#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 12:12 GMT TreeBASE (cc) 1994-2008 Study reference: Woudenberg J., Seidl M.F., Groenewald J.Z., Devries M., Stielow B., Thomma B.P., & Crous P.W. 2015. Alternaria section Alternaria: species, formae speciales or pathotypes?. Studies in Mycology, 82: 1-21. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16659] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=165; TAXLABELS Alternaria_aff._arborescens_CBS105_24_ Alternaria_aff._arborescens_CBS105_49 Alternaria_aff._arborescens_CBS108_41 Alternaria_aff._arborescens_CBS109730 Alternaria_aff._arborescens_CBS112633 Alternaria_aff._arborescens_CBS112749 Alternaria_aff._arborescens_CBS113_41 Alternaria_aff._arborescens_CBS115189 Alternaria_aff._arborescens_CBS115516 Alternaria_aff._arborescens_CBS115517 Alternaria_aff._arborescens_CBS116329 Alternaria_aff._arborescens_CBS117587 Alternaria_aff._arborescens_CBS118389 Alternaria_aff._arborescens_CBS123235 Alternaria_aff._arborescens_CBS123266 Alternaria_aff._arborescens_CBS123267 Alternaria_aff._arborescens_CBS124274 Alternaria_aff._arborescens_CBS124281 Alternaria_aff._arborescens_CBS124282 Alternaria_aff._arborescens_CBS124283 Alternaria_aff._arborescens_CBS126_60 Alternaria_aff._arborescens_CBS127263 Alternaria_aff._arborescens_CBS750_68 Alternaria_aff._arborescens_CPC25266 Alternaria_alstroemeriae__CBS118808 Alternaria_alternantherae__CBS124392 Alternaria_alternata_CBS102_47 Alternaria_alternata_CBS102595 Alternaria_alternata_CBS102596 Alternaria_alternata_CBS102598 Alternaria_alternata_CBS102599 Alternaria_alternata_CBS102600 Alternaria_alternata_CBS102602 Alternaria_alternata_CBS102603 Alternaria_alternata_CBS102604 Alternaria_alternata_CBS103_33 Alternaria_alternata_CBS104_26_ Alternaria_alternata_CBS106_24 Alternaria_alternata_CBS106_34 Alternaria_alternata_CBS107_27 Alternaria_alternata_CBS107_53_ Alternaria_alternata_CBS109455 Alternaria_alternata_CBS109803 Alternaria_alternata_CBS110027 Alternaria_alternata_CBS110977 Alternaria_alternata_CBS112249 Alternaria_alternata_CBS112251 Alternaria_alternata_CBS112252 Alternaria_alternata_CBS113013 Alternaria_alternata_CBS113014 Alternaria_alternata_CBS113015 Alternaria_alternata_CBS113024 Alternaria_alternata_CBS113025 Alternaria_alternata_CBS113054 Alternaria_alternata_CBS115069 Alternaria_alternata_CBS115152 Alternaria_alternata_CBS115188 Alternaria_alternata_CBS115190 Alternaria_alternata_CBS115199 Alternaria_alternata_CBS115200 Alternaria_alternata_CBS115616 Alternaria_alternata_CBS116749 Alternaria_alternata_CBS117_44 Alternaria_alternata_CBS117130 Alternaria_alternata_CBS117143 Alternaria_alternata_CBS118811 Alternaria_alternata_CBS118812 Alternaria_alternata_CBS118814 Alternaria_alternata_CBS118815 Alternaria_alternata_CBS118818 Alternaria_alternata_CBS119115 Alternaria_alternata_CBS119399 Alternaria_alternata_CBS119408 Alternaria_alternata_CBS119543 Alternaria_alternata_CBS120829 Alternaria_alternata_CBS121336 Alternaria_alternata_CBS121344 Alternaria_alternata_CBS121346 Alternaria_alternata_CBS121348 Alternaria_alternata_CBS121454 Alternaria_alternata_CBS121455 Alternaria_alternata_CBS121456 Alternaria_alternata_CBS121492 Alternaria_alternata_CBS121544 Alternaria_alternata_CBS121547 Alternaria_alternata_CBS124277 Alternaria_alternata_CBS124278 Alternaria_alternata_CBS125606 Alternaria_alternata_CBS126071 Alternaria_alternata_CBS126072 Alternaria_alternata_CBS126908 Alternaria_alternata_CBS126910 Alternaria_alternata_CBS127334 Alternaria_alternata_CBS127671 Alternaria_alternata_CBS127672 Alternaria_alternata_CBS130254 Alternaria_alternata_CBS130255 Alternaria_alternata_CBS130258 Alternaria_alternata_CBS130259 Alternaria_alternata_CBS130260 Alternaria_alternata_CBS130261 Alternaria_alternata_CBS130262 Alternaria_alternata_CBS130263 Alternaria_alternata_CBS130265 Alternaria_alternata_CBS154_31 Alternaria_alternata_CBS174_52 Alternaria_alternata_CBS175_52 Alternaria_alternata_CBS175_80 Alternaria_alternata_CBS192_81 Alternaria_alternata_CBS194_86 Alternaria_alternata_CBS195_86 Alternaria_alternata_CBS198_74 Alternaria_alternata_CBS267_77 Alternaria_alternata_CBS447_86 Alternaria_alternata_CBS479_90 Alternaria_alternata_CBS595_93 Alternaria_alternata_CBS603_78 Alternaria_alternata_CBS612_72 Alternaria_alternata_CBS620_83 Alternaria_alternata_CBS639_97 Alternaria_alternata_CBS686_68 Alternaria_alternata_CBS795_72 Alternaria_alternata_CBS806_96 Alternaria_alternata_CBS826_68 Alternaria_alternata_CBS877_95 Alternaria_alternata_CBS911_97 Alternaria_alternata_CBS916_96 Alternaria_alternata_CBS918_96 Alternaria_alternata_CBS965_95 Alternaria_alternata_CBS966_95 Alternaria_arborescens_CBS102605_ Alternaria_betae_kenyensis__CBS118810 Alternaria_burnsii_CBS107_38_ Alternaria_burnsii_CBS108_27 Alternaria_burnsii_CBS110_50 Alternaria_burnsii_CBS118816 Alternaria_burnsii_CBS118817 Alternaria_burnsii_CBS130264 Alternaria_burnsii_CBS879_95 Alternaria_cerealis_CBS119544 Alternaria_eichhorniae__CBS489_92 Alternaria_gaisen__CBS118488 Alternaria_gaisen__CBS632_93 Alternaria_gaisen_CPC25268 Alternaria_geophila_CBS101_13_ Alternaria_gossypina_CBS100_23 Alternaria_gossypina_CBS102597 Alternaria_gossypina_CBS102601 Alternaria_gossypina_CBS104_32_ Alternaria_gossypina_CBS107_36_ Alternaria_iridiaustralis_CBS118404_ Alternaria_iridiaustralis_CBS118486 Alternaria_iridiaustralis_CBS118487 Alternaria_jacinthicola_CBS133751 Alternaria_jacinthicola_CBS878_95 Alternaria_jacinthicola_CPC25267 Alternaria_longipes__CBS113_35 Alternaria_longipes__CBS121332 Alternaria_longipes__CBS121333 Alternaria_longipes__CBS539_94 Alternaria_longipes__CBS540_94 Alternaria_longipes__CBS917_96 Alternaria_senecionicola_CBS119545 Alternaria_tomato__CBS114_35 Alternaria_tomato_CBS103_30 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=168; TAXLABELS Alternaria_aff._arborescens_CBS105_24_ Alternaria_aff._arborescens_CBS105_49 Alternaria_aff._arborescens_CBS108_41 Alternaria_aff._arborescens_CBS109730 Alternaria_aff._arborescens_CBS112633 Alternaria_aff._arborescens_CBS112749 Alternaria_aff._arborescens_CBS113_41 Alternaria_aff._arborescens_CBS115189 Alternaria_aff._arborescens_CBS115516 Alternaria_aff._arborescens_CBS115517 Alternaria_aff._arborescens_CBS116329 Alternaria_aff._arborescens_CBS117587 Alternaria_aff._arborescens_CBS118389 Alternaria_aff._arborescens_CBS123235 Alternaria_aff._arborescens_CBS123266 Alternaria_aff._arborescens_CBS123267 Alternaria_aff._arborescens_CBS124274 Alternaria_aff._arborescens_CBS124281 Alternaria_aff._arborescens_CBS124282 Alternaria_aff._arborescens_CBS124283 Alternaria_aff._arborescens_CBS126_60 Alternaria_aff._arborescens_CBS127263 Alternaria_aff._arborescens_CBS750_68 Alternaria_aff._arborescens_CPC25266 Alternaria_alstroemeriae__CBS118808 Alternaria_alstroemeriae__CBS118809 Alternaria_alternantherae__CBS124392 Alternaria_alternata_CBS102_47 Alternaria_alternata_CBS102595 Alternaria_alternata_CBS102596 Alternaria_alternata_CBS102598 Alternaria_alternata_CBS102599 Alternaria_alternata_CBS102600 Alternaria_alternata_CBS102602 Alternaria_alternata_CBS102603 Alternaria_alternata_CBS102604 Alternaria_alternata_CBS103_33 Alternaria_alternata_CBS104_26_ Alternaria_alternata_CBS106_24 Alternaria_alternata_CBS106_34 Alternaria_alternata_CBS107_27 Alternaria_alternata_CBS107_53_ Alternaria_alternata_CBS109455 Alternaria_alternata_CBS109803 Alternaria_alternata_CBS110027 Alternaria_alternata_CBS110977 Alternaria_alternata_CBS112249 Alternaria_alternata_CBS112251 Alternaria_alternata_CBS112252 Alternaria_alternata_CBS113013 Alternaria_alternata_CBS113014 Alternaria_alternata_CBS113015 Alternaria_alternata_CBS113024 Alternaria_alternata_CBS113025 Alternaria_alternata_CBS113054 Alternaria_alternata_CBS115069 Alternaria_alternata_CBS115152 Alternaria_alternata_CBS115188 Alternaria_alternata_CBS115190 Alternaria_alternata_CBS115199 Alternaria_alternata_CBS115200 Alternaria_alternata_CBS115616 Alternaria_alternata_CBS116749 Alternaria_alternata_CBS117_44 Alternaria_alternata_CBS117130 Alternaria_alternata_CBS117143 Alternaria_alternata_CBS118811 Alternaria_alternata_CBS118812 Alternaria_alternata_CBS118814 Alternaria_alternata_CBS118815 Alternaria_alternata_CBS118818 Alternaria_alternata_CBS119115 Alternaria_alternata_CBS119399 Alternaria_alternata_CBS119408 Alternaria_alternata_CBS119543 Alternaria_alternata_CBS120829 Alternaria_alternata_CBS121336 Alternaria_alternata_CBS121344 Alternaria_alternata_CBS121346 Alternaria_alternata_CBS121348 Alternaria_alternata_CBS121454 Alternaria_alternata_CBS121455 Alternaria_alternata_CBS121456 Alternaria_alternata_CBS121492 Alternaria_alternata_CBS121544 Alternaria_alternata_CBS121547 Alternaria_alternata_CBS124277 Alternaria_alternata_CBS124278 Alternaria_alternata_CBS125606 Alternaria_alternata_CBS126071 Alternaria_alternata_CBS126072 Alternaria_alternata_CBS126908 Alternaria_alternata_CBS126910 Alternaria_alternata_CBS127334 Alternaria_alternata_CBS127671 Alternaria_alternata_CBS127672 Alternaria_alternata_CBS130254 Alternaria_alternata_CBS130255 Alternaria_alternata_CBS130258 Alternaria_alternata_CBS130259 Alternaria_alternata_CBS130260 Alternaria_alternata_CBS130261 Alternaria_alternata_CBS130262 Alternaria_alternata_CBS130263 Alternaria_alternata_CBS130265 Alternaria_alternata_CBS154_31 Alternaria_alternata_CBS174_52 Alternaria_alternata_CBS175_52 Alternaria_alternata_CBS175_80 Alternaria_alternata_CBS192_81 Alternaria_alternata_CBS194_86 Alternaria_alternata_CBS195_86 Alternaria_alternata_CBS198_74 Alternaria_alternata_CBS267_77 Alternaria_alternata_CBS447_86 Alternaria_alternata_CBS479_90 Alternaria_alternata_CBS595_93 Alternaria_alternata_CBS603_78 Alternaria_alternata_CBS612_72 Alternaria_alternata_CBS620_83 Alternaria_alternata_CBS639_97 Alternaria_alternata_CBS686_68 Alternaria_alternata_CBS795_72 Alternaria_alternata_CBS806_96 Alternaria_alternata_CBS826_68 Alternaria_alternata_CBS877_95 Alternaria_alternata_CBS880_95 Alternaria_alternata_CBS911_97 Alternaria_alternata_CBS916_96 Alternaria_alternata_CBS918_96 Alternaria_alternata_CBS965_95 Alternaria_alternata_CBS966_95 Alternaria_arborescens_CBS102605_ Alternaria_betae_kenyensis__CBS118810 Alternaria_burnsii_CBS107_38_ Alternaria_burnsii_CBS108_27 Alternaria_burnsii_CBS110_50 Alternaria_burnsii_CBS118816 Alternaria_burnsii_CBS118817 Alternaria_burnsii_CBS130264 Alternaria_burnsii_CBS879_95 Alternaria_cerealis_CBS119544 Alternaria_eichhorniae__CBS119778 Alternaria_eichhorniae__CBS489_92 Alternaria_gaisen__CBS118488 Alternaria_gaisen__CBS632_93 Alternaria_gaisen_CPC25268 Alternaria_geophila_CBS101_13_ Alternaria_gossypina_CBS100_23 Alternaria_gossypina_CBS102597 Alternaria_gossypina_CBS102601 Alternaria_gossypina_CBS104_32_ Alternaria_gossypina_CBS107_36_ Alternaria_iridiaustralis_CBS118404_ Alternaria_iridiaustralis_CBS118486 Alternaria_iridiaustralis_CBS118487 Alternaria_jacinthicola_CBS133751 Alternaria_jacinthicola_CBS878_95 Alternaria_jacinthicola_CPC25267 Alternaria_longipes__CBS113_35 Alternaria_longipes__CBS121332 Alternaria_longipes__CBS121333 Alternaria_longipes__CBS539_94 Alternaria_longipes__CBS540_94 Alternaria_longipes__CBS917_96 Alternaria_senecionicola_CBS119545 Alternaria_tomato__CBS114_35 Alternaria_tomato_CBS103_30 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=167; TAXLABELS Alternaria_aff._arborescens_CBS105_24_ Alternaria_aff._arborescens_CBS105_49 Alternaria_aff._arborescens_CBS108_41 Alternaria_aff._arborescens_CBS109730 Alternaria_aff._arborescens_CBS112633 Alternaria_aff._arborescens_CBS112749 Alternaria_aff._arborescens_CBS113_41 Alternaria_aff._arborescens_CBS115189 Alternaria_aff._arborescens_CBS115516 Alternaria_aff._arborescens_CBS115517 Alternaria_aff._arborescens_CBS116329 Alternaria_aff._arborescens_CBS117587 Alternaria_aff._arborescens_CBS118389 Alternaria_aff._arborescens_CBS123235 Alternaria_aff._arborescens_CBS123266 Alternaria_aff._arborescens_CBS123267 Alternaria_aff._arborescens_CBS124274 Alternaria_aff._arborescens_CBS124281 Alternaria_aff._arborescens_CBS124282 Alternaria_aff._arborescens_CBS124283 Alternaria_aff._arborescens_CBS126_60 Alternaria_aff._arborescens_CBS127263 Alternaria_aff._arborescens_CBS750_68 Alternaria_aff._arborescens_CPC25266 Alternaria_alstroemeriae__CBS118808 Alternaria_alstroemeriae__CBS118809 Alternaria_alternata_CBS102_47 Alternaria_alternata_CBS102595 Alternaria_alternata_CBS102596 Alternaria_alternata_CBS102598 Alternaria_alternata_CBS102599 Alternaria_alternata_CBS102600 Alternaria_alternata_CBS102602 Alternaria_alternata_CBS102603 Alternaria_alternata_CBS102604 Alternaria_alternata_CBS103_33 Alternaria_alternata_CBS104_26_ Alternaria_alternata_CBS106_24 Alternaria_alternata_CBS106_34 Alternaria_alternata_CBS107_27 Alternaria_alternata_CBS107_53_ Alternaria_alternata_CBS109455 Alternaria_alternata_CBS109803 Alternaria_alternata_CBS110027 Alternaria_alternata_CBS110977 Alternaria_alternata_CBS112249 Alternaria_alternata_CBS112251 Alternaria_alternata_CBS112252 Alternaria_alternata_CBS113013 Alternaria_alternata_CBS113014 Alternaria_alternata_CBS113015 Alternaria_alternata_CBS113024 Alternaria_alternata_CBS113025 Alternaria_alternata_CBS113054 Alternaria_alternata_CBS115069 Alternaria_alternata_CBS115152 Alternaria_alternata_CBS115188 Alternaria_alternata_CBS115190 Alternaria_alternata_CBS115199 Alternaria_alternata_CBS115200 Alternaria_alternata_CBS115616 Alternaria_alternata_CBS116749 Alternaria_alternata_CBS117_44 Alternaria_alternata_CBS117130 Alternaria_alternata_CBS117143 Alternaria_alternata_CBS118811 Alternaria_alternata_CBS118812 Alternaria_alternata_CBS118814 Alternaria_alternata_CBS118815 Alternaria_alternata_CBS118818 Alternaria_alternata_CBS119115 Alternaria_alternata_CBS119399 Alternaria_alternata_CBS119408 Alternaria_alternata_CBS119543 Alternaria_alternata_CBS120829 Alternaria_alternata_CBS121336 Alternaria_alternata_CBS121344 Alternaria_alternata_CBS121346 Alternaria_alternata_CBS121348 Alternaria_alternata_CBS121454 Alternaria_alternata_CBS121455 Alternaria_alternata_CBS121456 Alternaria_alternata_CBS121492 Alternaria_alternata_CBS121544 Alternaria_alternata_CBS121547 Alternaria_alternata_CBS124277 Alternaria_alternata_CBS124278 Alternaria_alternata_CBS125606 Alternaria_alternata_CBS126071 Alternaria_alternata_CBS126072 Alternaria_alternata_CBS126908 Alternaria_alternata_CBS126910 Alternaria_alternata_CBS127334 Alternaria_alternata_CBS127671 Alternaria_alternata_CBS127672 Alternaria_alternata_CBS130254 Alternaria_alternata_CBS130255 Alternaria_alternata_CBS130258 Alternaria_alternata_CBS130259 Alternaria_alternata_CBS130260 Alternaria_alternata_CBS130261 Alternaria_alternata_CBS130262 Alternaria_alternata_CBS130263 Alternaria_alternata_CBS130265 Alternaria_alternata_CBS154_31 Alternaria_alternata_CBS174_52 Alternaria_alternata_CBS175_52 Alternaria_alternata_CBS175_80 Alternaria_alternata_CBS192_81 Alternaria_alternata_CBS194_86 Alternaria_alternata_CBS195_86 Alternaria_alternata_CBS198_74 Alternaria_alternata_CBS267_77 Alternaria_alternata_CBS447_86 Alternaria_alternata_CBS479_90 Alternaria_alternata_CBS595_93 Alternaria_alternata_CBS603_78 Alternaria_alternata_CBS612_72 Alternaria_alternata_CBS620_83 Alternaria_alternata_CBS639_97 Alternaria_alternata_CBS686_68 Alternaria_alternata_CBS795_72 Alternaria_alternata_CBS806_96 Alternaria_alternata_CBS826_68 Alternaria_alternata_CBS877_95 Alternaria_alternata_CBS880_95 Alternaria_alternata_CBS911_97 Alternaria_alternata_CBS916_96 Alternaria_alternata_CBS918_96 Alternaria_alternata_CBS965_95 Alternaria_alternata_CBS966_95 Alternaria_arborescens_CBS102605_ Alternaria_betae_kenyensis__CBS118810 Alternaria_burnsii_CBS107_38_ Alternaria_burnsii_CBS108_27 Alternaria_burnsii_CBS110_50 Alternaria_burnsii_CBS118816 Alternaria_burnsii_CBS118817 Alternaria_burnsii_CBS130264 Alternaria_burnsii_CBS879_95 Alternaria_cerealis_CBS119544 Alternaria_eichhorniae__CBS119778 Alternaria_eichhorniae__CBS489_92 Alternaria_gaisen__CBS118488 Alternaria_gaisen__CBS632_93 Alternaria_gaisen_CPC25268 Alternaria_geophila_CBS101_13_ Alternaria_gossypina_CBS100_23 Alternaria_gossypina_CBS102597 Alternaria_gossypina_CBS102601 Alternaria_gossypina_CBS104_32_ Alternaria_gossypina_CBS107_36_ Alternaria_iridiaustralis_CBS118404_ Alternaria_iridiaustralis_CBS118486 Alternaria_iridiaustralis_CBS118487 Alternaria_jacinthicola_CBS133751 Alternaria_jacinthicola_CBS878_95 Alternaria_jacinthicola_CPC25267 Alternaria_longipes__CBS113_35 Alternaria_longipes__CBS121332 Alternaria_longipes__CBS121333 Alternaria_longipes__CBS539_94 Alternaria_longipes__CBS540_94 Alternaria_longipes__CBS917_96 Alternaria_senecionicola_CBS119545 Alternaria_tomato__CBS114_35 Alternaria_tomato_CBS103_30 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=164; TAXLABELS Alternaria_aff._arborescens_CBS105_24_ Alternaria_aff._arborescens_CBS105_49 Alternaria_aff._arborescens_CBS108_41 Alternaria_aff._arborescens_CBS109730 Alternaria_aff._arborescens_CBS112633 Alternaria_aff._arborescens_CBS112749 Alternaria_aff._arborescens_CBS113_41 Alternaria_aff._arborescens_CBS115189 Alternaria_aff._arborescens_CBS115516 Alternaria_aff._arborescens_CBS115517 Alternaria_aff._arborescens_CBS116329 Alternaria_aff._arborescens_CBS117587 Alternaria_aff._arborescens_CBS118389 Alternaria_aff._arborescens_CBS123235 Alternaria_aff._arborescens_CBS123266 Alternaria_aff._arborescens_CBS123267 Alternaria_aff._arborescens_CBS124274 Alternaria_aff._arborescens_CBS124281 Alternaria_aff._arborescens_CBS124282 Alternaria_aff._arborescens_CBS124283 Alternaria_aff._arborescens_CBS126_60 Alternaria_aff._arborescens_CBS127263 Alternaria_aff._arborescens_CBS750_68 Alternaria_aff._arborescens_CPC25266 Alternaria_alstroemeriae__CBS118808 Alternaria_alstroemeriae__CBS118809 Alternaria_alternata_CBS102_47 Alternaria_alternata_CBS102595 Alternaria_alternata_CBS102596 Alternaria_alternata_CBS102598 Alternaria_alternata_CBS102599 Alternaria_alternata_CBS102600 Alternaria_alternata_CBS102602 Alternaria_alternata_CBS102603 Alternaria_alternata_CBS102604 Alternaria_alternata_CBS103_33 Alternaria_alternata_CBS104_26_ Alternaria_alternata_CBS106_24 Alternaria_alternata_CBS106_34 Alternaria_alternata_CBS107_27 Alternaria_alternata_CBS107_53_ Alternaria_alternata_CBS109455 Alternaria_alternata_CBS109803 Alternaria_alternata_CBS110027 Alternaria_alternata_CBS110977 Alternaria_alternata_CBS112249 Alternaria_alternata_CBS112251 Alternaria_alternata_CBS112252 Alternaria_alternata_CBS113013 Alternaria_alternata_CBS113014 Alternaria_alternata_CBS113015 Alternaria_alternata_CBS113024 Alternaria_alternata_CBS113025 Alternaria_alternata_CBS113054 Alternaria_alternata_CBS115069 Alternaria_alternata_CBS115152 Alternaria_alternata_CBS115188 Alternaria_alternata_CBS115190 Alternaria_alternata_CBS115199 Alternaria_alternata_CBS115200 Alternaria_alternata_CBS115616 Alternaria_alternata_CBS116749 Alternaria_alternata_CBS117_44 Alternaria_alternata_CBS117130 Alternaria_alternata_CBS117143 Alternaria_alternata_CBS118811 Alternaria_alternata_CBS118812 Alternaria_alternata_CBS118814 Alternaria_alternata_CBS118815 Alternaria_alternata_CBS118818 Alternaria_alternata_CBS119399 Alternaria_alternata_CBS119408 Alternaria_alternata_CBS119543 Alternaria_alternata_CBS120829 Alternaria_alternata_CBS121336 Alternaria_alternata_CBS121344 Alternaria_alternata_CBS121346 Alternaria_alternata_CBS121348 Alternaria_alternata_CBS121454 Alternaria_alternata_CBS121455 Alternaria_alternata_CBS121456 Alternaria_alternata_CBS121492 Alternaria_alternata_CBS121544 Alternaria_alternata_CBS121547 Alternaria_alternata_CBS124277 Alternaria_alternata_CBS124278 Alternaria_alternata_CBS125606 Alternaria_alternata_CBS126071 Alternaria_alternata_CBS126072 Alternaria_alternata_CBS126908 Alternaria_alternata_CBS126910 Alternaria_alternata_CBS127334 Alternaria_alternata_CBS127671 Alternaria_alternata_CBS127672 Alternaria_alternata_CBS130254 Alternaria_alternata_CBS130255 Alternaria_alternata_CBS130258 Alternaria_alternata_CBS130259 Alternaria_alternata_CBS130260 Alternaria_alternata_CBS130261 Alternaria_alternata_CBS130262 Alternaria_alternata_CBS130263 Alternaria_alternata_CBS130265 Alternaria_alternata_CBS154_31 Alternaria_alternata_CBS174_52 Alternaria_alternata_CBS175_52 Alternaria_alternata_CBS175_80 Alternaria_alternata_CBS192_81 Alternaria_alternata_CBS194_86 Alternaria_alternata_CBS195_86 Alternaria_alternata_CBS198_74 Alternaria_alternata_CBS267_77 Alternaria_alternata_CBS447_86 Alternaria_alternata_CBS479_90 Alternaria_alternata_CBS595_93 Alternaria_alternata_CBS603_78 Alternaria_alternata_CBS612_72 Alternaria_alternata_CBS620_83 Alternaria_alternata_CBS639_97 Alternaria_alternata_CBS686_68 Alternaria_alternata_CBS795_72 Alternaria_alternata_CBS806_96 Alternaria_alternata_CBS880_95 Alternaria_alternata_CBS911_97 Alternaria_alternata_CBS916_96 Alternaria_alternata_CBS918_96 Alternaria_alternata_CBS965_95 Alternaria_alternata_CBS966_95 Alternaria_arborescens_CBS102605_ Alternaria_betae_kenyensis__CBS118810 Alternaria_burnsii_CBS107_38_ Alternaria_burnsii_CBS108_27 Alternaria_burnsii_CBS110_50 Alternaria_burnsii_CBS118816 Alternaria_burnsii_CBS118817 Alternaria_burnsii_CBS130264 Alternaria_burnsii_CBS879_95 Alternaria_cerealis_CBS119544 Alternaria_eichhorniae__CBS119778 Alternaria_eichhorniae__CBS489_92 Alternaria_gaisen__CBS118488 Alternaria_gaisen__CBS632_93 Alternaria_gaisen_CPC25268 Alternaria_geophila_CBS101_13_ Alternaria_gossypina_CBS100_23 Alternaria_gossypina_CBS102597 Alternaria_gossypina_CBS102601 Alternaria_gossypina_CBS104_32_ Alternaria_gossypina_CBS107_36_ Alternaria_iridiaustralis_CBS118404_ Alternaria_iridiaustralis_CBS118486 Alternaria_iridiaustralis_CBS118487 Alternaria_jacinthicola_CBS133751 Alternaria_jacinthicola_CBS878_95 Alternaria_jacinthicola_CPC25267 Alternaria_longipes__CBS113_35 Alternaria_longipes__CBS121332 Alternaria_longipes__CBS121333 Alternaria_longipes__CBS539_94 Alternaria_longipes__CBS540_94 Alternaria_longipes__CBS917_96 Alternaria_senecionicola_CBS119545 Alternaria_tomato__CBS114_35 Alternaria_tomato_CBS103_30 ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=49; TAXLABELS Alternaria_alstroemeriae_CBS118809 Alternaria_alternantherae_CBS124392 Alternaria_alternata_CBS102595 Alternaria_alternata_CBS102596 Alternaria_alternata_CBS102598 Alternaria_alternata_CBS102599 Alternaria_alternata_CBS102600 Alternaria_alternata_CBS102602 Alternaria_alternata_CBS102604 Alternaria_alternata_CBS103_33 Alternaria_alternata_CBS117_44 Alternaria_alternata_CBS118811 Alternaria_alternata_CBS118812 Alternaria_alternata_CBS118814 Alternaria_alternata_CBS118818 Alternaria_alternata_CBS119399 Alternaria_alternata_CBS119408 Alternaria_alternata_CBS119543 Alternaria_alternata_CBS121336 Alternaria_alternata_CBS121348 Alternaria_alternata_CBS121454 Alternaria_alternata_CBS121455 Alternaria_alternata_CBS121456 Alternaria_alternata_CBS194_86 Alternaria_alternata_CBS195_86 Alternaria_alternata_CBS479_90 Alternaria_alternata_CBS916_96 Alternaria_alternata_CBS918_96 Alternaria_arborescens_CBS102605 Alternaria_betaekenyensis_CBS118810 Alternaria_burnsii_CBS107_38 Alternaria_burnsii_CBS118816 Alternaria_burnsii_CBS118817 Alternaria_cerealis_CBS119544 Alternaria_eichhorniae_CBS119778 Alternaria_eichhorniae_CBS489_92 Alternaria_gaisen_CBS118488 Alternaria_gaisen_CBS632_93 Alternaria_geophila_CBS101_13 Alternaria_gossypina_CBS102597 Alternaria_gossypina_CBS102601 Alternaria_iridiaustralis_CBS118404 Alternaria_jacinthicola_CBS133751 Alternaria_jacinthicola_CBS878_95 Alternaria_jacinthicola_CPC25267 Alternaria_longipes_CBS540_94 Alternaria_senecionicola_CBS119545 Alternaria_tomato_CBS103_30 Alternaria_tomato_CBS114_35 ; END; BEGIN TAXA; TITLE Taxa6; DIMENSIONS NTAX=43; TAXLABELS Alternaria_alternantherae_CBS124392 Alternaria_alternata_CBS102595 Alternaria_alternata_CBS102596 Alternaria_alternata_CBS102598 Alternaria_alternata_CBS102599 Alternaria_alternata_CBS102600 Alternaria_alternata_CBS102602 Alternaria_alternata_CBS102604 Alternaria_alternata_CBS103_33 Alternaria_alternata_CBS117_44 Alternaria_alternata_CBS118811 Alternaria_alternata_CBS118812 Alternaria_alternata_CBS118814 Alternaria_alternata_CBS118818 Alternaria_alternata_CBS119399 Alternaria_alternata_CBS119408 Alternaria_alternata_CBS119543 Alternaria_alternata_CBS121336 Alternaria_alternata_CBS121348 Alternaria_alternata_CBS121454 Alternaria_alternata_CBS121455 Alternaria_alternata_CBS121456 Alternaria_alternata_CBS194_86 Alternaria_alternata_CBS19586 Alternaria_alternata_CBS479_90 Alternaria_alternata_CBS916_96 Alternaria_alternata_CBS918_96 Alternaria_arborescens_CBS102605 Alternaria_betae_kenyensis_CBS118810 Alternaria_burnsii_CBS118816 Alternaria_burnsii_CBS118817 Alternaria_cerealis_CBS119544 Alternaria_eichhorniae_CBS119778 Alternaria_eichhorniae_CBS489_92 Alternaria_gaisen_CBS118488 Alternaria_gaisen_CBS632_93 Alternaria_geophila_CBS101_13 Alternaria_gossypina_CBS102597 Alternaria_gossypina_CBS102601 Alternaria_longipes_CBS540_94 Alternaria_senecionicola_CBS119545 Alternaria_tomato_CBS103_30 Alternaria_tomato_CBS114_35 ; END; BEGIN TAXA; TITLE Taxa7; DIMENSIONS NTAX=166; TAXLABELS Alternaria_aff._arborescens_CBS105_24_ Alternaria_aff._arborescens_CBS105_49 Alternaria_aff._arborescens_CBS108_41 Alternaria_aff._arborescens_CBS109730 Alternaria_aff._arborescens_CBS112633 Alternaria_aff._arborescens_CBS112749 Alternaria_aff._arborescens_CBS113_41 Alternaria_aff._arborescens_CBS115189 Alternaria_aff._arborescens_CBS115516 Alternaria_aff._arborescens_CBS115517 Alternaria_aff._arborescens_CBS116329 Alternaria_aff._arborescens_CBS117587 Alternaria_aff._arborescens_CBS118389 Alternaria_aff._arborescens_CBS123235 Alternaria_aff._arborescens_CBS123266 Alternaria_aff._arborescens_CBS123267 Alternaria_aff._arborescens_CBS124281 Alternaria_aff._arborescens_CBS124282 Alternaria_aff._arborescens_CBS124283 Alternaria_aff._arborescens_CBS126_60 Alternaria_aff._arborescens_CBS127263 Alternaria_aff._arborescens_CBS750_68 Alternaria_aff._arborescens_CPC25266 Alternaria_alstroemeriae__CBS118808 Alternaria_alstroemeriae__CBS118809 Alternaria_alternantherae__CBS124392 Alternaria_alternata_CBS102_47 Alternaria_alternata_CBS102595 Alternaria_alternata_CBS102596 Alternaria_alternata_CBS102598 Alternaria_alternata_CBS102599 Alternaria_alternata_CBS102600 Alternaria_alternata_CBS102602 Alternaria_alternata_CBS102603 Alternaria_alternata_CBS102604 Alternaria_alternata_CBS103_33 Alternaria_alternata_CBS104_26_ Alternaria_alternata_CBS106_24 Alternaria_alternata_CBS106_34 Alternaria_alternata_CBS107_27 Alternaria_alternata_CBS107_53_ Alternaria_alternata_CBS109455 Alternaria_alternata_CBS109803 Alternaria_alternata_CBS110027 Alternaria_alternata_CBS110977 Alternaria_alternata_CBS112249 Alternaria_alternata_CBS112251 Alternaria_alternata_CBS112252 Alternaria_alternata_CBS113013 Alternaria_alternata_CBS113014 Alternaria_alternata_CBS113015 Alternaria_alternata_CBS113024 Alternaria_alternata_CBS113025 Alternaria_alternata_CBS113054 Alternaria_alternata_CBS115069 Alternaria_alternata_CBS115152 Alternaria_alternata_CBS115188 Alternaria_alternata_CBS115190 Alternaria_alternata_CBS115199 Alternaria_alternata_CBS115200 Alternaria_alternata_CBS115616 Alternaria_alternata_CBS116749 Alternaria_alternata_CBS117_44 Alternaria_alternata_CBS117130 Alternaria_alternata_CBS117143 Alternaria_alternata_CBS118811 Alternaria_alternata_CBS118812 Alternaria_alternata_CBS118814 Alternaria_alternata_CBS118815 Alternaria_alternata_CBS118818 Alternaria_alternata_CBS119115 Alternaria_alternata_CBS119399 Alternaria_alternata_CBS119408 Alternaria_alternata_CBS119543 Alternaria_alternata_CBS120829 Alternaria_alternata_CBS121336 Alternaria_alternata_CBS121344 Alternaria_alternata_CBS121346 Alternaria_alternata_CBS121348 Alternaria_alternata_CBS121454 Alternaria_alternata_CBS121455 Alternaria_alternata_CBS121456 Alternaria_alternata_CBS121492 Alternaria_alternata_CBS121544 Alternaria_alternata_CBS121547 Alternaria_alternata_CBS124277 Alternaria_alternata_CBS124278 Alternaria_alternata_CBS125606 Alternaria_alternata_CBS126071 Alternaria_alternata_CBS126072 Alternaria_alternata_CBS126908 Alternaria_alternata_CBS126910 Alternaria_alternata_CBS127334 Alternaria_alternata_CBS127671 Alternaria_alternata_CBS127672 Alternaria_alternata_CBS130254 Alternaria_alternata_CBS130255 Alternaria_alternata_CBS130258 Alternaria_alternata_CBS130259 Alternaria_alternata_CBS130260 Alternaria_alternata_CBS130261 Alternaria_alternata_CBS130262 Alternaria_alternata_CBS130263 Alternaria_alternata_CBS130265 Alternaria_alternata_CBS154_31 Alternaria_alternata_CBS174_52 Alternaria_alternata_CBS175_52 Alternaria_alternata_CBS175_80 Alternaria_alternata_CBS192_81 Alternaria_alternata_CBS194_86 Alternaria_alternata_CBS195_86 Alternaria_alternata_CBS267_77 Alternaria_alternata_CBS447_86 Alternaria_alternata_CBS479_90 Alternaria_alternata_CBS595_93 Alternaria_alternata_CBS603_78 Alternaria_alternata_CBS612_72 Alternaria_alternata_CBS620_83 Alternaria_alternata_CBS639_97 Alternaria_alternata_CBS686_68 Alternaria_alternata_CBS795_72 Alternaria_alternata_CBS806_96 Alternaria_alternata_CBS826_68 Alternaria_alternata_CBS877_95 Alternaria_alternata_CBS880_95 Alternaria_alternata_CBS911_97 Alternaria_alternata_CBS916_96 Alternaria_alternata_CBS918_96 Alternaria_alternata_CBS965_95 Alternaria_alternata_CBS966_95 Alternaria_arborescens_CBS102605_ Alternaria_betae_kenyensis__CBS118810 Alternaria_burnsii_CBS107_38_ Alternaria_burnsii_CBS108_27 Alternaria_burnsii_CBS110_50 Alternaria_burnsii_CBS118816 Alternaria_burnsii_CBS118817 Alternaria_burnsii_CBS130264 Alternaria_burnsii_CBS879_95 Alternaria_cerealis_CBS119544 Alternaria_eichhorniae__CBS119778 Alternaria_eichhorniae__CBS489_92 Alternaria_gaisen__CBS118488 Alternaria_gaisen__CBS632_93 Alternaria_gaisen_CPC25268 Alternaria_geophila_CBS101_13_ Alternaria_gossypina_CBS100_23 Alternaria_gossypina_CBS102597 Alternaria_gossypina_CBS102601 Alternaria_gossypina_CBS104_32_ Alternaria_gossypina_CBS107_36_ Alternaria_iridiaustralis_CBS118404_ Alternaria_iridiaustralis_CBS118486 Alternaria_iridiaustralis_CBS118487 Alternaria_jacinthicola_CBS133751 Alternaria_jacinthicola_CBS878_95 Alternaria_jacinthicola_CPC25267 Alternaria_longipes__CBS113_35 Alternaria_longipes__CBS121332 Alternaria_longipes__CBS121333 Alternaria_longipes__CBS539_94 Alternaria_longipes__CBS540_94 Alternaria_longipes__CBS917_96 Alternaria_senecionicola_CBS119545 Alternaria_tomato__CBS114_35 Alternaria_tomato_CBS103_30 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24912] TITLE Alternaria_section_Alternaria_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=523; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS105_49 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS108_41 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS109730 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS112633 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS112749 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS113_41 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS115189 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS115516 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS115517 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS116329 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS117587 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS118389 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS123235 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS123266 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS123267 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS124274 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS124281 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS124282 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS124283 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS126_60 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS127263 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CBS750_68 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_aff._arborescens_CPC25266 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alstroemeriae__CBS118808 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alstroemeriae__CBS118809 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternantherae__CBS124392 ATCATTACACAGATATGAAGGCGGGGCTGGAACCTCTCGGGGTTGCAGTCTTGCTGAATTATTCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACAAAC-CATGAACCTTTTGTAATTGCAATCAGCGTCAGTAACAACACAATCATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGCATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTGTCTCTGGCTTTGCTGGAGACTCGCCTTAAAGGAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTTCCAGCCACGGTCTGGCATCCATGAAGCCTTTTTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102_47 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102595 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102596 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102598 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102599 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102600 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102602 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102603 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS102604 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAGC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC--TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS103_33 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS104_26_ ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS106_24 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS106_34 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS107_27 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS107_53_ ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS109455 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS109803 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC--TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS110027 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS110977 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS112249 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS112251 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGAGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC--TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS112252 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS113013 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS113014 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS113015 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS113024 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS113025 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS113054 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS115069 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS115152 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCACTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS115188 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS115190 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS115199 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS115200 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC--TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS115616 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS116749 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS117_44 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS117130 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS117143 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS118811 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS118812 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS118814 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS118815 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS118818 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS119115 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS119399 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS119408 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGAGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC--TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS119543 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS120829 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121336 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121344 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121346 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121348 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121454 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121455 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCACTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121456 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121492 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121544 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS121547 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS124277 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS124278 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS125606 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS126071 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS126072 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS126908 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS126910 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS127334 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS127671 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS127672 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130254 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130255 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130258 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130259 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130260 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130261 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130262 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130263 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS130265 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS154_31 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS174_52 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS175_52 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS175_80 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS192_81 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS194_86 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS195_86 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS198_74 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS267_77 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC-TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS447_86 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS479_90 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS595_93 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS603_78 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS612_72 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS620_83 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC--TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS639_97 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS686_68 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS795_72 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS806_96 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS826_68 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS877_95 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS880_95 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS911_97 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS916_96 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS918_96 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS965_95 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_alternata_CBS966_95 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_arborescens_CBS102605_ ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_betae_kenyensis__CBS118810 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_burnsii_CBS107_38_ ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_burnsii_CBS108_27 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_burnsii_CBS110_50 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_burnsii_CBS118816 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_burnsii_CBS118817 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_burnsii_CBS130264 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_burnsii_CBS879_95 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGCCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_cerealis_CBS119544 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_eichhorniae__CBS119778 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATCCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTTGCCCACCACAAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_eichhorniae__CBS489_92 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTTGCCCACCACAAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_gaisen__CBS118488 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_gaisen__CBS632_93 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_gaisen_CPC25268 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_geophila_CBS101_13_ ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_gossypina_CBS100_23 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_gossypina_CBS102597 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_gossypina_CBS102601 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_gossypina_CBS104_32_ ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_gossypina_CBS107_36_ ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_iridiaustralis_CBS118404_ ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCAATAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_iridiaustralis_CBS118486 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCAATAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_iridiaustralis_CBS118487 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCAATAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_jacinthicola_CBS133751 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_jacinthicola_CBS878_95 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_jacinthicola_CPC25267 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_longipes__CBS113_35 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTCCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_longipes__CBS121332 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTCCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_longipes__CBS121333 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTCCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_longipes__CBS539_94 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTCCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_longipes__CBS540_94 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTCCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_longipes__CBS917_96 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC---TTTTTTCCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_senecionicola_CBS119545 ATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_tomato__CBS114_35 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC Alternaria_tomato_CBS103_30 ATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC--ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAA-TTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCC----TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24917] TITLE Alternaria_section_Alternaria_TEF1; LINK TAXA = Taxa2; DIMENSIONS NCHAR=241; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 ] [ . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS105_49 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGTGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAGTGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS108_41 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS109730 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS112633 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS112749 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS113_41 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGCCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS115189 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS115516 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS115517 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS116329 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS117587 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS118389 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS123235 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGTGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS123266 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS123267 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGTGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS124274 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS124281 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS124282 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS124283 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGTGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS126_60 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS127263 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CBS750_68 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_aff._arborescens_CPC25266 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGCAGCCAGAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGCCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATCCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alstroemeriae__CBS118808 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCCCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCCCATGCGG-CCTTCGCGAACTCTAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACGGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alstroemeriae__CBS118809 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCCCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCCCATGCGG-CCTTCGCGAACTCTAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACGGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternantherae__CBS124392 TATGGCATTTCTCTTCTTTCACCCGGACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCACAGCCTGGCTTATCGCAATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGGACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATCCAATTCCCCCATGCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102_47 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102595 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102596 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102598 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102599 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102600 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102602 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102603 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS102604 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS103_33 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS104_26_ TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS106_24 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS106_34 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS107_27 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS107_53_ TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS109455 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS109803 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS110027 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS110977 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS112249 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS112251 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS112252 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS113013 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS113014 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS113015 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS113024 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS113025 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS113054 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS115069 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS115152 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS115188 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS115190 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS115199 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS115200 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS115616 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS116749 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS117_44 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS117130 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS117143 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS118811 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS118812 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS118814 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS118815 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS118818 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS119115 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS119399 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS119408 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS119543 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS120829 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121336 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121344 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121346 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121348 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121454 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121455 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121456 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121492 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121544 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS121547 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS124277 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS124278 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS125606 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS126071 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS126072 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS126908 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS126910 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS127334 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS127671 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS127672 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130254 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130255 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130258 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130259 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130260 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130261 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130262 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130263 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS130265 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS154_31 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS174_52 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS175_52 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS175_80 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS192_81 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS194_86 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS195_86 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS198_74 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS267_77 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS447_86 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS479_90 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS595_93 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS603_78 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS612_72 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS620_83 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS639_97 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGACCTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS686_68 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS795_72 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS806_96 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS826_68 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTAAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS877_95 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS880_95 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS911_97 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS916_96 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS918_96 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS965_95 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS966_95 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_arborescens_CBS102605_ TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_betae_kenyensis__CBS118810 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTGACAACCCTCACAGGAAGCCGCCGAACTC Alternaria_burnsii_CBS107_38_ TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_burnsii_CBS108_27 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_burnsii_CBS110_50 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_burnsii_CBS118816 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_burnsii_CBS118817 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_burnsii_CBS130264 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_burnsii_CBS879_95 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_cerealis_CBS119544 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_eichhorniae__CBS119778 TATGGCATCACCTTTCTTTCACGCGGCCTGGTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCGCAGGAAGCCGCCGAACTC Alternaria_eichhorniae__CBS489_92 TATGGCATCACCTTTCTTTCACGCGGCCTGGTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCGCAGGAAGCCGCCGAACTC Alternaria_gaisen__CBS118488 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTT Alternaria_gaisen__CBS632_93 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTT Alternaria_gaisen_CPC25268 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTT Alternaria_geophila_CBS101_13_ TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gossypina_CBS100_23 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gossypina_CBS102597 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gossypina_CBS102601 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gossypina_CBS104_32_ TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gossypina_CBS107_36_ TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_iridiaustralis_CBS118404_ TATGGCATGACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCTGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_iridiaustralis_CBS118486 TATGGCATGACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCTGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_iridiaustralis_CBS118487 TATGGCATGACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCTGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_jacinthicola_CBS133751 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_jacinthicola_CBS878_95 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_jacinthicola_CPC25267 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_longipes__CBS113_35 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes__CBS121332 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes__CBS121333 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes__CBS539_94 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes__CBS540_94 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes__CBS917_96 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_senecionicola_CBS119545 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGATGGTGGGGGTGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCAATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_tomato__CBS114_35 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGTCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Alternaria_tomato_CBS103_30 TATGGCATCACTTTTCTTTCACGCGGCCTGTTGCGTCCACCCGGTGCTTTCTCTGAGCGCGTAGCCAAAGCCTGGCTTATCGCGATGAGGGGCATTTTTGGGTGGTGGGGATGTGCGAACTTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGCGAACTCCAACGCCATGACGCACATGTAATTTCCCCATTCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24911] TITLE Alternaria_section_Alternaria_GAPDH; LINK TAXA = Taxa2; DIMENSIONS NCHAR=579; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS105_49 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS108_41 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS109730 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS112633 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS112749 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS113_41 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATTCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS115189 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS115516 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGGCATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS115517 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS116329 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGATCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS117587 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS118389 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS123235 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS123266 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS123267 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS124274 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS124281 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS124282 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS124283 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS126_60 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS127263 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CBS750_68 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_aff._arborescens_CPC25266 GCCGTATCGTCTTCCGCAATGCGTAGGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGATCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGTGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTTCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alstroemeriae__CBS118808 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTTATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alstroemeriae__CBS118809 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTTATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternantherae__CBS124392 GCCGTATCGTCTTCCGCAATGCGTAAGCTTCGCCCAACTCGCCGATACAATCTATCCGAGCTGACCGCATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGGCCAGGCCATCCAAATCGTGACGATAGTCCTTGCGATGCGCTGAAGCTCCTCTGTGGTCGCAGAATGCACGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102_47 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102595 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102596 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102598 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102599 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102600 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102602 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102603 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS102604 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS103_33 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS104_26_ GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS106_24 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS106_34 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS107_27 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS107_53_ GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS109455 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS109803 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS110027 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS110977 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS112249 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS112251 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS112252 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCTTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS113013 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS113014 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS113015 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS113024 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS113025 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS113054 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS115069 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS115152 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS115188 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS115190 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS115199 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS115200 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS115616 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS116749 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS117_44 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS117130 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS117143 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS118811 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS118812 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS118814 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS118815 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS118818 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS119115 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS119399 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS119408 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS119543 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS120829 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121336 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121344 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121346 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121348 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121454 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121455 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121456 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121492 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121544 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS121547 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS124277 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS124278 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS125606 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS126071 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS126072 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS126908 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS126910 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS127334 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS127671 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS127672 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130254 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130255 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130258 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130259 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130260 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130261 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130262 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130263 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS130265 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS154_31 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS174_52 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS175_52 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS175_80 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS192_81 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS194_86 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS195_86 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCAGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTTAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS198_74 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS267_77 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS447_86 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS479_90 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS595_93 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS603_78 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS612_72 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS620_83 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS639_97 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS686_68 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS795_72 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS806_96 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS826_68 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS877_95 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS880_95 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS911_97 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS916_96 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS918_96 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS965_95 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_alternata_CBS966_95 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_arborescens_CBS102605_ GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_betae_kenyensis__CBS118810 GCCGTATCGTCTTCCGCAATGCGTAAGCTTCGCCCAACTCGTCGATACAATCTAACAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTCCAGCCATGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTAGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCTATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_burnsii_CBS107_38_ GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTACCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_burnsii_CBS108_27 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTACCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_burnsii_CBS110_50 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTACCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_burnsii_CBS118816 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTACCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_burnsii_CBS118817 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTACCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_burnsii_CBS130264 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTACCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_burnsii_CBS879_95 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTACCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_cerealis_CBS119544 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_eichhorniae__CBS119778 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCGACTCGTCGATACAATCTATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCGCACTCTAGCCATGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTAGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCACCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_eichhorniae__CBS489_92 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCGACTCGTCGATACAATCTATCAGAGCTGACCGCATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCGCACTCTAGCCATGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTAGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCACCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_gaisen__CBS118488 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCCTGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCAAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_gaisen__CBS632_93 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCCTGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCAAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_gaisen_CPC25268 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCCTGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCAAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_geophila_CBS101_13_ GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_gossypina_CBS100_23 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_gossypina_CBS102597 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_gossypina_CBS102601 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_gossypina_CBS104_32_ GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_gossypina_CBS107_36_ GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_iridiaustralis_CBS118404_ GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGGCCAACTCGTCGATACAATCTATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGTCGAGGCCATCCAAGCTGCGAAAACAGTCCTTGCGATGCGCTAGAGCGCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAAGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAAACTTACAAGTCCGACATCGAGGTTCTCTCTAACGCCTCTT Alternaria_iridiaustralis_CBS118486 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGGCCAACTCGTCGATACAATCTATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGTCGAGGCCATCCAAGCTGCGAAAACAGTCCTTGCGATGCGCTAGAGCGCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAAGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAAACTTACAAGTCCGACATCGAGGTTCTCTCTAACGCCTCTT Alternaria_iridiaustralis_CBS118487 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGGCCAACTCGTCGATACAATCTATCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGTCGAGGCCATCCAAGCTGCGAAAACAGTCCTTGCGATGCGCTAGAGCGCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAAGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAAACTTACAAGTCCGACATCGAGGTTCTCTCTAACGCCTCTT Alternaria_jacinthicola_CBS133751 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTATCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTTATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAAGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_jacinthicola_CBS878_95 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACGATCTATCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAAGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_jacinthicola_CPC25267 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTATCGAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAAGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_longipes__CBS113_35 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_longipes__CBS121332 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_longipes__CBS121333 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_longipes__CBS539_94 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_longipes__CBS540_94 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_longipes__CBS917_96 GCCGTATTGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_senecionicola_CBS119545 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCTAACTCGTCGATACAATCTACCAGAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCCACACTACAGCCGCGGCCATCCAAGTTGCGAAAACAGTCCTTGCGATGCGCTAGAGCTCCTCTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGGTTCTCTCCAACGCCTCTT Alternaria_tomato__CBS114_35 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTATCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCATATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT Alternaria_tomato_CBS103_30 GCCGTATCGTCTTCCGCAATGCGTAAGTTTCGCCCAACTCGTCGATACAATCTATCAAAGCTGACCGCATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTCCCCAAGCACCTACACTACAGCCGCGGCCATCCAAATTGCGAAAACAGTTCTTGCGATGCGCTAGAGCTC--CTGTGGTCGCAGAATGCAGGCTAACACATTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCATATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGGTTCTCTCCAACGCCTCTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M30180] TITLE Alternaria_section_Alternaria_Alta1updated; LINK TAXA = Taxa1; DIMENSIONS NCHAR=473; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS105_49 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCAAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCGCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS108_41 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS109730 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS112633 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS112749 CTCTCTCTTTGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTAAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCGCGAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS113_41 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGTTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTAAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGTTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGTTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS115189 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS115516 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS115517 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTAAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCGCGAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS116329 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS117587 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS118389 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS123235 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTAAGGGTAACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTGCTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCGCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS123266 CTCTCTCTTTGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTAAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCGCGAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS123267 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTAAGGGTAACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTGCTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS124274 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS124281 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS124282 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS124283 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTAAGGGTAACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTGCTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS126_60 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS127263 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CBS750_68 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_aff._arborescens_CPC25266 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACTATTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alstroemeriae__CBS118808 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGTTTCAACATCAAGGCTACCAATGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTA-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACAGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternantherae__CBS124392 CTCCCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGTCTCGCCAGGCCGACTCATCCTGCCCTGTCGTCAAGCAGGGTGACTACGTCTGGAAGATCTCCAAGTTCTTCGCAAACAAGCCTGACGGAACCTTCATCAACAGCCTCAGCATCAACATCCGGGCTACCAACGGAGGAACCCTCGACTTCACCTGCTCTGTGCAGGCCGACAAGATTGAAGACCACACGTACTACTCTTGCGGCCAGAACACCTACATGGACATCTCTTTCAACAGCGACCGCAACGGTCTACTCCTGAGGCAGAAGGTTGACGATCAGTAAGTCGTCCTCA-TATCTTGGATTACTATGTATATTCAGATATACTAACATTTTTCTAGCACCACCTATATCGGTACCGTTACTCTTCCCAACGTCTGCCGCGCCGGCGGTGGCAACTCGCAACACATGGTTTGCAATGGTGTTTCC Alternaria_alternata_CBS102_47 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS102595 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACATTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS102596 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS102598 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS102599 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS102600 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS102602 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS102603 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS102604 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACTGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS103_33 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS104_26_ CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS106_24 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS106_34 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS107_27 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS107_53_ CTCTCTCTTCGCCGCCGCTGGCCTCGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACTAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS109455 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACTAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS109803 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS110027 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS110977 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS112249 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS112251 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS112252 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS113013 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS113014 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS113015 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS113024 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS113025 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS113054 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS115069 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS115152 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACTAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS115188 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS115190 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS115199 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS115200 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS115616 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS116749 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS117_44 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGATTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS117130 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS117143 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS118811 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS118812 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACTAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS118814 CTCTCTCTTCGCCGCCGCTGGCCTCGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACTAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS118815 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACTAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS118818 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACTAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS119115 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS119399 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS119408 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS119543 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS120829 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121336 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121344 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121346 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121348 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121454 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121455 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121456 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-CACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121492 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121544 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS121547 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS124277 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS124278 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACTGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS125606 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS126071 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS126072 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCGTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGACTATTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS126908 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS126910 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS127334 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGCTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS127671 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS127672 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130254 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCACATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130255 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130258 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130259 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130260 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130261 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130262 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130263 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS130265 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCACATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS154_31 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS174_52 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS175_52 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS175_80 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS192_81 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS194_86 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS195_86 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS198_74 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS267_77 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS447_86 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTCTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS479_90 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGATTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS595_93 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS603_78 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGCTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS612_72 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS620_83 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACTAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS639_97 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS686_68 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS795_72 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS806_96 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS826_68 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCACCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACCGAGGGTGACTACGTCTGGAAGATTTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATGTTTCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS877_95 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS911_97 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCACATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS916_96 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS918_96 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS965_95 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_alternata_CBS966_95 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATCTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_arborescens_CBS102605_ CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_betae_kenyensis__CBS118810 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGTCAAGACACCGCGTCCTGCCCTGTCACCACTGAGGGTGATTACGTCTGGAAGATTTCCGAGTTCTCCGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCAGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGAATTCTCTTTCGACAGCGACCGCAGTGGTCTGCTCCTGAAGCAGGACGTTAGCGACGAGTAAGTTACCCTTT-TACCTTCGATTACTTCGCACATCCACATATACTAACATACTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAATGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCA Alternaria_burnsii_CBS107_38_ CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_burnsii_CBS108_27 CTCTCTCTTCGCCGCCGCTGGCCTCGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_burnsii_CBS110_50 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_burnsii_CBS118816 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_burnsii_CBS118817 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_burnsii_CBS130264 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_burnsii_CBS879_95 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_cerealis_CBS119544 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_eichhorniae__CBS489_92 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGTCAGGACACCGCGTCTTGCCCTGTCACCACTGAGGGTGATTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCAGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGAATTCTCTTTCGACAGCGACCGCAGTGGTCTACTCCTGAAGCAGAACGTTAGCGACGAGTAAGTTACCCTTA-TACCTTCGATTACTTCACAGATCCAGATATACTAACATATTCCCAGCATCACCTATGCCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_gaisen__CBS118488 ATCTCTCTTCGCTGCCGCTGGCCTTGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTATGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGATAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTGTTACCTGCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_gaisen__CBS632_93 ATCTCTCTTCGCTGCCGCTGGCCTTGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTATGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGATAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTGTTACCTGCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_gaisen_CPC25268 ATCTCTCTTCGCTGCCGCTGGCCTCGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTATGGAAGATCTCCGAGTTCTACGGACGCAAGCCTGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGATAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTGTTACCTGCGATTACTTCGCAGATTCAGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTCCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_geophila_CBS101_13_ CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_gossypina_CBS100_23 CTCTCTCTTCGCCGCCGCTGGCCTCGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_gossypina_CBS102597 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_gossypina_CBS102601 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_gossypina_CBS104_32_ CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_gossypina_CBS107_36_ CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_iridiaustralis_CBS118404_ CTCTCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGTCTCGTCAGGACACCGCATCCTGCCCCGTCACCACTAAGGGTGACTACGTGTGGAAGATCTCTGGGTTCTCCGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTAAGGACCACACTTGGTACTCTTGCGGCGAGAATAGCTTCATAAGCTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTA-TACCTTCGATGACTTCGCAGAATCAGATATACTAACATATTCCCAGCACCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_iridiaustralis_CBS118486 CTCTCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGTCTCGTCAGGACACCGCATCCTGCCCCGTCACCACTAAGGGTGACTACGTGTGGAAGATCTCTGGGTTCTCCGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTAAGGACCACACTTGGTACTCTTGCGGCGAGAATAGCTTCATAAGCTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTA-TACCTTCGATGACTTCGCAGAATCAGATATACTAACATATTCCCAGCACCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_iridiaustralis_CBS118487 CTCTCTCTTCGCCGCCGCTGGCCTTGCTGCCGCTGCTCCTCTCGAGTCTCGTCAGGACACCGCATCCTGCCCCGTCACCACTAAGGGTGACTACGTGTGGAAGATCTCTGGGTTCTCCGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTAAGGACCACACTTGGTACTCTTGCGGCGAGAATAGCTTCATAAGCTTCTCTTTCGACAGCGACCGCAACGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTA-TACCTTCGATGACTTCGCAGAATCAGATATACTAACATATTCCCAGCACCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_jacinthicola_CBS133751 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCCCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTATAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-AACCTTCGATTACCTCGCAGATTCGGATATACTAACAAATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_jacinthicola_CBS878_95 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGATTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACCTCGCAGATTCGGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_jacinthicola_CPC25267 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGATTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGCCTGCTCCTGAGGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACCTCGCAGATTCGGATATACTAACATATTCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_longipes__CBS113_35 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_longipes__CBS121332 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_longipes__CBS121333 CTCTCTCTTCGCCGCCGCTGGCCTCGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_longipes__CBS539_94 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_longipes__CBS540_94 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_longipes__CBS917_96 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCCGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACTACCGAGGGTGACTATGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACACTCGACTTCACCTGTTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTCAGATATACTAACACATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_senecionicola_CBS119545 CTCTCTCTTCGCCGCCGCTGGCCTTGCCGCTGCTGCTCCTCTCGAGTCTCGCCAGGACACCGCATCCTGCCCTGTCACCACTGAGGGTGACTACGTCTGGAAGATTTCCGAATTCTACGGACGCAAGCCGGAAGGAACCTACTACAACAGCCTCGGCTTCAACATCAAGGCCACCAACGGAGGAACCCTCGACTTCACCTGCTCTGCTCAGGCCGATAAGCTTGAGGACCACAAGTGGTACTCCTGTGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAAGCAGAAGGTTAGCGACGAGTAAGTTATCCTTG-TACCTTCGATTACTTCGCAGATTCAAATATACTAACATATCCCCAGCATCACCTATGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCTGGCGGTAACGGCCCCAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_tomato__CBS114_35 CTCTCTCTTCGCCGCCGCTGGCCTCGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACGCTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC Alternaria_tomato_CBS103_30 CTCTCTCTTCGCCGCCGCTGGCCTCGCCGCCGCTGCTCCTCTTGAGTCTCGCCAGGATACCGCATCCTGCCCTGTCACTACCGAGGGTGACTACGTCTGGAAGATCTCCGAGTTCTACGGACGCAAGCCGGAGGGAACTTACTACAACAGCCTCGGCTTCAACATCAAGGCTACCAACGGAGGAACGCTCGACTTCACATGCTCTCACTCAGCCGACAAGCTTGAGGACCACACTTGGTACTCTTGCGGCGAGAACAGCTTCATGGACTTCTCTTTCGACAGCGACCGCAGCGGTCTGCTCCTGAGGCAGAAAGTTAGCGACGAGTAAGTTACCCTTG-TACCTTCGATTACTTCGCAGATTTAGATATACTAACATATTCCCAGCATCACCTACGTCGCTACCGCCACTCTTCCCAACTACTGCCGCGCAGGCGGTAACGGCCCTAAGGACTTTGTCTGCCAGGGTGTTGCC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24913] TITLE Alternaria_section_Alternaria_LSU; LINK TAXA = Taxa2; DIMENSIONS NCHAR=849; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS105_49 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS108_41 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS109730 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS112633 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS112749 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS113_41 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS115189 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS115516 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS115517 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS116329 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS117587 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS118389 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS123235 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS123266 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS123267 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS124274 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS124281 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS124282 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS124283 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS126_60 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS127263 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CBS750_68 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_aff._arborescens_CPC25266 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alstroemeriae__CBS118808 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alstroemeriae__CBS118809 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternantherae__CBS124392 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102_47 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102595 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102596 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102598 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102599 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102600 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102602 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102603 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS102604 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS103_33 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS104_26_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS106_24 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS106_34 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS107_27 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS107_53_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS109455 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS109803 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS110027 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS110977 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS112249 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS112251 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS112252 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS113013 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS113014 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS113015 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS113024 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS113025 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS113054 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS115069 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS115152 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS115188 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS115190 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS115199 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS115200 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS115616 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS116749 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS117_44 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS117130 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS117143 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS118811 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS118812 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS118814 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS118815 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS118818 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS119115 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS119399 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS119408 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS119543 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS120829 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121336 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121344 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121346 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121348 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121454 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121455 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121456 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121492 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121544 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS121547 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS124277 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS124278 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS125606 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS126071 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS126072 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS126908 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS126910 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS127334 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS127671 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS127672 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130254 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130255 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130258 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130259 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130260 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130261 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130262 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130263 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS130265 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS154_31 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS174_52 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS175_52 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS175_80 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS192_81 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS194_86 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS195_86 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS198_74 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS267_77 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS447_86 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS479_90 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS595_93 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS603_78 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS612_72 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS620_83 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS639_97 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS686_68 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS795_72 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS806_96 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS826_68 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS877_95 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS880_95 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS911_97 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS916_96 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS918_96 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS965_95 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS966_95 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_arborescens_CBS102605_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_betae_kenyensis__CBS118810 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_burnsii_CBS107_38_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_burnsii_CBS108_27 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_burnsii_CBS110_50 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_burnsii_CBS118816 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_burnsii_CBS118817 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_burnsii_CBS130264 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_burnsii_CBS879_95 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_cerealis_CBS119544 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_eichhorniae__CBS119778 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_eichhorniae__CBS489_92 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gaisen__CBS118488 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gaisen__CBS632_93 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gaisen_CPC25268 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_geophila_CBS101_13_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gossypina_CBS100_23 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gossypina_CBS102597 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gossypina_CBS102601 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gossypina_CBS104_32_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gossypina_CBS107_36_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_iridiaustralis_CBS118404_ ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_iridiaustralis_CBS118486 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_iridiaustralis_CBS118487 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_jacinthicola_CBS133751 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_jacinthicola_CBS878_95 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_jacinthicola_CPC25267 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_longipes__CBS113_35 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_longipes__CBS121332 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_longipes__CBS121333 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_longipes__CBS539_94 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_longipes__CBS540_94 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_longipes__CBS917_96 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_senecionicola_CBS119545 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_tomato__CBS114_35 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_tomato_CBS103_30 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24919] TITLE Alternaria_section_Alternaria_KOG1077; LINK TAXA = Taxa6; DIMENSIONS NCHAR=781; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternantherae_CBS124392 TGCCCACGATGCGAGGTACATGACGGCATGCCCATGCAACGCCAGGGATGGAAGCTTACAAACCCGGACAGGACTGGTCTCCTTCATCGCTGACCTGCGAAATGCTCGCGCACGAGAACTAGAAGAGAAGCGCATCAACAAGGAATTGGCAAACATACGGTGGGTGCTCCAACACGTTCCACACCAGG-TCCCCGAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCCCGGACACGCTTCCTCCCATGATTTGGTCTAACAGGATTCCCCCCCCAGATGCCGGCCTGAACGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCGCTCACCGCTCTCTCCCCCCCCG-TTGCTGACCCTTGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAATCTCGTCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTCACCCTGTTCCTGCACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACAATAATGAGCTCAACAACTGCCTGGCGCTGCACGCGATTGCCAACGTGGGCGGGAAGGAACTGGGAGAAGCACTGAGCTCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGACGCGGAACGCTTCCAACGGCCGAGCTGACGCTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACGCTGCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS102595 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CATGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGTCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS102596 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCTCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCAGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACTCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCGCCGTGAGTAGCACAGAACGCTTCCAATGGCTGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS102598 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGGATT--CTCCCCAGATGCTGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACTCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTACATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGATAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS102599 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS102600 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGGATT--CTCTCCAGATGCTGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACTCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTACATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGATAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS102602 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS102604 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS103_33 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCTCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCAGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACTCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCGCCGTGAGTAGCACAGAACGCTTCCAATGGCTGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTGTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS117_44 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS118811 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS118812 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGGATT--CTCCCCAGATGCTGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACTCCACTCACCGCTCTC-CCTGCCCTG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTACATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGATAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS118814 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGGATT--CTCCCCAGATGCTGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACTCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTACATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGATAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS118818 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CACCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCGCCGTGAGTAGCACAGAACGCTTCCAATGGCTGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS119399 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGGATT--CTCTCCAGATGCTGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACTCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTACATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGATAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS119408 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCGTTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCATGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS119543 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS121336 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCTCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCAGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACTCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCGCCGTGAGTAGCACAGAACGCTTCCAATGGCTGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS121348 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS121454 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGGATT--CTCCCCAGATGCTGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACTCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTACATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGATAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS121455 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CATGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS121456 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS194_86 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCTCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCAGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACTCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCGCCGTGAGTAGCACAGAACGCTTCCAATGGCTGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS19586 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS479_90 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCATTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS916_96 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCTCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCTCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGGAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_alternata_CBS918_96 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCGTTTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTCTACCGGAAACACCCT Alternaria_arborescens_CBS102605 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCGTTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGTATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCTCAAGGCTAACAACACTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT---CCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAGGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCATAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_betae_kenyensis_CBS118810 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTAGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTCCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCACGCAGCTCCTATACATATACATACTCGGCTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAATTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCTCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACACAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGCCTATACCGGAAACACCCT Alternaria_burnsii_CBS118816 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAGGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAAAT--CCTCCCAGATGCCGGCCTGAATGGCTATCAGAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTACCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTTGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCTCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGAACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGAAAACACCCT Alternaria_burnsii_CBS118817 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAGGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAAAT--CCTCCCAGATGCCGGCCTGAATGGCTATCAGAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTACCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTTGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCTCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGAACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGAAAACACCCT Alternaria_cerealis_CBS119544 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCGTTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCTCAAGGCTAACAACACTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT---CCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAGGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCATAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_eichhorniae_CBS119778 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGACGGAAGCTTACAATTCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTCGGTCCTCCAACTCGTTCCACA-AAGTCCCCCCCAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTGCCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCCCCC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCAAAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCTCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACACAACACTTCCAATGGCCGAGCTGACGTTGGACAGAGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAATACCCT Alternaria_eichhorniae_CBS489_92 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGACGGAAGCTTACAATTCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTCGGTCCTCCAACTCGTTCCACA-AAGTCCCCCCCAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTGCCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCCCCC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCAAAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCTCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACACAACACTTCCAATGGCCGAGCTGACGTTGGACAGAGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAATACCCT Alternaria_gaisen_CBS118488 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACACGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCGTTTGCTGAACCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_gaisen_CBS632_93 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACACGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCGTTTGCTGAACCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTTGTGAAGAAGAAGGCGGCTCTCACACTTCTACGGCTATACCGGAAACACCCT Alternaria_geophila_CBS101_13 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACC-AAGT-CCCCCAAGGCTAACAGCACTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT---CCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAGGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCATAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTTCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_gossypina_CBS102597 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGACCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAAAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCGTTTGCTGAACCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGGAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCGATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTGTACCGGAAACACCCT Alternaria_gossypina_CBS102601 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGACCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAAAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCGTTTGCTGAACCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGGAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCGATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTGTACCGGAAACACCCT Alternaria_longipes_CBS540_94 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATACCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGACCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAAAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT--CCCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCGTTTGCTGAACCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAGAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGGAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCGATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTGTACCGGAAACACCCT Alternaria_senecionicola_CBS119545 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGATGGAAGCTTACAAATCTGGACAGGACTGGTCTCGTTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAAGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCTCAAGGCTAACAACACTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAATT---CCCCCAGATGCCGGCCTGAATGGCTATCAAAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTGCCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTCGGACATCTCGAGGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCGCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCGCCGAAGTCCATAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGGACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGGAAACACCCT Alternaria_tomato_CBS103_30 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAGGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAAAT--CCTCCCAGATGCCGGCCTGAATGGCTATCAGAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTACCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTTGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCTCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCTCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGAACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGAAAACACCCT Alternaria_tomato_CBS114_35 TGCCCACGATGCGAGGTACATGACGGCATGCCCACGAGATGCCAGGGACGGAAGCTTACAAATCTGGACAGGACTGGTCTCATTCATCGCTGATCTGAGAAATGCTCGCGCAAGAGAACTGGAGGAGAAGCGCATCAACAAGGAATTGGCCAACATACGGTGGGTACTCCAACTCGTTCCACA-AAGT-CCCCCAAGGCTAACAGCGCTGCAGGCAAAAGTTCAGAGGTACTTCTCGGACACGCTTCC-CCCATGATTTGGTCTAACAGAAAT--CCTCCCAGATGCCGGCCTGAATGGCTATCAGAAGAAGAAATACGTCTGCAAGGTATACACGCCACTCACCGCTCTC-CCTACCCCG-TTGCTGACCCTCGCAGCTCCTATACATATACATACTCGGTTGGAACGTCGATTTTGGACATCTCGAAGCGGTGAACCTCATCTCGGCGACCAAGTACTCGGAAAAGCAGATCGGATATCTCGCCGTTACCCTATTCCTACACGAGGAGCACGAACTGCTGCACCTGGTCGTTAACAGCATCAGGAAGGACTTGCTGGACCACAATGAGCTCAACAACTGCTTGGCTCTGCATGCGATTGCCAACGTGGGTGGAAAGGAACTGGGAGAAGCACTGAGCTCCGAAGTCCACAGGCTCCTCATATCACCGTGAGTGGCACAGAACGCTTCCAATGGCCGAGCTGACGTTGAACAGGGCCTCCAAGGCATTCGTGAAGAAGAAGGCGGCTCTCACACTCCTACGGCTATACCGAAAACACCCT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24916] TITLE Alternaria_section_Alternaria_SSU; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1021; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGCGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS105_49 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS108_41 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGCGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS109730 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS112633 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS112749 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS113_41 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS115189 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS115516 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS115517 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS116329 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS117587 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS118389 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS123235 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS123266 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS123267 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS124274 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS124281 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS124282 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGCGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS124283 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS126_60 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS127263 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CBS750_68 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGCGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_aff._arborescens_CPC25266 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alstroemeriae__CBS118808 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alstroemeriae__CBS118809 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternantherae__CBS124392 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102_47 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102595 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102596 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102598 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102599 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102600 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102602 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102603 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS102604 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS103_33 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS104_26_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS106_24 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS106_34 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS107_27 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS107_53_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS109455 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS109803 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS110027 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS110977 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS112249 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS112251 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS112252 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS113013 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS113014 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS113015 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS113024 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS113025 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS113054 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS115069 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS115152 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS115188 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS115190 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS115199 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS115200 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS115616 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS116749 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS117_44 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS117130 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS117143 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS118811 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS118812 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS118814 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS118815 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS118818 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS119115 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS119399 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS119408 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS119543 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS120829 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121336 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121344 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121346 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121348 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121454 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121455 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121456 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121492 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121544 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS121547 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS124277 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS124278 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS125606 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS126071 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS126072 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS126908 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS126910 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS127334 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS127671 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS127672 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130254 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130255 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130258 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130259 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130260 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130261 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130262 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130263 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS130265 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS154_31 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS174_52 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS175_52 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS175_80 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS192_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS194_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS195_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS198_74 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS267_77 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS447_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS479_90 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS595_93 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS603_78 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS612_72 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS620_83 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS639_97 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS686_68 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS795_72 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS806_96 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS826_68 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS877_95 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS880_95 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS911_97 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS916_96 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS918_96 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS965_95 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS966_95 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_arborescens_CBS102605_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_betae_kenyensis__CBS118810 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_burnsii_CBS107_38_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_burnsii_CBS108_27 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_burnsii_CBS110_50 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_burnsii_CBS118816 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_burnsii_CBS118817 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_burnsii_CBS130264 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_burnsii_CBS879_95 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_cerealis_CBS119544 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_eichhorniae__CBS119778 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_eichhorniae__CBS489_92 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gaisen__CBS118488 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gaisen__CBS632_93 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gaisen_CPC25268 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_geophila_CBS101_13_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gossypina_CBS100_23 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gossypina_CBS102597 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gossypina_CBS102601 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gossypina_CBS104_32_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gossypina_CBS107_36_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_iridiaustralis_CBS118404_ TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_iridiaustralis_CBS118486 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_iridiaustralis_CBS118487 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_jacinthicola_CBS133751 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_jacinthicola_CBS878_95 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_jacinthicola_CPC25267 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_longipes__CBS113_35 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_longipes__CBS121332 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_longipes__CBS121333 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_longipes__CBS539_94 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_longipes__CBS540_94 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_longipes__CBS917_96 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_senecionicola_CBS119545 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_tomato__CBS114_35 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_tomato_CBS103_30 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M24915] TITLE Alternaria_section_Alternaria_RPB2; LINK TAXA = Taxa7; DIMENSIONS NCHAR=753; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS105_49 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACAAGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS108_41 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS109730 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS112633 ACTTACGCCTCCACACTATCCCACTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACAAGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACTTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS112749 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS113_41 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATTTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS115189 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS115516 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS115517 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS116329 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS117587 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS118389 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS123235 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACAAGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS123266 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS123267 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACAGAGGGTGAGCAC Alternaria_aff._arborescens_CBS124281 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS124282 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS124283 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACAGAGGGTGAGCAC Alternaria_aff._arborescens_CBS126_60 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS127263 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CBS750_68 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACAAGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_aff._arborescens_CPC25266 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTTTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_alstroemeriae__CBS118808 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCGTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_alstroemeriae__CBS118809 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCGTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternantherae__CBS124392 ACCTACGCCTCCACACTGTCCCATTTGCGTCGAACCAACACCCCTGTTGGTCGTGATGGAAAGCTGGCAAAGCCGCGACAACTCCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGGAACATGCAGCTTCTGGAAGAGTATGATCAAAATCAGAACCCCGACGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAGCTTGTCACAGTTGTGCAGGAGCTCCGACGAAACGGAACCCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTATTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACTAAGGAGATTAGTAACAAGCTCAAGCAGGAGCAACTAGAGACAAGCACACGACAAGGTTGGAGCCAGGATGAGGTCGAATCAGCCACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAGGAGGAGGAGACGGCCATGATAACATTCTCCCCCGAGGATCTGGAGGAGTGGCGAGAGATGAAACTGGGCCTGCCTGCGGCGGAGCGATCTACTGAGGGTGAGCAC Alternaria_alternata_CBS102_47 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS102595 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS102596 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS102598 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS102599 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTAGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS102600 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS102602 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTAGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS102603 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTAGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS102604 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS103_33 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACAAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAGTCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS104_26_ ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS106_24 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCACGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAATATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGCGAGCAC Alternaria_alternata_CBS106_34 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS107_27 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS107_53_ ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACATTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS109455 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS109803 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS110027 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS110977 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS112249 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS112251 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS112252 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCACGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS113013 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS113014 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS113015 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS113024 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS113025 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS113054 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTAGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS115069 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS115152 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS115188 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACAAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAGTCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS115190 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS115199 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS115200 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS115616 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS116749 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACAAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAGTCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS117_44 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCACGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAATATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGCGAGCAC Alternaria_alternata_CBS117130 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATATTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS117143 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTAGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS118811 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTAGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS118812 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS118814 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS118815 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS118818 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS119115 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS119399 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS119408 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS119543 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS120829 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATATTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS121336 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS121344 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTAGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS121346 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTAGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS121348 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS121454 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS121455 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS121456 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS121492 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS121544 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCACGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAATATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGCGAGCAC Alternaria_alternata_CBS121547 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS124277 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATATTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS124278 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS125606 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS126071 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS126072 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAATGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTCGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCAGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS126908 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCACGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAATATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGCGAGCAC Alternaria_alternata_CBS126910 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS127334 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS127671 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS127672 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS130254 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS130255 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS130258 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS130259 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS130260 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS130261 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS130262 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS130263 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS130265 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS154_31 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS174_52 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS175_52 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS175_80 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS192_81 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTAGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS194_86 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCACGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAATATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGCGAGCAC Alternaria_alternata_CBS195_86 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS267_77 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS447_86 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS479_90 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS595_93 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS603_78 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS612_72 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS620_83 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS639_97 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS686_68 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAAGGTGAGCAC Alternaria_alternata_CBS795_72 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS806_96 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS826_68 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS877_95 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS880_95 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS911_97 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS916_96 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS918_96 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS965_95 ACTTACGCCTCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_alternata_CBS966_95 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_arborescens_CBS102605_ ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_betae_kenyensis__CBS118810 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGCCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATTATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGTACTCTGTCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAGAATGACATTCGGAAACCAAACCGCAACCACCTCATCTTCACAAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAGTCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTGGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_burnsii_CBS107_38_ ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_burnsii_CBS108_27 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_burnsii_CBS110_50 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_burnsii_CBS118816 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGATTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_burnsii_CBS118817 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGATTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_burnsii_CBS130264 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_burnsii_CBS879_95 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_cerealis_CBS119544 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_eichhorniae__CBS119778 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGCCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACACTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAAGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_eichhorniae__CBS489_92 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGCCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCCCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAAGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGGGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_gaisen__CBS118488 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCGGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAATCCTGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAGCAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_gaisen__CBS632_93 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCGGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAATCCTGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAGCAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_gaisen_CPC25268 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCGGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAGCAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_geophila_CBS101_13_ ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_gossypina_CBS100_23 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_gossypina_CBS102597 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_gossypina_CBS102601 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_gossypina_CBS104_32_ ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_gossypina_CBS107_36_ ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_iridiaustralis_CBS118404_ ACTTACGCCTCTACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAATATGATCAGAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGTAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCCACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_iridiaustralis_CBS118486 ACTTACGCCTCTACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAATATGATCAGAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGTAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCCACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_iridiaustralis_CBS118487 ACTTACGCCTCTACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAATATGATCAGAACCAGAACCCTGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGTAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCCACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_jacinthicola_CBS133751 ACTTATGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACGAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_jacinthicola_CBS878_95 ACTTATGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACGAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_jacinthicola_CPC25267 ACTTATGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACGAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_longipes__CBS113_35 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_longipes__CBS121332 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_longipes__CBS121333 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_longipes__CBS539_94 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_longipes__CBS540_94 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_longipes__CBS917_96 ACTTACGCCTCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCAC Alternaria_senecionicola_CBS119545 ACTTACGCCTCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCAC Alternaria_tomato__CBS114_35 ACTTACGCCTCCACACTGTCTCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGACGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC Alternaria_tomato_CBS103_30 ACTTACGCCTCCACACTGTCTCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGACGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCAC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M30182] TITLE 'Alternaria section Alternaria OPA10_2updated'; LINK TAXA = Taxa4; DIMENSIONS NCHAR=634; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS105_49 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS108_41 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS109730 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGTGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACGGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS112633 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS112749 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGTGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS113_41 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGGGAGGAGACTGGCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACTGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS115189 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS115516 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS115517 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGTGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS116329 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS117587 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACTTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCTTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS118389 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGTGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS123235 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS123266 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS123267 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS124274 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGTGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACGGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS124281 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS124282 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS124283 CTCTGACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS126_60 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGTGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACGGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS127263 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CBS750_68 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGTGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_aff._arborescens_CPC25266 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTACACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alstroemeriae__CBS118808 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCTCAACCTTACTGCGTGTTCAAGCCTGAGGAATCGCTTGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAGTGCCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAACCACTTTGTCGAAGGACAAGAAAGTGGCTTCTATTGGCCCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTGGGCGGCCGCGTCTCTGGCGTTGGAATCGGAGGTCTTACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGACAATGTGGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alstroemeriae__CBS118809 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCTCAACCTTACTGCGTGTTCAAGCCTGAGGAATCGCTTGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAGTGCCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAACCACTTTGTCGAAGGACAAGAAAGTGGCTTCTATTGGCCCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTGGGCGGCCGCGTCTCTGGCGTTGGAATCGGAGGTCTTACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGACAATGTGGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102_47 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102595 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102596 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGAGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102598 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102599 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102600 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCACTCGATGTATCCACCATGGTGCTGCTGTCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGAATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATCGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102602 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102603 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS102604 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS103_33 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGGGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS104_26_ CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAAAGTCGCATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS106_24 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS106_34 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS107_27 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS107_53_ CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS109455 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS109803 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS110027 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS110977 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS112249 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS112251 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGATGAGGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGCCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATAACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCCGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTTTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTACTCTGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS112252 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS113013 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS113014 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS113015 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS113024 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS113025 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS113054 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS115069 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS115152 CTTTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS115188 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAGATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS115190 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCGGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS115199 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS115200 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS115616 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS116749 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS117_44 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCCGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAACCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS117130 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS117143 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS118811 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCACTCGATGTATCCACCATGGTGCTGCTGTCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGAATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATCGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGTGTCTCTGGCGTCGGAATTGGAGGTCTTACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATACGGCTGGGCTTGCGACAATGTCGCATCTTACGAAGTCGTTACTGCCTCGGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS118812 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGATGAGGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGCCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATAACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCCGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTTTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTACTCTGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS118814 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS118815 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS118818 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS119399 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS119408 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGATGAGGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGCCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATAACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCCGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTTTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTACTCTGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS119543 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS120829 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121336 CTTTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121344 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121346 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121348 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121454 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121455 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121456 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121492 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121544 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS121547 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS124277 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS124278 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS125606 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS126071 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS126072 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCGGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAGATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGACCCGGCAACCTATGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGTGTCTCCGGCGTTGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTGCTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS126908 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS126910 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS127334 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCACTCGATGTATCCACCATGGTGCTGCTGTCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGAATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATCGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS127671 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS127672 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS130254 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS130255 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS130258 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS130259 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS130260 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS130261 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAATGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS130262 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAATGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS130263 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS130265 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS154_31 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCGGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS174_52 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS175_52 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS175_80 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS192_81 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS194_86 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS195_86 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCACTCGATGTATCCACCATGGTGCTGCTGTCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGAATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATCGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS198_74 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS267_77 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS447_86 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS479_90 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGATGAGGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGCCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATAACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCCGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTTTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTACTCTGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS595_93 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS603_78 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS612_72 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS620_83 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS639_97 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS686_68 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGGAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS795_72 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS806_96 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS880_95 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGACGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGGTCGCCCACGGTCCGC Alternaria_alternata_CBS911_97 CTCTCATATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCGTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCATTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTAAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACTTTCGCCCACGGTCCGC Alternaria_alternata_CBS916_96 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAATTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS918_96 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATTGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAATATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS965_95 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_alternata_CBS966_95 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_arborescens_CBS102605_ CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_betae_kenyensis__CBS118810 CTCTCACATCAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGACGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCACTTGATGTATCCACCATGGTGCTACTATCTCGTCTCACACAGTGTGCTTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACTGTTCTCTTTGAGCGCATGAAGCAAATTACTTTGTCAAAAGATAAGAAAGTTGCATCTATTGGACCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCCGGCGTCGGAATTGGAGGTCTTACAACAGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGTATCATAGAAGTCAGCCAAAAGTCGTATCCAGACCTGTACTGGGCATTAAGAGGTGGAGGCAACAATCTCGCACTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_burnsii_CBS107_38_ TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_burnsii_CBS108_27 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_burnsii_CBS110_50 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_burnsii_CBS118816 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_burnsii_CBS118817 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_burnsii_CBS130264 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_burnsii_CBS879_95 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_cerealis_CBS119544 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_eichhorniae__CBS119778 CTCTCACATCAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAGCCGTACTGCGTGTTCAAGCCTGAGGAAGCACTTGATGTATCCACCATGGTGCTGCTATCTCGTCTCACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACTGTTCTCTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGACCCGGTAACCTCTGGTACGACATCTACACAACCCTCGCCAAAGACAACCTAGCAGTAGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCATTGAGAGGCGGAGGCAATAATCTCGCCCTCGTTACAAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_eichhorniae__CBS489_92 CTCTCACATCAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAGCCGTACTGCGTGTTCAAGCCTGAGGAAGCACTTGATGTATCCACCATGGTGCTGCTATCTCGTCTCACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGACATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACTGTTCTCTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGACCCGGTAACCTCTGGTACGACATCTACACAACCCTCGCCAAAGACAACCTAGCAGTAGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCATTGAGAGGCGGAGGCAATAATCTCGCCCTCGTTACAAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_gaisen__CBS118488 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_gaisen__CBS632_93 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAGGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_gaisen_CPC25268 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTGCTGCGTGTTCAAGCCTGAGGAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACACATTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCGCTTTGTCAAAGGACAAGAAAGTTGCTTCCATTGGACCCGGCAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACGACCTAGCAGTGGTAGGCGGTCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGTGGCGGGATTTCGTTCTTCTCAAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTACGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_geophila_CBS101_13_ CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGCATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_gossypina_CBS100_23 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGTTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_gossypina_CBS102597 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGTTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_gossypina_CBS102601 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGTTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_gossypina_CBS104_32_ CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGTTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_gossypina_CBS107_36_ CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATGGCCATCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGTTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_iridiaustralis_CBS118404_ CTCTCACATTAGTGCAGCTCTCTCAAGCGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGCGAGAAGCGGAGGGCATACAGCCTTTGCAGGCGCGTCAAACATTGATGGTGGCATCACAGTCCTATTCGAGCGCATGAAGCAAATCACCTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAATCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGAGGCGGGATTTCATTCTTCTCAAACGAATACGGCTGGGCTTGCGACAACGTAGCATCTTATGAAGTTGTTACTGCCTCGGGGTGTATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGGGGTGGAGGCAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_iridiaustralis_CBS118486 CTCTCACATTAGTGCAGCTCTCTCAAGCGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGCGAGAAGCGGAGGGCATACAGCCTTTGCAGGCGCGTCAAACATTGATGGTGGCATCACAGTCCTATTCGAGCGCATGAAGCAAATCACCTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAATCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGAGGCGGGATTTCATTCTTCTCAAACGAATACGGCTGGGCTTGCGACAACGTAGCATCTTATGAAGTTGTTACTGCCTCGGGGTGTATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_iridiaustralis_CBS118487 CTCTCACATTAGTGCAGCTCTCTCAAGCGCATCTTTGGTGATGCGAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGCGAGAAGCGGAGGGCATACAGCCTTTGCAGGCGCGTCAAACATTGATGGTGGCATCACAGTCCTATTCGAGCGCATGAAGCAAATCACCTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAATCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTCACAACAGGAGGCGGGATTTCATTCTTCTCAAACGAATACGGCTGGGCTTGCGACAACGTAGCATCTTATGAAGTTGTTACTGCCTCGGGGTGTATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_jacinthicola_CBS133751 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCTTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGACGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAATGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_jacinthicola_CBS878_95 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCTTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGACGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGCAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAATGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGGGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_jacinthicola_CPC25267 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGACGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGCAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAATGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_longipes__CBS113_35 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTTGAGACCCGAGAGGAGACTGCCTATACCATGGCCGTCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_longipes__CBS121332 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTTGAGACCCGAGAGGAGACTGCCTATACCATGGCCGTCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_longipes__CBS121333 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTTGAGACCCGAGAGGAGACTGCCTATACCATGGCCGTCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_longipes__CBS539_94 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTTGAGACCCGAGAGGAGACTGCCTATACCATGGCCGTCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_longipes__CBS540_94 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTTGAGACCCGAGAGGAGACTGCCTATACCATGGCCGTCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_longipes__CBS917_96 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTTGAGACCCGAGAGGAGACTGCCTATACCATGGCCGTCGATTATTTTTGGTCAGCTCAGCAGAAGGTTGCCCAACCTTACTGCGTGTTCAAGCCTGAGAAAGCGCTTGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTTAGAAGCGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGCATCACAATTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCTGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCGGGGTGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGCAACAATCTCGCCCTAGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_senecionicola_CBS119545 CTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCGAAGGTCGAGACCCAAGAGGAGACTGCCTATACCTTAGCCATCGATTATTTCTGGTCAGCGCAGCAGAAGGTTGCCCAACCTTACTGCGTATTCAAGCCTGAGGAAGCGCTCGATGTATCCACCATGGTGCTGCTATCTCGTCTTACTCAGTGTCCTTTTGCAGTGAGAAGCGGAGGGCATGCAGCCTTTGCAGGTGCATCAAACATTGATGGCGGTATCACAGTTCTGTTCGAGCGCATGAAGCAAATCACTTTGTCAAAAGACAAGAAAGTTGCATCTATTGGGCCCGGTAACCTCTGGTACGACATCTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGTGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTTGCATCTTATGAAGTCGTCACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGATCTGTACTGGGCGTTGAGAGGTGGAGGCAACAATCTCGCCCTGGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_tomato__CBS114_35 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC Alternaria_tomato_CBS103_30 TTCTCACATTAGTGCAGCTCTCTCAAACGCATCTTTGGTGATGCAAAGGTCGAGACCCGAGAGGAGACTGCCTATACCATAGCCATCGATTATTTCTGGTCAGCTCAGCAGAAGGTTGCCCAACCGTACTGCGTGTTCAAGCCTGAGGAAGCGCTCGATGTATCTACCATGGTGCTGCTATCTCGTCTTACTCAATGTCCTTTTGCAGTGAGAAGTGGAGGGCATGCAGCCTTTGCAGGCGCATCAAACATTGATGGTGGTATTACAGTTCTGTTCGAGCGCATGAAGCAAATTACTTTGTCAAAAGACAAGAAAGTTGCTTCTATTGGACCCGGCAACCTCTGGTACGACATTTACACAACCCTAGCCAAAGACAACCTAGCAGTGGTAGGCGGCCGCGTCTCTGGCGTCGGAATTGGAGGTCTTACAACGGGTGGCGGGATTTCGTTCTTCTCGAACGAATATGGCTGGGCTTGCGATAACGTCGCATCTTATGAAGTCGTTACTGCCTCAGGATGCATCATAGAAGTCAGTCAAAAGTCGTATCCAGACCTGTACTGGGCGTTGAGAGGCGGAGGGAACAATCTCGCCCTCGTTACGAAGTTCAACCTCGAAACGTTCGCCCACGGTCCGC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M30181] TITLE Alternaria_section_Alternaria_endoPGupdated; LINK TAXA = Taxa3; DIMENSIONS NCHAR=448; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_aff._arborescens_CBS105_24_ CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGCTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS105_49 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS108_41 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGCTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS109730 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS112633 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS112749 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS113_41 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS115189 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS115516 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS115517 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS116329 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS117587 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS118389 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGCTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS123235 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS123266 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS123267 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS124274 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS124281 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGCTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS124282 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS124283 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCTGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS126_60 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGCTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS127263 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CBS750_68 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACCGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGCTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_aff._arborescens_CPC25266 CGTTGCCGTCCCTTCAGACACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATCGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alstroemeriae__CBS118808 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCAAGTCTGGCCGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATTCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCTCCATCACCGGCATTACCATCAAGAACCCTCCTGTCCAAGTCGTTAGTATTAACGGTTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alstroemeriae__CBS118809 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCAAGTCTGGCCGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATTCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCTCCATCACCGGCATTACCATCAAGAACCCTCCTGTCCAAGTCGTTAGTATTAACGGTTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102_47 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTATTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102595 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102596 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102598 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102599 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTGCCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102600 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102602 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTGCCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102603 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTGCCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS102604 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS103_33 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS104_26_ CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS106_24 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS106_34 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS107_27 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS107_53_ CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS109455 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS109803 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS110027 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS110977 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS112249 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS112251 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS112252 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS113013 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS113014 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS113015 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS113024 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS113025 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS113054 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS115069 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS115152 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS115188 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS115190 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS115199 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS115200 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS115616 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS116749 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS117_44 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS117130 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS117143 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS118811 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS118812 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS118814 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS118815 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS118818 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS119115 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS119399 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS119408 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS119543 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS120829 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121336 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTATTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121344 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTGCCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121346 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTGCCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121348 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121454 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121455 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121456 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121492 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121544 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS121547 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS124277 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS124278 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS125606 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS126071 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS126072 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS126908 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS126910 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS127334 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAATGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS127671 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS127672 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS130254 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS130255 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS130258 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS130259 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS130260 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACCCTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACATGACTATTGATGCGTCTGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGGTTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTAC Alternaria_alternata_CBS130261 CGTTGCCGTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTGACGGTACTACTGTCATCTTCGAGGGTACCACCACCTGGGGCTACTCAGAGTGGAAGGGTCCTCTTCTTGACATCCAAGGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGTGCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACTAAGCCCAAGTTCTTCTCCGCTCACAAACTGACCGACTCC