#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:20 GMT TreeBASE (cc) 1994-2008 Study reference: Vargas-isla R., Capelari M., Menolli jr N., Nagasawa E., Tokimoto K., & Ishikawa N.K. 2014. Relationship between Panus lecomtei and P. strigellus inferred from their morphological, molecular and biological characteristics. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16493] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=18; TAXLABELS Lentinus_sp_JQ428825 Neolentinus_kauffmanii_JF808173 Neolentinus_kauffmanii_JQ428821 Panus_lecomtei_JQ955721 Panus_lecomtei_JQ955726 Panus_sp_HM245784 Panus_sp_JF741922 Panus_sp_KF496188 Panus_sp_KF496194 Panus_sp_KJ195662 Panus_sp_KM70912 Panus_strigellus_JQ955722 Panus_strigellus_JQ955724 Panus_strigellus_JQ955725 Panus_strigellus_JQ955727 Polyporales_sp_EF694648 Spongipellis_delectans_HQ728298 Spongipellis_delectans_HQ728299 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24472] TITLE Panus_3_mafft_edited; LINK TAXA = Taxa1; DIMENSIONS NCHAR=603; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Lentinus_sp_JQ428825 ????????????????GACAGGGTTGTAGCTGGCCCT--ATCCGGGCATGTGCACGAAATGCTCAT--TCCAATTCTTACACCTCTGTGCACTTAACA-TGGGCTGGTCGTAGGCTTTTGTCTTGCTTCAGTGTGAGACGGGCTTTGACCTGCCTGTGGTTACTCTACAAACACTTTAAAGTATTAGAATGTAACATCGCGGATAATAAACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCTAAATCTTTGCGGATTTGGATGAATTGGATGTGGAGGTTTATTGCT-GGCGACTATCCTTCTGGATCTGTGTCCGGCTCCTCTG-AATACATTAGCAGGAATGTTGCCGTGCCAACCTCAGTG??????????????????????????????????????????????????????????????????????????????????????? Neolentinus_kauffmanii_JF808173 ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????G{CT}GAGC-TT{AG}ACCCGCCTGTGGTT-CTCTACAAACACTTATAGTATTTAGAATGTAAACCTGCGTATAAT-AACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCCCTAAATCTTTGCGGATTTGGGTGAATTGGATGTGGAG-GTGATTGCT-GGCGTGCGTTTTTT-AAATGGCGTGCCGGCTCCTCTGAAATGAATTAGCGGGAATGTTGCCGTGTCAACCTCAGTGTGATAATTATCTGCGCTGTTGTTGCTCAGCAAAAATATATGTTCTCGCTTCGAATCGTCTTTGGACAATTTCTTGACAATCTGACCT Neolentinus_kauffmanii_JQ428821 ???????????????????????????????GGCCCT-AACCGGGGCATGTGCACGCCTTGCTCAT--TCCAAATTCTACACCTCTGTGCACTTAACATTGGGTTGGTTGCGGCTTGT-----------CTCTCGGGGCGAGC-TTGACCCGCCTGTGGTT-CTCTACAAACACTTATAGTATTTAGAATGTAAACCTGCGTATAAT-AACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCCCTAAATCTTTGCGGATTTGGGTGAATTGGATGTGGAG-GTGATTGCT-GGCGTGCGTTTTTT-AAATGGCGTGCCGGCTCCTCTGAAATGAATTAGCGGGAATGTTGCCGTGTCAACCTCAGTGTGATAATTATCTCCCCTGTTGTTGCTCAGCAAAAATATATGTTCTCGCTTCGAATCGTCTTTGGACAATTTCTTGACAATCTGACCT Panus_lecomtei_JQ955721 CATTAC-TGAATTTATGACAAGGTTGTAGCTGGCCCT--ATCCGGGCATGTGCACGCCTTGCTCAT--TCCAATTCTTACACCTCTGTGCACTTAACA-TGGGCTGGTCGTAGGCTTTTGTCTTGCTTCACTGTGAGACGGGCTTTGACCTGCCTGTGGTTACTCTACAAACACTTTAAAGTATCAGAATGTAACATCGCGGATAATAAACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCTAAATCTTTGCGGATTTGGATGAATTGGATGTGGAGGTTTATTGCT-GGCGACTATCCTTCTAGATCTGTGTCCGGCTCCTCTGAAATAAATTAGCAGGAATGTTGCCGTGCCAACCTCAGTGTGATAATTATCTGCGCTGTTGTTGCTCAGCAAAA-TATATGTTCTTGCTTCTAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_lecomtei_JQ955726 ?????????????????????GGTTGTAGCTGGCCCT--ATCCGGGCATGTGCACGCCTTGCTCAT--TCCAATTCTTACACCTCTGTGCACTTAACA-TGGGCTGGTCGTAGGCTTTTGTCTTGCTTCACTGTGGGACGGGCTTTGACCTGCCTGTGGTTACTCTACAAACACTTTAAAGTATTAGAATGTAACATCGCGGATAATAAACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCTAAATCTTTGCGGATTTGGTTGAATTGGATGTGGAGGTTTATTGCT-GGCGACTATCCTTCTGGATCTGTGTCCGGCTCCTCTGAAATAAATTAGCAGGAATGTTGCCGTGCCAACCTCAGTGTGATAATTATCTGCGCTGTTGTTGCTCAGCAAAA-TATATGTTCTTGCTTCTAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_sp_HM245784 CATTAC-TGAATTTATGACAAGGTTGTAGCTGGCCCT--ATCCGGGCATGTGCACGCCTTGCTCAT--TCCAATTCTTACACCTCTGTGCACTTAACA-TGGGCTGGTCGTGGGCTTTTGTCTTGCTTCACTGTGAGACGGGCTTTGACCTGCCTGTGGTTACTCTACAAACACTTTAAAGTATTAGAATGTAACATCGCGGATAATAAACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCTAAATCTTTGCGGATTTGGATGAATTGGATGTGGAGGTTTATTGCT-GGCGACTATCCTTCTGGATCTGTGTCCGGCTCCTCTGAAATAAATTAGCAGGAATGTTGCCGTGCCAACCTCAGTGTGATAATTATCTGCGCTGTTGTTGCTCAGCAAAA-TATATGTTCTTGCTTCTAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_sp_JF741922 CATTACTTGCCTTTATGACAAGGTTGTAGCTGGCCCTAACCCGGGGCATGTGCACGCCTTGCTCAT--TCCAAATTCTACACCTCTGTGCACTTAACA-TGGGTTGGTTGCGGCTTGT-----------CTCTCGGGGCGAGC-TTG-CCCGCCTGTGGTT-CTCTACAAACACTTTATAGTATTAGAATGTAAACCCGCGTATAAT-AACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCCCTAAATCTTTGCGGGTTTGGGTGAATTGGATGTGGAGGGTGATTGCT-GGCGTGCGTTTTTTTAAATGGCGTGCCGGCTCCTCTGAAATGAATTAGCGGGAATGTTGCCGTGTCAACCTCAGTGTGATAATTATCTGCGCTGTTGTTGCTCAGCAAAATATTATGTTCTCGCTTCGAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_sp_KF496188 CATTAC-TGAATTTATGACAAGGTTGTAGCTGGCCCT--ATCCGGGCATGTGCACGCCTTGCTCAT--TCCAATTCTTACACCTCTGTGCACTTAACA-TGGGCTGGTCGTAGGCTTTTGTCTTGCTTCACTGTGAGACGGGCTTTGACCTGCCTGTGGTTACTCTACAAACACTTTAAAGTATCAGAATGTAACATCGCGGATAATAAACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCTAAATCTTTGCGGATTTGGATGAATTGGATGTGGAGGTTTATTGCT-GGCGACTATCCTTCTGGATCTGTGTCCGGCTCCTCTGAAATAAATTAGCAGGAATGTTGCCGTGCCAACCTCAGTGTGATAATTATCTGCGCTGTTGTTGCTCAGCAAAA-TATATGTTCTTGCTTGGAAACGTCTTCGGACAATTTCTTGAC-ATCGGA--T Panus_sp_KF496194 ???????????????????????????????????????????????????????????????????????????????????????????????????????????TCGTAGGCTTTTGTCTTGCTTCACTGTGAGACGGGCTTTGACCTGCCTGTGGTTACTCTACAAACACTTTAAAGTATCAGAATGTAACATCGCGGATAATAAACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCTAAATCTTTGCGGATTTGGATGAATTGGATGTGGAGGTTTATTGCT-GGCGACTATCCTTCTGGATCTGTGTCCGGCTCCTCTGAAATAAATTAGCAGGAATGTTGCCGTGCCAACCTCAGTGTGATAATTAT-TGCGCTGTTGTTGCTCAGCAAAA-TATATGTTCTTGCTTC-AATCGTCTTCGGACAATTTCTTGAC-ATGAGACCT Panus_sp_KJ195662 CATTAC-TGAATTCATGACAAGGTTGTAGCTGGCCCT--ACCCGGGCATGTGCACGCCTTGCTCAT--TCCAATTCTTACACCTCTGTGCACTCAACA-TGGGTTGGTTGTGGCCTGA-------CATGCTTGCGTGAAGGGC-CTGTACCGCCTGTGGTTACTCTACAAACACCTAAAAGTATTAGAATGTAA-ACTGCGTATAAC-GCATC--TTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTCGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCCAAATCTTTGCGGATCTGGTTGGATTGGATGTGGAG-GATCTTGCTGGGTGTGCCTTCCTTGGG--C-GTGTCCGGCTCCTCTGAAATGCATTAGCAGGAATGTTGCCGTGCCAACCTCAGTGTGATAATTGTCTACGCTGTTGTTGCTCGGCAAAA-TGTATGTTCTTGCTCACAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_sp_KM70912 CATTAC-TGAATTCATGACAAGGTTGTAGCTGGCCCT--ACCCGGGCATGTGCACGCCTTGCTCAT--TCCAATTCTTACACCTCTGTGCACTCAACA-TGGGTTGGTTGTGGCCTGA-------CATGCTTGCGTGAAGGGC-CTGTACCGCCTGTGGTTACTCTACAAACACCTAAAAGTATTAGAATGTAA-ACTGCGTATAAC-GCATC--TTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCCGAATCTTTGCGGATCTGGTTGGATTGGATGTGGAG-GCTCTTGCTGGGTGTGCCTTCCTTGGG--C-GTGTCCGGCTCCTCTGAAATGCATTAGCAGGAATGTTGCCG{GT}GCCAACCTCAGTGTGATAATTGTCTACGCTGTTGTTGCTCGGCAAAA-TGTATGTTCTTGCTCACAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_strigellus_JQ955722 ???????????????????????????????????????TCTCGGGCATGTGCACGCCTTGCTCAT--TCCAATTC-TACACCTCTGTGCACTTAACA-TGGGTTGGTTGCGGCTCGT-----------CTTTCGGGATGGGC-TTGACCT-CCTGTGGTT-CTCTACAAAC-TCATATAGTAATAGAATGTAA-TCCGCGTATAAT-AACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAACTCCCTAAATCTTTGCGGATTTGGGTGAGTTGGATGTGGAG-GTGATTGCT-GGCGTGCATTAGTTT----GCGTTGTCGGCTCCTCTGAAATAAATTAGCGGAAATGTTGCCGTGTCAACCTCAGTGTGATAATTGTCTACGCTGTTGTTGCTCTGCAAAA-TATATGTTTCCGCTTCAAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_strigellus_JQ955724 CATTAC-TGAATTCATGACAAGGTTGTAGCTGGCCCC-ATCTCGGGCATGTGCACGCCTTGCTCAT--TCCAATTC-TACACCTCTGTGCACTTAACA-TGGGTTGGTTGCGGCTCGT-----------CTTTCGGGATGGGC-TTGACCT-CCTGTGGTT-CTCTACAAAC-TCATATAGTAATAGAATGTAA-TCCGCGTATAAT-AACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAACTCCCTAAATCTTTGCGGATTTGGGTGAGTTGGATGTGGAG-GTGATTGCT-GGCGTGCATTAGTTT----GCGTTGTCGGCTCCTCTGAAATAAATTAGCGGAAATGTTGCCGTGTCAACCTCAGTGTGATAATTGTCTACGCTGTTGTTGCTCTGCAAAA-TATATGTTTCCGCTTCAAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_strigellus_JQ955725 CATTAC-TGAATTCATGACAAGGTTGTAGCTGGCCCC-ATCTCGGGCATGTGCACGCCTTGCTCAT--TCCAATTC-TACACCTCTGTGCACTTAACA-TGGGTTGGTTGCGGCTCGT-----------CTTTCGGGATGGGC-TTGACCT-CCTGTGGTT-CTCTACAAAC-TCATATAGTAATAGAATGTAA-TCCGCGTATAAT-AACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGC?CCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAACTCCCTAAATCTTTGCGGATTTGGGTGAGTTGGATGTGGAG-GTGATTGCT-GGCGTGCATTAGTTT----GCGTTGTCGGCTCCTCTGAAATAAATTAGCGGAAATGTTGCCGTGTCAACCTCAGTGTGATAATTGTCTACGCTGTTGTTGCTCTGCAAAA-TATATGTTTCCGCTTCAAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Panus_strigellus_JQ955727 CATTAC-TGAATTCATGACAAGGTTGTAGCTGGCCCC-ATC-CGGGCATGTGCACGCCTTGCTCAT--TCCAATTC-TACACCTCTGTGCACTTAACA-TGGGTTGGTTGCGGCTCGT-----------CTTTCGGGATGGGC-TTGACC-GCCTGTGGTT-TTCTACAAAC-TCATATAGTAATAGAATGTAA-ACCGCGTATAAT-AACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAACTCCCTAAATCTTTGCGGATTTGGGTGAGTTGGATGTGGAG-GTGATTGCT-GGCGTGCATTAGTTT----GCGTTGTCGGCTCCTCTGAAATAAATTAGCGGAAATGTTGCCGTGTCAACCTCAGTGTGATAATTGTCTACGCTGTTGTTGCTCAGCAAAA-TATATGTTTCCGCTTCAAATCGTCTTCGGAC????????????????????? Polyporales_sp_EF694648 CATTAC-TGAATTTATGACAAGGTTGTAGCTGGCCCT--ATCCGGGCATGTGCACGCCTTGCTCAT--TCCAATTCTTACACCTCTGTGCACTTAACA-TGGGCTGGTCGTAGGCTTTTGTCTTGCTTCACTGTGAGACGGGCTTTGACCTGCCTGTGGTTACTCTACAAACACTTTAAAGTATTAGAATGTAACATCGCGGATAATAAACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATTCTCAATTCTCTAAATCTTTGCGGATTTGGATGAATTGGATGTGGAGGTTTATTGCT-GGCGACTATCCTTCTGGATCTGTGTCCGGCTCCTCTGAAATAAATTAGCAGGAATGTTGCCGTGCCAACCTCAGTGTGATAATTATCTGCGCTGTTGTTGCTCAGCAAAA-TATATGTTCTTGCTTCTAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Spongipellis_delectans_HQ728298 CATTAA-TGAATTTATGACAAGGTTGTCGCTGGCCCT--AATTGGGCATGTGCACGCCTTGCTCATTTTCCAATTCTTACACCTCTGTGCACTTTTCA-TAGGTTGGTTGTGGCT-GT-----------C-TTCGCGGATGGT-TCAGCCTGCCTATGCTT---TTACAAACGCTTC--AGTTATAGAATGTAT-CTTGCGTAT----AACGCATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATGGTATTCTCAATACCCCAAGTCTTTGCGGATAAGGGTGTATTGGATTTGGAG-GTTTATGCT-GGCGT-----------------TTGTCGGCTCCTCTTAAATGCATTAGCAAAGATGTTACTGCTAC-TCTTCAGCGTGATAATTGTCTACGCTGCCGTTGTACGGTATAA--ATAAGTCTTTGCTTCTAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT Spongipellis_delectans_HQ728299 CATTAA-TGAATTTATGACAAGGTTGTCGCTGGCCCT--AATTGGGCATGTGCACGCCTTGCTCATTCTCCAATTCTTACACCTCTGTGCACTTTTCA-TAGGTTGGTTGTGGCT-GT-----------C-TTCGCGGATGGT-TCAGCCTGCCTATGCTT---TTACAAACGCTTC--AGTTATAGAATGTAT-CTCGCGTAT----AACGCATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATGGTATTCTCAATACCCCAAGTCTTTGCGGATAAGGGTGTATTGGATTTGGAG-GTTTATGCT-GGCGT-----------------TTGTCGGCTCCTCTTAAATGCATTAGCAAAGATGTTACTGCTAC-TCTTCAGCGTGATAATTGTCTACGCTGCCGTTGTACGGTATAA--ATAAGTCTTTGCTTCTAATCGTCTTCGGACAATTTCTTGAC-ATCTGACCT ; END; BEGIN TREES; TITLE Panus_3_RAxML_bipartitions; LINK TAXA = Taxa1; TRANSLATE 1 Polyporales_sp_EF694648, 2 Panus_sp_HM245784, 3 Spongipellis_delectans_HQ728298, 4 Spongipellis_delectans_HQ728299, 5 Panus_sp_JF741922, 6 Neolentinus_kauffmanii_JF808173, 7 Neolentinus_kauffmanii_JQ428821, 8 Lentinus_sp_JQ428825, 9 Panus_lecomtei_JQ955721, 10 Panus_strigellus_JQ955722, 11 Panus_strigellus_JQ955724, 12 Panus_strigellus_JQ955725, 13 Panus_lecomtei_JQ955726, 14 Panus_strigellus_JQ955727, 15 Panus_sp_KF496188, 16 Panus_sp_KF496194, 17 Panus_sp_KJ195662, 18 Panus_sp_KM70912; TREE Imported_tree_1 = [&R] ((3:0.0038465052195963,4:1.52277619919638E-6):0.08313377567737082,(((5:0.009169328270905958,(6:1.5227761993318E-6,7:0.0037865178142813343)100:0.018050209645709088)100:0.03807485874010235,(14:0.002145772230389221,(10:1.5227761993318E-6,(11:1.5227761993318E-6,12:1.5227761993318E-6)93:1.5227761993318E-6)93:0.003530136661371449)97:0.038701995659791946)42:0.014140759025216484,((17:0.0030069891604718717,18:0.002307236417261296)100:0.07182023296277902,(2:1.5227761993318E-6,((1:1.5227761993318E-6,(8:0.012632851853189008,13:0.003511232303262909)20:1.5227761993318E-6)17:1.5227761993318E-6,(9:0.0016899047514280841,(15:0.006387019570701888,16:0.003080095460284308)57:0.0013017403079914915)63:0.0016917437586712648)40:0.0016902686954899753)100:0.043396133605843906)85:0.019418656434714004)100:0.08313377567737082); END;