#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 10:21 GMT TreeBASE (cc) 1994-2008 Study reference: Maharachchikumbura S., Crous P.W., Groenewald J.Z., Xu J., & Hyde K.D. 2014. Pestalotiopsis revisited. Studies in Mycology, 79: 121-186. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16539] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=74; TAXLABELS Amphisphaeria_umbrina_AF452029 Arecophila_bambusae_AF452038 Bartalinia_bischofiae_AF382367 Bartalinia_lateripes_AF382368 Bartalinia_laurina_AF382369 Discosia_artocreas_AB593705 Discosia_pini_AB593708 Discosia_sp._AB593712 Discosia_sp._AB593720 Discostroma_fuscellum_AB593726 Discostroma_fuscellum_AB593739 Discostroma_tostum_AB593727 Dyrithiopsis_lakefuxianensis_AF452047 Funiliomyces_biseptatus_AY772015 Lanceispora_sp._AF452032 Lanceispora_sp._AF452035 Monochaetia_kansensis_DQ534035 Monochaetia_kansensis_DQ534036 Monochaetia_kansensis_DQ534037 Neopestalotiopsis_formicarum_CBS_115.83 Neopestalotiopsis_mesopotamica_CBS_336.86 Neopestalotiopsis_natalensis_CBS_138.41 Neopestalotiopsis_piceana_CBS_254.32 Neopestalotiopsis_rosae_CBS_101057 Neopestalotiopsis_rosae_CBS_124745 Neopestalotiopsis_sp._CBS_110.20 Neopestalotiopsis_sp._CBS_164.42 Neopestalotiopsis_sp._KM116259 Neopestalotiopsis_sp._KM116274 Neopestalotiopsis_steyaertii_IMI_192475 Neopestalotiopsis_surinamensis_CBS_111494 Pestalotiopsis_arceuthobii_CBS_434.65 Pestalotiopsis_arengae_CBS_331.92 Pestalotiopsis_biciliata_CBS_790.68 Pestalotiopsis_camelliae_CBS_443.62 'Pestalotiopsis camelliae MFLUCC 12-0278' Pestalotiopsis_chamaeropis_CBS_237.38 Pestalotiopsis_colombiensis_CBS_118553 'Pestalotiopsis furcata MFLUCC 12-0054' Pestalotiopsis_hawaiiensis_CBS_114491 Pestalotiopsis_hollandica_CBS_265.33 Pestalotiopsis_jesteri_CBS_109350 Pestalotiopsis_knightiae_CBS_114138 Pestalotiopsis_malayana_CBS_102220 Pestalotiopsis_papuana_CBS_887.96 Pestalotiopsis_sp._CBS_263.33 Pestalotiopsis_sp._EU715665 Pestalotiopsis_sp._KM116195 Pestalotiopsis_sp._KM116223 Pestalotiopsis_sp._KM116237 Pestalotiopsis_spathulata_CBS_356.86 Pestalotiopsis_telopeae_CBS_114137 Pseudopestalotiopsis_cocos_CBS_272.29 Pseudopestalotiopsis_sp._KM116277 Pseudopestalotiopsis_sp._KM116278 Pseudopestalotiopsis_theae_EU833969 'Pseudopestalotiopsis theae MFLUCC 12-0055' Seimatosporium_elegans_AB593733 Seimatosporium_eucalypti_JN871209 Seimatosporium_eucalypti_JN871212 Seimatosporium_glandigenum_AB593735 Seimatosporium_hypericinum_AB593737 Seiridium_cardinale_AF382376 Seiridium_cardinale_AF382377 Seiridium_papillatua_DQ414531 Seiridium_phylicae_KC005809 Seiridium_phylicae_KC005810 Seiridium_sp._KM116280 Truncatella_angustata_AF382383 Truncatella_hartigii_DQ278928 Truncatella_laurocerasi_AF382385 Truncatella_restionacearum_DQ278929 Truncatella_sp._AF382382 Xylaria_hypoxylon_AF132333 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=76; TAXLABELS 'Neopestalotiopsis saprophyta MFLUCC 12-0282' Pestalotiopsis_adusta_ICMP_6088 'Pestalotiopsis adusta MFLUCC 10-0146' Pestalotiopsis_anacardiacearum_IFRDCC_2397 Pestalotiopsis_arceuthobii_CBS_434.65 Pestalotiopsis_arengae_CBS_331.92 Pestalotiopsis_australasiae_CBS_114126 Pestalotiopsis_australasiae_CBS_114141 Pestalotiopsis_australis_CBS_111503 Pestalotiopsis_australis_CBS_114193 Pestalotiopsis_australis_CBS_114474 Pestalotiopsis_australis_CBS_119350 Pestalotiopsis_biciliata_CBS_124463 Pestalotiopsis_biciliata_CBS_236.38 Pestalotiopsis_biciliata_CBS_790.68 Pestalotiopsis_brassicae_CBS_170.26 Pestalotiopsis_camelliae_CBS_443.62 'Pestalotiopsis camelliae MFLUCC 12-0277' 'Pestalotiopsis camelliae MFLUCC 12-0278' Pestalotiopsis_chamaeropis_CBS_113604 Pestalotiopsis_chamaeropis_CBS_113607 Pestalotiopsis_chamaeropis_CBS_186.71 Pestalotiopsis_chamaeropis_CBS_237.38 'Pestalotiopsis clavata MFLUCC 12-0268' Pestalotiopsis_colombiensis_CBS_118553 Pestalotiopsis_diploclisiae_CBS_115449 Pestalotiopsis_diploclisiae_CBS_115587 Pestalotiopsis_diploclisiaeCBS_115585 'Pestalotiopsis diversiseta MFLUCC 12-0287' Pestalotiopsis_ericacearum_IFRDCC_2439 'Pestalotiopsis furcata MFLUCC 12-0054' 'Pestalotiopsis gaultheria IFRD 411-014' Pestalotiopsis_grevilleae_CBS_114127 Pestalotiopsis_hawaiiensis_CBS_114491 Pestalotiopsis_hollandica_CBS_265.33 Pestalotiopsis_humus_CBS_115450 Pestalotiopsis_humus_CBS_336.97 'Pestalotiopsis inflexa MFLUCC 12-0270' 'Pestalotiopsis intermedia MFLUCC 12-0259' Pestalotiopsis_jesteri_CBS_109350 Pestalotiopsis_kenyana_CBS_442.67 Pestalotiopsis_kenyana_CBS_911.96 Pestalotiopsis_knightiae_CBS_111963 Pestalotiopsis_knightiae_CBS_114138 'Pestalotiopsis linearis MFLUCC 12-0271' Pestalotiopsis_malayana_CBS_102220 Pestalotiopsis_monochaeta_CBS_144.97 Pestalotiopsis_monochaeta_CBS_440.83 'Pestalotiopsis novae-hollandiae CBS 130973' Pestalotiopsis_oryzae_CBS_111522 Pestalotiopsis_oryzae_CBS_171.26 Pestalotiopsis_oryzae_CBS_353.69 Pestalotiopsis_papuana_CBS_331.96 Pestalotiopsis_papuana_CBS_887.96 Pestalotiopsis_parva_CBS_265.37 Pestalotiopsis_parva_CBS_278.35 Pestalotiopsis_portugalica_CBS_393.48 Pestalotiopsis_rhododendri_IFRDCC_2399 'Pestalotiopsis rosea MFLUCC 12-0258' Pestalotiopsis_scoparia_CBS_176.25 Pestalotiopsis_sp._CBS_263.33 Pestalotiopsis_sp._CBS_264.33 Pestalotiopsis_spathulata_CBS_356.86 Pestalotiopsis_telopeae_CBS_113606 Pestalotiopsis_telopeae_CBS_114137 Pestalotiopsis_telopeae_CBS_114161 Pestalotiopsis_trachicarpicola_IFRDCC_2403 Pestalotiopsis_trachicarpicola_IFRDCC_2440 'Pestalotiopsis trachicarpicola MFLUCC 12-0263' 'Pestalotiopsis trachicarpicola MFLUCC 12-0264' 'Pestalotiopsis trachicarpicola MFLUCC 12-0265' 'Pestalotiopsis trachicarpicola MFLUCC 12-0266' 'Pestalotiopsis trachicarpicola MFLUCC 12-0267' 'Pestalotiopsis unicolor MFLUCC 12-0275' 'Pestalotiopsis unicolor MFLUCC 12-0276' 'Pestalotiopsis verruculosa MFLUCC 12-0274' ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=59; TAXLABELS Neopestalotiopsis_aotearoa_CBS_367.54 'Neopestalotiopsis asiatica MFLUCC 12-0286' Neopestalotiopsis_australis_CBS_114159 'Neopestalotiopsis chrysea MFLUCC 12-0261' 'Neopestalotiopsis chrysea MFLUCC 12-0262' Neopestalotiopsis_clavispora_CBS_447.73 'Neopestalotiopsis clavispora MFLUCC 12-0280' 'Neopestalotiopsis clavispora MFLUCC 12-0281' Neopestalotiopsis_cubana_CBS_600.96 Neopestalotiopsis_ellipsospora_CBS_115113 'Neopestalotiopsis ellipsospora MFLUCC 12-0283' 'Neopestalotiopsis ellipsospora MFLUCC 12-0284' Neopestalotiopsis_eucalypticola_CBS_264.37 Neopestalotiopsis_foedans_CGMCC_3.9123 Neopestalotiopsis_foedans_CGMCC_3.9178 Neopestalotiopsis_foedans_CGMCC_3.9202 Neopestalotiopsis_formicarum_CBS_115.83 Neopestalotiopsis_formicarum_CBS_362.72 Neopestalotiopsis_honoluluana_CBS_111535 Neopestalotiopsis_honoluluana_CBS_114495 Neopestalotiopsis_javaensis_CBS_257.31 'Neopestalotiopsis magna MFLUCC 12-652' Neopestalotiopsis_mesopotamica_CBS_299.74 Neopestalotiopsis_mesopotamica_CBS_336.86 Neopestalotiopsis_mesopotamica_CBS_464.69 Neopestalotiopsis_natalensis_CBS_138.41 Neopestalotiopsis_piceana_CBS_225.30 Neopestalotiopsis_piceana_CBS_254.32 Neopestalotiopsis_piceana_CBS_394.48 Neopestalotiopsis_protearum_CBS_114178 Neopestalotiopsis_rosae_CBS_101057 Neopestalotiopsis_rosae_CBS_124745 Neopestalotiopsis_samarangensis_CBS_115451 'Neopestalotiopsis samarangensis MFLUCC 12-0233' Neopestalotiopsis_saprophytica_CBS_115452 'Neopestalotiopsis saprophytica MFLUCC 12-0282' Neopestalotiopsis_sp._CBS_110.20 Neopestalotiopsis_sp._CBS_119.75 Neopestalotiopsis_sp._CBS_164.42 Neopestalotiopsis_sp._CBS_177.25 Neopestalotiopsis_sp._CBS_233.79 Neopestalotiopsis_sp._CBS_266.37 Neopestalotiopsis_sp._CBS_266.80 Neopestalotiopsis_sp._CBS_274.29 Neopestalotiopsis_sp._CBS_322.76 Neopestalotiopsis_sp._CBS_323.76 Neopestalotiopsis_sp._CBS_360.61 Neopestalotiopsis_sp._CBS_361.61 Neopestalotiopsis_sp._CBS_664.94 Neopestalotiopsis_steyaertii_IMI_192475 Neopestalotiopsis_surinamensis_CBS_111494 Neopestalotiopsis_surinamensis_CBS_450.74 'Neopestalotiopsis umbrinospora MFLUCC 12-0285' Neopestalotiopsis_zimbabwana_CBS_111495 Pestalotiopsis_trachicarpicola_OP068 Pseudopestalotiopsis_cocos_CBS_272.29 Pseudopestalotiopsis_indica_CBS_459.78 'Pseudopestalotiopsis theae MFLUCC 12-0055' Pseudopestalotiopsis_theae_SC011 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24630] TITLE Pestalotiopsis; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1519; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Neopestalotiopsis saprophyta MFLUCC 12-0282' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGG-AGTTAT-AGGT----------CTT----------------------CTTA--------------------TAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACT-TCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAA----TTTT-TTT-CTCGCTTTTGTTAGGTGCTATAAC-TCC-CAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAACC--TGTCTG--TCTCGACACGGCCTCAA-TACGACG--TTTTTCG-TGCCTGCACGA-----CAGCCCCGAA---CAGTGAATTAGGTCAAGATAGAGGAC-ATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTT-TCAATTCCTCCTGCTTCCTGTTGAG-CTTGTAGGCTGAC-TCGATGACCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCT--GGCAACAACTGGTTATAATCTAGTGATT-CCCAT------CATCATTTCC-------CTTCACTT-CAGCGTCATCATTT-TCAACCTGCGTGTTGAAAATTA--------TTTTCGCTCCTTCCACACTTTTTTCG--CTGGTTACCCCGCCGCGAGGCCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACCTTGCACAA---------GCAACCATGCATTGCTCATGAGCCCACTTTGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCGTGTGCTGCATGAGACACC-TGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_adusta_ICMP_6088 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CAACTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCA-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGCTT-CCTTGGCTACTTGCTTTCCCACGGA-CTTGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATGCTCACA-T-CCCATCATCCTCATC-----------ATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTTCCAG--ACACTTATCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATCTCACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCATAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis adusta MFLUCC 10-0146' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CAACTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCA-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGCTT-CCTTGGCTACTTGCTTTCCCACGGA-CTTGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACA-T-CCCATCATCCTCATC-----------ATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTTCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATCTCACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCATAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_anacardiacearum_IFRDCC_2397 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCAATTGTTGCCTCGGCAGA-GGCTACCCGGT---ACCTTACCTTGGTGCGGCCTACCCTGTAGCGCCTTACCCTGGAACGGGCTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA---TTTTT-TTT-CTCGCTTTTGACTGGAGTTGCAGCGTCCTTAGCCGCTAAACCCCCCAA--TTTTTAATGG-TGACCTCG-ATCAGGTGGTGCTGCTTTCTGGTATGTACCC-CCATCGA--CCTCGACAC-GCCCCGA-CACGACG--CCTCCCG-CAACTCGACAACGCGGCGTTCTCAAC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCAGTCTTTGATAGGCAAACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTCCTTGCTTTCCCATGAG-CATGTTGACTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCCCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCT--GGCAACAACTGGTAGTCATCCTCACAAT-CCCAT------CAGC--------ACATTCATGGCCT-CCCATCGAAGATCT-CCGACCCG-ATGTCGAAAAT-A--TTTTCGTTTTTCGCACCTTCCCACATTTTC----CCACTTACCCCGCCGCATGGCCGCACGACCCCGCGGTGCAAACG-AAAAAATTCTTATC----AGCCCCACCTCGCACAAACA-TTTTGGCAGCCACGCACTTT-CATGA-CCCATGATGAGCCATTGCTGACCCCGCCAAACAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACAACTCTCATGCATCCGAACTC-AGACTAACATGACAATACAGACGCTCCCGGTCACCGTGACTTCATCAAGA Pestalotiopsis_arceuthobii_CBS_434.65 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACT-ATTGTTGCCTCGGCAGA-GGCTACCCGGT---ACC-TACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCGGGAACGGATTACCCTGTAGCGGCTGCCGGTGGACCACTAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TTT-CTCGCTTTTGACTGGAGTTGCAGCGTCCTTTGCCGCTAAACCCCCAAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCCTCCACCTA--CCTCGACAC-GGCTCAG-CACGACG--CCTCCCGCCAACTCTACAA--CGACCTTCTCAAC---TATTTGGTTGGAACCCAGCGAAAGAC-TTGATACTGACCGGTCTTCGATAGGCAAACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCCTT-CCTTGGCTACTTGCTTTCCCACGAA-CATGTTGGCTAACACACGAGCTTGTCCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTTGGTC-AGTCC-GGTGCT--GGAAACAACT??TAGTCATCCTCCTGAT-CCCCTCAT---CATC--------GTCATCACCACTTTCCCCTCCAACATCT-TCAA-CCG-G-GTCGAAAATCTA-TTTTTTCTATCCGCACCTGGGCATATTCT--G--GCACTTACCCCGCCGCGTGGCCGCACGACCCCGCGGTGCCAACG-AAAAATTTCTTATC--ACAGCCCCACCTCGCACAAACA-TTTTGGCCGCTATGC-CTTTTCAATA-CCCACTTTGAGCACTTGCTGACACCGCCAAACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCACGTCCACATCAAGCGTCATGCACCCGTTCAC-AGACTAACATGGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_arengae_CBS_331.92 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCCTGTAGCGTCTTACCCGGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGACCTACCCTGTAGCGGCTGCCGGTGGACTACTCAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGACCTGCGATATCCTCTGAGCGTAGTAA----TTCT-TTT-CTCGCTTTTGACTGGAGTTGCAGCGTCCTTGGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTACCC--TATATA--TCTCGACAC-GCCTCAT-TACGACG--CCTCCCG-CAACCCGACCACGCGACATTCTCAAC---TACTCGGTTGGAATCACACGAAAGACTTTGATACTGACCCGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTGCTTGCT-----ACGAA-CATGTTAGCTGACACTCGTGATTGTTCAGCTACAACGGTACCTCTGAGCTCCAGCTGGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGGGTTAGTCATCACGAT-CCCAT------CTTC--------ATCTTCATCAGCG---CCTCAAACAATT-CCCTCTTG-GTGCCGAAAATCA-------TTTTTTCGCACCTTCCCACGTTCTCTG--ACACTTACCCCGCCGCGTGGCCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACCT--CACAAACA-TTTTGGCAGCCACGCACTGT-CATGA-CCCACCATGAACCTATACTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCTACAACATGTATCATGCCTTCGACCTC-AGACTAACATGGTAATACAGACGCTCCCGGTCACCGTGACTTCATCAAGA Pestalotiopsis_australasiae_CBS_114126 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGGCAA--CGACATTCTCAAA---TGCTTGTTTGGAACCATACGAAAGAC-TTGATACTGACCGGCCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTACTCGCTTTCCCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTGCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAATCCCCATCATCCTCATC--------CTCATTATCACCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGCATCCCTGTCCACAACATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_australasiae_CBS_114141 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGGCAA--CGACATTCTCAAA---TGCTTGTTTGGAACCATACGAAAGAC-TTGATACTGACCGGCCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTACTCGCTTTCCCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTGCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAATCCCCATCATCCTCATC--------CTCATTATCACCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATCGGTTAGTATCCCTGTCCACAACATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_australis_CBS_111503 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----ATTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA-TTTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAATTCGACAA--CGACGTTCTCAACGACTGCTTGATTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTGCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGG????????????CAAT-CCCATCATTCCCATC----------C-TCATCATCG-CCTCGCACACAT---TCCAACCG-GTGCCGAAAATTTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCATGCACTTTCCAGGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTAACCCTGTCCATGCGATGTACCATGCGTCTGAATGT-ATGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_australis_CBS_114193 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----ATTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA-TTTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAATTCGACAA--CGACGTTCTCAACGACTGCTTGATTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTGCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGGGTTAGTCCTCACAAT-CCCATCATTCCCATC----------C-TCATCATCG-CCTCGCACACAT---TCCAACCG-GTGCCGAAAATTTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCATGCACTTTCCAGGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTAACCCTGTCCATGCGATGTACCATGCGTCTGAATGT-ATGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_australis_CBS_114474 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----ATTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA-TTTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAATTCGACAA--CGACGTTCTCAACGACTGCTTGATTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTGCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GG??????????????????GGTTAGTCCTCACAAT-CCCATCATTCCCATC----------C-TCATCATCG-CCTCGCACACAT---TCCAACCG-GTGCCGAAAATTTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCATGCACTTTCCAGGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTAACCCTGTCCATGCGATGTACCATGCGTCTGAATGT-ATGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_australis_CBS_119350 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGCAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----ATTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA-TTTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACGACTGCTTGATTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTGCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAAC???GGTTAGTCCTCACAAT-CCCATCATTCCCATC----------C-TCATCATCG-CCTCGCACACAT---TCCAACCG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAAATTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCATGCACTTTCCAGGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTAACCCTGTCCATGCGATGTACCATGCGTCTGAATGT-ATGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_biciliata_CBS_124463 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTA-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCGA-TACGACA--CCCCCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGTTTGGAACCATACGAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTACTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTTTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCCCATC--------CTCATCAACATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTCCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--GCAGCCCCACATCACA-AAACG-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGTGTCATGTCACCGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_biciliata_CBS_236.38 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTA-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCGA-TACGACA--CCCCCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGTTTGGAACCATACGAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTACTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTTTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCCCATC--------CTCATCAACATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTCCGCACCTTCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--GCAGCCCCACAT--CACAAACG-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGTGTCATGTCACCGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_biciliata_CBS_790.68 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCGA-TACGACA--CCCCCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGTTTGGAACCATACGAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTACTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTTTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCCCATC--------CTCATCAACATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTCCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--GCAGCCCCACAT--CACAAACG-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGTGTCATGTCACCGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_brassicae_CBS_170.26 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACC-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAAATTTTTTAATGGTTGACCTCGGATCAGGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATCCACACAAT-CCCATCATTCCCACCATTCCCATCTTATCATCATCG---CCTCAAACATCT-TCCAACCG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACACCATGTATCATGCATCCGACCTT-GTGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGACTTCATCAAGA Pestalotiopsis_camelliae_CBS_443.62 CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCCGGT---ACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTTATGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGTTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TTTCCTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCT--CATCTA--CCTCGACGC-GCCTCAG-CACGACG--CCTCTCG-CAACTCGACAA--CGACGTTATCAAC---TACTTGGTTGAAACCAAGCGAAAGAC-TTGATACTGACAGGCCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGTAC-CCTTGGCTACCTGC-TTCCCACGAA-CATGTCAGCTAACACTCGTGGT---TCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACT??TAGTTATCCTCACAAT-TCCATCATCCTC--------------ACTATCATTA-CCTCGCAAATACTT-CCAAACCG-GTGTCGAAAATATGTGCTTCTTTTTTCGCGCCTGCCCACATCCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGTCAGCCATGCACTTTTCATAA-CCCAC-ACGAGCATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATCCATCATGCATCCGAAATC-AGACTAACACGGCACCACAGATGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis camelliae MFLUCC 12-0277' CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCCGGT---ACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTTATGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGTTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TTTCCTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA---TTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCT--CATCTA--CCTCGACGC-GCCTCAG-CACGACG--CCTCTCG-CAACTCGACAA--CGACGTTATCAAC---TACTTGGTTGAAACCAAGCGAAAGAC-TTGATACTGACAGGCCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGTAC-CCTTGGCTACCTGC-TTCCCACGAA-CATGTCAGCTAACACTCGTGGT---TCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCACAAT-TCCATCATCCTC--------------ACTATCATTA-CCTCGCAAATACTT-CCAAACCG-GTGTCGAAAATATGTGCTTCTTTTTTCGCGCCTGCCCACATCCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACACCGCACAAACA-TTTTGGCAGCCATGCACTTTTCATAA-CCCAC-ACGAGCATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCAC---ATCCATCATGCATCCGAAATC-AGACTAACACGGCACCACAGATGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis camelliae MFLUCC 12-0278' CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCCGGT---ACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTTATGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGTTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TTTCCTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA---TTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCT--CATCTA--CCTCGACGC-GCCTCAG-CACGACG--CCTCTCG-CAACTCGACAA--CGACGTTATCAAC---TACTTGGTTGAAACCAAGCGAAAGAC-TTGATACTGACAGGCCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGTAC-CCTTGGCTACCTGC-TTCCCACGAA-CATGTCAGCTAACACTCGTGGT---TCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCACAAT-TCCATCATCCTC--------------ACTATCATTA-CCTCGCAAATACTT-CCAAACCG-GTGTCGAAAATATGTGCTTCTTTTTTCGCGCCTGCCCACATCCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACACCGCACAAACA-TTTTGGCAGCCATGCACTTTTCATAA-CCCAC-ACGAGCATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCAC---ATCCATCATGCATCCGAAATC-AGACTAACACGGCACCACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_chamaeropis_CBS_113604 CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAAGTGCTTGCTTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCA-AAT-CCCATCATTCCCATC--------CTCATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAGAATCTG--------TTTTCGCATCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAAATTCTCATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACACGATGTACTATGCATCTGAATGT-ATACTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_chamaeropis_CBS_113607 CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAAGTGCTTGCTTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCA-AAT-CCCATCATTCCCATC--------CTCATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAGAATCTG--------TTTTCGCATCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAAATTCTCATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACACGATGTACTATGCATCTGAATGT-ATACTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_chamaeropis_CBS_186.71 CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAAGTGCTTGCTTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCA-AAT-CCCATCATTCCCATC--------CTCATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAGAATCTG--------TTTTCGCATCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAAATTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACACGATGTACTATGCATCTGAATGT-ATACTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_chamaeropis_CBS_237.38 CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAAGTGCTTGCTTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCA-AAT-CCCATCATTCCCATC--------CTCATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAGAATCTG--------TTTTCGCATCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAAATTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACACGATGTACTATGCATCTGAATGT-ATACTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis clavata MFLUCC 12-0268' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCCTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTACGTAGTC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCTCCG-CAACTCGACAA--CGACCTTCTCAACAACTGCTTGGTTGGAACCAAAGAAAAGAC-CTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAATACCCGTGATTGTTCAGCTACAACGGTACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTTGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATTCTCACAAT-CCCATCATTCCCATC--------CTCATCATCATCA-CCTCGCAAACATTT-TCCAACTG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGTCATGCACTTTCCAAGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACACGATGTACCATGCATCCGACCTT-GTACTAACATGGCAATCCAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_colombiensis_CBS_118553 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTA-TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACTAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CTTCGGCAC-GCCTCAA-TACGACA--CCCTCCG-CAACTCGACGA--CGACATTCTCGGC---TACTTGGTTGGAACCGAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCATTT-CCTTGCCTACTTGCTTTCCCACGAA-CATGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCGTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACAGT-CCCATCATCCTCATC-----------ATAATCATCG-ACTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAGTGAACAATTGCTAACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTTCACAGAATGTACCATGTCTCCGAACTC-AGACTAACATCACAACACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_diploclisiae_CBS_115449 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGTC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCG-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACAGT-CCCATCATCCTCATC-----------ACCATCATCG-CCTCGCAAACATTT-TCCAACCG-TTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACAATTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCGATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_diploclisiae_CBS_115587 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGTC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCG-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACAGT-CCCATCATCCTCATC-----------ACCATCATCG-CCTCGCAAACATTT-TCCAACCG-TTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACAATTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCGATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_diploclisiaeCBS_115585 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGTC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCG-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACAGT-CCCATCATCCTCATC-----------ACCATCATCG-CCTCGCAAACATTT-TCCAACCG-TTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACAATTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCGATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis diversiseta MFLUCC 12-0287' CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-GGCTACCCGGTA-CACCTTACCCTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACTAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGTCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TTT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAA-CCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGATAC-GCCTCAA-TACGACG--CCTCCCG-CAACTCAACAA--CGACGTTCTCAAC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCCGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGAGTGTACGTATCCGTT-CCTTGGCTACTTGCTTTCCCACGAA-CATGCTAGCTGACATCCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCACAAT-CCCATCAT---CATC--------TTCATCACCATCA-CCTCGCACACATTT-TCAACTCA-GTGCCGAAAATCAG---------TTTCGCACCTGCCCACATTCCCAG--ACACTTACCCCGCCGCGTGGCCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC----AGCCCCACATCACACAAACA-TTTTGGCGGCCATGCACTTTTCGTAA-CCCACAATGAGCAATTGCTGACCCTGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTATCCCTGCCCACAAGCTCTCTCATGGATCCGAACTC-ATACTAACATCGCAATATAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_ericacearum_IFRDCC_2439 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-GGCTACCCGGT---ACC-TACCCTGGAACGGCCTACCCTGTAGCGCCTTACCCGGGAACGGGCTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGGTATCCTCTGAGCGTAGTAA----TTTT-TTT-CTCGCTTTTGACTGGAATTGCAGCGTCCTTAGCCGCTAAATCCCCCAA--TTTCTAATGGTTGACCTCGGATCAGG-GGTGCTGCTTTCTGGTATGTAGCC--TATCTA--CCTCGACAC-GCCTCAA-CACGACG--CCTCCCG-CAACTCGACAA--CGACGTTCTCAAC---TATCTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCCGTCTTTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCC-TT-CCTTGGCTACCTACTTT---TCGA-------TGGCTAATACTC---GTCGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTGGTTATCCTCAAAAT-CCCATCAT---CATG--------CCCATCATCGCC--TCCCTCAAATATTT-TCAACTCG-GTGCCGAGAACCA--------TTATTCGCACCTGCCCACATTCTCTGACACACTTACCCCGCCGCG--------CGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACCTCGCACAAACA-TTTTCGCAGCCATGCA-TCTCCATGAT-CCACAATGAGCAACTGCTGACCCCGCCAAACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTCTACCCGTCCACAAGAAGGATCATTCATCCGACATC-ATACTAACATGGCAATACAGACGCTCCCGGTCACCGTGACTTCATCAAGA 'Pestalotiopsis furcata MFLUCC 12-0054' CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCCGGT---ACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTTATGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGTTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TTTCCTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGTT--CATCTA--CCTCGACGC-GCCTCAG-CACGACG--CCTCTCG-CAACTCGACAA--CGACGTTATCAAC---TACTTGGTT-AAACCAAACGAAAGAC-TTGATACTGACAGGCCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTC-CCTTGGCTACCTGC-TTCCCACGAAACATGTCAGCTAACACTCGTGGT---TCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCACAAT-CCCATCATCCTC--------------ACCATCATTG-CCTCGCAAACATTT-CCAAACCG-GCGTCGAAAATCTG-GTGTGTTTTTTCGCGCCTGCCCACATTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTCTGGCAGCCATGAACTTTACATAA-CCCAT-ACGAGCATCTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATCCGACATGCATCCAAAATC-AGACTAACACGGCACCACAGATGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis gaultheria IFRD 411-014' CATTATAGAGTTT--TAAAC-TCCCAACCCATGTGAACTTACC-ACTGTTGCCTCGGCAGA-GGCTACCCGGTA-CACCCTACCCTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTGC-AGCCTTTACTGGCTGCAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAATTTTTTTTTTTTTCTCGCTTTTGACTGGAGTTGCACCGTCTTTACCCCCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGG-GGTGCTGCTTTCTGGTATGTAGCC--TATCTA--CCTCGACAC-GCCTCAA-TATGATG--CCTCCCG-CAACTCGACGC--CGACGTTCTCAAA---TACTTGGTTGGATCCAAACGGAAGAC-TTGATACTGACCC-TCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTGCCCTTT-CCTTGGCTACCTGCTTTCCCACGAA-CATGCTAGCTAACCCTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTTCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGCCCAGTCCCGGTCCCCGGGAAACAACTGGTAGTCATCCTCAAAAT-CCCAT------CATC-----------ATCACCATCA-CCTGGCACGCATTT-CCAACGCG-GTGCCGAAAATCAG--------TTTTCGCACTTGCCCATATTCCCAG--ACACTTACCCCGCCGCGTGGCCGCACGACCCCGCGATGCAAACG-AAAAATTTCTTATC----AGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTTCATAAT-CCACAATGAGCAATTGCTGACCCCGTCAAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTATCCCTGTCCACTAGCTGTTGCATGCATCCGAACTC-AGACTAATATGGCAATATAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_grevilleae_CBS_114127 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCGA-TACGACA-CCCCCCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGTTTGGAATCATACGAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCTCGTGAA-CATGTCAGCTAACACTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTATTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATACTCGCAAT-CCCATCATCCCCATG--------CTCATCATCATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGTATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAACATGCATCATGTCTCCGAACTCAAGACTAATCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_hawaiiensis_CBS_114491 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCAATTGTTGCCTCGGCAGA-GGCTACCCGGT---ACCTTACCTTGGTACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGGCTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTACTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TTT-CTCGCTTTTGACTGGAGTTGCAGCGTCCTTTGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTACCC-CCATCGA--CCTCGACAC-GCCCCGA-CACGACG--CCTCCCG-CAGCTCGACAACGCGGCGTTCTCAAC---TACTTGGTTGAGACCAAACGAAAGAC-TTGATACTGACCAGTCTTTGATAGGCAAACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTCCTTGCTTTCCCATGAG-CATGTTGACTAACACTCGTGGTCGTTCAGCTACAACGGTACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTC??????????????????????????????GTAGTCATCCTCACAAT-CCCAT------CATC--------ACATCCGCGGCTT-CCACTCGAACATTT-CCCACCCG-ACGCCGAAAAT-A--TTTTCGC-TTGCGCATCTTCCCACATTCTC----CCACTTACCCCGCCGCGTGGCCGCACGACCCCGCGGTGCAAACGAAAAAATTTCTTATC----GGCCCCACCTCGCATAAACA-TTTTGGCAGCCACTCACTTC-CATGA-CCCACGATGAGCCATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACAAGTCTCATGCATCCGAACTC-AGACTAACATGGCAATACAGACGCTCCCGGTCACCGTGACTTCATCAAGA Pestalotiopsis_hollandica_CBS_265.33 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACC-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAAATTTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACAACCCCCCCGGCAACTCGACAA--CGACGTTCTCAACAACTGCTTGGTTGGAAACAAAGGAAAGAC-TTGATACTGACCGGTCCTTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCACACAAT-CCCATCATTCCCACCATTCCCATCTTATCATCATCG-CCT--CAAACATCT-TCCAACCG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACACCATGTATCATGCATCCGACCTT-GTGCTAACATGGCAACACAGATGCTCCC?????????????????????? Pestalotiopsis_humus_CBS_115450 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGCG-CGCCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGTC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCG-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACAGT-CCCATCATCCTCATC-----------ATCATCATTG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCATCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACTTCACAT-AACA-TTTTGGCAGCCACGCAATTTGCATGAT-CCACAATGAACGATTGCTGACCCCACCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAGAAAGTACCATGTGTCCGAACTC-AGACTAACATCGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAA?? Pestalotiopsis_humus_CBS_336.97 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGCG-CGCCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGTC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCG-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAGCCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACAGT-CCCATCATCCTCATC-----------ACCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACAATTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACTTCACAC-AACA-TTTTGGCGGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis inflexa MFLUCC 12-0270' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTA-TTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGCGTTGGGAGCCTACT-GCTTTTATTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CACC-A--CCTCGACAC-GGCTCAG-CACGACG--CCTCCCG-CAACTCCACGA--CGACGTTTTCAAC---TACTTGGTTGAAACCAAACGAAAGAC-TCGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATGTCAGCTAACACTCGTGCTTGCTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGTAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCACAAT-CCCATCATCCCCATC--------TTCATCATCATCA-CCTGGCAAATACTTTTCCCAACG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCACTTTCCCAG--ACACGTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAAATTCTTATC--ACAGCCCCACATCGCACAACCA-TTTTGGCAGCCATGCACTTTTCATGATCCCACAACGACCATTCGCTGACCCCGCCAAACAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACCAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGCATCATGCATCCGAACTC-ATACTAACATGGCAATACAGATGCTCCCGGTCACCGTGACTTCATCAAGA 'Pestalotiopsis intermedia MFLUCC 12-0259' CATTATAGAGTTTTTT-AAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTTACC--TGTCTG--CCTCGACACGGCCTTAATGACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAAGTGCTTGGTTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAACACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTAGCTACTTGCTTTCCCACGAA-CATCTTAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCATCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCA-AAT-CCCATCATTCCCATC--------CTCATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAGAATCTG--------TTTTCGCATCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATTCCTGTCCACACGATGTACTATGCATCTGAATGT-ATACTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_jesteri_CBS_109350 CATTATAGAGTTTTTCAAAC-TCCCAACCCATGTGAACTTACC-ACTGTTGCCTCGGCAGA-GGCTACCCGGT---ACC-TACCTCGGAACGGCCTACCCTGTAGCGCCTTACCTGGGAGCGG-TTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACTAGCCCTCGCGGCCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TCTTACCT-CTCGCTTTTGTCAGGATTCCCAGCATC--TAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTACGTACCC--CGACTG--CCTCGACAC-GCCTCAT-CACGACG--CCTCTGA-GTACCCTACGA--CGA----TTCGAA---CAACTAGTGGCAGCAACATGGGAGGC-ATGATACTGACTGATCTTTGACAGGCAAACTATCTCTGGTGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCATTTCCCTTGGCCACTCGCTTTCTGAAGAA-CATGCAAGCTAAATTTCGTGGTCGATTAGTTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCTGGTCCCTTCGGTCAGCTCTTCCGCCCTGACAACTTTGTTTTCGGTC-AATCC-GGTGCT--GGCAACAACTGG?????ATCCTCACGAT-CCCGTCATT--TTG-------TTTCCATCACTCT-G-CCCA--AATCATTT--CGT---G--TGTCGA--------TTTTTTTTTTTCGCACCTGCCCACATTCTCTG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACGCAAAAATTTCTTATC--ACAGCCCCACCCCATTTCAAAA-A------AGCCATGCATTCCTCTGGA-CCCAGAATGAGCATTCGCTGACCCCGCCTAATAGGAAGCTGCCGAGCTCGTAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGTGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCTTTGGTTAGTATCCCCACCCAAATGTAGCGCCCAACACGCGACCGT-CGACTAACATTGCACTACAAATGCTCCCGGTCACCGTGACTTCATCAAGA Pestalotiopsis_kenyana_CBS_442.67 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_kenyana_CBS_911.96 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAAATACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_knightiae_CBS_111963 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTA-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCGA-TACGACA-CCCCCCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGTTTGGAATCATACGAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCTCGTGAA-CATGTCAGCTAACACTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTATTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCGTCATC--------CTCATCATCATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAC--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ATAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCAAGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGCATCATGTCTTTGAACTCAAGACTAACCTTGCACTACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_knightiae_CBS_114138 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTA-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCGA-TACGACA-CCCCCCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGTTTGGAATCATACGAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCTCGTGAA-CATGTCAGCTAACACTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTATTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCGTCATC--------CTCATCATCATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAC--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ATAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCAAGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGCATCATGTCTTTGAACTCAAGACTAACCTTGCACTACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis linearis MFLUCC 12-0271' CATTATAGAGTTTTTTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAACC--TGTCTGTCTCTCGACACCGCCTCA--TACGACA-ACGAC--G----TTCTA-----CGACGTTCTCAACAAGTGCTTGGTTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAACACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTAGCTACTTG-TTTCCCACGAA-CATCTTAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCA-AAT-CCCATCATTCCCATC--------CTCATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAGAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACACGATGTACCATGCATCTGAATGT-ATACTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_malayana_CBS_102220 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACTAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CAACTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCA-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGCTT-CCTTGGCTACTTGCTTTCCCACGGA-CTTGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACAGT-CCCATCATCCTCATC-----------ACCATCATCG-CCTCGCAAACATTT-TCCAACCG-TTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACAATTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCGTGTCCACAGAAAGTATCATGTGTCCGAACTC-AGACTAACATTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_monochaeta_CBS_144.97 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACC-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAAATTTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAACTGCTTGGTTGGAAACAAAGGAAAGAC-TTGATACTGACCGGTCCTTAATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCACACAAT-CCCATCATTCCCATCATTCCCATCTTATCATCATCG-CCT--CAAACATCT-TCCAACCG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACAGTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACACCATGTATCATGCATCCGACCTT-GTGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGACTTCATCAAGA Pestalotiopsis_monochaeta_CBS_440.83 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACC-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAAATTTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAACTGCTTGGTTGGAAACAAAGGAAAGAC-TTGATACTGACCGGTCCTTAATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCACACAAT-CCCATCATTCCCATCATTCCCATCTTATCATCATCG-CCT--CAAACATCT-TCCAACCG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACAGTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACACCATGTATCATGCATCCGACCTT-GTGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGACTTCATCAAGA 'Pestalotiopsis novae-hollandiae CBS 130973' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCCGGT---ACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TTT-CTCGCTTTTGACTGGAGTTGCAGCGTCCTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATGTA--CCTCGACAC-GCCCCAA-CACGACG--CCACCCG-CAACTCGACAA--CGACGTTCTCAAC----ACTGGGTTGGAACTAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATTTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-TCTTGGCTACTTGC-TTCCCACGAA-CATGTCAGCTAACACTCGTGTTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACA?????TAGTCATCCTCACAAT-CCCATCA---CCATC--------CTCCTTATCACCA-CCTCGCAAACATTT-T-AAATCG-GTGCCGAGAATCTG--------TTTTCGCACCTGCCCACATTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAAAG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGACAGCCATGCACTTTTCATGG-CCCACAATGAGGATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATACCTGTCCACACCATGCATCACGCATCCGAATTC-AGACTAACATGGCAATACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_oryzae_CBS_111522 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAC--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ATAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCACCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAACATGCATCATGTCTCCGAACTCAAGACTAACCTTTCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_oryzae_CBS_171.26 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAC--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ATAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCACCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAACATGCATCATGTCTCCGAACTCAAGACTAACCTTTCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_oryzae_CBS_353.69 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAC--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ATAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCACCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAACATGCATCATGTCTCCGAACTCAAGACTAACCTTTCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_papuana_CBS_331.96 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CAACTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCA-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGCTT-CCTTGGCTGCTTGCTTTCCCACGGA-CTTGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACA-T-CCCATCATCCTCATC-----------ATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTTCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATCTCACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCATAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_papuana_CBS_887.96 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CAACTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCA-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGCTT-CCTTGGCTGCTTGCTTTCCCACGGA-CTTGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACT?GTAGTCATGCTCACA-T-CCCATCATCCTCATC-----------ATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTTCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATCTCACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCATAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_parva_CBS_265.37 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA---CTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGGTTGAAACCATACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTACTCGCTTTCTCGTGAA-CATGTCAGCTAACACTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGC?????????????????????????????????????????????????TAGTCATCCTCGCAAT-CCCATCATCCTCATC---------T--TCATCATCA-CCTCGCAAAGATTT-CCACATCG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--GCAATTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ATAGCCCCACAT--CACAAACA-TTTTGGCAGCCACGCACTCTGCATGA-CCCACAACGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAACATGTGTCATGTCTCCGAACTCAAGACTAACCTTACAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_parva_CBS_278.35 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA---CTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGGTTGAAACCATACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTACTCGCTTTCTCGTGAA-CATGTCAGCTAACACTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC---------T--TCATCATCA-CCTCGCAAAGATTT-CCACATCG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--GCAATTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ATAGCCCCACAT--CACAAACA-TTTTGGCAGCCACGCACTCTGCATGA-CCCACAACGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAACATGTGTCATGTCTCCGAACTCAAGACTAACCTTACAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_portugalica_CBS_393.48 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCCGGT---ACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA---TTTTT-TTT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACG--CCTCCCG-CAGCTCGACCA--CGACGGCCTCAAC---TATTTGGTTGGAACCAAACAAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTG-CCTTCTCCATTTGCCTTCCCACGAA-CATGTTAGCTAACACCCGTGCTTGCTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CTCATCATGCCCACCCCCATC--ATCATCATCACCA-CCTCGCAAACATCT-TCAACTTG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATGTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAAATTCTTATC--ACAGCCCCACATCGCACAAACATTTTTGGCAGCCATGCACTTTTCATGA-CCCACATTGAGCATTTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATTGATCATGCCTCGGAACTC-AGACTAACATGGTAATACAGATGCTCCCGGTCACCGTGACTTCATCAAGA Pestalotiopsis_rhododendri_IFRDCC_2399 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCCTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCTAA--TTTTTAATGGTTGACCTCGGATCAGG-GGTGCTGCTTTCTGGTACGTAGCCA-TATCTA--CCTCGACAC-GCCTCGA-TACGACA-ACCCTCCG-CAACTCGACAA--CGACCTTCTCAACAACTGCTTGGTTGGAACCAAAGAAAAGAC-CTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAATACCCGTGATTGTTCAGCTACAACGGTACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTTGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCACAAT-CCCATCATCCCCATC--------------ATCATCG-TCTCGCAAACATTT-TCCAACTG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCGGCCCACACCATGTACCATGCATCCGACCTT-GTACTAACATCACAATACAGATGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis rosea MFLUCC 12-0258' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTA-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCACCGG-CAACTCGACAA--CGACATTCTCAAC---TGCTTGGTTGAAACCAAAAGAAAGAC-CTGATACTGACCGGTCTTTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTACTCGTTTTTCCACGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGTAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGCC-AGTCC-GGTGCC--GGAAACAACTGGTTATAATCCTCGCATT-CCCATCATCCTCATC-------------C-TCATCA-CCTCGCAAACATTT-CCACACTG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCTAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACACCATGCATCATGTCTTCGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_scoparia_CBS_176.25 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGTT-TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTTTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAAGTGCTTGGTTGGAAACAAGGGAAAGAC-TTGACACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTTTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCACAAT-GCCATCATTCCCATC----------C-TCCTCATCG-CCTCGCAAACAT---TCCAACCG-GTGCCGAAAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTCGCAGCCATGCACTTTCCAGGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTCACCCTGTCCATGCGATGTACCATGCATCTGAATGT-ATGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_sp._CBS_263.33 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCGTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CAACTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCA-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGCTT-CCTTGGCTACTTGCTTTCCCACGGA-CTTGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGT???????????????????????TAGTCATGCTCACA-T-CCCATCATCCTCATC-----------ATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTTCCAG--ACACTTACCCCG--------CCGCACGA--CCGCGGTGCAAACG-AAAAATTTCTTATCTCACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCATAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_sp._CBS_264.33 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGCAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATGGTTATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCGTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CAACTA--CCTCGACAC-GCCTCAA-TACGACA--CCCTCCA-CAACTCGACGA--CGGCATTCTCGGC---TACTTGGTTGGAACCAAACGAAAGAC-TTGATACTGACCGGTCTCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCGCTT-CCTTGGCTACTTGCTTTCCCACGGA-CTTGTTAGCTAACACTCGTGCTTGCTCAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCTGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCCGGTCCTTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATGCTCACA-T-CCCATCATCCTCATC-----------ATCATCATCG-CCTCGCAAACATTT-TCCAACCG-GTGCCGAAATTCTG--------TTTTCGCACCTGCCCATTTTTCCAG--ACACTTACCCCG--------CCGCACGA--CCGCGGTGCAAACG-AAAAATTTCTTATCTCACAGCCCCACTTCACAC-AACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCATAGAAAGTATCATGTGTCCGAACTC-AGACTAACATCGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_spathulata_CBS_356.86 CATTATAGAGTTTTCTAAACTTCCCAACCCATGTGAACTTACC-ACTGTTGCCTCGGCAGAAGGCTACCCGGTA-TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAGCGGCTGCCGGTGGACTACTAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACG-GCTTTTACTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA---TTTTT-TTT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--TATCTA--CCTCGACAC-GCCTCAA-TACGACG--CCCCCCG-CAACTCGACGC--CGACGTTCTCAAC---TACTTGGTTGGATCCAAACGGAAGAC-TTGATACTGACCG---TCTCATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTGCCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATACTAGCTAACCCTCGTGGTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCTGGCAACAAGTACGTTCCTCGTGCCGTCCTTGTCGATCTCGAGCCCGGAACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGCC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCACGAT-CCCAACAT---CATC--------ACCATCACTATCA-CCTTGCACACATTT-TCAACTCG-GTGCCGAAAATCAG--------TTTTCGCGCTTGCCCACATTCCCAG--ACACTTACCCCGCCGCGTGGCCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC----AGCCCCACATCGCACAAATA-TTTTGACAGCCATGCACTTTTCACAAT-CCACAATGAGCAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGCGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTATCCCTGTCCACCAGCTGTTTCATGCATCCGAACTC-GCACTAACATGGCAATATAGATGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_telopeae_CBS_113606 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA-CCCCCCGG-CAACTCGACAA--CGACATTCTTAAC---TGCTTGTTTGGAACCATACAAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCCTTT-CCCTGGCTATTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAATCCCCATCATCCTCATC--------CTCATTATCACCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_telopeae_CBS_114137 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA-CCCCCCGG-CAACTCGACAA--CGACATTCTTAAC---TGCTTGTTTGGAACCATACAAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCCTTT-CCCTGGCTATTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCTTCT-CGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAATCCCCATCATCCTCATC--------CTCATTATCACCA-CCTCGCAAACATTTCCACACCGG--TGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_telopeae_CBS_114161 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCCTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA-CCCCCCGG-CAACTCGACAA--CGACATTCTTAAC---TGCTTGTTTGGAACCATACAAAAGAC-TTGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCCTTT-CCCTGGCTATTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGG?????????????????????????????TAGTCATCCTCGCAATCCCCATCATCCTCATC--------CTCATTATCACCA-CCTCGCAAACATTT-CCACACCG-GTGCCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACTTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGTCCACAACATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_trachicarpicola_IFRDCC_2403 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGCTGACCTCGGATCAGG-GGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTCACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pestalotiopsis_trachicarpicola_IFRDCC_2440 CATTATGGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTTATGATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis trachicarpicola MFLUCC 12-0263' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAAATACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis trachicarpicola MFLUCC 12-0264' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGC---CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis trachicarpicola MFLUCC 12-0265' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis trachicarpicola MFLUCC 12-0266' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis trachicarpicola MFLUCC 12-0267' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTGCTCGGTG-CACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAA---TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACGC-GCCTCAA-TACGACA--CCCCCGG-CAACTCGACCA--CGATAATCTCAAC---TGCTTGGTTGGAACCATACGAAAGAC-TCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCCTGGCTGTTCGCTTTCTCGTGAA-CATGTCAGCTAACAGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCGCAAT-CCCATCATCCTCATC--------CTCATCATCATCA-CTTCGCAAACATTTCCCACACCG-GTGTCGAAAATCTGG-------TTTTCGCACCTGCCCATTTTCTCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCACACAAACA-TTTTGGCAGCCACGCACCTTGCATGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis unicolor MFLUCC 12-0275' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAA--TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAAGTGCTTGGTTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTTTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGGTAGTCATCCTCACAAT-CCCATCATTCCCATC--------CTCATCATCGTCG-CCTCGCGAACATTTTT-CAACCG-GTGCCGAGAATCTG--------TTTTCGCACCTGCCCATTTTCCCAG--ACACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAAGTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACCTTCCAAGA-CCCAC-ATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTAACCTTGTCCATACGATGTACCATGCAACTGAATGT-ATACTAACACGGCAAAACAGATGCTCCCGGTCACCGTGATTTCATCAAGA 'Pestalotiopsis unicolor MFLUCC 12-0276' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCTTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACT-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAAA-TTTTTAATGGTTGACCTCGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCC--CATCTA--CCTCGACAC-GCCTCAA-TACGACA-ACCCCCCG-CAACTCGACAA--CGACGTTCTCAACAAGTGCTTGGTTGGAAACAAGGGAAAGAC-TTGATACTGACCGGTCCCTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTT-CCTTGGCTACTTGCTTTCCCACGAA-CATCTCAGCTAACACTCGTGGTTTTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTC-AGTCC-GGTGCC--GGAAACAACTGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 'Pestalotiopsis verruculosa MFLUCC 12-0274' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGA-AGCTACCTGGT--TACCCTACCTTGGAACGGCCTACCCTGTAGCGCCTTACCCTGGAACGGCCTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGT-GGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACC-GCTTTTGCTAGCGGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAA----TTTT-TAT-CTCGCTTTTGACTGGAGTTGCAGCGTCTTTAGCCGCTAAACCCCCCAAATTTTTTAATGGTTGACCTCGGATCAGGT???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTATAATCCACACAAT-CCCATCATTCCCATCATTCCCACCTTATCATCATCG---CCTCAAACATCT-TCCAACCG-GTGCCGAAAATCTG--------TTTTCGCGCCTGCCCATTTTCCCAG--GCACTTACCCCG--------CCGCACGACCCCGCGGTGCAAACG-AAAAATTTCTTATC--ACAGCCCCACATCGCACAAACA-TTTTGGCAGCCATGCACTTTCCAAGA-CCCACAATGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATCCCTGCCCACACGATGTATCATGTATCCGACCTT-GTGCTAACATGGCAACACAGATGCTCCCGGTCACCGTGA-TTCATCAAGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24629] TITLE Neopestalotiopsis_and_Pseudopestalotiopsis; LINK TAXA = Taxa3; DIMENSIONS NCHAR=1418; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Neopestalotiopsis_aotearoa_CBS_367.54 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGGAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis asiatica MFLUCC 12-0286' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTTACCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAAATAGGTCAAGATAGAGGGAACATAATACTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTAACTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATCTACTGATTCCCTTCATCATTCTCCTTCACACTTCAT-GCCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCATAAGCAACCATGCATTGCTCAT--GGGATCCACTT--TGAATAATCGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTTATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_australis_CBS_114159 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTACAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACT??TAGTCATCTACTGATTCCCGTCATCATTCTCCTTCAC--TTCAGCGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCAGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCATAAGCAACCATGCATTGCTCAT--GAGATCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis chrysea MFLUCC 12-0261' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCTCGAACAGTGAAATAGGTCAAGATAGAGGGAACATAATACTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTAACTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATCTACTGATTCCCGTCATCATTCTCCTTCAC--TTCAGCGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCATAAGCAACCATGCATTGCTCAT--GAGATCCACCT--TGAACAATCGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACTGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTTATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis chrysea MFLUCC 12-0262' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCTCGAACAGTGAAATAGGTCAAGATAGAGGGAACATAATACTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTAACTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTACTGATTCCCGTCATCATTCTCCTTCAC--TTCAGCGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCATAAGCAACCATGCATTGCTCAT--GAGATCCACCT--TGAACAATCGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACTGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTTATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_clavispora_CBS_447.73 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACT??TAGTCATCTATTGATTCCCATCATCATTTCCCTTCAC--TTCAGTGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTACACAAGCAATCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTCATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis clavispora MFLUCC 12-0280' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TACCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTTCCCTTCAC--TTCAGTGTTATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAATCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis clavispora MFLUCC 12-0281' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TACCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTC-TCGGTCAGTCC-GTGCTGGCAACAACTGGTTATAATCTATTGATTCCCATCATCATTTCCCTTCAC--TTCAGTGTTATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAATCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_cubana_CBS_600.96 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACAGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGT????????????????????TAGTCATCTATTGATTCCCATCATCATTCCCCTTCAC--TCCAGCGTCATGATTTTCAACCTACGCGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTTCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_ellipsospora_CBS_115113 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGACGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCGGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCATCATCATCCTCCTTCAC--TTCAGCATCATAATTTTCAACCTACATGTTGAAAATTA-TTTTCGCTCCTTCCACAT--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTTTGTGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCACTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCCTGCTTCACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis ellipsospora MFLUCC 12-0283' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGATGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATTTATTGATTCCAATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCACGAGGCACCCGCACGACCCCGCGATGCAAACGAAAAATTTCTTATCACAGCCCCACCTTACACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis ellipsospora MFLUCC 12-0284' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGATGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCAATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCACGAGGCACCCGCACGACCCCGCGATGCAAACGAAAAATTTCTTATCACAGCCCCACCTTACACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_eucalypticola_CBS_264.37 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCCCCTTCAC--TTCAGCGTCATGATTTTCAACATACGTGTTGAAAATTA-TTTTCGCTCCTTCCACACTTTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTACTCAT--GAGACCCACTT--TGAACAATTGCTAATTCCTTCATTCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTACCCCTCCACCTATGCCATGTACTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_foedans_CGMCC_3.9123 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-CTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATGTATTGATTCCCATCATC---CCCCTTCAC--TTCAGCATCATAAATTTCAACCTGCGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCAAAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_foedans_CGMCC_3.9178 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATGTATTGATTCCCATCATC---CCCCTTCAC--TTCAGCATCATAAATTTCAACCTGCGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCAAAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_foedans_CGMCC_3.9202 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA-TTTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATGTATTGATTCCCATCATC---CCCCTTCAC--TTCAGCATCATAAATTTCAACCTGCGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCAAAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_formicarum_CBS_115.83 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCCCCTTCTC--TTCAGCGTCATGATTTTCAACCTACGCGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTTCT--CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTTCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACGATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_formicarum_CBS_362.72 CATTATAGAGTTTTCTAAACTTCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCACCTTCTC--TTCAGCGTCATGATTTTCAACCTACGCGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTTCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACGATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_honoluluana_CBS_111535 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAA--TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCATTTTCAATCCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTTCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCTGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCTGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCCCCTTCAC--TTCAGCGTCATGATTTTCAACATGCGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTACTCAT--GAGACCCACTT--TGAACAATTGCTAATTCCTTCATTCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTACCCTTCCACCTATGCCATGTACTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_honoluluana_CBS_114495 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAA--TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCATTTTCAATCCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTTCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCTGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCTGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCCCCTTCAC--TTCAGCGTCATGATTTTCAACATGCGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTACTCAT--GAGACCCACTT--TGAACAATTGCTAATTCCTTCATTCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTACCCTTCCACCTATGCCATGTACTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_javaensis_CBS_257.31 CATTATAGAGTTTTCTAAACTTCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAA????TAGTCATTTATTGATTCCCATCATC---CCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis magna MFLUCC 12-652' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGCTATAGGACTTCTTATAGCTGCTGCCGGTGGACCACTAAACTCTTGTTATTTTA-TGGAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTCTAGGAGTCGTAGTTCCTGAAATACAACGGCGGATTTATAGTGTCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTCAGGTGCTGTAACTCCCAGCCGCTAAA-CCCCTAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTTG-TGCCTTCACGACGGCCCCGAACAGGGAATTAGGTCAAGATACAGGGAACATAATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGCTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTACCGGCAACAAGTATGTTCCTCGTGCCGTCCTCGTTGATCTCGAGCCCGGTACCATGGATGCCGTCCGC???????????????????????????????????????????????????????????????????????????????????????????????????????????????TTCAGGGTCATGATTTTCAACC-ACG--TTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT-TC-CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAATAATTGCTAATGCCTTGATACAGGAAGCTGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCTCTCCACCTATGTCATGTTCTGCACCATAAGACACTTGACTAACCTTGCTTTATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_mesopotamica_CBS_299.74 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACAGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACA?????TAGTCATTTATTGATCCCCGTCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGGTCCATAAGACACTTGACTAACCTTGCTT-ATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_mesopotamica_CBS_336.86 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTCTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACAGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAG?????????????????????TAGTCATTTATTGATTCCCGTCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCGAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTCGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCCTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_mesopotamica_CBS_464.69 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTACAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACAGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGACCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Neopestalotiopsis_natalensis_CBS_138.41 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAGGTTACGGGTTACCCTGTAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATATTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACCTCTCTTCGGAGTCGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAA-TTTTTTCTCGCTTTTGTTAGGTGCTGCAACTCCCAGCCGCTAAA-CCCCCTA--TTTTTTTTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGCCTACCTCGACCCGGCTTCAATACGACATTTTTCG-TGACTTCACGACAGCCTCGAACACTTGGTAGGGTCAAGATAGAGAGAACACGATGCTAATTGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCATTTTAAATTCCTTTTGCTTCTTGTTGAGCTCGTAGGCTGACTTGATCGCCCTTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTTGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCAATCGGTTCCCATCATC--T-CCCTTCAC--TCCAGCGTCATGATTTTCAGCCTACGTGTTGAAGATCAATTTTCGCTCCTTCCACAC--TTTTTTCTCCCGATCGTTACCCCGCCGTGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCCGACATGCATTGCGTAC--GAGACCCACTT--TAAACAACTGCTAATGTCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACTGTCATTGGTTAGTACCTTATCACCTATGCCATGTGCTGCACAATAAGACTCTT-ACTAATAGTACTCCTCAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_piceana_CBS_225.30 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGGAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTGT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_piceana_CBS_254.32 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGGAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTG?TAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTGT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_piceana_CBS_394.48 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGGAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTG?TAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTGT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_protearum_CBS_114178 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTCTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTTACCTGTCTGCCTCGACACGGCCTTACTACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAAAAGTGAAATAGGTCAAGATAGAGGGAACATGATACTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTAACTTCAATTCCTCCTGCTTCCTGTTGAGTTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGG?AGTCATTTATTGATTCCCATCATC---CCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_rosae_CBS_101057 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAAC???TAGTCATTTATTGATTCCCGTCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_rosae_CBS_124745 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCGTCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_samarangensis_CBS_115451 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGACGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis samarangensis MFLUCC 12-0233' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTCCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATTTATTGATTCCCATCATCATCCCCCTTGAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCGCCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_saprophytica_CBS_115452 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACAGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTGATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGTGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACCCTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis saprophytica MFLUCC 12-0282' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGGAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACAGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGACCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATCTAGTGATTCCCATCATCATTTCCCTTCAC--TTCAGCGTCATCATTTTCAACCTGCGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCGTGTGCTGCTCCATGAGACACCTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_110.20 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACT??TAGTCATCTGTTGATTCCTATCATCATT-CCCTTCAC--ATCAGCGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCAATGCCATATGCTGCTCCATAAGACACTTGACTAACCTTACTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_119.75 CATTATAGAGTTTTCTAAACTTCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGATATAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTAAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGG????????????GTTTCCCGTCATGATTCTCCTTCAC--TTCAGCGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCATAAGCAACCATGCATTGCTCAT--GAGATCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTGTGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_164.42 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGGAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCCTGCACGACAGCCCCGAACAGTGAATTAGGTCAAGATAGAGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGTGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCCCCTTCTC--TTCAGCGTCATGATTTTCAACCTACGCGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTTCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACGATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_177.25 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TCCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_233.79 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTTACCTGTCTGCCTCGACACGGCCTTACTACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAAATAGGTCAAGATAGAGGGAACATGATACTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTAACTTCAATTCCTCCTGCTTCCTGTTGAGTTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAAC??????TAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TTCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCACCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_266.37 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCATTTTCAATCCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTTCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCTGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCCCCTTCAC--TTCAGCGTCATGATTTTCAACATACGTGTTGAAAATTA-TTTTCGCTCCTTCCTCAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTACTCAT--GAGACCCACTT--TGAACAATTGCTAATTCCTTCATTCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTACCCTTCTACCTATGCCATGTACTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_266.80 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTACAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TAGTCATCTACTGTTTCCCGTCATGATTCTCCTTCAC--TTCAGCGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCATAAGCAACCATGCATTGCTCAT--GAGATCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTGTGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_274.29 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TCCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_322.76 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TCCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_323.76 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCATTTTCAATCCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTTCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCTGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACT??TAGTCATCTATTGATTCCCATCATCATTCCCCTTCAC--TTCAGCGTCATGATTTTCAACATACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTACTCAT--GAGACCCACTT--TGAACAATTGCTAATTCCTTCATTCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTACCCTTCTACCTATGCCATGTACTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_360.61 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGTCTCGACACGGCCTCAATACGACGTTTTTCG-TGCTTGCACGACAGCCCCGAACAGTGAATTAGGTCAAGATAGTGGGAACATGATGCTAATAGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTTAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTGTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATATATTGATTCCCATCATCATTCCCCTTCTC--TTCAGCGTCATGATTTTCAACCTACGCGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTTCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACGATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_361.61 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCATTTTCAATCCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTTCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCTGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCCCCTTCAC--TTCAGCGTCATGATTTTCAACATACGTGTTGAAAATTA-TTTTCGCTCCTTCCTCAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTACTCAT--GAGACCCACTT--TGAACAATTGCTAATTCCTTCATTCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTACCCTTCTACCTATGCCATGTACTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_sp._CBS_664.94 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAATCTGTCTGCCTCGACACGGCCTTAATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGATCAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTATTTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAAC???TAGTCATTTATTGATTCCCATCATCATCCCCCTTCAC--TCCAGCATCATAATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_steyaertii_IMI_192475 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTACAGGTTACCCTGTAGCTGCTGCCGGTGGACCACTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAA-TCTTTTCTCGCTTTTGTCAGGTGCTGCAACTCCCAGCCGCTAAA-CCCCCAATTTTTTTTGTGGTTGACCT-CGGA-CAGGTGGTGCTGCTTTCTGGTATGTAGCCTGTCTACCTGGACACGGTCTC-ATACGACATTTTTCG-TGACTTCACGACGGCCTCGAATAGTTGATTGGGTCAAGATAGAGATAACATGATGCTAATGGGTCATTCATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCATTTTAAATTCCTTTTGCTTCTTGTTGAGCTCGTAGGCTGACTTGATGGCCATTTAGCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTTGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATCTACTGATTCCCATCATT-TT-CATTCCCC--TTGAGCGTCATGATTTTCGACCTACCTGTTGAAAATTATTTTTCGCTCCTTCCACAT--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCCTATCACAGCCCCACCTTGCATAAGCAACTATGCACTGCTCAT--GAGACCCACTT--TGAAATTTTGCTAATCCCTCCTTACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCTACCACCCATGCCATGTGCTGCTGAACAAGACAC-CGACTAACATTGCTCCACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_surinamensis_CBS_111494 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTT-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTCTTAGGAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTACAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTTACCTGTCTGCCTCGACACGGCCTTACTACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAAAAGTGAAATAGGTCAAGATAGAGGGAACATGATACTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTAACTTCAATTCCTCCTGCTTCCTGTTGAGTTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCT????????????TAGTCATCTACTGTTTCCCGTCATCATTCTCCTTCAC--TTCAGCGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACAATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_surinamensis_CBS_450.74 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTTACCTGTCTGCCTCGACACGGCCTTACTACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAAATAGGTCAAGATAGAGGGAACATGATACTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTAACTTCAATTCCTCCTGCTTCCTGTTGAGTTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAAC???TAGTCATCTATTGATTCCCATCATCATTCCCCTTCTC--TTCAGCGTCATGATTTTCAACCTACGCGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTTCACAAGCAACCATGCATTGCTCAT--GAGACCCACTT--TGAACGATTGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Neopestalotiopsis umbrinospora MFLUCC 12-0285' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTT-A-TAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAACCTGTCTGC-TCGAC-CGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCTCGAACAGTGAAATAGGTCAAGATAGAGGGAACATAATACTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACTAACTTCAATTCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATCTACTGATTCCCGTCATCATTCTCCTTCAC--TTCAGCGTCATGATTTTCAACCTACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC--TTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCATAAGCAACCATGCATTGCTCAT--GAGATCCACTT--TGAACAATCGCTAATGCCTTCATACAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTACCCCTCCACCTATGCCATGTGCTGCTCCATAAGACACTTGACTAACCTTGCTTTATAGACGCTCCCGGTCACCGTGATTTCATCAAGA Neopestalotiopsis_zimbabwana_CBS_111495 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAAT-TTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTAACCTGTCTGCCTCGACACGGCCTTGATACGACGTTTTTCG-TGCCTGCACGACGGCCCCGAACAGTGAATTAGGTCAAGATACAGGGAACATGATGCTAATAGGTCATTTATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTATGTACCATTTTCAATCCCTCCTGCTTCCTGTTGAGCTTGTAGGCTGACTCGATGGCCATTTAGCTACAACGGTACCTCCGAGCTTCAGCTCGAGCGTATGAGCGTCTACTTCAACGAGGCTTCTGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGCCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTATTGATTCCCATCATCATTCCCCTTCAC--TTCAGCGTCATGATTTTCAACATACGTGTTGAAAATTA-TTTTCGCTCCTTCCACAC-TTTTTTT----CGCTGGTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACCTTGCACAAGCAACCATGCATTACTCAT--GAGACCCACTT--TGAACAATTGCTAATTCCTTCATTCAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTCAGTACCCTTCTACCTATGCCATGTACTGCTCCATAAGACACTTGACTAACCTTGCTTCATAGACGCTCCCGGTCACCGTGATTTCA?????? Pestalotiopsis_trachicarpicola_OP068 CATTATGGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACC-ATTGTTGCCTCGGCAGAAGCTACGGCTTACCCTGTAACGGCTGCCGGTGGACTACCAAACTCTTGTTATTTTATTGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACTGCTTTTGCTAGCTGTAGCTCCTGAAATACAACGGCGGATCTGCGATATCCTCTGAGCGTAGTAAATTTTTATCTCGCTTTTGACTGGAGTTGCAGCCTTTGGCCGCTAAATCCCCCAA--TTTTTAATGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTAGCCCATCTACCTCGACGC-GCCTCAATACGACACCCC-CGGCAACTCCACGATAATCTCAACTGCTTGGTTGGAACCA-TACGAAAGA-CTCGATACTGACCGGTCTATGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCCTTTCCCTGGCTGTTCGCTTTCTCGTGAACATGTCAGCTAACGTCGTGCTTGTTCAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGCTTCCGGCAACAAGTACGTTCCTCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGAAACAACTGGTTATGATCCTCGCAATCCCATCATC---CTCATCCTC--ATCATCATCACCATTTCCCACACCGGTGTCGAAAATCTGGTTTTCGCACCTGC-C-C--A-TTTTCTC-AGACACTTACCCCG-----------CCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACATCACACAAGCAGCCACGCA-CT-TG-C-A-TGACCCACAA--TGAACAATTGCTGACCCCGCCAAATAGGAAGCCGCCGAGCTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTAT-CC-CTGCCCACAATATGTGTCATGTCTCTGAACTCAAGACTAACCTTGCAATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pseudopestalotiopsis_cocos_CBS_272.29 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAGGCTACAGGTTACCCTGTAGCAGCTGCCGGTGGACTACTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCTTAGCTTAGTGTTGGGAATTTACAG-TT-----A--TGTAATTCCTGAAATACAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAA-TTATTTCTCGCTTTTGTCAGGTGCTGCAGCTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCCTTCTGGTATGTATCCTATCTACCTCGGCATTACCTCGATATGACGCCTTTTGACGAGTCTACGACGACCTTGAACGCTTGATTAGGTCAGGG-ATAAA-AACACGATGCTAATGGGTCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCATCTCC---TCCGATTGCTTCTTGTTGAGCACACGAACTAACTTGTGGCCTTGTTAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGTGTCTACTTCAATGAGGCTTCCGGCAACAAGTACGTCCCTCGTGCCGTTCTCGTCGATCTCGAGCCTGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGTCAGCTTTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTG??????????????TAGTCATCTACTGATTTCCATCAACAATCTCATCAAC--ATCTGCGTCATGATCTTCAACTTGCCAGTTGAAAATTA-TTTTTCGCACTTCC-CAC--ATTTTT----CGACACTTACCCCGCCGCAAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACTATGCACCAGCAACCATGCACATCTGAT--GAGACCCACTT--TGAACTATTGCTAATACCTCCCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTGTTCC-CCGCCCTTACCAAGCATC-TTGGACATGACTCTTGACTAACATGGCCACACAGACGCTCCCGGTCACCGTGACTTCATCAAGA Pseudopestalotiopsis_indica_CBS_459.78 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAGGTTACAGGTTACCCTGTAGCAGCTGCCGGTGGACTACTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATTTACAG-TT-----A--TGTAATTCCTGAAATACAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAA-TTATTTCTCGCTTTTGTCAGGTGCTGCAGCTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTATCCTATCTACCTCGGCATTACCTCGATATGACGCCTTTTAACGAGTCT---ACGACCTTGAACGCTTGATTAGGTCACGG-ATAAA-AACACGATGCTAATGGGTCACTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCATCTCC---TCCGATTCCTTCTTGTTGAGCACACGAACTAACTTGTGGCCTTGATAGCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGTGTCTACTTCAATGAGGCTTCCGGCAACAAGTACGTCCCTCGTGCCGTTCTCGTCGATCTCGAGCCTGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGTCAGCTTTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTACTGAATTCCATCAACAATCTCAT-GAC--ATCTGCGTCATGATCTTCAACTTGCCAGTTGAAAATTA-TTTTTCGCACTTCC-CAC--ATTTTT----CGACACTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACTATGCACCAGCAACCATGCACATCTGAT--GAGACCCACTT--TGAACTATTGCTAATACCTCCCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATTCC-CTGCCCTTGCCAAGCATC-TTTGACATGACTCTTGACTAACATGGCCATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA 'Pseudopestalotiopsis theae MFLUCC 12-0055' CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAGGTTACAGGTTACCCTGTAGCAGCTGCCGGTGGACTACTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAACTTACAG-T---A--A--TGTAATTCCTGAAATACAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAA-TTATTTCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTATCCAATCTA-CTCGGCATTACCTCGATATGACGCCTTTTGGCGAGTCTACGACGACCTTGAACGCTTGGTTAGGTCAAGG-ATAAAGAACACGATGCTAATGGGCCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCATCTCC---TCCGATTGCTTTTTGTTGAGCACACGAACTGACTTATGGCCTTTTTAGCTACAACGGTACCTCTGAGCTCCAGCTCGAGCGCATGAGTGTCTACTTCAATGAGGCTTCCGGCAACAAGTATGTCCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGTCAGCTTTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTTATAATTTACTGATTCCCATCATCACTCTCATCAAG--ATCTGCGTGATG-TTTTCAACCTGCCAGTTGAAAATTA-TTTATCGCACTTCC-CAC--AATTTT----CGACACTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACTATGCACCAGCAACCATGCATCTCTGACGAGAGACCCACTT--TGAACTATTGCTAATACCTCCCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATTCC-CTGCCCTTACCAAGCATC-TTTGACATGACTCTTGACTAACATGGCCATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA Pseudopestalotiopsis_theae_SC011 CATTATAGAGTTTTCTAAAC-TCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAGGTTACAGGTTACCCTGTAGCAGCTGCCGGTGGACTACTAAACTCTTGTTATTTTA-TGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAACTTACAG-T---A--A--TGTAATTCCTGAAATACAACGGCGGATCTGTGGTATCCTCTGAGCGTAGTAAA-TTATTTCTCGCTTTTGTTAGGTGCTGCAGCTCCCAGCCGCTAAA-CCCCCAA--TTTTTTGTGGTTGACCT-CGGATCAGGTGGTGCTGCTTTCTGGTATGTATCCCATCTACCTCGGCATTACCTCGATATGACGCCTTTTGGCGAGTCTACGACGACCTTGAACGCTTGGTTAGGTCAAGG-ATAAAGAACACGATGCTAATGGGCCATTGATAGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGAGTGTACGTACCATCTCC---TCCGATTGCTTTTTGTTGAGCACACGAACTGACTTATGGCCTTTTTAGCTACAACGGTACCTCTGAGCTCCAGCTCGAGCGCATGAGTGTCTACTTCAATGAGGCTTCCGGCAACAAGTATGTCCCTCGTGCCGTTCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGCGCCGGTCCCTTCGGTCAGCTTTTCCGCCCTGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGCAACAACTGGTAGTCATCTACTGATTTCCATCATCAATCTCATCAAC--ATCTGCGTCATGATTTTCAACCTGCCAGTTGAAAATTA-TTTTTCGCACTTCC-CAC--ATTTTT----CGACACTTACCCCGCCGCGAGGCACCCGCACGACCCCGCGGTGCAAACGAAAAATTTCTTATCACAGCCCCACTATGCACCAGCAACCATGCATCTCTGACGAGAGACCCACTT--TGAACTATTGCTAATACCTCCCAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTCTGGAAGTTCGAGACCAACGAGTACAATGTCACCGTCATTGGTTAGTATTCC-CTGCCCTTACCAAGCATC-TTTGACATGACCCTTGACTAACATGGCCATACAGACGCTCCCGGTCACCGTGATTTCATCAAGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24628] TITLE Pestalotiopsis_LSU_overview; LINK TAXA = Taxa1; DIMENSIONS NCHAR=807; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Amphisphaeria_umbrina_AF452029 CTCAAATTT-GAAATCT-GGCCTTCGGGTCCGAATTGTAATTTGTAGAGGATGCTTTT-GGTTAGGTACCTTCCGAGTGCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAACAGCACGTGAAATT-GTTGAAAGGGAAGCGTTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTCTAGGCCAGCATCGGTTTTCGTAGGGGGATAAAATTTGTGGGAACGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTGCTAAATAATACCTCTGCGGGGACTGAGGTTCGCGCT--CTGCAAGGAT-GCTGGCG-TAA-TGGTCA-TCAACGGCCCGTC-TTGAAACACGGGCCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCC-TT-A--GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Arecophila_bambusae_AF452038 CTCAAATTT-GTAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGGTTTT-GGCGCGGTGGCTTCCGAGTTCCCTGGAACGGGACGGCTTAAGGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATTCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACGCATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATT-GTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCAGGTCAAGGCCAGCATCGGTTTTCGAGGGGGGACAAAAGCTTGGGGAACGTAGCTCC-CTTCGGG--AGTGTT-ATAGCCCCTTGCATAATACCCCCTCGGGGACCGAGGAACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTCG-TCAACGACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTAGGGTGTTAAACCCCTGCGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTC-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Bartalinia_bischofiae_AF382367 CTCAAATTT-GAAATCT-GGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTT-GGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCCCT-CGGGGAAGTGTT-ATAGCCTATTG-ATAATACACTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGCTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Bartalinia_lateripes_AF382368 CTCAAATTT-GAAATCT-GGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTT-GCTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCTCT-CGGG-AAGTGTTAATAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATGACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Bartalinia_laurina_AF382369 CTCAAATTT-GAAATCT-GGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTT-GGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTAGGAATGTGGCTTCCCTCCGGG--AGTGTT-ATAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Discosia_artocreas_AB593705 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAGTTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTCAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTC--CTCCGGG--AGTGTT-ATAGCCTATTGTATAATACCCTACTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Discosia_pini_AB593708 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAGTTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTCAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTC--CTCCGGG--AGTGTT-ATAGCCTATTGTATAATACCCTACTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Discosia_sp._AB593712 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAAGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTC--CTCCGGG--AGTGTT-ATAGCCTATTGTATAATACCCTACTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Discosia_sp._AB593720 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAGTTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGACTACCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCTCAGTTTAGGCCAGCATCGATTTTCGGTGGGGGATAAAAGCTTTAGGAATGTGGCTC--CTCCGGG--AGTGTT-ATAGCCTATTGTATAATACCCTACTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCCCGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Discostroma_fuscellum_AB593726 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGCTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTTACGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Discostroma_fuscellum_AB593739 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTAGCTCC-CT-CGGG--AGTGTT-ATAACCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTTACGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Discostroma_tostum_AB593727 CTCAAATTT-GAAATCT-GGCCCTTGGATCCCAATTGTAATTTGTATTGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTCAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTGTTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTTACGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Dyrithiopsis_lakefuxianensis_AF452047 CTCAAATTT-GAAATCT-GGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTT-GGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGAATCATCCGGTGTTCTCACCGGTGCACTTCTTTCAGTTTAGGCCAGCATCGACTTTCGGCGGCGGATAAAAGCTTCAGGAATGTGGCTCCTCT-CGGGG-AGTGTT-ATAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Funiliomyces_biseptatus_AY772015 CTCAAATTTTGAAATCTTGGC-CT--AGCCCGAGTTGTAATTTGTAGAGGATGCTTTT-GGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGCGTTTATGACCAGACTTTTTCCTGGCGGATCATCCGGCGTTCTCGCCGGTGCACTTCGCCAGGTCGAGGCCAGCATCGGTTCTTACGGGGGGATAAAAGCTTTGGGAACGTAGCTC--TT-CGG---AGTGTT-ATAGCCCATTGCATAATACCCTCGCGGGGACCGAGGTACGCGCA--TTGCAAGGAT-GCTGGCG-TAA-TGGTCA-TCAACGACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTCAGAGCC-GC-A--AGGTGCATGATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Lanceispora_sp._AF452032 CTCAAATTT-GAAAGCT-GACTTTCGGGTCCGCATTGTAATTTGTAGAGGATGCTTTT-GGTTAGGTTCCTTCCAAGTGCCCTGGAACGGGTCGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGAAACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAACAGCACGTGAAATT-GTTAAAGGGGAAGCGTTTACGACCAGACCTTTTCCAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGCCTGGTTTAGGCCAGCATCGGTTTTCGCTGGGGGATAAAAGCTTCAGGAACGTGGCTC--CTCCGGG--AGTGTTAATAGCCTGTTGTATAATACCCTAGCGGGGACCGAGGACCGCGCTT-CGGCAAGGAT-GCTGGCA-TAA-TGGTCG-TTAACGACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTCAGAGCC-TT-A--GGGTGCATGATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Lanceispora_sp._AF452035 CTCAAATTT-GAAAGCT-GACTTTCGGGTCCGCATTGTAATTTGTAGAGGATGCTTTT-GGTCAGGTTCCTTCCAAGTGCCCTGGAACGGGTCGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGAAACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAACAGCACGTGAAATT-GTTAAAGGGGAAGCGTTTACGACCAGACCTTTTCTAGGCGGATCATCCGGTGTTCTCACCGGTGCACTTCGTCTAGTTTAGGCCAGCATCGGTTTTCGCTGGGGGATAAAAGCTTCAGGAACGTGGCTC--CTCCGGG--AGTGTTAATAGCCTGTTGTATAATACCCTAGCGGGGACCGAGGACCGCGCTT-CGGCAAGGAT-GCTGGCA-TAA-TGGTCG-TTAACGACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTCAGAGCC-TT-A--GGGTGCATGATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Monochaetia_kansensis_DQ534035 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATACCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCAGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTCCGGAGGGGGATAAAAGCTTTAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTATTGTATAATACCTTTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTAAGAGCCCTT-AC-GGGTGCATTATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAGGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Monochaetia_kansensis_DQ534036 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATACCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCAGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTCCGGAGGGGGATAAAAGCTTTAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTATTGTATAATACCTTTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTAAGAGCCCTT-AC-GGGTGCATTATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAGGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Monochaetia_kansensis_DQ534037 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATACCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCAGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTCCGGAGGGGGATAAAAGCTTTAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTATTGTATAATACCTTTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTAAGAGCCCTT-AC-GGGTGCATTATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAGGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_formicarum_CBS_115.83 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_mesopotamica_CBS_336.86 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_natalensis_CBS_138.41 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGCAGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCTGTTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGTAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_piceana_CBS_254.32 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_rosae_CBS_101057 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_rosae_CBS_124745 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_sp._CBS_110.20 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_sp._CBS_164.42 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_sp._KM116259 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_sp._KM116274 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_steyaertii_IMI_192475 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGGATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Neopestalotiopsis_surinamensis_CBS_111494 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_arceuthobii_CBS_434.65 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-TTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_arengae_CBS_331.92 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_biciliata_CBS_790.68 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTG-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_camelliae_CBS_443.62 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-TTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCTGT-AT-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG 'Pestalotiopsis camelliae MFLUCC 12-0278' CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-TTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCTGT-AT-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_chamaeropis_CBS_237.38 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_colombiensis_CBS_118553 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCCCCT-CGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG 'Pestalotiopsis furcata MFLUCC 12-0054' CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-TTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCTGT-AT-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_hawaiiensis_CBS_114491 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-TTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_hollandica_CBS_265.33 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CCACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_jesteri_CBS_109350 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAACGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_knightiae_CBS_114138 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_malayana_CBS_102220 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CCTCGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_papuana_CBS_887.96 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_sp._CBS_263.33 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_sp._EU715665 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-TTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_sp._KM116195 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CCACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_sp._KM116223 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_sp._KM116237 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTG-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CCACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_spathulata_CBS_356.86 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-TTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pestalotiopsis_telopeae_CBS_114137 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGATTTTCGGCGGCGGATAAAAGCAGTGGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCCATTGTATAATACGCTGCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCGT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pseudopestalotiopsis_cocos_CBS_272.29 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGGGGGATAAAAGCAGTAGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCTGTTGTATAATACCCTGCTGGGGACCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pseudopestalotiopsis_sp._KM116277 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGGGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCCTGCTGGGGACCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pseudopestalotiopsis_sp._KM116278 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGGGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCCTGCTGGGGACCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Pseudopestalotiopsis_theae_EU833969 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGGGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCCTGCTGGGGACCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG 'Pseudopestalotiopsis theae MFLUCC 12-0055' CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTTGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGGGGGATAAAAGCAGTAGGAATGTGGCTCT-CTACGGGG-AGTGTT-ATAGCCTATTGTATAATACCCTGCTGGGGACCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seimatosporium_elegans_AB593733 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTCAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTGTTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seimatosporium_eucalypti_JN871209 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCAATCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seimatosporium_eucalypti_JN871212 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCAATCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGCGGGATAAAAGCTTTAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seimatosporium_glandigenum_AB593735 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGCTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTTAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTATTGTATAATACCGCCCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTTTACGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAAATGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seimatosporium_hypericinum_AB593737 CTCAAATTT-GAAATCT-GGCCCTCGGGTCCGAATTGTAATTTGTAGAGGATGTTTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTTTGTAAAACTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGCGAATCATCCGGTGTTCTCACCGGTGCACTTCGTTTAGTTTAGGCCAGCATCGATTTTCGGGGTGGGATAAAAGCTTCAGGAATGTGGCTCC-CT-CGGG--AGTGTT-ATAGCCTGTTGCATAATACCGCCCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seiridium_cardinale_AF382376 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCC-CTCCGGGG-AGTGTT-ATAGCCCATTGTATAATACCTCTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGCC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seiridium_cardinale_AF382377 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCC-CTCCGGG--AGTGTTAATAGCCCATTGTATAATACCTTTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seiridium_papillatua_DQ414531 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGATAGGGATAAAAGCTTTAGGAATGTGGCACC-CTCCGGGG-TGTGTT-ATAGCCTATTGTATAATACCTTTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seiridium_phylicae_KC005809 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCC-TC-CGGG--AGTGTT-ATAGCCCATTGTATAATACCTTTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seiridium_phylicae_KC005810 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCC-TC-CGGG--AGTGTT-ATAGCCCATTGTATAATACCTTTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Seiridium_sp._KM116280 CTCAAATTT-GAAATCT-GGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTT-GGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTGGGCGGATCATCCGGTGTTCTCACCGGTGCACTTTGCCCAGTTTAGGCCAGCATCGATTTTCGGAGAGGGATAAAAGCTTTGGGAATGTGGCTCC-CC-CGGG--AGTGTT-ATAGCCCATTGTATAATACCTTTCTGGGGATCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Truncatella_angustata_AF382383 CTCAAATTT-GAAATCT-GGCGCTTGGGTCCGAGTTGTAATTTGCAGAGGATGATTTT-GGTTAGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGGTAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTCTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTGGGAATGTGGCTCCTTT-CGGGG-AGTGTT-ATAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Truncatella_hartigii_DQ278928 CTCAAATTT-GAAATCT-GGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTT-GGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTCTTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTCAGGAATGTAGCTCC-CCTCGGGG-AGTGTT-ATAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTCTGCGCATGGGGG Truncatella_laurocerasi_AF382385 CTCAAATTT-GAAATCT-GGCGCTTGCGTCCGAGTTGTAATTTGCAGAGGATGATTTT-GGTTAGGTACCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGATGCCGAGCCTTTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTTAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTCTAGGCCAGCATCGACTTTCGGCGGTGGATAAAAGCTTTGGGAATGTGGCTCCTTT-CGGGG-AGTGTT-ATAGCCTATTGTATAATACACTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTGTGCAAGTGTTTGGGTGTTAACCCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Truncatella_restionacearum_DQ278929 CTCAAATTT-GAAATCT-GGCGCTTGCGTCCGAGTTGTAATTTGTAGAGGATGATTTT-GGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTTTAGGCCAGCATCGACTTCTGGCGGCGGATAAAAGCTTCAGGAATGTGGCTCC-CTACGGGG-AGTGTT-ATAGCCTGTTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATCACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Truncatella_sp._AF382382 CTCAAATTT-GAAATCT-GGCGCTTGGGTCCGAGTTGTAATTTGTAGAGGATGATTTT-GGTTAGGTACCTTTCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGATTGGATGCCGAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATT-GTTGAAAGGGAAGGATTTATGACCAGACTTTTTCTAGGAGGATCATCCGGTGTTCTCACCGGTGCACTTCTTCTAGTTTAGGCCAGCATCGACTTTCGGCGGCGGATAAAAGCTTTAGGAATGTGGCTCCTCT-CGGGG-AGTGTT-ATAGCCTATTGTATAATACGCTGCTGGGGGTCGAGGTACGCGCTT-CTGCAAGGAT-GCTGGCG-TAA-TGGTTA-TCAATGACCCGTC-TTGAAACACGGACCAA-GGAGTCGAACATTTATGCGAGTGTTTGGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGAAGTTTTCGGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTGGATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATGGGGG Xylaria_hypoxylon_AF132333 ??????????????TCT-GGCCTTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTT-CGCGCGGTGCCTTCCGAGGTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGCTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTGGCGGATCATCCGGTGTTATCACCGGTGCACTTCGCCAGGTTGAGGCCAGCATCGGTTTTTGTAGGGGGATAAAAGCCTAGGGAATGTGGCTCC-TT-CGGG--AGTGTT-ATAGCCCCTCGCATAATACCTTAC-GGGGACCGAGGACCGCGCTTTATGCAAGGATAGCTGGCGGTAAATGGGCCGTCAACGACCCGTCCTTGAAACACGGACCAAAGGAGTCGAACATTTGTGCGAGTGTTCCGGTGTTAAACCCTCACGCGTAATGAAAGTGAACGGAGGTGAGAGCCCTT-AC-GGGTGCATCATCGACCGATCCTGATGTCTTCCGATGGATTTGAGTAAGAGCATAACTGTTCGGACCCGAAAGATGGTGAACTATGCGTCGATAGGGTGAAGCCAGACGAAACTCTGGTGGAGGCCTGCAGCGGTTCTGACGTGCAAATCGATCGTCAAA-TCTGCGCATCGGGG ; END; BEGIN TREES; TITLE Fig._3._Bayesian_result_generated_from_LSU_sequence_alignment; LINK TAXA = Taxa1; TRANSLATE 1 Seiridium_phylicae_KC005810, 2 Seiridium_sp._KM116280, 3 Seiridium_phylicae_KC005809, 4 Seimatosporium_eucalypti_JN871212, 5 Seimatosporium_eucalypti_JN871209, 6 Pseudopestalotiopsis_theae_EU833969, 7 Monochaetia_kansensis_DQ534037, 8 Monochaetia_kansensis_DQ534036, 9 Monochaetia_kansensis_DQ534035, 10 Seiridium_papillatua_DQ414531, 11 Truncatella_restionacearum_DQ278929, 12 Truncatella_hartigii_DQ278928, 13 Pestalotiopsis_jesteri_CBS_109350, 14 Pestalotiopsis_papuana_CBS_887.96, 15 Pestalotiopsis_biciliata_CBS_790.68, 16 Pestalotiopsis_sp._KM116237, 17 Pestalotiopsis_sp._EU715665, 18 Pestalotiopsis_camelliae_CBS_443.62, 19 Pestalotiopsis_arceuthobii_CBS_434.65, 20 Pseudopestalotiopsis_sp._KM116278, 21 Neopestalotiopsis_steyaertii_IMI_192475, 22 'Pestalotiopsis camelliae MFLUCC 12-0278', 23 'Pestalotiopsis furcata MFLUCC 12-0054', 24 'Pseudopestalotiopsis theae MFLUCC 12-0055', 25 Pseudopestalotiopsis_sp._KM116277, 26 Neopestalotiopsis_sp._KM116274, 27 Pestalotiopsis_spathulata_CBS_356.86, 28 Neopestalotiopsis_mesopotamica_CBS_336.86, 29 Pestalotiopsis_arengae_CBS_331.92, 30 Neopestalotiopsis_sp._KM116259, 31 Pseudopestalotiopsis_cocos_CBS_272.29, 32 Pestalotiopsis_hollandica_CBS_265.33, 33 Pestalotiopsis_sp._CBS_263.33, 34 Neopestalotiopsis_piceana_CBS_254.32, 35 Pestalotiopsis_chamaeropis_CBS_237.38, 36 Neopestalotiopsis_sp._CBS_164.42, 37 Neopestalotiopsis_rosae_CBS_124745, 38 Pestalotiopsis_colombiensis_CBS_118553, 39 Neopestalotiopsis_formicarum_CBS_115.83, 40 Pestalotiopsis_sp._KM116223, 41 Pestalotiopsis_hawaiiensis_CBS_114491, 42 Pestalotiopsis_knightiae_CBS_114138, 43 Pestalotiopsis_telopeae_CBS_114137, 44 Neopestalotiopsis_surinamensis_CBS_111494, 45 Neopestalotiopsis_natalensis_CBS_138.41, 46 Neopestalotiopsis_sp._CBS_110.20, 47 Pestalotiopsis_malayana_CBS_102220, 48 Neopestalotiopsis_rosae_CBS_101057, 49 Pestalotiopsis_sp._KM116195, 50 Funiliomyces_biseptatus_AY772015, 51 Dyrithiopsis_lakefuxianensis_AF452047, 52 Arecophila_bambusae_AF452038, 53 Lanceispora_sp._AF452035, 54 Lanceispora_sp._AF452032, 55 Amphisphaeria_umbrina_AF452029, 56 Truncatella_laurocerasi_AF382385, 57 Truncatella_angustata_AF382383, 58 Truncatella_sp._AF382382, 59 Seiridium_cardinale_AF382377, 60 Seiridium_cardinale_AF382376, 61 Bartalinia_laurina_AF382369, 62 Bartalinia_lateripes_AF382368, 63 Bartalinia_bischofiae_AF382367, 64 Discostroma_fuscellum_AB593739, 65 Seimatosporium_hypericinum_AB593737, 66 Seimatosporium_glandigenum_AB593735, 67 Seimatosporium_elegans_AB593733, 68 Discostroma_tostum_AB593727, 69 Discostroma_fuscellum_AB593726, 70 Discosia_sp._AB593720, 71 Discosia_sp._AB593712, 72 Discosia_pini_AB593708, 73 Discosia_artocreas_AB593705, 74 Xylaria_hypoxylon_AF132333; TREE Fig._3 = [&R] (74:1.02481077006124,52:0.8274980987263086,((((((((1:0.01699369906580259,3:0.01868583966395907):0.04271366843705837,2:0.04399965687172411):0.04358761784630808,59:0.01751091320029764,60:0.06213936414615997):0.06514892249641924,10:0.09343928039546744):0.05964380226879679,(((((((4:0.01738539329182967,5:0.01629048307535099):0.06840551944455475,(65:0.09015063701268022,67:0.01781647163995788):0.06726681938203066):0.03820777380512429,(64:0.06502409184021787,((66:0.0425615743927167,69:0.01769621495622288):0.0420530784585014,68:0.1702540390690877):0.04319356954449675):0.06894761677875862):0.2037537141850054,71:0.04047491882509767):0.1039961667182873,(70:0.09166069968748657,72:0.01780943955223307,73:0.01868446862742936):0.04280336904416426):0.1714902115945047,((((11:0.08772807457426085,12:0.1797721073456649):0.09730234435238906,58:0.04264681083940179):0.08633836473911055,(51:0.1049405321996701,((61:0.01608819497349073,63:0.0379064759442534):0.05733805305106437,62:0.0660846050578489):0.0722243825955214):0.09411369328108365):0.09855819459507098,(56:0.06375585772976768,57:0.04072152792016708):0.2043824706422441):0.4777984556296016):0.1042542873093531,(((6:0.0169537501479802,20:0.01905430985191151,(21:0.06673599664243297,26:0.01609708379351965,(28:0.0156228591587488,37:0.01926793135904681,45:0.168694197332916,48:0.01687130449302272):0.04116829369686657,30:0.01690911254162203,34:0.017585682074307,36:0.01730436233639998,39:0.01606635574013223,44:0.01707006537396981,46:0.01725264708895221):0.1438925093357279,24:0.01748497595443544,25:0.0174219812912247):0.04074879625253747,31:0.04566252071173969):0.06701952972635386,(((13:0.06918862961886206,(14:0.01814737391905992,(15:0.0293641922655702,16:0.03860886798125113):0.04170992863183597,(18:0.01619043805545694,22:0.01901808058893836,23:0.0171945502246725):0.08574728565154671,29:0.0419410110277232,(32:0.01638593103599255,47:0.04061100028620424,49:0.01788765051892368):0.03515995505334733,33:0.01664595857637833,35:0.01631361437198536,38:0.01706816319813339,40:0.04118689701556944,42:0.01738858485833949,43:0.01666973770848513):0.04507612469662681):0.03680558766872585,(27:0.0180288609478895,41:0.01711380673804562):0.02976144842760111):0.06927873436313169,(17:0.01702206896110517,19:0.01711428338068323):0.1161931859814723):0.1505507971744583):0.2927107055630293):0.08841920408476465):0.0730522673590556,(7:0.01790199871459234,8:0.01753938217261135,9:0.01679883818521639):0.2082864102736242):0.5610325205509195,((53:0.0644449700511459,54:0.06893473001885148):0.9139417749676547,55:0.3746651362029754):0.2696216201661636):0.3706018476719563,50:0.6794869267618157):0.1998937621490323); END; BEGIN TREES; TITLE Fig._5._Bayesian_result_generated_from_combined_alignment_for_Pestalotiopsis; LINK TAXA = Taxa2; TRANSLATE 1 'Pestalotiopsis furcata MFLUCC 12-0054', 2 Pestalotiopsis_camelliae_CBS_443.62, 3 'Pestalotiopsis camelliae MFLUCC 12-0277', 4 'Pestalotiopsis camelliae MFLUCC 12-0278', 5 Pestalotiopsis_adusta_ICMP_6088, 6 Pestalotiopsis_papuana_CBS_331.96, 7 Pestalotiopsis_papuana_CBS_887.96, 8 'Pestalotiopsis adusta MFLUCC 10-0146', 9 Pestalotiopsis_sp._CBS_264.33, 10 Pestalotiopsis_sp._CBS_263.33, 11 Pestalotiopsis_malayana_CBS_102220, 12 Pestalotiopsis_diploclisiae_CBS_115449, 13 Pestalotiopsis_diploclisiaeCBS_115585, 14 Pestalotiopsis_diploclisiae_CBS_115587, 15 Pestalotiopsis_humus_CBS_336.97, 16 Pestalotiopsis_humus_CBS_115450, 17 Pestalotiopsis_colombiensis_CBS_118553, 18 Pestalotiopsis_oryzae_CBS_111522, 19 Pestalotiopsis_oryzae_CBS_353.69, 20 Pestalotiopsis_oryzae_CBS_171.26, 21 Pestalotiopsis_kenyana_CBS_442.67, 22 Pestalotiopsis_trachicarpicola_IFRDCC_2403, 23 Pestalotiopsis_telopeae_CBS_114137, 24 Pestalotiopsis_trachicarpicola_IFRDCC_2440, 25 Pestalotiopsis_kenyana_CBS_911.96, 26 'Pestalotiopsis trachicarpicola MFLUCC 12-0263', 27 'Pestalotiopsis trachicarpicola MFLUCC 12-0267', 28 'Pestalotiopsis trachicarpicola MFLUCC 12-0266', 29 'Pestalotiopsis trachicarpicola MFLUCC 12-0265', 30 'Pestalotiopsis trachicarpicola MFLUCC 12-0264', 31 Pestalotiopsis_telopeae_CBS_113606, 32 Pestalotiopsis_telopeae_CBS_114161, 33 Pestalotiopsis_australasiae_CBS_114126, 34 Pestalotiopsis_australasiae_CBS_114141, 35 Pestalotiopsis_grevilleae_CBS_114127, 36 Pestalotiopsis_knightiae_CBS_111963, 37 Pestalotiopsis_knightiae_CBS_114138, 38 Pestalotiopsis_biciliata_CBS_124463, 39 Pestalotiopsis_biciliata_CBS_236.38, 40 Pestalotiopsis_biciliata_CBS_790.68, 41 Pestalotiopsis_parva_CBS_265.37, 42 Pestalotiopsis_parva_CBS_278.35, 43 'Pestalotiopsis rosea MFLUCC 12-0258', 44 'Pestalotiopsis clavata MFLUCC 12-0268', 45 Pestalotiopsis_rhododendri_IFRDCC_2399, 46 Pestalotiopsis_monochaeta_CBS_144.97, 47 Pestalotiopsis_monochaeta_CBS_440.83, 48 Pestalotiopsis_hollandica_CBS_265.33, 49 Pestalotiopsis_australis_CBS_111503, 50 Pestalotiopsis_australis_CBS_114193, 51 Pestalotiopsis_australis_CBS_119350, 52 Pestalotiopsis_australis_CBS_114474, 53 'Pestalotiopsis unicolor MFLUCC 12-0276', 54 Pestalotiopsis_chamaeropis_CBS_113604, 55 Pestalotiopsis_chamaeropis_CBS_113607, 56 Pestalotiopsis_chamaeropis_CBS_186.71, 57 Pestalotiopsis_chamaeropis_CBS_237.38, 58 'Pestalotiopsis unicolor MFLUCC 12-0275', 59 Pestalotiopsis_scoparia_CBS_176.25, 60 'Pestalotiopsis intermedia MFLUCC 12-0259', 61 'Pestalotiopsis linearis MFLUCC 12-0271', 62 'Pestalotiopsis inflexa MFLUCC 12-0270', 63 'Pestalotiopsis novae-hollandiae CBS 130973', 64 Pestalotiopsis_portugalica_CBS_393.48, 65 'Pestalotiopsis diversiseta MFLUCC 12-0287', 66 Pestalotiopsis_spathulata_CBS_356.86, 67 'Pestalotiopsis gaultheria IFRD 411-014', 68 Pestalotiopsis_ericacearum_IFRDCC_2439, 69 Pestalotiopsis_arceuthobii_CBS_434.65, 70 Pestalotiopsis_arengae_CBS_331.92, 71 Pestalotiopsis_hawaiiensis_CBS_114491, 72 Pestalotiopsis_anacardiacearum_IFRDCC_2397, 73 Pestalotiopsis_jesteri_CBS_109350, 74 Pestalotiopsis_brassicae_CBS_170.26, 75 'Pestalotiopsis verruculosa MFLUCC 12-0274', 76 'Neopestalotiopsis saprophyta MFLUCC 12-0282'; TREE Fig._5 = [&R] (76:0.4049126,73:0.2442198,((((((1:0.02034879,(2:0.006587953,(3:7.819152E-4,4:8.715453E-4):0.002703255):0.01668381):0.05163883,((((((((5:0.006368063,8:0.002117749):0.002305544,(6:9.073589E-4,7:7.883447E-4):0.002229765,(9:9.140038E-4,10:8.494718E-4):0.00217021):0.004855892,11:0.0108869):0.007548631,((12:0.002093073,13:8.955255E-4,14:9.297922E-4):0.003690559,(15:0.004120208,16:0.01189155):0.003581145):0.003049118):0.01051067,17:0.02615697):0.02882089,((((((18:8.842248E-4,19:8.26469E-4,20:0.002150259):0.009538117,(21:9.061975E-4,(22:0.003258045,24:0.005764035,26:8.838867E-4,27:8.549601E-4,28:8.929047E-4,29:8.782221E-4,30:8.326494E-4):0.002059546,25:9.137871E-4):0.007907723):0.01039648,((23:0.009651027,31:7.869787E-4,32:9.842458E-4):0.005736698,(33:0.002011419,34:0.002123067):0.007634154):0.004958448):0.00549504,((35:0.008663255,(36:8.418098E-4,37:7.965848E-4):0.01212253):0.01016664,((38:9.300578E-4,39:0.002136091):0.003906952,40:0.001422911):0.01053309):0.004005868):0.005060256,(41:9.189279E-4,42:8.096495E-4):0.01858397):0.008222562,43:0.03107971):0.02039036):0.01491215,((44:0.008660432,45:0.01334618):0.02776992,(((46:9.182143E-4,47:8.797601E-4):0.003364523,(48:0.00144319,(74:0.002286608,75:0.01703165):0.004696505):0.002187766):0.01684448,(((((49:0.00224384,50:8.427521E-4,52:8.39245E-4):0.003234452,51:0.003542756):0.01996922,59:0.00911622):0.007578426,(53:0.001705937,58:0.002888314):0.01338433):0.004008894,(((54:9.627887E-4,55:8.631899E-4):0.0021303,56:8.767625E-4,57:9.063859E-4):0.004828546,(60:0.008380751,61:0.01020386):0.01667317):0.006359862):0.01155869):0.01765943):0.01548945):0.01149161,62:0.05163194):0.01002796,63:0.03212281):0.005624184,64:0.05737629):0.01120678,(65:0.03994514,(66:0.03080607,67:0.04060494):0.02022397):0.01597583):0.02320939,(70:0.09758269,(71:0.02851628,72:0.02562105):0.04198063):0.01452336):0.005882483,68:0.06019017,69:0.1025824):0.07357414); END; BEGIN TREES; TITLE Fig._4._Bayesian_result_generated_from_combined_alignment_for_Neopestalotiopsis_and_Pseudopestalotiopsis; LINK TAXA = Taxa3; TRANSLATE 1 Neopestalotiopsis_steyaertii_IMI_192475, 2 Neopestalotiopsis_rosae_CBS_101057, 3 Neopestalotiopsis_rosae_CBS_124745, 4 Neopestalotiopsis_mesopotamica_CBS_336.86, 5 Neopestalotiopsis_mesopotamica_CBS_299.74, 6 Neopestalotiopsis_australis_CBS_114159, 7 Neopestalotiopsis_mesopotamica_CBS_464.69, 8 'Neopestalotiopsis saprophytica MFLUCC 12-0282', 9 Neopestalotiopsis_saprophytica_CBS_115452, 10 Neopestalotiopsis_foedans_CGMCC_3.9123, 11 Neopestalotiopsis_foedans_CGMCC_3.9178, 12 Neopestalotiopsis_foedans_CGMCC_3.9202, 13 Neopestalotiopsis_formicarum_CBS_115.83, 14 Neopestalotiopsis_sp._CBS_360.61, 15 Neopestalotiopsis_sp._CBS_164.42, 16 Neopestalotiopsis_sp._CBS_664.94, 17 Neopestalotiopsis_samarangensis_CBS_115451, 18 Neopestalotiopsis_sp._CBS_177.25, 19 Neopestalotiopsis_sp._CBS_274.29, 20 Neopestalotiopsis_sp._CBS_322.76, 21 Neopestalotiopsis_aotearoa_CBS_367.54, 22 Neopestalotiopsis_piceana_CBS_225.30, 23 Neopestalotiopsis_piceana_CBS_254.32, 24 Neopestalotiopsis_piceana_CBS_394.48, 25 'Neopestalotiopsis samarangensis MFLUCC 12-0233', 26 Neopestalotiopsis_clavispora_CBS_447.73, 27 'Neopestalotiopsis ellipsospora MFLUCC 12-0283', 28 'Neopestalotiopsis ellipsospora MFLUCC 12-0284', 29 'Neopestalotiopsis clavispora MFLUCC 12-0280', 30 'Neopestalotiopsis clavispora MFLUCC 12-0281', 31 Neopestalotiopsis_formicarum_CBS_362.72, 32 Neopestalotiopsis_cubana_CBS_600.96, 33 Neopestalotiopsis_ellipsospora_CBS_115113, 34 Neopestalotiopsis_surinamensis_CBS_450.74, 35 Neopestalotiopsis_sp._CBS_233.79, 36 Neopestalotiopsis_surinamensis_CBS_111494, 37 Neopestalotiopsis_eucalypticola_CBS_264.37, 38 Neopestalotiopsis_zimbabwana_CBS_111495, 39 Neopestalotiopsis_sp._CBS_266.37, 40 Neopestalotiopsis_sp._CBS_361.61, 41 Neopestalotiopsis_sp._CBS_323.76, 42 Neopestalotiopsis_honoluluana_CBS_111535, 43 Neopestalotiopsis_honoluluana_CBS_114495, 44 Neopestalotiopsis_sp._CBS_110.20, 45 'Neopestalotiopsis asiatica MFLUCC 12-0286', 46 'Neopestalotiopsis umbrinospora MFLUCC 12-0285', 47 'Neopestalotiopsis chrysea MFLUCC 12-0261', 48 'Neopestalotiopsis chrysea MFLUCC 12-0262', 49 Neopestalotiopsis_javaensis_CBS_257.31, 50 Neopestalotiopsis_protearum_CBS_114178, 51 Neopestalotiopsis_sp._CBS_119.75, 52 'Neopestalotiopsis magna MFLUCC 12-652', 53 Neopestalotiopsis_natalensis_CBS_138.41, 54 Neopestalotiopsis_sp._CBS_266.80, 55 Pseudopestalotiopsis_cocos_CBS_272.29, 56 Pseudopestalotiopsis_indica_CBS_459.78, 57 'Pseudopestalotiopsis theae MFLUCC 12-0055', 58 Pseudopestalotiopsis_theae_SC011, 59 Pestalotiopsis_trachicarpicola_OP068; TREE Fig._4 = [&R] (59:0.2177176730284077,(1:0.03747198349759821,(((((2:6.650657278964776E-4,3:6.338768722265207E-4,(4:0.00412710834644702,5:0.002212984925193856,7:0.005173691504763983):0.002364712423342089,((10:0.004356441561425005,12:6.921499894694233E-4):0.003385355788534584,11:6.62816847825927E-4):0.006175324167450437,49:6.866131281465543E-4):0.003386577283368454,(6:0.001615927237355381,(51:0.005289611043183525,54:0.001039589724867191):0.004199182388237492):0.006630023626573686,(37:0.001812861294295471,((38:6.08744274784168E-4,(39:6.315584744422055E-4,40:6.290113702648022E-4):0.001485397525255179,41:6.335693439111388E-4):0.001518195543077669,(42:6.114727380312043E-4,43:6.308354998801853E-4):0.002683512960309979):0.01061241885706232):0.006478486484604523):0.0044078404300461,(8:0.01308532799209105,9:0.005452808590283222,((14:0.005354085320284147,15:0.004397874048211629):0.002481749654035628,32:0.001525917204661714):0.002475559128790273):0.003263725706560087):0.002816885965310169,(((13:0.003233855798625181,31:0.001657741323002443):0.004306194257821314,(((16:7.672063226747216E-4,18:6.320665331302492E-4,19:6.33703514269164E-4,20:6.510940126202929E-4):0.001763080364705787,17:0.001989598940102531,(21:6.352548114299905E-4,(22:6.618095974920242E-4,23:6.231576581019267E-4,24:6.318625454155765E-4):0.001510675664919167):0.001513961645906691,25:0.007114917352102821):0.002700130556921658,(27:0.003399741584850813,28:6.518405815340044E-4):0.006378476695880288,33:0.008854654330881926):0.004283454621696063,(26:0.004319206536323728,(29:6.24029553738717E-4,30:0.003402415188551294):0.00435561314175155):0.003292783105200434,44:0.006363696908460122):0.002792389932296103,52:0.03330896278622102):0.001637091005196348,((34:0.006168016338598896,(35:0.003680366289492456,50:0.002990746508853144):0.003908165705826461,36:0.007214649719847488):0.003232940290537953,(45:0.005888165400226148,(46:6.341252926803654E-4,(47:6.517480564411819E-4,48:0.004174316709339453):0.002440699138278206):0.003170626674574321):0.01283734242112715):0.005094648012528581):0.03536221153124251,53:0.05453431399408748):0.009397494300585323):0.09689433870870892,((55:0.009664818043259242,56:0.008320469896147941):0.01359394649881694,(57:0.01124185284082393,58:0.001499789842638697):0.00739838968854665):0.05933553623642787); END;