGAAGGAA-CCCCGTGCGCTCGCGCACC Viola_d_Udine --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-GAGGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AATAGAAAA-CGAATGAGAGAGAGAG-AGCCCCCCCCCCCCCGCAG-ACAGGGTGCGAAAGT-GGG--GGCCTCTCTGTCC--ATTGTT--AAACT--AAAATGTCCGCCAAAACCACCCCTATGGGGGG---------G-AGCT-GGGGGGGGACTTTTTTCTCCCCTGGTGCTCCTCGCCC--CGATGGT-CTCAATTTT-TTCTCCTGG-TGA--GGATGACCACCA-CAAAAAGCGGTGTTTTTTACTAATGACCTCCT-CTGGTGTTGTGCGGCCTCC-C-------------------------------- Viola_dissecta --TCGAAACATGCCCCACAGAACGACCCGCGAACATGTTACAAGCACACCGCGGGGC-AGC--TTGG-CGCCTCGGCCC--TTGCTGTCCCGC-GAAGGCGTGTCGCGGCCGTGCGTGCGCGTTCG-CGCGAGC-TACGGTCAGCGCCACCGCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAACGAGAGCG--AG-CGCCCTCCTCGCCCCGGGA-ACGGTGCGCGATGGT-GGG--CGCCTCGCTGTCC--AATGATATAAACT--AACGTCGCCGCCAGCACACCCTTCCCTTAGGGGATCGGGATGTAGCT-GGGGGCGGATTTTGGCCTCCCGTGCGCCTCAGCGCGCGCGGTTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGATCAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCG-CGGAGAGAAGGAA-CCTCGTGCGGTAGCGCACA Viola_domingensis --TCGAAACCTGCCCGACAGAACGAACCGCGAACATGTTACAAGCACAACGCGGGGC-AGC--TTGG-CGCCTCGGCCC--TTGCTGTCCAGC-GCGGTGGTGTCGCGGCCGTGGGTGCGCGTTCG-CGCGGGCCTACGGTTCGTGCCGC-GCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAA-CAA-CAAACGAGAGCGGGCG-CGCCCCCCTCGCCCCGGGA-ACGGTGCGCGATGGG-GGA--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCACCAGCACACCCTTCCCTTTGGG-GTCGAGTGGTAGCT-GGGGGCGGATTCTGGCCTCCCGTGCGCCTTTGCGCGCGCGGCTGGC-CTAAATTTT-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GAGTGTTGTCGTGAGGCCTCG-CGGAGAGAAGGAA-CCCTGTGCGCTCGCGCACC Viola_fischerii --TCGAAACCTGCCCGACAGAGCGACCCGTGAACACGTTACAAGCACAACGCGGGCC-AGA--TAG--TGCCTCGGCCC--TGGCTGTCCCGT-GCGGTGGTGTCGCGGCCGTCCTTGCGCATTCG-TGCGCGAGTACGGTTCGCGCCGCTGCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAACGAGAGCGGGCG-CTCCCCCCTCGCCCCGGTA-ACGGTGCGCGATGGG-GGA--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAGCACACCCTTTCCTGCAGGGATCGAGTGGTAGCT-GGGGGCGGATTCTGGCCTCCCGTGTGCCTCAGCGCGCGCGGTTGGCGTTAAATTAC-AGCTCACGGCCGA--GGATCGCCACGATCAAGCGGTGGTTTTCTTAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCT-CGGAGAGAAGGAAGCCCTGTGCGCTCGCGCACT Viola_flagelliformis --TCGAAACCTGCCCCACTGAATGACCCGTGAACATGTTACAAGCACACCGTGGGGT-AGC--TCGG-TGCCTCGGCCC--TAGTTGTCCCGC-GCGGTGGTGTCGCAGCCGTGCGTGCGCGTTCG-CGCGCGCACACGGTTTGTGCCGC-GCCATTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAACGAGAGCAG--G-CGCGCCCCTCGCCCCGGGA-ACGGTGCGCGATGGG-GGA--CGCCTCGCTGTCC--AATGAT--AAACT--AACGTCGCCACCAGCACACCCTTTCCCTAGGG-ATCGAGTGGTAGCT-GGGGGCGGATTCTGGCCTCCCGTGCGCCTCTGCGCGCGCGGCTGGC-CTATATTTC-AGCTCACGG-CGA--GGATCGCCACAA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCCGCCTCG-CCGAGAGAAGGAA-CCC-GTGCGCTCGCGCACC Viola_helenae --TCGAAACATGGCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-T-GGCC-CCGGCTGCCTCG-CGCAGGGG------TGCTGCGGCTGC{GT}T-------------------------------------CCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAATGA{AG}AGCGA{AG}AG-CGCCCCC-TCGCCCCGGAT-ACGGTGG----------TG--TGCCTAGCTCTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGAATTTGGCCTCCCGTGTGCCTCGGTGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--{AG}GATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCT-CGGAGGGAACGGA-CCCTGTGCGCTCGCGCACC Viola_hemsleyana --------CATGCCCGACTGAACGACCCGCGAACATGTTACTAACACTGCGCGGG-T-GGCC-ATGGCTGCCTCC-CGCGGGGG------TGCTGCGACTGCTT----------GCGCAAACTAGC-TGCTCGCACCCTGTCCGCGCCATCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAT-----C-AATGAAAGCGAGAG-CGCCCCCCCTCCCCCGAAA-ACGGT----------------------------------------------AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGTGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAATCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGTCCTCT-CGGA{AG}A{AG}ACCGGA-CCCTGTGCGCTCGCGCACC Viola_hirta --TCGACACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-C-GGCC-TCGGCTGCCTCG-CTTGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTATCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAA--CGAATGAGAGCGAGAG-CG-CCCCCCCGCCCCGGAA-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGAATTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGGGGTTTTTTGAACTAAGGACCTC-GGGGGTTGTCGTGCGGCCTCC-CGGAGGGAATGGA-CCCTGTGCGCTTGCGCACC Viola_hookeria --TCGAAACATGCCCGACTGAGCGACCCGCGAACATGTTACTAACACTGCGCGGGGT-GGCC-ATGGCTGCCTCG-CGCGGGGG------TGCTGCGGCTGC{GT}T----------GCGCAAACTAGC-TG{AC}GCGCACGCTGTCC{GT}CGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGGGAACAAAAAA-CGAATGAGAGCTAGAG-CGCCCCCCTCGCCCCGGAA-ACGGTGTGCGATGGT-GGG--CGCCCGCTGATCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CTAAATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAATCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGTCCTCT-CGGA{AG}A{AG}ACCGGA-CCCCGTGCGCTCGCGCACC Viola_incisa --TCGAAACCTGCCCCACAGAACGACCCGCGAACATGTTACAAGCAACACCGCGGGC-AGC--TTGG-CGCCTCGGCCC-TTGGCTGTCCCGC-GAGGCGGTGTCGCGGCCGTGCGTGCGCGTTCG-CGCGAGCCTACGGTCAGCGCCACCGCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAACGAGAGCG--AG-CGCCCTCCTCGCCCCGGGA-ACGGTGCGCGATGGT-GGG--CGCCTCGCTGTCC--AATGATATAAACT--AACGTCGCCGCCAGCACACCCTTCCCTTAGGGGATCGGGATGTAGCT-GGGGGCGGATTTTGGCCTCCCGTGCGCCTCAGCGCGCGCGGTTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGATCAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCG-CGGAGAGAAGGAA-CCTCGTGCGGTAGCGCACA Viola_kauaensis ------------GCCGACGAACCGACCCGCGAACACGTTACAAACACTGCGCGGG-T-GGCC-CCGGCTGCCTCG-CGTAGGGG------TGCTGCGGCTGC{GT}T-------------------------------------CCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAATGAGAGCGAGAG-CGCCCCC-TCGCCCCGGA{AG}-ACGGTGTGCGACGGT-GGG--TGCCTAGCTGACC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCTTAAGGGCGG---------GCTGTT-GGGGGCGGAATTTGGCCTCCCGTGTGCCTCGGTGCGC--GGATGGC-CT-AATTTC-AGCTCCGGG-CGA--{AG}GATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCT-CGGAGTGAACGGA-CCCTGTGCGCTCGCGCACC Viola_langsdorffii --TCGAAACATGCCCGACAGAGCGACCCGCGAACACGTTACAAACATTGCGCGGG-C-GGCC-CCGG-TGCCTCG-CGCGGGGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAA-A-CGAATGAGAGGGAGAG-CGCCCCCC-CGCCCCGGAA-ACGGTGTGCGATGGT-GGG--TGCCTAGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGAATTTGGCCTCCCGTGTGCCTCGGCGCGC--GGATGGC-CT-AATCTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCT-CGGAGGGAACGGA-CCCTGTGCGCTCGCGCACC Viola_lutea --TCGAAACCTGCCCGACAGAGCGACCCGCGAACGCGTTACAAACACTGCGCTGG-C-GGCC-TCGGCCG-CTCG-CGCGGCTG------TGCTGCGGCTGCGT----------GGGCAA------------GCGCGCTGCCCGTTCCACGGCCACTTAAAG-AACCCACGGCGCGGACTGCGCCAAGG-AACATAAAA-CTTACGAGAGCGAGCG-CTCCCTCCTCGCCCCGGAG-ACGGTGGGCGATGTTTGGG--CGCCTCGCTGTCC--AATGAT--AAACT-----GTCGCCGCCAACGCCGCCCTTAGGGGCGC---------GCAGTT-GGGGGCGGAATATGGCCTCCCGTGCGCCTCGGCGCGC--GGTTGGC-CTAAATATC--GCCCCCGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTCAACGAAGGACCTC-GGGTGTTGTCGTGCGGCCTTC-CGGAGGGAACGGA-CCCTGCGCTGTCGAGCGC- Viola_macloskeyi_subsp._pallens --TCGAAACCTGCCCGACAGAACGACCCGCGAACATGTTACAAGCACAACGCGGGGC-AGA--TTGG-CGCATCGGCCC--TTGCTGTCCAGC-GCGGTGGTGTCGCGGCAGTGAGTGCGCGTTCG-CGCGGGCCTACGGTTCGTGCCGC-GCCAATAACAG-AACCC-CGGCGCGGAGTGCGCCAAGG-AACAAACAA-CATATGAGAGCGGGAG-AGCCCCCCTCGCCCCGGGA-ACGGTGCGCGATGGG-GGA--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAGCACACCCTTCCCTTTGGG-GTCGAGTGGTAGCT-GGGGGCGGATTCTGGCCTCCCGTGCGCCTTTGCGCGCGCGGTTGGC-CTAAATTTT-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GAGTGTTGTCGTGAGGCCTCG-CGGAGAGAAGGAA-CCCTGTGCGCTCGCGCACC Viola_maviensis --TCCAAACATGCCCGACACAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-C-GGCC-CCGGCTGCCTCG-CGCAGGGG------TGCTGCGGCTGCGT-------------------------------------CCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAGAAA-CAAATGACAGCGACAG-CGCCCCC-TCGCCCCGGAG-ACGGTGTGCGACGGT-GGG--TGCCTAGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCTTAAGGGCGG---------GCAGTT-GGGGGCGGAATTTGGCCTCCCCTGTGTCTCGGTGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--AGATCACCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-CGGTGTTGTCTTGCGGCCTCT-CGGAAGGAACGGA-CCCTGTGCGCTCGCGCACC Viola_micranthella --TCGAAACCTGCCCGACAGAACGACCCGCGAACACGTTAAAAACACAGCGTGGGGC-GAC--CTGG-TGCCTCGGCTC--AGGCTGTCCTGCT-CGGAGGTGTCGCGGCCTTGGGGGTGCGTTCG-TGCGCTCTCATTGTCCGCGGC-CCTCCATTAACA{AG}-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAGAAA-CAAATGA{AG}A{AG}CTAGTG-TGCCCTCCCCGTCCCGGAA-ACGGTGCGCGGTGG--GGG--CGCCTC{AG}CTGTCT--ATTTAT--AAACT--AACGTCGCCACCAACACCATCTTGTAAAAAGG-GT-GAGT---AGTC-GGGGGCGGAGTATGGCTTCCCGTGCGCCCCG-TGCGCGCGGTTGGC-ATAAATTCT-AGCTCACGG-CGT--GGATCGCCACGG-CAAGCGGTGGTTTTTTGAACTAATTACCTC-GGTTGTTGTCGTGCGTCCTCC-CGGAAAGAACGAA-CCCTGTGCTTTCGAGCACT Viola_mirabilis_a --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTACGCGGG-C-GGCC-CCGGCTGCCTCG-CGCGGAGA------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAGCAACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGTGAGCG-CGCCCCCCTCGCCCCGGAGTACGGTGCGCGACGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGAGCGCCTCGGCGCGC--GGATGGC-CT-ATTTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGGGAACGGA-CCCTGTGCGCTCGCGCACC Viola_mirabilis_b --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTACGCGGG-C-GGCC-CCGGCTGCCTCG-CGCGGAGA------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGTGAGCG-CGCCCCCCTCGCCCCGGAG-ACGGTGCGCGACGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGAGCGCCTCGGCGCGC--GGATGGC-CTTAATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGGGAACGGA-CCCTGTGCGCTCGCGCACC Viola_nagasawai --TCGAAACCTGCCCGACAGAACGAACCGCGAACATGTTACAAGCACATCGTGGGGC-AGC--TTGG-CGCTTCGGCTC--ACGCTGTCCCGC-GAGGTGGTGTCGCGGCCGTGCGTACGCGTTCG-CGCGCGCCTACGGTTTGTGCCAT-GCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAACGA{AG}AGCG--AG-CGTCCTCCTCGCCCCGGGA-ACGGTGCGCGATGGT-GGA--CGCCTCGCTGTCC--AATGAT--AAACT--AA{CT}GTCGCCGCCAGCACACTCTTCCCTTAGGG-GTCGCGATGTAGCT-GGGGGCGGATTTTGGCCTCCCGTGCGCCTTGGTGCGCGCGGTTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCG-TTGAGAGAAGGAA-CCCTGTGTGCTCGCGCACC Viola_nannei --TCGAAACCTGCCCGACCGAGCGACCCGCAAACAC{GT}TTACAAACACTGC{AG}AGGG-C-GGCC-ATGGCTGCCTCG-CGCGGGGG------TGCTGC{AG}ACTGC{GT}T----------GCGCAAACTAGC-TGCGCGCATGCTGTCCGTGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CGCCCCCCTCGCCCCGGA{AG}-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGTACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAATCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGTCCTCT-CGGA{AG}AGACCGGA-CCCCGTGCGCTCGCGCACC Viola_odorata_Fr --TCGAAACCTGCCCGACAGAGCGACCCGCGAACAC-TTACAAACACGGCGCGGG-C-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTGGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CTCCCCCCTCGCCCCGGAG-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT----CGTCGCCGCCAACCCCACCCCTAAGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATCTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCCCC-CGGAGGGAACGGA-CCCCGTGCGCTCGCGCACC Viola_odorata_Ge --TCGAAACCTGCCCGACAGAGCGACCCGCGAACAC-TTACAAACACGGCGCGGG-C-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTGGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CTCCCCCCTCGCCCCGGAG-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT----CGTCGCCGCCAACCCCACCCCTAAGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATCTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCCCC-CGGAGGGAACGGA-CCCCGTGCGCTCGCGCACC Viola_odorata_US --TCGAAACCTGCCCGACAGAGCGACCCGCGAACAC{GT}TTACAAACACGGCGCGGG-C-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGC{GT}T----------GCGCAAACTGGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACA{AG}-AACCC-CGGCGCGGACTGCGCC{AC}AGGAAACAAAAAA-CGAATGAGAGCGAGAG-CTCCCCCCTCGCCCCGGAA-ACGGTG-GC{AG}ATGGT-GGG--CGCCTC{CG}CTGTCC--ATTGAT--AAACT----CGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATCTC-A{CG}CTCCTGG-CGAA-GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCCCC-CGGAGGGAACGGA-CCCCGTGCGCTCGCGCACC Viola_parvula --TCAAAACATGCCCGACAGAGCGACCCGCGAACGCGTCACAAACACTGCGCTTG-C-GGCC-TCGGCTG-CTCG-CCCGGCAG------TGGTGCGGCTGCGT----------GCGCAA------------GCGCGCTGCCCGCTCCGCTGCCACTTAAAG-AACCCACGGCGCGGACTGCGCCAAGG-AACATAAAA-CTCACGAGAGCGAGCG-CTCCTTCGTCGCCCCGGAA-ACGGTGCGCGACGTT-GGGCGCGCCTCGCTCTCC--AATGAT--AAACT-----GTCGCCGCCAACGCCGCCCTTTTGGGCGC---------GCAGTT-GGGGGCGGAATATGGCATCCCGTGCGCCTCGGCGCGC--GGTTTGC-CT-AATATC--GCCCCCGG-CGA--GGATCGCCACAA-CAAAAGATGGTTTTTTGGAAGAAGGACCTC-GGGTGTTG----------------------------------------------- Viola_pedata --TCGAAACCTGCCCGACCGAATGACCCGCGAACAC{GT}TTACAAACACTGCTCGGG-C-GGCC-ATGGCTGCCTCG-CGCGGGGG------TGCTGCGGCTGCGT----------GCGCAAACTA{AG}C-TGCGCGCACGCTGTCCGCGCTACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGA--CCGCCCCCTCGCCCCGGGA-ACGGTGCGCGATGGT-GGG--CGCCTCG-----------------------AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGTGC--GGATGGC-CT-AATTTC-ACCTCCTGG-CAA--GGATCGCCACAA-CAAGCGGTGGTTTTT{AG}-AA{AC}{ACG}AAGGA{AC}C{CT}C-{CG}GGTTTTGTT{CT}TGCTTCCCCC-C{CG}{AG}A{AG}AAAAAGGA-CCCTTG-TGCTC{GT}CGCAC{AC} Viola_pinnata --TCGAAACATGCCCCACAGAACGACCCGCGAACATGTTACAAGCACAC{AC}GCGGGGC-AGC--TTGG-CGCCTCGGCCC--TTGCTGTCCTGC-GAGGCGGTGTCGCGGCCGTGCGTGCGCGTTCG-CGCGCGCCTACGGTCAGCGCCAC-GCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAACGAGAGCG--AG-CGCCCTCCTCGCCCCGGGA-ACGGTGCGCGATGGT-GGG--CGCCTCGCTGTCC--AATGAT--AAACT--AACGTCGCCGCCAGCACACCCTTCCCTTAGGGGATCGGGATGTAGCT-GGGGGCGGATTTTGGCCTCCCGTGCGCCTCAGCGCGCGCGGTTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCG-CGGAGAGAAGGAA-CCCCGTGCGCTAGCGCACA Viola_praemorsa --TCGAAACCTGCCCGACAGAGCGACCCGTGAACACGTTACAAGCACAACGCGGGCT-AGT--TGGG-CGCCTCGGCCC--TAGCTATCCCGC-GCGGTGTTGGCACTAACAGTAGTCGTGCATTCATGCGCGCCTATGGTTCTTGCCAC-ACCACTAACAG-AACCCCCGGCGCGGATTGCGCCATGG-AACAAAAAA-CGAACAAGAGCGGGCG-CGCCCCCCTCGCCCCGGGA-ACGGTGCGCGATGGG-GGT--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACACACCCTTTCCTTAGGG-ATTGAGTGGTAGTT-GGGGGCGGATTATGGCCTCCCGTGCGCCCTGGCGCGCGCGGCTGGC-CTAAATTTC-ATCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCA-CTGAGAGAAGGAA-CCCCGTGCGCTCGCGCACT Viola_pubescens --TCGAAACCTGCCCGACAGAGCGACCCGTGAACACGTTACAAGCACACCACGGGGC-AGT--TTGG-TGCCTCGGCCC--TTGCTGTCCCG-TGCGGTGGTGGCAC{AG}AACCATAGGC-GCGCGCG-CGCGCGTCTCTGGTTCGCGCCA-GACCACTAACA{AG}-AACCC-CGGCGCGGACTGCGCCAAGGGAACAAAAAA-CGAATGAGAGCTAGAG-CGCCCCCCTCGCCCCGGAA-ACGGTGTGCGATGGT-GGG--CGCC-CGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCACCCTTTCCTCAGGG-ATTGAGTGGAAGTT-GGGGGCGGATTATGGCCTCCCGTGCGCCTCTGCGCGCGCGGCTGGC-CTAAATTTT-AACTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCA-CGGAGAGAAGGAA-CCTCGTGCGCTCGCGCACC Viola_purpurea --TAGAAACCTGCCCGACAGAGCGACCCGTGAACACGTTACAAGCACAACGCGGGCC-AGG--TGGG-CGCTTCGGCCC--TAGCTTTCCCGC-GCGGTGTTGGCACTAACCGTAGTCGTGCATTCATGCGCGCCTATGGTTCTTGCCAC-ACCACTAACAG-AACCCCCGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAATGAGAGCGGGCG-CGCCCCCCTCGCCCCGGGA-ACGGTGCGCGATGGG-GGT--TGCCTTGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACACACCCTTTCCTTAGGG-ATTGAGTGGTAGTT-GGGGGCGGATTATGGCCTCCCGTGCGCCCTGGCGCGCGCGGCTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCA-CTGAGAGAAGGAA-CCCTGTGCGCTCGCGCACT Viola_reichei --TCTAAACCTGCCCGACAGAGCGAGCCGTGAACGCGTTACAAACGGGCCGTGGGGC-AGC--TAGG-TGCCTCGGTCC--TGGCTGTCCTGC-GCGGTGGTGTCGCGGCCATATGCGCGCATTCG-TGCGCGCGCGCGGCCCGTGGCACCACCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAACAA-CAAACGAGAGCGCGCG-CGCCCACCTCGCCCCGGGA-ACGGTGAGCGATGG--GGG--TGCCTCGCTGTCTGTATTGAA--AAACT--AACGTCGCCGCCAACACCATCCCTAGGGATTG-AGT-------AGTT-GGGGGCGGATTTTGGCTGCCCGTGCGCCTCGTCGCGCGCGGCCGGT-CTAAATTTC-AGCTCGCGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCA-CGCGGAGAAGGAA-CCCTGTGCGCTCGCGCACT Viola_reichenbachiana --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACG-AACAAACAATGCGCGGG-C-GGCC-CTGGCTGCCTCG-TGCGGAGG------TGCTGCGGCTGCGC----------GAGCAAACTAGC-TACGCGCACGCTGTCCGTGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-TGAACGAGAGCGAGCG-CGCCCTCTTCGCCCCGGAA-ACGGTGCGCGATGGT-GGG--CGGCTCGCTGTCC--ATT------------AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTCTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAG-GAACGGA-CCCCGTGCGCTCGCGCACC Viola_riviniana --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTACGCGGG-C-GGCC-CTGGCTGCCTCG-CGCGGAGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGTGACACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AATAAAAAA-CGAATGAGAGCGAG---CGCCCCCCTCGCCCCGGAG-ACGGTGCGCGACGGT-GGG--TACCTCGCTGTCC--ATTGAT--AAACT----CGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGGGAACGGA-CCCTGTGCGCTCGCGCACC Viola_scandens --TCTAAAC{AG}TGCCCGATGTAGCGACCCGTGAACAC{GT}TTACAAACACACCGTGGTGC-A{CG}C--TTGG-TGCCTCGGCCC--AGGCTGTCCCGC-GCGGTGGTGTTGCGGCCTCAGGCGTGCATCCT-TGCATGTTTGTTGTCCGCGGCAC-TCCACTAAAA{AG}-AACCC-GGGCGCGGACTGCGCCAAGG-AACAAACAA-CAAATGACAGCTTGCG-CGCCCTCTCCGCCCCGC{AG}A-ACGGTGA{GT}TGATGGGGGGGGATGCCTC{CG}CTGTCT--ATTGAT--CATTA--AACGTCGCCGCCAAAACCTTCCCTACGGATGA-GT--------AGTT-GGGGGCGTATTCTGGCTTCCCGTGCGC-TGAGCTCGCGCGGCTGGC-CTAAATTTC-AGCTCACGG-CGAGAGAATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-AGGTGTTGTCGTGGGGACTCC-CCGAGA{AG}AACGAA-CCTCGTGCGCTTGCGCACT Viola_sheltonii --TCGAAACCTGCCAGACAGAGCGACCCGTGA-CACGTTACAAGCACAACGCGGGCC-AGT--TGGG-TGCCTCGGCCC--TGGCTGTCCCGC-GCGGTGTTGGCACGAACCGTAGCGCGCATTCG-TGCGATAAAACGGCTCGCGCCAG-ACCATTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAATGAGAGCGGGCG-CGCCCCCCTCGCCCCGGGA-ACGGTGCGCGACGGG--GA--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACACACCCTTTCCTTAGGG-ATCGAGTGGTAGTT-GGGGGCGGATTATGGCCTCCCGTGCGCCCCGGCGCGCGCGGCTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCG-CGGAGAGAAGGAA-CCCCGTGCGCTCGCGCACT Viola_sintenisii --TTAACACCTGCCCGAC{AT}GAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-A-GGCC-CCGGCTGCCTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAGAG-CCCCCACCCCGCCCCGGAG-ACGGTGTGCGAAGGT-GGG--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCG{GT}GC{CG}CCTCGGCGCGC--GGATGGC-CT-AATTTC-A{CG}CTCCTGG-CGA--GGATCGCCACGA-CAAGCGG{GT}GGTTTTTTGAACTAAGGACCTC-GGG{GT}GTTG{CT}CG{GT}GCGGCCTCC-CGGA{AG}A{AG}AAC{AG}{AG}A-CCCTGTGCGCTCGCGCACC Viola_striata --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-C-GGCC-CTGGCTGCCTCG-CGCGGAGG------TGATGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGTGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGGAAACAAAAAA-TGAATGAGAGTGAGCG-CGCCCTCCTCGCCCCGGAA-ACGGTGCGCGACGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GCAGTT-GGGGGCGGACTCTGGCCTCCCGTGCGCCACGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGAGGCCTCC-CGGAGGGAACGGA-CCCCGTGCGCT-------- Viola_suavis_a --TCGACACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-C-GGCC-TCGGCTGCTTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGTGCCAAGG-AATAAAAAA-CGAATGAGAGCGAGAG-CGCCCCCCTCGCCCCGGAG-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GTAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCTTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGGGAACAGA-CCCTGTGCGCTCGCGCACC Viola_suavis_b --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACACTGCGCGGG-C-GGCC-TCGGCTGCTTCG-CGCGGCGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGCGCCACCTCCACTAACAG-AACCC-CGGCGCGGACTGTGCCAAGG-AATAAAAAA-CGAATGAGAGCGAGAG-CGCCCCCCTCGCCCCGGAG-ACGGTGTGCGATGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCCTAGGGGCGG---------GTAGTT-GGGGGCGGACTTTGGCCTCCCGTGCGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCTTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGGAGGGAACAGA-CCCTGTGCGCTCGCGCACC Viola_tricolor --TCGAAACCTGCCCGACAGAGCGACCCGCGAACGCGTTACAAACACTGCGC{GT}GG-C-GGCC-TCGGC{CT}G-CTCG-CGCGGCTG------TGCTGCGGCTGCGT----------GCGCAA------------GCGCGCTGCCCGTT{CG}CACGGCCACTTAAAG-AACCCACGGCGCGGACTGCGCCAAGG-AACAT{AT}AAA-CTTACGAGAGCGAGCG-CTCCCTCCTCGCCCCGGAG-ACGGTGCGCGATGTT-GGG--CGCCTCGCTGTCC--AATGAT--AAACT-----GTCGCCGCCAACGCCGCCCTTAGGGGCGC---------GCAGTT-GGGGGCGGAATATGGCCTCCCGTGCGCCTCGGCGCGC--GGTTGGC-CTAAATATC--ACCCCCGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTCAACGAAGGACCTC-GGGTGTTGTCGTGCGGCCTTC-CGGAGGGAACGGA-CCCTGCGC{CT}CTCGAGCGC- Viola_umbraticola --TCGAAACCTGCCCGACAGAGCGACCCGCGAACACGTTACAAACTCTGCGCGGG-C-GGCC-CTGGCTGCCTCG-CGCGGAGG------TGCTGCGGCTGCGT----------GCGCAAACTAGC-TGCGCGCACGCTGTCCGTGGCACCTCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CGAATGAGAGCGAACG-CGCCCTCCTCGCCCCGGAA-ACGGTGCGCGACGGT-GGG--CGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACCCCACCCTTAGGGGTGG---------GCAGTT-GGGGGCGGACTTTGGCCTCCCGTGTGCCTCGGCGCGC--GGATGGC-CT-AATTTC-AGCTCCTGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCC-CGAAAAGAATGGA-CCCCGTGCGCT-------- Viola_uniflora --TCGAAACCTGCCCGACAGAGCGACCCGTGAACACGTTACAAGCACAACGCGGGCC-ACC--TAGG-TGCCTCGGCCC--TGGCTGTCCCGC-GCGGTGGTGTCGCGGCCGCCCTTGCGCATTCG-TGCGTGAGTACGGTTCGTGCCGCTGCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAACGAGAGCGGGCG-CTCCCCCCTCGCCCCGGTA-ACGGTGCGCGATGGG-GGA--TGCCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAGCACACCCTTTCCTAAGGG-ATTGAGTGGTAGCT-GGGGGCGGATTCTGGCCTCCCGTGTGCCTCAGCGCGCGCGGTTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCGTCGGAGAGAAGGAA-CCCCGTGCGCTCGCGCACT Viola_vallicola --TAGAAACCTGCCCGACAGAGCGACCCGTGAACACGTTACAAGCACAACGCGGGCC-AGG--TGGG-TGCCTCGGCCC--TAGCTGTCCCGC-ACGGTGGTGGCACAAACCGTAGTCGTGCATTCATGCGCGCCTATGGTTTGTGCCAG-ACCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAAAA-CAAATGAGAGCGGGCG-TGCCCCCCTCGCCCCGGGA-ACGGTGCGCGATGGG-GGA--CACCTCGCTGTCC--ATTGAT--AAACT--AACGTCGCCGCCAACACACCCTTTCCTTATGG-ATTGAGTGGTAGTT-GGGGGCGGAATATGGCCTCCCGTGCGCCCCGGCGCGCGCGGCTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTAAATTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCG-CGGAGAGAAAGAA-CCCCGTGCGCTCGCGCACT Viola_variegata --TCGAAACCTGCCCCACAGAACGACCCGCGAACATGTTACAAGCACACCGCGGGGC-AGC--TTGG-CGCCTCGGCCC--TTGCTGTCCCGC-GCGGTGGTGTCGCGGCCGTGCGTGCGCGTTCG-CGCGCGCCTACGTTTCGCGCCACCGCCACTAACAG-AACCC-CGGCGCGGACTGCGCCAAGG-AACAAAGAA-CAAACGAGAGCG--AG-CGGCCTCCTCGCCCCGGGA-ACGGTGCGCGATGGT-GGA--CGCCTCGCTGTCC--AATGAT--AAACT--AACGTCGCCGCCAGCACACCCTTCCCTTAGGGGATCGTGATGTAGCT-GGGGGCGGATTTTGGCCTCCCGTGCGCCTCAGCGCGCGCGGTTGGC-CTAAATTTC-AGCTCACGG-CGA--GGATCGCCACGA-CAAGCGGTGGTTTTTTGAACTAAGGACCTC-GGGTGTTGTCGTGCGGCCTCGACGGAGAGAAGGAA-CCTCGTGCGCTCGCGCACA ; END; BEGIN TREES; TITLE Tb7965; LINK TAXA = Taxa1; TRANSLATE 1 Viola_reichenbachiana, 2 Viola_reichei, 3 Viola_purpurea, 4 Viola_pubescens, 5 Viola_praemorsa, 6 Viola_pinnata, 7 Viola_pedata, 8 Viola_parvula, 9 Viola_odorata_US, 10 Viola_odorata_Ge, 11 Viola_odorata_Fr, 12 Viola_nannei, 13 Viola_nagasawai, 14 Viola_mirabilis_b, 15 Viola_mirabilis_a, 16 Viola_micranthella, 17 Viola_maviensis, 18 Viola_macloskeyi_subsp._pallens, 19 Viola_lutea, 20 Viola_langsdorffii, 21 Viola_kauaensis, 22 Viola_incisa, 23 Viola_hookeria, 24 Viola_hirta, 25 Viola_hemsleyana, 26 Viola_helenae, 27 Viola_flagelliformis, 28 Viola_fischerii, 29 Viola_domingensis, 30 Viola_dissecta, 31 Viola_cuneata, 32 Viola_cucullata, 33 Viola_clauseniana, 34 Viola_chamissoniana_subsp._tracheliifolia, 35 Viola_cazorlensis, 36 Viola_capillaris, 37 Viola_canadensis, 38 Viola_calcarata, 39 Viola_blanda_var._palustriformis, 40 Viola_beckwithii, 41 Viola_affinis, 42 'Viola alba subsp. dehnhardtii TM494-2', 43 'Viola alba subsp. dehnhardtii TM494-1', 44 'Viola alba subsp. dehnhardtii TM397-2', 45 'Viola alba subsp. dehnhardtii TM342-1', 46 Viola_alba_subsp._cretica, 47 Viola_alba_TM496, 48 Viola_alba_MH043220, 49 'Viola alba TM469-5', 50 'Viola alba TM469-7', 51 'Viola alba TM357-21', 52 Viola_Parme_de_Toulouse_N, 53 Viola_Parme_de_Toulouse_9, 54 Viola_Parme_de_Toulouse_8, 55 Viola_Gloire_de_Verdun, 56 Viola_d_Udine, 57 Viola_Marie_Louise, 58 Viola_Ash_Vale_Blue, 59 Viola_variegata, 60 Viola_vallicola, 61 Viola_uniflora, 62 Viola_umbraticola, 63 Viola_tricolor, 64 Viola_suavis_b, 65 Viola_suavis_a, 66 Viola_striata, 67 Viola_sintenisii, 68 Viola_sheltonii, 69 Viola_scandens, 70 Viola_riviniana; TREE Fig._1 = [&R] (69,((((((((((58,(57,(56,55))),(54,53,52),(51,50,45),49,48,47,46,67)Viola_alba_Clade_D,((44,43,42),((11,10),9))Viola_Clade_C,((((((41,32),33)'Boreali-Americanae',(((25,23),12)Mexicanae,7)),((34,(26,(21,17)))Nosphinium,20)),(((38,(19,63)),8)Melanium,35)),24)Viola_Clade_E,(65,64)),(15,14)),70),(1,66)),62),16)Viola_Clade_B,((((40,((5,3),60)),68)Nuttallianae,4),((((39,(29,18))Stolonae,((((30,22),6),59)Adnatae,13))Nominium,((37,27),31)Canadenses),(28,61)Nudicaules))Viola_Clade_A),2),36); END; BEGIN TREES; TITLE Tb7966; LINK TAXA = Taxa1; TRANSLATE 1 Viola_reichenbachiana, 2 Viola_reichei, 3 Viola_purpurea, 4 Viola_pubescens, 5 Viola_praemorsa, 6 Viola_pinnata, 7 Viola_pedata, 8 Viola_parvula, 9 Viola_odorata_US, 10 Viola_odorata_Ge, 11 Viola_odorata_Fr, 12 Viola_nannei, 13 Viola_nagasawai, 14 Viola_mirabilis_b, 15 Viola_mirabilis_a, 16 Viola_micranthella, 17 Viola_maviensis, 18 Viola_macloskeyi_subsp._pallens, 19 Viola_lutea, 20 Viola_langsdorffii, 21 Viola_kauaensis, 22 Viola_incisa, 23 Viola_hookeria, 24 Viola_hirta, 25 Viola_hemsleyana, 26 Viola_helenae, 27 Viola_flagelliformis, 28 Viola_fischerii, 29 Viola_domingensis, 30 Viola_dissecta, 31 Viola_cuneata, 32 Viola_cucullata, 33 Viola_clauseniana, 34 Viola_chamissoniana_subsp._tracheliifolia, 35 Viola_cazorlensis, 36 Viola_capillaris, 37 Viola_canadensis, 38 Viola_calcarata, 39 Viola_blanda_var._palustriformis, 40 Viola_beckwithii, 41 Viola_affinis, 42 'Viola alba subsp. dehnhardtii TM494-2', 43 'Viola alba subsp. dehnhardtii TM494-1', 44 'Viola alba subsp. dehnhardtii TM397-2', 45 'Viola alba subsp. dehnhardtii TM342-1', 46 Viola_alba_subsp._cretica, 47 Viola_alba_TM496, 48 Viola_alba_MH043220, 49 'Viola alba TM469-5', 50 'Viola alba TM469-7', 51 'Viola alba TM357-21', 52 Viola_Parme_de_Toulouse_N, 53 Viola_Parme_de_Toulouse_9, 54 Viola_Parme_de_Toulouse_8, 55 Viola_Gloire_de_Verdun, 56 Viola_d_Udine, 57 Viola_Marie_Louise, 58 Viola_Ash_Vale_Blue, 59 Viola_variegata, 60 Viola_vallicola, 61 Viola_uniflora, 62 Viola_umbraticola, 63 Viola_tricolor, 64 Viola_suavis_b, 65 Viola_suavis_a, 66 Viola_striata, 67 Viola_sintenisii, 68 Viola_sheltonii, 69 Viola_scandens, 70 Viola_riviniana; TREE Fig._4 = [&R] (69,((((((((((54,53,52),((51,50,45),49,48,47,(46,67)))Viola_alba_Clade_D,((44,43,42),((11,10),9))Viola_Clade_C,((((((41,32),33)'Boreali-Americanae',(((25,23),12)Mexicanae,7)),((34,(26,(21,17)))Nosphinium,20)),(((38,(19,63)),8)Melanium,35)),24)Viola_Clade_E,(65,64)Viola_suavis),(15,14)Viola_mirabilis),70),(1,66)),62),16)Viola_Clade_B,((((40,((5,3),60)),68)Nuttalianae,4),((((39,(29,18))Stolonae,((((30,22),6),59)Adnatae,13))Nominium,((37,27),31)Canadenses),(28,61)Nudicaules))Viola_Clade_A),2),36); END;