#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 7:42 GMT TreeBASE (cc) 1994-2008 Study reference: Coelho G., Silveira A.D., Antoniolli Z.I., & Yurchenko E. 2016. Tropicoporus stratificans sp. nov. (Hymenochaetales, Basidiomycota) from southern Brazil. Phytotaxa, 245(2): 144-152. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S16729] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=23; TAXLABELS Mensularia_radiata_KC414257 Sanghuangporus_baumii_JN642565 Sanghuangporus_sanghuang_JN794061 Tropicoporus_cubensis_JQ860324 Tropicoporus_cubensis_JQ860325 Tropicoporus_dependens_KC778778 Tropicoporus_dependens_KC778779 Tropicoporus_excentrodendri_KP030791 Tropicoporus_guanacastensis_KP030792 Tropicoporus_guanacastensis_KP030794 Tropicoporus_linteus_JQ860321 Tropicoporus_linteus_JQ860322 Tropicoporus_linteus_JQ860323 Tropicoporus_pseudolinteus_AF534075 Tropicoporus_pseudolinteus_KC778781 Tropicoporus_rudis_KP030796 Tropicoporus_rudis_KP030797 Tropicoporus_sideroxylicola_KC778782 Tropicoporus_stratificans_KM199688 Tropicoporus_stratificans_KM199689 Tropicoporus_tropicalis_AY599487 Tropicoporus_tropicalis_AY641432 Tropicoporus_tropicalis_KF695121 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M32550] TITLE Tropicoporus_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=760; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Mensularia_radiata_KC414257 GTTGCTGGCGTGGAAA-----CACGTATGTGCACGGCCTTCGTGCTC---ATCC-ACTCA--CCCTTGTGCAC-------------------------------------CTTATCGAAGTT-AGTAATACTTTTCTATCGGGCTGTAATTGGGCTG-----CTGG----------------TAT-TATTAGTC-------GCAGGGCGAAAATGC--------------TAGTGCTCTTGGTCTGAGGG-------GAAG----------------------GGACGAACAC-TTTGA-------CTTTA---CAAACACATACTTTGTC-TTGTAGAATG---TAATG-----CTCCTTGTGGGCGA--AATG-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTTTTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTTATCTCAATCTCCTTGTC-----TTCTT-AATTGAAG----TCTCG-GGGCTTGGATTTGGAGG----TCTTGCTGGCAGTT------ATGTCGGCTCCTCTTAAATACATTAGCTGGACTTTGGTTCGCGTTAC-TGGTGTAATAG--ATTTATGTTCGC---CAGACGCTTGCCTAATGGGTCT-GCTTCTAATCGTCT-------TCGGACAAGGTC Sanghuangporus_baumii_JN642565 GTTGCTGGCGCGGGAAATTCTCGCGCATGTGCACGGCCTTCGCGCTC-AAATCCAACTCAA-CCCCTGTGCACCTTT-------------------------ATATATCGCGAGTCGAAGTT-AGTAAT--------------------CTGAGGTT-----CTTG--CA------------AGT-AATCGGTA-------GGAAGGCGAAAGCGAGAGTCTTGCTCGT-TAG-GTAACCTTTCGAAAAT-------GAAAGCG---------GGTGC--GTCGGGTGAAGGC-TTCGGCTCGTT-GTTATTACAAACACCTTATATTGTCTTTGT-GAATG---TAATG-----CTCCTCGTGGGCGA--AAAG-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG{AG}ACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAACCACTCGTC----TTTCTT-AATCGAAGG---GCTTGCAGGTTTGGACTTGGAGG--GTTACTGCTGGCGCCTCTCGAGGGGTCGGCTCCTCTTAAATATATTAGCTGGGCTTTGGCTCGCGTTTA-CGGTGTAATAGTTGATTCCATTCACCAACGAGCGCTTGCCTGAAGGGCCT-GCTTCTAGCCGTCCGC-GTCGTCGGACAAGG{AG}G Sanghuangporus_sanghuang_JN794061 GCTGCTGGTGCGAAAT-----CGCGCATGTGCACGGTCTTCGCGCTC-AAATCCAACTCAAACCCCTGTGCAC-CTT-------------------------ATATATCGCGAGTCGAAGTT-AGTAGC--------------------CTGAGGTC-----TTGT--A-------------AGT-AATTAGTA-------GAAGGGCGAAAGCG--AGTCTTGCTCGT-TAG-GTAGCCTTTCGAAAAT-------GAAAGCG---------AGTGC--GTCGGGTGAAGAC-TTCGGCTTGTC-GTTAC--AAAACACCTTATATTGTCTTTGT-GAATG---TAATG-----CTCCTTGTGGGCGA--AAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTTATCTCAAACCGCTCGTC----TTTCTT-AATTGAAGG---GCTTG-AGGTTTGGACTTGGAGG--TTTACTGCTGGCGCCTTTCGAGGGGTCGGCTCCTCTTAAATACATTAGCTGGGCTTTGGCTCGCGTTTA-CGGTGTAATAGTTGATTCCATTCACCAACGAGCGCTTGCCTGACGAGCTT-GCTTCTAGCCGTCCGC-GTCGTCGGACAAGGAG Tropicoporus_cubensis_JQ860324 GCTGCTGGCGCGGAAA-----CGCGCATGTGCACGGCTCTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCAC-----------------------------CCTTCTATCCTGTCGAAGCGAAGTAGT--------------------TCGGGGAT-----CCAT--GGGA-----------------------------------------------------------------CCGTTCGTTAGGC-----------GGCC--------CCTAA--CTCGAGCGAAAGC-TTTGGCTTGTA-TTTAT---AAACCACAGTTGATGTC-TTGT-GAATG---TGATG-----CTCCTAGTGGGCGA--AAAC-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAACCTCAAATCACTCGTC---TTTTTTT-AATCGAAAG---GCTTG-TGGTTTGGACTTGGAGG-CTTTTTTGCTGGCTC--------CGGTCGGCTCCTCTTAAATGCATTAGCTGGGCTTTGGCTCGCGTTCG-TGGTGTAATAGTTAATTCTTTCGCC---TGAGCGCTTGTCGGACTGGCCC{GT}GCTTCTATTCTTCCGC-TTC{GT}TTGGACAAGGTC Tropicoporus_cubensis_JQ860325 GCTGCTGGCGCGGAAA-----CGCGCATGTGCACGGCTCTCGCGCTCAAAATCC-ACTCAA-CCCCTGTGCAC-----------------------------CCTTCTATCCTGTCGAAGCGAAGTAGT--------------------TCGGGGAT-----CCAT--GGGA-----------------------------------------------------------------CCGTTCGTTAGGC-----------GGCC--------CCTAA--CTCGAGCGAAAGC-TTTGGCTTGTA-TTTAT---AAACCACAGTTGATGTC-TTGT-GAATG---TGATG-----CTCCTAGTGGGCGA--AAAC-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAACCTCAAATCGCTCGTCTTTTTTTTTT-AATCGAAAG---GCTTG-TGGTTTGGACTTGGAGG-{CT}TTTTTTGCTG{CG}CTC--------CGG{CT}CG{CG}CTCCTCTTAAATGCATTAGCTGGGCTTTGGCTCGCGTTCG-TGGTGTAATAGTTAATTCTTTCGCC---TGAGCGCTTGTCTGACTGGCCT-GCTTCTAATCGTCCGC-TTCGTTGGACAAGGTC Tropicoporus_dependens_KC778778 GCTGCTGGCGCGGAAA-----CGCGCATGTGCACGGCTTTTGCGCTC-AAATCC-ACTCAACCCCCTGTGTGC---------------------------ACCTCTCTATCTTGTCGAAGCG-AGTAGT--------------------TTGGGACCGGACCCCAT--GGGGG------ACGGCT-AGCCGGTA-------GAAAGGGAGGGTAA---------------CAG--CTCCATTCGAAAGGC---GGGGGAAGAGCC--------CCTAACTCTCGAGCGAAAGC-TTTGGCTTGTA-TTCAT---AAATCACAGTTGATGTC-TTGT-GAATG---TGATG-----CTCCTTGTGGGCGA--AAATGAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCGCTCGTC----TTTTTT-AATCGAAAG---GCTTG-CGGTTTGGACTTGGAGG---TTTTTGCTGGCTC--------TGGTTGGCTCCTCTTAAATGCATTAGCTGGGCTTTGGCTCGCGTTCG-TGGTGTAATAGTTAATTCTTTCGCC---TGAGCGCCTGTCTGACGGGTCC-GCTTCCAATCGTCCGC-TTAGTCGGACAG-GCC Tropicoporus_dependens_KC778779 GCTGCTGGCGCGGAAA-----CGCGCATGTGCACGGCTTTTGCGCTC-AAATCC-ACTCAACCCCCTGTGTGC---------------------------ACCTCTCTATCTTGTCGAAGCG-AGTAGT--------------------TTGGGACCGGACCCCAT--GGGGG------ACGGCT-AGCCGGTA-------GAAAGGGAGGGTAA---------------CAG--CTCCATTCGAAAGGC---GGGGGAAGAGCC--------CCTAACTCTCGAGCGAAAGC-TTTGGCTTGTA-TTCAT---AAATCACAGTTGATGTC-TTGT-GAATG---TGATG-----CTCCTTGTGGGCGA--AAATGAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCGCTCGTC----TTTTTT-AATCGAAAG---GCTTG-CGGTTTGGACTTGGAGG---TTTTTGCTGGCTC--------TGGTCGGCTCCTCTTAAATGCATTAGCTGGGCTTTGGCTCGCGTTCG-TGGTGTAATAGTTAATTCTTTCGCC---TGAGCGCCTGTCTGACGGGTCC-GCTTCCAATCGTCCGC-TTAGTCGGACAG-GCC Tropicoporus_excentrodendri_KP030791 GTTGCTGGCGTGGAAT-----CGCGCAAGTGCACGGCTTTCGCGCTC-AAATCC-ATTCAAACCCATGTGCAC------------------------------CCTTTATCTTGTCGAAACG-AGTAGT--------------------TTGGGCTT-----TCGG--GAT--------GGTAGT-AGTCAGTA-------AGAGGGGAGGATGC---------------AACTGTCTCCTTTCGAAGAC-------GAAAAGT---------CCTGT--ACCGAACGAAAGT-TTTGGCTTGCA-TTTAT---AAATCACATTTGTTGTC-TTGT-GAACG---TGATG-----CTCCTTGTGGGCAAAAAAAT-ATGTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTGGTC----TTTCTT-AATTGAGAG---GTCTG-GGATTTGGACATGGAGG--GTTTCTGCTGGCTC--------GGGTCGGCTCCTCTCAAATGCATTAGCTGGGCTTCGGCTCGCGTTTA-TGGTGTAATAGTTAATTCTCTCACC---GGAGCGCTTGCCTAACGGGTCC-GCTTCTAATCGTCTGC-CTAGTCGGACAAGGCC Tropicoporus_guanacastensis_KP030792 GCTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGTGC---------------------------ACCTTTCTATCTTGTCGAAGCG-AGTAGT--------------------TTGAGACCGTCCCCCATGGGGGGG------ACGGTT-AGCCGGTA-------GAAAGGGAGGGTAA---------------CAG--CTCCATTCGAAAGGC-GGGGGGGAAGAGCC--------CCTAACTCTCGAGCGAAAGC-TTTGGCTTGTA-TTTAT---AAATCACAGTTGATGTC-TTGT-GAATG---TGATG-----CTCCTTGTGGGCGA--AAATGAAATACAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTCGTC----TTTTTT-AATCGAAAG---GCTTG-TGGTTTGGACTTGGAGG---TTTTTGCTGGCTC--------CGGTCGGCTCCTCTTAAATGCATTAGCTGGGCTTTGGCTCGCGTTCG-TGGTGTAATAGTTAATTCTTTCGCC---TGAGTGCCTGTCTGACGGGTCC-GCTTCCAATCGTCCGC-TTAGTCGGACAAGGCC Tropicoporus_guanacastensis_KP030794 GCTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGTGC---------------------------ACCTTTCTATCTTGTCGAAGCG-AGTAGT--------------------TTGAGACCGTCCCCCAT--GGGGG------ACGGTT-AGCCGGTA-------GAAAGGGAGGGTAA---------------CAG--CTCCATTCGAAAGGCGGGGGGGGGAGAGCC--------CCTAACTCTCGAGCGAAAGC-TTTGGCTTGTA-TTTAT---AAATCACAGTTGATGTC-TTGT-GAATG---TGATG-----CTCCTTGTGGGCGA--AAATGAAATACAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTCGTC----TTTTTT-AATCGAAAG---GCTTG-TGGTTTGGACTTGGAGG---TTTTTGCTGGCTC--------CGGTCGGCTCCTCTTAAATGCATTAGCTGGGCTTTGGCTCGCGTTCG-TGGTGTAATAGTTAATTCTTTCGCC---TGAGCGCCTGTCTGACGGGTCC-GCTTCCAATCGTCCGC-TTAGTCGGACAA-G{AC}C Tropicoporus_linteus_JQ860321 GCTGCTGGTGCGGAAA-----CGTACATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCAC------------------------------CTTATATCCTGTCGAAGCG-AGTAGT--------------------TTGAGATC-----AAAG--G----------------------------------------------------------------------------------------GTGTGGTCACCCTT--AGTAG--CTCGAGCGAAAGC-TTTGGCTTGTA-TTTAA--CAAACCACTATTATTGTC-TTGT-GAATGG--TAATG-----CTCCTTGTGGGCGA--AAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAACCACT{CT}G-------------------------TTTTG-TGGTTTGGACTTGGAGG---TTTCTGCTGGCCCCT---GCGGGGTCGGCTCCTCTGAAATGCATTAGCTGGGCTT{CT}GGCTCGCGTTTGTTGGTGTAATAGTTAAT{CT}{CG}TTTCACC---TGAGCGCTTGCCTGATGGGCCT-GCTTCTAATCGTCTGC-TTGGTCGGACAAGGTC Tropicoporus_linteus_JQ860322 GCTGCTGGTGCGGAAA-----CGTACATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCAC------------------------------CTTATATCCTGTCGAAGCG-AGTAGT--------------------TTGAGATC-----AAAG--G----------------------------------------------------------------------------------------GTGTGGTCACCCTT--AGTAG--CTCGAGCGAAAGC-TTTGGCTTGTA-TTTAA--CAAACCACTATTATTGTC-TTGT-GAATGG--TAATG-----CTCCTTGTGGGCGA--AAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAACCACTCG-------------------------TTTTG-TGGTTTGGACTTGGAGG---TTTCTGCTGGCCCCT---GCGGGGTCGGCTCCTCTGAAATGCATTAGCTGGGCTTCGGCTCGCGTTTGTTGGTGTAATAGTTAATCGTTTCACC---TGAGCGCTTGCCTGATGGGCCT-GCTTCTAATCGTCTGC-TTGGTCGGACAAGGTC Tropicoporus_linteus_JQ860323 GCTGCTGGTGCGGAAA-----CGTACATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCAC------------------------------CTTATATCCTGTCGAAGCG-AGTAGT--------------------TTGAGACC-----AAAG--G------------------------------------------------------------------------------------------GGTGTCACCCTT--AGTAG--TTCGAGCGAAAGC-TTTGGCTTGTA-TTTAA--CAAACCACTATTATTGTC-TTGGTGAATG---TAATG-----CTCCTTGTGGGCGA--AAAC-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAGCCACTCG--------------------------TTTG-TGGTTTGGACTTGGAGG---TTTGTGCTGGCCC------TGTGGTCGGCTCCTCTGAAATGCATTAGCTGGGCTTTGGCTCGCGTTTGTTGGTGTAATAGTTAATCCTTTCACC---TGAGCGCTTGCCTGATGGGCCT-GCTTCTAATCGTCTGC-TTGGTCGGACAAGGTC Tropicoporus_pseudolinteus_AF534075 GTTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCACCTTTATCCTGTCGAAGCGAGTAGTTTGGGACCTTTATCCTGTCGAAGCG-AGTAGT--------------------TTGGGACC-----TTTG--AGGACGTGTGTAGCAGT-AGCCGGCCAAGTAGAAAGGGGAAGGGTAA---------------CAGCTCTCCATTCGAAAGGC-------GAAGCGTCGTCTCTCGTCTAG--CTCGGGCGAAAGC-TTTGGCTTGTA-TTTAA---AAACCACATTTGTTGTC-TTGT-GAATGC--AAACG-----CTCCTCGTGGGCGA--AAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTTGTC----TTTTTTAAATCGAAAG---GCTCG-TGGTTTGGACTTGGAGG---TTTATGCCGGCTC--------CGGTCGGCTCCTCTTAAATGCATTAGCTGGGCTGTGGCTCGCGTTTG-TGGTGTGATAGTTAAGTCTTTCGCC---TGAGCGCTTGCCTGAGGGGTCC-GCTTCTAATCGTCTGC-TTGGTCGGACAAGGCC Tropicoporus_pseudolinteus_KC778781 GTTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCAC-------------------------------CTTTATCCTGTCGAAGCG-AGTAGT--------------------TTGGGACC-----TTTG--AGGACGCGTGTAGCAGT-AGCCGGCCAAGTAG-AAGGGGGAGGGTAA---------------CAGCTCTCCATTCGAAAGGC-------GAAGCGTCGTCTCTCGTCTAG--CTCGGGCGAAAGC-TTTGGCTTGTA-TTTAA---AAACCACATTTGTTGTC-TTGT-GAATGC--AAACG-----CTCCTCGTGGGCGA--AAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTTGTC----TTTTTTAAATCGAAAG---GCTCG-TGGTTTGGACTTGGAGG---TTTATGCCGGCTC--------CGGTCGGCTCCTCTTAAATGCATTAGCTGGGCTGTGGCTCGCGTTTG-TGGTGTGATAGTTAAGTCTTTCGCC---TGAGCGCTTGCCTGAGGGGTCC-GCTTCTAATCGTCTGC-TTGGTCGGACAAGGCC Tropicoporus_rudis_KP030796 GCTGCTGGCGCGGAAA-----CGCGCATGTGCACGGCCTTCGCGCTC-AAATCC-ACTCAACCCCCTGTGCAC-------------------------------CTTTATCCTGTCGGAGCG-AGTAGC--------------------TTGAGACC-----TTTT--TGGGA------CGTAGT-AGCCGGTA--ATAGTAGAAAGGAGGGTAA---------------CAG--CTCCATTCGAAAGGC-------GAAAAGGC--------CCTAA--CTCGAGCGAAAAC-TTTGGCTTGTATTTTAT---AAACCACATTTGTTGTC-CTGT-GAATGT--TAATG-----CTCCTTGTGGGCGA--GAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAACCTCAAATCACACTTG----TCTTTT------GGGG---CTTTG-TGGTTTGGACCTGGAGG---TTTCTGCTGGCCC------TGCGGTCGGCTCCTCTTAAATGCATTAGCTGGGTTTCGGCTCGCGTTTG-TGGTGTAATAGTTAATTCTTTCGCC---TGAGCGCTTGCCTGATGGGCCC-GCTTCTAATTGTCTGC-TTGGTCGGACAAGGT{CT} Tropicoporus_rudis_KP030797 GCTGCTGGCGCGGAAA-----CGCGCATGTGCACGGCCTTCGCGCTC-AAATCC-ACTCAACCCCCTGTGCAC-------------------------------CTTTATCCTGTCGGAGCG-AGTAGC--------------------TTGAGACC-----TTTT--TGGGA------CGTAGT-AGCCGGTA--ATAGTAGAAAGGAGGGTAA---------------CAG--CTCCATTCGAAAGGC-------GAAAAGGC--------CCTAA--CTCGAGCGAAAAC-TTTGGCTTGTATTTTAT---AAACCACATTTGTTGTC-CTGT-GAATGT--TAATG-----CTCCTTGTGGGCGA--GAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAACCTCAAATCACACTTG----TCTTTT------GGGG---CTTTG-TGGTTTGGACCTGGAGG---TTTCTGCTGGCCC------TGCGGTCGGCTCCTCTTAAATGCATTAGCTGGGTTTCGGCTCGCGTTTG-TGGTGTAATAGTTAATTCTTTCGCC---TGAGCGCTTGCCTGATGGGCCC-GCTTCTAATTGTCTGC-TTGGTCGGACAAGGTC Tropicoporus_sideroxylicola_KC778782 GCTGCTGGCGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCAC-------------------------------CTTTGTCCTGTCGAAGCA-AGTAGT--------------------TCCGAGAC-----TTTG--GGGAC------CGTAGT-AGCCGGTA-------GAAAGGAGGCGGGGGGCGGTTAGCTCCCCCAG--CTCCATTCGAAGAGC-------GAAAAGG---------CCCGG--CTCGAGCGAAAAC-TTTGGCTTGTA-TCTAT---AAACCACAGATATTGTC-TTGT-GAATG---TGATGGCCTACACCTTGTGGGCGA--AAAC-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAACCACACGTC----TTTTTT-AATCGAAGGGC-TTTTG-TGGTTTGGACTTGGAGGATTCTTCTGCTGGCTTC-------GGTCCGGCTCCTCTCAAATGCATTAGCTGGGCTTTGGCTCGCGTTTA-TGGTGTAATAGTTAATTCTTTCGCC---CGAGCGCTTGCCTGATGGGCCC-GCTTCTAATCGTCCGCTTTAGTCGGACAAGGCC Tropicoporus_stratificans_KM199688 GCTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCAC------------------------------CTTTTATCCTGTCGAAGCG-AGTAGT--------------------TTGAGACC-----TTGG--GGAA-------CCTAGT-AGCCAGTA-------GAAGGGGAGGGTAA---------------CAG--CTCCATTCGAAAAGT-------GAAAAGGGGGACCC--GTTAG--CTCGAGCGAAAAC-TTTGGCTTGTA-TTTCA--CAAACCACATTTA-TGTC-CTGT-GAATGTAATAATG-----CTCCTCGTGGGCGA--AAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTAGTC----TTTTTT-AATCGAAAGGC-TTTTG-TGGTTTGGACTTGGAGG---TTTCTGCTGGCTG--------TGGTCGGCTCCTCTTAAAGGCATTAGCTGGGCTTCGGCTCGCGTTTGTTGGTGTGATAGTTAATTCTTTCGCC---TGAGCGCTTGCCTGATGGGTCC-GCTTCTAATCGTCTGC-CTGGTCGGACAAGGCC Tropicoporus_stratificans_KM199689 GCTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CCCCTGTGCAC------------------------------CTTTTATCCTGTCGAAGCG-AGTAGT--------------------TTGAGACC-----TCGG--GGGA-------CTTAGTAAGTCAGTA-------GAAGGGGAGGGTAA---------------CAG--CTCCATTCGAAAAGT-------GAAAAGG----CCC--CTTAG--CTCGAGCGAAAGCTTTTGACTTGTA-TTTCA--CAAACCACGTTTA-TGTC-CTGT-GAATG---TAATG-----CTCCTTGTGGGCGA--AAAT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTAGTC----TTTTTT-AATCGAAAGGCTTTTTG-TGGTTTGGACTTGGAGG---TTTCTGCTGGCTG--------CGGTCGGCTCCTCTTAAAAGCATTAGCTGGGCTTCGGCTCGCGTTTG-TGGTGTGATAGTTAATTCTTTCGCC---TGAGCGCTTGCCTGATGGGTCC-GCTTCTAACCGTCTGC-TTGGTCGGACAAGGCC Tropicoporus_tropicalis_AY599487 GCTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC--AATCC-ACTCAA-CACCTGTGCAC-------------------------------CTATATCTGGTTGAAGCG-AGTAGT--------------------TCGGGCTC-----CTGT--AGG--------CGGAGT-AATGAGTA-------GAAAGGAGGCACAG-------------------TCTTCCGTTTGAAAGT-------GAAATGT---------CTCGG--CTCGAGTGAAAGC-TTCGACTTGTT-CTCAT---AAACCACACTTGTTGTC-TTGT-GAATG---TAATG-----CTCCCTGTGAGCGA-TAATT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTTGTC----TTTCTT-AACTGAAGG---GCCTG-AGGTTTGGACTTGGGGG---TTTTTGCTGGCTC--------CGGTCGGCTCCTCTCAAATGTATTAGCTGGGCTTTGGCTTGCGTTTA-CGGTGTAATAGTTAATCCTTTCGCC---AGAACGCTTGCCTAATAGGTCT-GCTTCTAATCGTCCGT-T---TCGGACAAGGCT Tropicoporus_tropicalis_AY641432 GCTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC--AATCC-ACTCAA-CACCTGTGCAC-------------------------------CTATATCTGGTTGAAGCG-AGTAGT--------------------TCGGGCTC-----CTGT--AGG--------CGGAGT-AATGAGTA-------GAAAGGAGGCACAG-------------------TCTTCCGTTTGAAAGT-------GAAATGT---------CTCGG--CTCGAGTGAAAGC-TTCGACTTGTT-CTCAT---AAACCACACTTGTTGTC-TTGT-GAATG---TAATG-----CTCCCTGTGAGCGA-TAATT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTTGTC----TTTCTT-AACTGAAGG---GCCTG-AGGTTTGGACTTGGGGG---TTTTTGCTGGCTC--------CGGTCGGCTCCTCTCAAATGTATTAGCTGGGCTTTGGCTTGCGTTTA-CGGTGTAATAGTTAATCCTTTCGCC---AGAACGCTTGCCTAATAGGTCT-GCTTCTAATCGTCCGT-T---TCGGACAAGGCT Tropicoporus_tropicalis_KF695121 GCTGCTGGTGCGGAAA-----CGCGCATGTGCACGGCTTTCGCGCTC-AAATCC-ACTCAA-CACCTGTGCAC-------------------------------CTATATCTGGTTGAAGCG-AGTAGT--------------------TCGGGCTC-----CTGT--AGG--------CGGAGT-AATGAGTA-------GAAAGGAGGCACAG-------------------TCTTCCGTTTGAAAGT-------GAAATGT---------CTCGG--CTCGAGTGAAAGC-TTCGACTTGTT-TTTAT---AAACCACACTTGTTGTC-TTGT-GAATG---TAATG-----CTCCCTGTGAGCGA-TAATT-AAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCACTTGTC----TTTCTT-AATTGAAGG---GCCTG-AGGTTTGGACTTGGAGG--ATTCTTGCTGGCTC--------CGGTCGGCTCCTCTCAAATGTATTAGCTGGGCTTCGGCTTGCGTTTA-CGGTGTAATAGTTAATCCTTTCGCC---AGAACGCTTGCCTAATAGGTCT-GCTTCTAATCGTCCGT-T---TCGGACAAGGCT ; END; BEGIN TREES; TITLE Tropicoporus_ML; LINK TAXA = Taxa1; TRANSLATE 1 Mensularia_radiata_KC414257, 2 Tropicoporus_guanacastensis_KP030792, 3 Tropicoporus_linteus_JQ860321, 4 Tropicoporus_pseudolinteus_AF534075, 5 Sanghuangporus_sanghuang_JN794061, 6 Tropicoporus_cubensis_JQ860325, 7 Tropicoporus_rudis_KP030796, 8 Tropicoporus_sideroxylicola_KC778782, 9 Tropicoporus_dependens_KC778779, 10 Tropicoporus_guanacastensis_KP030794, 11 Tropicoporus_linteus_JQ860323, 12 Tropicoporus_stratificans_KM199688, 13 Tropicoporus_cubensis_JQ860324, 14 Tropicoporus_tropicalis_AY599487, 15 Tropicoporus_excentrodendri_KP030791, 16 Tropicoporus_rudis_KP030797, 17 Tropicoporus_linteus_JQ860322, 18 Tropicoporus_tropicalis_KF695121, 19 Sanghuangporus_baumii_JN642565, 20 Tropicoporus_stratificans_KM199689, 21 Tropicoporus_pseudolinteus_KC778781, 22 Tropicoporus_dependens_KC778778, 23 Tropicoporus_tropicalis_AY641432; TREE ML_tree = [&R] (5:0.04612907,19:0.0292581,(1:0.29021174,((18:3.5E-7,(14:1.0E-8,23:1.0E-8):0.01186632):0.11401895,(15:0.13721945,(((11:0.01887966,(3:1.6E-7,17:1.3E-7):0.01284357):0.07856602,((12:0.01469386,20:0.01425226):0.03599751,(8:0.08880252,(7:1.0E-8,16:9.0E-8):0.06198716):0.00872381):0.00579955):0.01162377,((4:0.0036444,21:1.6E-7):0.06462442,(((9:1.0E-8,22:0.00180695):0.01903014,(2:0.00182979,10:0.00180584):0.00557541):0.022501,(6:0.00361558,13:0.00756142):0.04652269):0.04874858):4.17E-6):0.05902251):0.02546268):0.10910068):0.12822368); END; BEGIN TREES; TITLE Tropicoporus_BI; LINK TAXA = Taxa1; TRANSLATE 1 Mensularia_radiata_KC414257, 2 Tropicoporus_guanacastensis_KP030792, 3 Tropicoporus_linteus_JQ860321, 4 Tropicoporus_pseudolinteus_AF534075, 5 Sanghuangporus_sanghuang_JN794061, 6 Tropicoporus_cubensis_JQ860325, 7 Tropicoporus_rudis_KP030796, 8 Tropicoporus_sideroxylicola_KC778782, 9 Tropicoporus_dependens_KC778779, 10 Tropicoporus_guanacastensis_KP030794, 11 Tropicoporus_linteus_JQ860323, 12 Tropicoporus_stratificans_KM199688, 13 Tropicoporus_cubensis_JQ860324, 14 Tropicoporus_tropicalis_AY599487, 15 Tropicoporus_excentrodendri_KP030791, 16 Tropicoporus_rudis_KP030797, 17 Tropicoporus_linteus_JQ860322, 18 Tropicoporus_tropicalis_KF695121, 19 Sanghuangporus_baumii_JN642565, 20 Tropicoporus_stratificans_KM199689, 21 Tropicoporus_pseudolinteus_KC778781, 22 Tropicoporus_dependens_KC778778, 23 Tropicoporus_tropicalis_AY641432; TREE BI_con50majrule = [&R] (1:0.1429133947768514,(5:0.0316025419579768,19:0.02346597541726564):0.07263145425884948,((((((2:0.002367613573005879,10:0.00225870157518272):0.006265967976339892,(9:9.764005493626082E-4,22:0.002257556185282717):0.01380640403348702):0.01715116940105133,(6:0.003765091220289346,13:0.006327015642663871):0.03158897936136181):0.03308268435829446,(((3:0.001148657613013458,17:0.001512396772915975):0.009573424480721982,11:0.01419542047254131):0.04993502327159397,((7:9.832791546546646E-4,16:9.683073601471863E-4):0.04452402737648811,8:0.0595375981593499):0.008514152125636424,(12:0.01197537541591145,20:0.01122810623545502):0.02427253224658933):0.01040279094805022,(4:0.00300432367574358,21:0.001407798960479693):0.04468984329841184):0.0402188284920204,15:0.08432853399064033):0.02525981707637517,((14:9.870295428683737E-4,23:0.001029980531365387):0.008208293237446119,18:0.002282437898104341):0.06755412136420666):0.05954641458179719); END;