#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 21:02 GMT TreeBASE (cc) 1994-2008 Study reference: Dentinger B., & Mclaughlin D. 2006. Reconstructing the Clavariaceae using nuclear large subunit rDNA sequences and a new genus segregated from Clavaria. Mycologia, 98(5): 746-762. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1699] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=19; TAXLABELS Armillaria_NABSI_GC17 Armillaria_irazuensis Armillaria_tabescens Cyptotrama_asprata Flammulina_velutipes Gloiocephala_menieri Gloiocephala_sp._TENN7573 Gloiocephala_spathularia Oudemansiella_canarii Physalacria_aff._orinocensis Physalacria_corticola Physalacria_inflata Physalacria_maipoensis Physalacria_sp._DJM_1035 Rhizomarasmius_pyrrhocephalus Rhodotus_palmatus Strobilurus_trullisatus Xerula_furfuracea Xerula_megalospora ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=20; TAXLABELS Clavaria_argillacea Clavaria_fumosa Clavaria_fusiformis Clavaria_redoleoalli Clavaria_sulcata Clavaria_vermicularis Clavaria_zollingeri Clavulinopsis_helvola Clavulinopsis_laeticolor Galerina_paludosa Gymnopilus_aeruginosus Gymnopilus_junonius Gymnopilus_penetrans Gymnopilus_spectabilis Hebelomina_neerlandica Mucronella_calva Mucronella_sp_DJM1309 Phlebia_tristis Ramariopsis_kunzei Ramariopsis_sp._DJM1049 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=11; TAXLABELS Bulbillomyces_farinosus Henningsomyces_candidus Macrotyphula_defibulata Macrotyphula_fistulosa Macrotyphula_juncea_DJM_1032 Macrotyphula_juncea_DJM_975 Phyllotopsis_nidulans Pleurocybella_porrigens Typhula_phacorrhiza_AF393079 Typhula_phacorrhiza_AY586724 Typhula_phacorrhiza_DAOM195241 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=11; TAXLABELS Actiniceps_laevis Bioluminescent_mycenoid Calyptella_capula Chaetotyphula_hyalina Chaetotyphula_sp._BDCR0419_2C Hemimycena_delicatella Hemimycena_ignobilis Mycena_adonis Mycena_aurantiidisca Pistillaria_sp._DJM1031 Pleurotopsis_longinqua ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=18; TAXLABELS Auriscalpium_vulgare Cantharellopsis_prescotii Clavaria_nebulosoides Clavaria_purpurea_BD299 Clavaria_purpurea_DJM1334 Clavulina_cristata Cotylidia_alba Cotylidia_aurantiaca Cotylidia_diaphina Hyphodontia_radula Omphalina_brevibasidiata Omphalina_marchantiae Omphalina_rosella Ramaria_eumorpha Resinicium_bicolor Rickenella_mellea Rickenella_pseudogrisella Trichaptum_abietinum ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M914] TITLE Hymenochaetoid_clade_28S_rDNA; LINK TAXA = Taxa5; DIMENSIONS NCHAR=896; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Auriscalpium_vulgare TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG-GTCTCTGGCCGTCCGAGTTGTAGT-CTGGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAGTGCTC-TGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCGCGTTCCTCGAGACTCAGCCTTGCCTTCCGGCCTGGTGTACTTCTCGTTG-AACGGGCCAGCATCAATTTTGAT-CGTCGGATAAAGGCGGGAGGAAGGTGGCACCCCTCGGGGTGTGTTATAGCCTCTCGTCACATACGACGGTTGGGATTGAGGACCGCAGCACGCCTTTATGGTCGGGG--TTCGCCC-ACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAATGACCNGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTCGGGTGGA-AAACCCGTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TGTCGTGGAGGG-CACCGACGCCCGGACCAGACCTTCTGTGACGGATCTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Cantharellopsis_prescotii TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA--GTTTAGGCTGTCCGAGTTGTAAT-CTGGAGAAGTGTTTTCCGTGTTGGACCGTGCAAAAGTCTCTTGGAATAGAGCATCATAGAGGGTGAGAATCCCGTC-TTTGGCACGGAC-TACCAATGCTT-TGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGGACTCAGCCTTGC--TTCTGCTTGGTGTACTTCCCGGTT-GACGGGCCAACATCGATTTTTGC-TGGTGGAAAAAGGTGGGGGGAATGTGGCACCTTT--TGGTGTGTTATAGCCCCTCATTGTATGCATCAGCGGGGATCGAGGACCGCAGCACGCCC-TTGTGGCCGGG--TTCGCCC-ACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTAGGGTGAT-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGATCCT-TGTCATGGGGAG-CACCGACGCCCGGCCTTGAACTTCTGTGACGGCGCCGCGGTGGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Clavaria_nebulosoides TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACGTGTCTTTGGCCGTCCGAGTTGTAAT-CTGGAGAAGTGTTTTCTGTGTTGGACCGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAATGCTC-TGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGGACTCAGCCTTGC--TTTTGCTCGGTGTACTTCCTGGTT-GACGGGTCAACATCGATTTTGGT-CGGCGGACAATGGTGGGGGGAATGTGGCACCTTT--GGGTGTGTTATAGCCTCCCGTCGGACGCGTCGACTGGGATCGAGGACCGCAGCACGCCTTTTTGGCCGGGG--TTCGCCC-ACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTAGGGTGGT-AAACCCTTGCGCGCAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGGGGG-CACCGACGCCCGGCCTTGAACTTCTGTGACGGTGCCGCGGTGGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCNGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGNGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Clavaria_purpurea_BD299 TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACGTGTCTTTGACCGTCCGAGTTGTAAT-CTGGAGAAGTGTTTTCTGTGTTGGACCGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAATGCTC-TGNGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGGACTCAGCCTTGC--TTTTGCTCGGTGTACTTCCTGGTT-GACGGGTCAACATCGATTTTGGT-TGGCGGACAATGGTGGGGGGAATGTGGCACCTTT--GGGTGTGTTATAGCCTCCCGTCGGACGCGTCGACTGGGATCGAGGACCGCAGCACGCCTTTTTGGCCGGGG--TTCGCCC-ACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTAGGGTGGC-AAACCCTTGCGCGCAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGGGGG-CACCGACGCCCGGCCTTGAACTTCTGTGACGGTGCCGCGGTGGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Clavaria_purpurea_DJM1334 TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACGTGTCTTTGGCCGTCCGAGTTGTAAT-CTGGAGAAGTGTTTTCTGTGTTGGACCGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAATGCTC-TGTGATACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGGACTCAGCCTTGC--TTTTGCTCGGTGTACTTCCTGGTT-GACGGGTCAACATCGATTTTGGT-CGGCGGACAATGGTGGGGGGAATGTGGCACCTTT--GGGTGTGTTATAGCCTCCCGTCGGACGCGTCGACTGGGATCGAGGACCGCAGCACGCCTTTTTGGCCGGGG--TTCGCCC-ACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTAGGGTGGT-AAACCCTTGCGCGCAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGGGGG-CACCGACGCCCGGCCTTGAACTTCTGTGACGGTGCCGCGGTGGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Clavulina_cristata TTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCA-GTCTTTGGTTGCCCGAATTGTAAT-CTAGAGAAGCGTTTTCCGTGCTGGACTGTGTACAAGTTTCCTGGAACGGAACATCATAGAGGGTGAGAATCCCGTC-CTTGACACAGAC-CCCCAGTACTTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGAAGTCAGTCACGTTTGCTTGGACTCAGCCTT{AT}C--TTCGGTTTGGTGCATTTCCTTGCA-GACGGGCCAGCGTCCATGTTGTT-TGCCGGAGAAGGGGTGAGAGAATGTGGCTCCTTT--GGGAGTGTTATAGCTCTTGCTCGTATGCGGGGAATGATATGGAGTGGTACAGCAC--------------------------ACTTT-GGTGGTGCTTGTGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTCTGCGAGTGTTTGGGTGGA-AAACCCGGGTGCGTAATGAAAGTGATG-GCTGGGAACCC-CTTTTGGGAGG--CACCGGCGCCCCGAGCTGACCTTCTGTGACGCATCGGAGGCAGAGCATACATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Cotylidia_alba TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA---GTTTCACTGTCCGAGTTGTAAT-CTGGAGAAGCATTTTCCGTGCTGGACTGTATACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTC-TTTGATACAGAC-TACCAGTACTT-TGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTATTGGGATTCAGCCTTGC--TTCTGCTTGGTGTACTTCCTAATG-GATGGGTCAACATCGATTTTGAC-CGGTGGATAAAGGTAAAGGGAATGTGGCACCTCC--GGGTGTGTTATAGCTCTTTATCACATGCATTGGTTGGGATCGAGGATCGCAGCATGCCTTTTTGGCCGGGG--TTCGCCC-ACGTACCATGCTTAGGATGTTGACATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTAGGGTGGT-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TGTCATCGAGGG-CACCGACGCCCGGCCTTGAACTTCTGTGACAGAGCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Cotylidia_aurantiaca TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG---GTTTCACCGTCCGAGTTGTAATTCTGGAGAAGTGTTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAGTGCTT-TGTGATACACTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGGACTCAGCCTTGC--CTTGGCTTGGTGTACTTCCTGGTT-AACGGGCCAACATCGATTTTGACCGGATGGATAAAGTTAGAGGGAATGTGGCACCTTT--GGGTGTGTTATAGCCCTCTATCATATGCGCCGGTTGGGATCGAGGACTGCAGCACGCCTTTATGGCCGAGG--GTAACC-TACGTACCGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTAGGGTGGT-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGAGGG-CACCGACGCCCGGCCTTGAACTTTTGTGACGGAGCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Cotylidia_diaphina TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCA--GCTT-CGCTGTCCGAGTTGTAAT-CTGGAGAAGCATTTTCCGTGCTGTACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAGTGCTT-TGTGATATGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGGACTCAGCCTTGC--TTCTGCTTGGTGTACTTCCTGGTT-GACGGGCCAACATCAATTTTGAT-CAGTGGATAAAGGCAGAGGGAATGTGGCACCTCC--GGGTGTGTTATAGCCCTTTGTCACATGCATTGGTTGGGATTGAGGACCGCAGCACGCCTTTT-GGCCGGGG--TTCGCCC-ACGTACCGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCAAGTGTTAGGGTGGT-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGAGGG-CACCGACGCCCGGCCTGAAACTTCTGTGACGGAGCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Hyphodontia_radula TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGACA---GTTTCACTGTCCGAGTTGTAAT-CTGGAGAAGCATTTTCCGCGTCGGACCGTGTACAAGTTTCTTGGAATAGAACGTCATAGAGGGTGAGAATCCCGTC-CATGACACGGAC-TACCGATGCTT-TGTGATATGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGTGAGGGANNNNNNNNNNCCTTGGAAAGAGAGTTAA{AC}CAGTACGTGAAATTGTTGAAAGGGAAACGCCTGAAGTCAGTCCCGTTGGCAGAGACTCAGC--TGC--TT--GCAT-GTGTACT-CTCAGTT-AACGGGTCAACATCAATTTCAGT-TGGTGGATAAAGGC-ATTGGAATGTGGCAC-TTC---GGTGTGTTATAGACCTCTGTCGCATACACTGACC-GGATTGAGGAACGCAGCACGCCACTAAGGCCAGGG-ATCCGTCCCATGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTAGGGTGGA-AAACCCTTGTGCGTAATTAACGTGAAA-GTTGGGACC---TCTTGC-GAGGG-CACCGACGCCCGGCCCTGAAGTTTACTGACGGCGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGG-TGAAGCCAGGGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGG-TATAGGG-CGAAAG-CTA-TCG Omphalina_brevibasidiata TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG---GTTACGCCGCCCGAGTTGTAAT-CTGGAGAAGTGTTTTCCGTGTTGGACCGTGTACAAGTCTCTTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAATACTT-TGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCTGGGACTCAGCCTGGC-TATCCGCTTGGTGTACTTCCTGGGT-GACGGGCCAACATCGATTTTGGT-CGGCGGATAAAGGTGGGGGGAATGTGGCATCTTC--GGATGTGTTATAGCCCCCTGTCGGATGCGTCGGCTGGGATCGAGGATCGCAGCACGCCTTTTTGGCCGGGG--TTCGCCC-ACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTAGGGTGGA-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCCT-TGTCATGGGGGG-CACCGACGCCCGGCCTTGAACTTCTGTGACGGCGCCGCGGTGGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Omphalina_marchantiae TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG--GTTAACTCCGTCCGAGTTGTAAT-CTGAAGAAGCATTTTCGATGCCAGCCCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTC-CATGGCACGGACATNCTGGTGTCA-TATGATATGCTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCAAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACATTGGCCGGGACTCAGCCGCGACTTTGGTCTTGGTGTACTTCCTGGTT-GATGGGTCAATATCTATTTTGGT-CGACGGATAAATTCGGCTTGAATGTAGCACCCTTTTGGGTGTGTTATAGCTTGTCGTCTGATACGCCGACTGGGATTGAGGATCGCAGCACGCCCTTGTGGCCGGGG--TTCGCCC-ACGTATTGTGCTTAGGATATTGACATAATGACNTTAATCGACCCGTCTTGANACACGGNCCAAGGAGTCTAACATGCCTGCGAGTATTAGGGTGACTAAACCCTTGTGCGCAATGAAAGTGACA-GTTGGGACCC--TCTCAC-GAGGGGCACCGACGCCCGGCCTTGATCTTCTGTGACGGTGCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Omphalina_rosella TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG--GTTTATGCCGTCTGAGTTGTAAT-CTGGAGAAGTGTTTTCTGTGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TGCCAATGCTA-TGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGTGTCGTCTGGGACTCAGCCTTGC--TTCTGCTTGGTGTACTTCCTGGTT-GACGGGCCAACATCGATTTTGAC-CAGTGGACAAAGACAAATGGAATGTGGCACCTTC--GGGTGTGTTATAGCCTTTTGTTGCATACGCTGGTTGGGATTGAGGACTGCAGCATGCCTTTTTGGCCGGGGCATTTGCCC-ACGTAACATGCTTAGGATGTTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTCGCGAGTGTTAGGGTGGT-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGAGGG-CACCGACGCCCGGCCTTGAACTTCTGTGATGGCGCCGAGGTAGAGCGCGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Ramaria_eumorpha TTCCCCTANTAACNGCGAGTGAAGCGGGAAGAGCTCNAANTTGTAATCTGGCG-GTCTCTGTCCGTCCGAGTTGTAGT-CTGGAGAAGCGTCTTCCTCGCCGGACCGTGTATAAGTCTCTTGGAAGNNGGCGTCATAGAGGGTGAGAATNCCGTC-TTCGACACGGAC-TACCGGTGCTT-TGTGATNCNCTCTCGAAGAGNCGAGNTGTTTGGGAATNCAGCTCAAAANGGGTGGTAAATTCCATCTAAAGCTAAATATTGTCGAGAGACCGATANCGAACAAGTACCGTGNGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGCGTCTCCCGGGACTCAGCCCCGC--TTCTGTGGGGTGCACTTCCCGGGGCGACGGGCCAGCATCGATTTCGAC-CGTCAGAGAAAGGTCGGGGGAATGTGGCACCTTC--GGGTGTGTTATAGCCCTCGGTCGCATGTGACGGTCGGGATCGAGGATCGCAGCACGCCTTCATGGCCGGGG--TTCGCCC-ACGTAACGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGGACGCGGAATGAAAGTGAAAGGTTGGGACCTC-TGTCGTGGAGGG-CACCGACGCCCGGACCAGACCTTCTGTGACGGTTCCGAGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAACTTGGGTATAGGGGCGAAAGACTAATCG Resinicium_bicolor TTCCCCTAGTAACTGCGAGTGAAGAGGGAAA-GCTCAAATTTAAAATCTGGCA--GCTTTGGCTGTCCGAGTTGTAAT-CTGGAGAAGTGTTTTCAGTGCAGGACCGTGTACAAGTCTCTTGGAATGGAGCATCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCTGTGCTT-TGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTTGTTAGAACTCAGC-TTGGC-TTCTGCTTAGTGTACTTTCTAATG-AACGGGCCAACATCGATTTCAGT-CAGTGGATAAGGGTAAGAGGAATGTGGCACCTTC--GGGTGTGTTATAGCCTCTTATCGTATACATTTACTGGGATCGAGGTCTGCAGCAC---TT----------------------------GTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTAGGGTGGT-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGGGGG-CACCGACGCCCGGTCCAGAACTTCTGTGACGGTACTGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Rickenella_mellea TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG---GTTATGCCGNCCGAGTTGTAAT-CTGGAGAAGCGTTTTCCGTGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAATGCTT-TGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCTGGGACTCAGCCTTGC--TTCTGCATGGTGTATTTCCTGGTT-AACGGGCCAACATCGATTTTGGT-CGGTGGATAAAGTCGAGAGGAATGTGGCACCTTC--GGGTGTGTTATAGCCTCTTGTCGGATGCATCGACTGGGATCGAGGATCGCAGCACGCCTTTTTGGCCGGGG--TTCGCCC-ACGTAACGTGCTTAGGATGTTGGCATAATGGCTNTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTAGGGTGGA-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGGGGG-CACCGACGCCCGGCCTTGAACTTCTGTGACGGCGCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Rickenella_pseudogrisella TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG---GTTTTGCCGTCCGAGTTGTAAT-CTGGAGAAGTGTTTTCCGTGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTC-TTTGACACGGAC-TACCAATACTT-TGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGGACTCAGCCTTGC--TTCTGCTTGGTGTATTTCCTGGTT-GACGGGCCAACATCGATTTTGGA-CGGCGGATAAAGATGGAGGGAATGTGGCACCTTA--GGGTGTGTTATAGCCTTCTGTCGCATACGTCGACTGGGATCGAGGATCGCAGCACGCCTTTTTGGCCGGGG--TTCGCCC-ACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTAGGGTGGA-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TGTCATGGAGGG-CACCGACGCCCGGCCTTGAGCTTTTGTGACGGTGCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCG Trichaptum_abietinum TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCG---GTTTCACCGTCCGAGTTGTAAT-CTGGAGAAGCGTTTTCCGTGTCGGACCGTGCACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTTTTATGGCACGGAC-ACCCGATACTT-TGTGATACGTTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATACGGACCAAGTACCGTAAGGGAAAGATCAAAAGCACCTTTGGAAAGAGAGTTAACCAGTACGTGAAATTGTTGAAAGGGAAACGCCTGAAGTCAGTCGCGTCCTCTAGGAATCAGCCTTAC--TTCGG-TTAGTGTACT--CTGGTTTGACGGGTCAACATCGATTTTGAT-CGACGGATAAAGG-AGAAGGAATGTGGCACCTCC--GGGTGTGTTATAGCCCTC-CTCGTATACGTCGATT-GGATCGAGGACTGCAGCACGCCTT-GTGGCCGGGG--TTCGCCCTACGTATCGTGCTTAGGATGTTGACATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTCGCGAGTGTTAGGGTGGA-AAACCCTTGCGCGTAATGAAAGTGAAA-GTTGGGACCTC-TG-CAAGGAGGG-CACCGACGCCCGGCCCTGAAGTTCTCTGACGGTGCTGCGGTAGAGCGCGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGG-CGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGG-TATAGGG-CGAAAGACT-ATCG ; END; BEGIN SETS; CHARSET AMBIG (CHARACTERS = Hymenochaetoid_clade_28S_rDNA) = 54-60; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Hymenochaetoid_clade_28S_rDNA) = N: 1-896; CODONPOSSET CodonPositions (CHARACTERS = Hymenochaetoid_clade_28S_rDNA) = N: 1-896; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M912] TITLE Clavaria_clade_28S_rDNA; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1409; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Clavaria_argillacea NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAACAAGGATTCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGTCAG-TTCT----GCT-GACCGAGTTGTAAATTAGAGAAGTGCTATCAG-TGCTGG-CCTG-TGTAAAAGTCTCTTGGAAAAGAGCATCATAGAGGGTGACAATCCCGTCTTTGGTACAG-ATC--TCCAGTGCTTCCATGATGCGCTCTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAAACCGATAGCGCACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATTCTTCAGAAATCAACCTGAC----TTTGGTCTGGCTTACTTTCT--GTT--GGATGGGTCAGCATCAATTTTGATCATTGGATAAA-GCCCTTGGGAA-AGTGGCATC-TCC---GGATGTGTTATAGCCCTTGGATCACATACAATGGTTGGGATTGAGGAACTCAGTGTGAATTT-------GGAG----CTTTGC----TCACAACACGCACTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACATGCGAGTGTTTGGGTGGAAAA--CTCAAGCGCGCAATGAAAGTGAAA-GTTGAGAACCCTGTCGT--GGGGTGCATCGACGCCCGGACCTGACCTTTT-GTGATGGACCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACCCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGCCGAAGTTTCCCTCAGGATAGCAGACACTCAGA--ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGATGAAACCGTTTCTTAATTGAACCGTTTCGCGATTGAAGAGTGTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGAAGTTAAGGTGCCGGAATCTACGC{CT}CAT{CT}AGACACCACAAAAGGTGGTTAGTTCATCTAGACAGCACGGACGGTGGGCCATGGAAGTCGGGAATCCGCTAAGGGT{GT}{GT}{GT}TAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTAGTACCCATACTNNN Clavaria_fumosa NNNNNNNNNNNNTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCAACAAGGATTCCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTGTAATCTGGCAG-TCATAT-GGCT-GTCCGAGTTGTAAGTTAGAGAAGTGTCATCCG-TGCTGG-CCTG-CACAAAAGTCCCTTGGAAAAGGGCATCATAGAGGGTGACAATCCCGTCTTTGGTGCAG-ACC--ACCAGTGCATTTGTGATGCGCTCTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATGGGCGAGAAACCGATAGCGCACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCATATCCCTCAGAAATCAACC-CACCC-ATTGGGTCAGGTGCATTTTCTGTGTT--GGATGGGTCAGCATCAATTTTGACCATTGGATAAA-GGGCTTGGGAA-TGTGGCATC-TCC---GGATGTGTTATAGACCATGT-CTGCATACAATGGTTGGGATTGAGGAACTCAGTGTGACCTTT-TGGTTTGGGGG---TTTTAACC-TCACACTACACACTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCATGCAAGTGTTTGGGTGGAAAA--CCCAAGCGCGTAATGAAAGTGAAA-GTTGAGAACCCTGTTAT--GGGGTGCATCGACGCCCGGCCCTGACCTTCT-GTGACGGACCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCGCCGAAGTTTCCCTCAGGATAGCAGACACTCATTGGATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGATGAAACCGTTTCTTAATTGAACCGTTTCGCGATTGAAGAGTGTCTAGTGGGCCATTTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGCAACGTGAGGTTAAGTGCCGGAATCTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCATGGAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGATGAACTAGACCTGAAATGGATGCGCTAACGNNNNNNNNNNNNNNNNNNNNNNNN Clavaria_fusiformis NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTGAAATCTGGCGG-TTCT----GCC-GTCCGAGTTGTAGTTTAGAGAAGTGCTACCCG-CGCTGG-CCTG-TGCATAAGTTTCTTGGAAAAGAACATCATAGAGGGTGACAATCCCGTCTTTGGCACAG-ACTT-ACCAGGGCTTTTGTGGTGTGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGTGTCCTCTGGAAATCAAG-TTGAC---TCTGGTTGACTGTACTTTCCAGCTG--GGATGGGTCAGCATCAATTTTGATCGCTGGATAAA-GGCCTTGGGAA-TGTGGCATC-TTC---GGATGTGTTATAGACCATGGTACTGATACAGTGGTTGGGATTGAGGAACTCAGTGTGCCTTCA-TGGTTGGGG----CTTTTTAGCTCACATTAGCGCACTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAA--CCCATATGCGCAATGAAAGTGAAA-GTTGAGATCTCTGTCAT--GGAGAGCATCGACGCCCGGACCTGACCTTCT-GCGAGGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAG--TGCTACTTGGTGGTTAAGAGGCACCTGAAAGGGTTCAGCCTAGTGAGCAATTGAGGCTTGCGACACTGTCAAATTGCGGGGACGTCCTAAAGCCTTCACTACTAAGCCAATGTTGAAAAGTATT-GGTGGCCGAGTTAATGACCCTGGGTATAGTAAAAATGTGAAGGATATTACAATGGATAATCTGCAGCCAAGTCCTAAAGGTTTAAAAGACCTATGGATGCAGTTCACAGACTAAATGGCAGTGGGTGTGGCATATTTGGTGCCATGCTTAAGATATAGTCGGTCCTACCGTGAAAGCGGTCTGGCAGAGGAGGACTTTCATCTCTCAATATTTGATGCAAGTCCAGAGCTGCTGGGAGGCTTTTGAAAGCCTTTGGGTATAATGCTAGTAGCTGGTTCCC Clavaria_redoleoalli NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGGCAG-TCTCT--GGCT-GTCCGAGTTGTAAATTAGAGAAGCGTTATCCG-CGCTGG-ACTG-TGCATAAGTTCCTTGGAAAAGGGCATCATAGAGGGTGACAATCCCGTCTTTGGCACAG-ACT--CCCAGGGCTTTTGTGATGCGCTCTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAAACCGATAGCGCACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCATCCTTCAGAAATCAACCTGACC--GNTAGGTCTGGCGTACTTTCT--GATT-GGATGGGTCAGCATCAATTTTGATCATTGGATAAA-GGCTTTGGGAA-CGTGGCATC-TTT---GGATGTGTTATAGCCCTTGGTTCATACACAGTGGTTGGGATTGAGGAACTCAGTG----------------------CTTTT-------------AGCACTCAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACATGCGAGTGTTTGAGTGGCAAA--CTCGAGCGCACAATGAAAGTGAAA-GTTGAGAACCCTGTCGT--GGGGTGCATCGACGCCCGGACCTGACCTTTT-GTGATGGACCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Clavaria_sulcata NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTGAAATCTGGCAG-GTCTTGTATCT-GTCCGAGTTGTAGTTTAGAGAAGTGTCATCCG-CGCTGGGTCTG-TGCACAAGTTTCTTGGAACAGAACATCATAGAGGGTGATAATCCCGTCTTTGGCACAG-ATTTGACCAGGGCTTTTGTGATGCACCCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGCGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGATGCATCTTGCAGAGATCAACCT-GAC---AAATGTCAGGTGTATTCCCTG-TCTT--GATGGGTCAGCATCAATTTTGATTGCTGGATAAA-GGCTGATGGGAAAGTGGCATCCTACG--GGATGTGTTATAGACCATGG--CCCATACAGTGATTGGGATTGAGGAACTCGGCCAAAA-----TGTTTG-----TTTTGG-----------------TCTCAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTATTTGGGTGGAAAAA-CCCTTATGCGAAATGAAAGTGAAAAGTTGAGATCTCTGTCGT--GGAGAGCATCGACGCCCGGACCAGAGCTTCGTGCGATGGATCTGCGGTGGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTC-TAGCGATTCTGACGTGCAAATCGATCGTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Clavaria_vermicularis NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTAAAATCTGGCAG-TCTTT--GATT-GTCCGAGTTGTAAATTGGAGAAGTGTTATCCG-CGCTGG-CCTG-TGCATAAGTCTCTTGGAAAAGAGCATCATAGAGGGTGACAATCCCGTCTTTGGCATAG-ACT--ACCAGGGCTTTTGTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCATGTCCCATTGAAATCAACCTGACAC--TCGTGTCTGGTGTACTTTCT--ATG--GGACAGGTCAGCATCAGTTCTGACTGCTGGAAAAA-GGCCTTGGGAA-TGTGACATCTTTCTCAAGATGTGTTATAGCCCTTGGACCACATACAGTGGTTGGGACTGAGGAACTCGGTGTG-------TGATTT--AGCTCCTTAGGGAGCCACG-----CATTCAAGGATGCTGGCGTAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCATGCGAGTGTTTGGGTGGAAAA--CTCAAGCGCGCAATGAAAGTGAAA-GCTGAGAACCCTGTCAAA-GGGGTGCATCGACGCCCGGTCTTGAACTTTTAGTGACAGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGNAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Clavaria_zollingeri NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTAACCAGGATTCCCTTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTGTAATCTGGCAG-TG-CT---GCT-GTCCGAGTTGTAAATTCAAGAAGTGTTATCCAATGCTGG-ACCCATGCACAAGTCTCTTGGAAAAGAGCATCATAGAGGGTGACAATCCCGTCTCTGGCATGG-ACT--CCCAGCACTCCTGT--TACACTTTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCATGTTCATCAGAAATCAACCTGACCCT-TGTGGTCTTGTGCACTTTCT--GGT--GAGCAGGCCAGCATCAATTTTNGACCACTGCAAAAAGGCTTAGGAAAATGTAGCATCCTTCG--GGGTGTGGTATAGTCCTGAGTTGGATANCAGTGGTTGGGATTGAGGAACTCAGTGTGACCNTTCGGGNTTTGGAGGG{GT}TTTACTTCTCACAA-CACACACTTAGGATGCTGGCGTAATGGCTTTAATTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACATGCAAGTATTTGAGTGGAAAA--CTCAAGTGCGCAATGAAAGTGAAA-GTTGAGAACC{CT}TGTCGT--GGGGTGCACCAACGCCCGGTCCAGAGCTTCT-GTGACGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGACACTCATAG-CTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGGAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGATGAAACTGTTTCTTAATTGAACTGTTTCGTGATTGAAGAGTGTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCAAGGTTAAAGTGCCGGAATCTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAATCCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Clavulinopsis_helvola NNNNNNNNNCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGCTAACAAGGATTCCCTTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTGAAATCTGGCGG-TTCTAGTAGCC-GTCCGAGTTGTAGTTTAGAGAAGTGCTATCCG-CGTTGG-CCTG-TGCATAAGTTTCTTGGAAAAGAATATCATAGAGGGTGACAATCCCGTCTTTGGCACAG-ATC--ACCAGGGCTTTTGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGTG{AT}CCTCTAGGGATCAAG-TCAGC---TCTGGTTGACCGTACTTTCTA-GTT--GGATGGGTCAGCATCAATTTTGATCGCTGGACAAA-GGCCTTGGGAA-TGTGGCATC-TTC---GGATGTGTTATAGACCATGGTTCTGATACAGTGGTTGGGATTGAGGAACTCAGCGTGAATT--------GGGG----CTATTA-GCTCACATC-GCACGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAA--CCCATATGCGCAATGAAAGTGAAA-GTTGAGATCTCTGTCAT--GGAGAGCATCGACGCCCGGACCTGACCTTTT-GTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTGATTTGCTACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Clavulinopsis_laeticolor NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGAGGGATGAGCTCAAATTTGTAATCTGGCAG-TATCT--CACT-GTCCGAGTTGTAAATTCAAGAAGTGTTATCCG-TGTTGG-ACCA-TGCACAAGTCTCTTGGAAAAGAGCATCATAGAGGGTGACAATCCCGTCTCTGGCATGG-ACG--CCCACCACATTCGTGA{GT}GCACTTTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCTTGTGCTTCAGAAATCAGCAGGAC----TC{CT}-GTCTTGTGCACTTTCT--GTT--{CT}CACAGGCCAGCATCAATTTCAACGGCTAGAGAAA-AGCTTTGGAAA-TGTGGCATC-TTCTATGG-TGTGTTATAGTCCTTGG-CTGTATGTAGTCGTCGGGATTGAGGCTTTCAG---------------------------------CTCTC-GTAGCTGACAAGGATGCTGGCGTAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACATGCAAGTATTTGAGTTGTAAA--CTCT{GT}GTGCGCAATGAAAGTGAAT-GTTGAGAACTATGTCAAAAGTAGTGCATCAACGCCCGGTCCAGACCTTCT-GTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGACACTCGTATCTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGATCAAGCCTTTGCTTAAGTGAATGGCTTGTCGATTGCAACAGTGTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCAAGGTTAAGGTGCCGGAATCTACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGGACTAGCCCTGAAAATGGATGGCGCTCAAGCGTAGTACCCATACCTTGNNN Galerina_paludosa NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCTGGCGG-TCTCA--GGCT-GTCCGCGTTGTAATCTAGAGAAGTGTTATCCG-CGCTGG-ACCG-TGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACT--GCCAGGGCTT-TGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGGATCGGAGATCAACCTTGC----TTTTGCTGGGCGTACTCTCC--GGTT--GACGGGCCAGCATCAATTTTGGGCGCTGGAAAAA-GGCTAAGGGAA-TGTGGCATC-TTC---GGATGTGTTATAGCCCTTGG-TCGCATACAGTGGCTGGGATTGAGGAACTCAGCACGCCG-CAAGGC---CG-GGTTTTT-AACCAC---GTT--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAA--CCCGAGCGCGTAATGAAAGTGAAA-GTTGAGATCCCTGTCGT--GGGGAGCATCGACGCCCGGACCAGACCTTTT-GTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT---ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Gymnopilus_aeruginosus GNCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCTGGCAG-TCTTT--GATT-GTCCGCGTTGTAATCTAGAGAAGTGTTACCCG-CGTTGG-ACCG-TGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGACAATCCCGTCTTTGACACGG-ACT--CCCAAGGCTT-TGTGGTGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAGATCAACCTTGC----TTTTGCTGGGCGTACTCTCC--GGTT--GACGGGCCAGCATCAGTTTTGACCATTGGAAAAG-GGCAGAGGGAA-TGTGGCATC-TTC---GGATGTGTTATAGCCTTCTG-TCGTATACAGTGGTTGGGACTGAGGAACTCAGCACGCCG-CAAGGC---GG-GGATTC--ATCCAC---CTT--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAA--CCCGAGCGCGTAATGAAAGTGAAA-GTTGAGATCCCTGTCGT--GGGGAGCATCGACGCCCGGACCAGACCTTTT-GTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Gymnopilus_junonius GACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCTGGCGG-TCTTT--GGCC-GTCCGCATTGTAATCTAGAGAAGTGTTACCCG-CGTTGG-ACCG-TGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGACAATCCCGTCTTTGACACGG-ACT--CCCAAGGCTT-TGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAGATCAACCTTGC----TTTTGCTGGGCGTACTCTCC--GGTT--GATGGGCCAGCATCAGTTTTGGCCACTGGAAAAG-GACGGAGGAAA-TGTGGCATC-CTC---GGATGTGTTATAGTCTTCCG-TCGTATACAGTGGCTGGGACTGAGGAACTCAGCACGCCG-CAAGGC---CG-GGTATTTATTCCAC---GTA--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAA--CCCGAGCGCGTAATGAAAGTGAAA-GTTGAGATCCCTGTCGT--GGGGAGCATCGACGCCCGGACCAGACCTTTT-GTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Gymnopilus_penetrans GACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCTGACGG-TCTTT--GGCC-GTCCGCATTGTAATCTAGAGAAGTGTTACCCG-CGTTGG-ACCG-TGTACAAGTCTCCTGGAATGGAGCATCATAGAGGGTGACAATCCCGTCTTTGACACGG-ACT--CCCAAGGCTT-TGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAGATCAACCTTGC----TTTTGCTGGGCGTACTCTCT--GGTT--GACGGGCCAGCATCAGTTTTGGCCACTGGAAAAG-GGCGGAATGGAATGTGGCATC-TTC---GGATGTGTTATAGCCTTCCG-TCGTATACAGTGGCTGGGACTGAGGAACTCAGCACGCCG-CAAGGC---CG-GGATTTT-ATCCAC---GTT--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAA--CCCGAGCGCGTAATGAAAGTGAAA-GTTGAGATCCCTGTCGT--GGGGAGCATCGACGCCCGGACCAGACCTTTT-GTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Gymnopilus_spectabilis GACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCTGGCGG-TCTTT--GGCC-GTCCGCATTGTAATCTAGAGAAGTGTTACCCG-CGTTGG-ACCG-TGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGACAATCCCGTCTTTGACACGG-ACT--CCCAAGGCTT-TGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAGATCAACCTTGC----TTTTGCTGGGCGTACTCTCC--GGTT--GACGGGCCAGCATCAGTTTTGGCCACTGGAAAAG-GGCGGAGGAAA-TGTGGCATC-CTC---GGATGTGTTATAGTCTTCCG-TCGTATACAGTGGCTGGGACTGAGGAACTCAGCACGCCG-CAAGGC---CG-GGATTT--ATCCAC---GTA--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAA--CCCGAGCGCGTAATGAAAGTGAAA-GTTGAGATCCCTGTCGT--GGGGAGCATCGACGCCCGGACCAGACCTTTT-GTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Hebelomina_neerlandica NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCTGACGG-TCTTT--GGCC-GTCCGCATTGTAATCTAGAGAAGTGTTACCCG-CGTTGG-ACCG-TGTACAAGTCTCCTGGAATGGAGCATCATAGAGGGTGACAATCCCGTCTTTGACACGG-ACT--CCCAAGGCTT-TGTGGTGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAGATCAACCTTGC----TTTTGCTGGGCGTACTCTCT--GGTT--GACGGGCCAGCATCAGTTTTGGCCANTGGAAAAG-GGCGGAATGGAATGTGGCATC-TTC---GGATGTGTTATAGCCTTCCG-TCGTATACAGTGGCTGGGACTGAGGAACTCAGCACGCCG-CAAGGC---CG-GGATTTT-ATCCAC---GTT--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAA--CCCGAGCGCGTAATGAAAGTGAAA-GTTGAGATCCCTGTCGT--GGGGAGCATCGACGCCCGGACCAGACCTTTT-GTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT---ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTAATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Mucronella_calva NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAG--CTTT---GCT-GTCCGAGTTGTAGTCTAGAGAAGTGCTATCCG-TGCTGG-CCTG-TGTACAAGTCCCTTTGAACAGGGCATCATAGAGGGTGATAATCCCGTCTCTGACACAG-ACT--CCCAGGACTTTTGTGATGCGCTCTCAATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCATGTTGGCTGGGGATCAACCTTGC----TTTTGCTGGGTGTATTTCCT--GGTTT--ACAGGTCAGCATCAGTTTTGATCACCATACAAA-GACTCAGAGAA-TGTGGCATC-TCC---GGATGTGTTATAGCTTTGGGATCACATGTGGTGGTTGGGACTGAGGAATGCAGCACACCTTTA-TGGTCGGGG-------TTCGCC-CACGCTT--GTGCTTAGGATGCTGACAAAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAA--CCCATGCGCGTAATGAAAGTAAAA-GTTGAAATCCCTGTCGT--GGAGAGCATCGACGCCCGGACCAGACCTTTT-GTGACGGATCTGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGATGAAGCCAGAAGAAACTCTGGTGGAGGTCCGTAGCGATTCTGACGAGCAAATCGATAATCAAATTTNNNTATAGGGGCGAAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Mucronella_sp_DJM1309 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGGAATCTGGCGG-TCCTAT-GGCC-GTCCGAGTTGTAGTTTAGAGAAGCGTCGTCCG-CGCCGG-CCCG-TGTACAAGTCCCTTTGAATAGGGCGTCGTAGAGGGTGATAACCCCGTCTCTGACACGG-ACT--CCCGGTGCTTTCGTGATGCGCTCTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGGGATCAACCGAGC--TCTTTTGCGAGGTGCACTCCCT--GGTTTT-ACGGGCCAGCGTCGATTTCGACCGTCGGACAAA-GGCTCGGGGAA-TGTGGCATC-TCC---GGATGTGTTATAGCCCTGGGACCGGATACGACGGTGGGGATCGAGGGACTCAGCACGCCTCTAATGGTCGGGG------CTTCGGCTCACGCTTTGGTGCTTAGGATGCTGGCGTAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGGAAA--CCCAGACGCGCAATGAAAGTGAAA-GTTGAGATCCCTGTCGC--TGGGAGCATCGACGCCCGGACCAGACCTGCT-GTGACGGATCCGCGGTGGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Phlebia_tristis GACCTCAAATCGGGCGGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCCCAAATTTAAAATCTGGCGG-TCCT---GGACCGTCCGAGTTGTAATCTGGAGAAGCGTCGCCCG-CGCCGG-ACCG-TGTACAAGTCCCTTGGAAGAGGGCATCTTAGAGGGTGAAAATCCCGTCTACGACATGG-ATC--CCCGGTGCTTCTGTGGTGCGCTCTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTGAACTCCATCTAAGGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGT-CGTGAAATGGCTGAAGGGAAA-CGCTTGAAA--AATCCCGTTGTCCGGGATTCAGCCTTGC----CTCGGCGGGGTTTACTTTCC--GGTT--GACGGTTCAGCATCGATTTTGGCCGCCGGAAAAG-GGCGGAGGGAA-TGTGGCACC-TTG---GGGTGTGTTATAGCCCTCCG-TCGGATTACGGCGGCCGGGATCGAGGATCGCGGCGCAGCTCCTT---CGGGGGTGCGGGTTCGCC-CAGTTCAT-GCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAAAACGCCCGCGAGTGTTAGGGTGGAAAA--CCCTTGCGCGCAATGAAAGTGAAA-GCCGAGAACCCTCAC-----GGGTGCATCGGTGCCCGGATCTGGGGCTTCGGCCCTTGGCCCGCGGTGGAGCGTGTGTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGG-TATAGGG-CGAAAGACTAATCGAACCATCTAGTAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Ramariopsis_kunzei NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGAGGGATAAGCTCAAATTTAAAATCTGGCTG-TTCTCGTAGCA-GTCCGAGTTGTAGTTTAGAGAAGTGTTATCCG-CGTTGG-CCTG-TGCAAAAGTTTCTTGGAAAAGAACATCATAGAGGGTGACAATCCCGTCTTTGGCACAG-ATA--ACCAAGGCTTTTGTGATGCGCTCTCNACGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGTGTCTTCTAGGGATCAAG-TTGC---CTTTGGGTGACCGCACTTCCT--GGTT--GATGGGTCAGCATCAATTTTGACCGTTGGATAAA-GGCCCAAGGAA-TGTGGCATC-TTC---GGATGTGTTATAGACTTGGG-TTGGATACAACGATCGGGATTGAGGAACTCAGTGTGCCTTCA-TGGTTGGGG----CTTAGGCC--TACATT-ACACACTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTGTTTGGGTGGAAAA--CCCAAGCGCGTAATGAAAGTGAAA-GTTGAGATCTCTGTCAT--GGAGAGCATCGACGCCCGGACCAGACCTTTT-GCGACGGATCTGCGGTAGAGCACGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATTTAATTTGCTACTTGGTGGTTAAGAGGCACTTGAAAGGGGTTAGCCTAGTGAGCAATTGAGGCTTGCTACACTGTCAAATTGCGGGGACGTCCTAAAGCCTTTACTACTAAGCTGAAGTCGAAAGACTATCNGTGGCCGAGTTAATTACCCTGGGTATAGTCAAAATGTAAAGGATGTAACAATGGATAACCTGCAGCCAAGTCCTAAGGATTT---TAATCTATGGATGCAGTTCACAGACTAAATGGCAGTGGGTGTAGT-TAAACTTAACTATGCTTAAGATATAGTCGGTCCTACTGTGAAAGCAGTCTGGCAGATGAAGGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Ramariopsis_sp._DJM1049 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACAGGTATTCCCTTAGTA-CTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGTTG-TTCTTGTAGCA-GCCCGAGTTGTAGTTTAGAGAAGTGCTATCCG-CGCTGG-CCTG-TGCAAAAGTTTCTTGGAAAAGAACATCATAGAGGGTGACAATCCCGTCTTTGGCACAG-ATA--ACCAGGGCTTTTGTGATGTGCTCTCAACGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACACTTGAAGTCAGTCTTGTCTTCCAGTGATCAAG-TTACCC-CCTTGGGTGACCGCATTTTCT--GGTT--GATGGGTCAGCATCAATTTTGATCATTGGATAAA-GGCCTAAGGAA-TGTGGCATC-TTC---GGATGTGTTATAGACTTTGG-TTGGATACAATGATCAGGATTGAGGAACTCAGTGTGCCGTCAATGGTTGGGG----CTTAGGC---TCACATNGCACACTTAGGATGCTGGCATAATGGCTTTAATTGACCCGTCTTGAAACACGGACCAAGGAGTNTAACATGCATGCGAGTGTTTGGGTGGAAAA--CTCAAGCGCGTAATGAAAGTGAAA-GTTGAGATCTCTGTCAT--GGAGAGCATTGACGCCCGGACCAGACCTTTT-GTGACGGATCTGCGGTGGAGCATGTATGTTGGGACCCGAAAGANGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGTAGCGATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN ; END; BEGIN SETS; CHARSET ambig (CHARACTERS = Clavaria_clade_28S_rDNA) = 470-509 622-668; CHARSET ends (CHARACTERS = Clavaria_clade_28S_rDNA) = 1-111 990-1409; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Clavaria_clade_28S_rDNA) = N: 1-1409; CODONPOSSET CodonPositions (CHARACTERS = Clavaria_clade_28S_rDNA) = N: 1-1409; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M910] TITLE Chaetotyphula_clade_28S_rDNA; LINK TAXA = Taxa4; DIMENSIONS NCHAR=863; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Actiniceps_laevis AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGT-CTTC----GGCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTT-TGTGATGCACTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGAAATCAACCTGGTTT----ACCTGGTGTACTTTCTAGTCAATGGGTCAACATCAGTTTTGAGTGCTGGATAAAGATTAGAGGAATGTGGCATCTTCGGGTGTGTTATAGCCTTTAGTTGTATACAGCATTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGGTTTTT--ACCACGTA-CGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGATCTCTGTCGTGGAGAGCATCGACGCCCGGCTCAGAACTTTTGGGACGATGCCGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Bioluminescent_mycenoid AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCCTT-GCGGTCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTATACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGATACGGACTACCAGGGCTTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGGGATCAACCTTGCTCTTTTGCTTGGCGTACTTCCCAGTTGATGGGTCAGCATCAGTTTTGACTGTTGGATAAAGGTCAAGGGAATGTGGCATCTTCGGATGTGTTATAGCCTTTGGTCGTATACAGCGGTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGGTACTTGTACCACGTAACGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCGTGGAGAGCATCGACGCCCGGACCTGAACTTCTGTGACGGCCCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Calyptella_capula AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAG-TTTC----ACTGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTT-TGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCACGTTGGCTGGGAATCAACCTTGCTTT---GCTTGGTGTACTTTCTAGTTAATGGGTCAGCATCAGTTTTGAGTGTTGGAAAAAGATTAGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTTGGTTGTATACA-CACTTGGGACTGAGGAACTCAGCACGCCGCAAGGCTGG-TCTTCG-GACACATA-CGTGCTTAGGATGCTG-CAAAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCAAGTATTTGGGTGGAAAACTCGAATGCGAAATGAAAGTGAAAGTTGAGATCCCTGTCGCGGGGAGCATCGACGCCCGGCTCTGAGCTTTTGTGACGATGCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Chaetotyphula_hyalina A-CTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG-CTTT----GTCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTT-TGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGAAATCAACCTTGTTT----ACTTGGTGTACTTTCTAGTCAATGGGTCAACATCAGTTTTGAGTGTTGGATAAAGATTAGAGGAATGTGGCATCTTCGGATGTGTTATAGCCTTTAGTTGTATACAGCATTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGG-ATTTA-TCCACGTA-CGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGAGTGCGCAATGAAAGTGAAAGTTACGATCTCTGTCGTGGAGAGCATTGACGCCCGGCGCAGAACTTTTGGGACGCTGCCGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Chaetotyphula_sp._BDCR0419_2C AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG-CTTC----GTCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGCCACGGACTACCAGGGCTT-TGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGGAATCAACCTGGTTT----ACCTGGTGTACTTCCTAGTCAATGGGTCAACATCAGTTTTGAGTGCTGGATAAAGATTAGAGGAATGTGGCATCTTCGGATGTGTTATAGCCTTTAGTTGTATACAGCATTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGGTTTTT--ACCACGTA-CGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGAGTGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCGTGGAGAGCATCGACGCCCGGCTCAGAACTTTTGGGACGATGCCGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Hemimycena_delicatella AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCCGTCTTT---GATTGCCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTT-TGTGATATGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGAAGTCAGTCGCATTTACTTGAAATCAACCTTGCTTTTT-GCTTGGTGTACTTTCTTGTCGATGGGTCAACATCAGTTTTGACTGCTGGATAAAGATTAAGGGAATGTGGCATCCTCGGATGTGTTATAGCCTTTAGTTGTATACAGTAATTGGGACTGAGGAACTCAGCACGCCGAAAGGCCGGGTACTTGTACCACGTT-CGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGTAAACCCATATGCGCAATGAAAGTGAAAGTTGAGATCTCTGTCGTGGAGAGCATCGACGCCCGGGTCAGACCTTTTGTGACGATTCCGCGGTTGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Hemimycena_ignobilis AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG-CTTT----GTCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGCCACGGACTACCAGGGCTT-TGTGATGCACTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGGAATCAACCTTACTTT---GTTTGGTGTACTTCCTAGTTAATGGGTCAACATCAGTTTTGAGTGTTGGATAAAGATTGAGGGAATGTGGCATCCTCGGATGTGTTATAGCCTTTAGTTGTATACAACACTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGGTCTTTG-ACCACGTA-CGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACCCGAGTGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCGCGGAGAGCATCGACGCCCGGTCCAGATCTTCTGTGACGGTACCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Mycena_adonis AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTCTT-GCAGCCGTCCGAGTTGTAATTTAGAGAAGTGCTATCCGCGCTGGACCGTATACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGATACGGACTGCCAGGGCTT-TGTGATGTGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGGGATCATCCTTGCTTTTTTGCTTGGTGTACTTCCTAGTTGATGGGTCAACATCAGTTTTGACTGTTGGATAAAGTTCAGAGGAATGTGGCATCTTTAGATGTGTTATAGCCTTTGTTCGTATACAGCAGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGGTATTTATACCACGTA-CGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCAGACTTGAGCTTTTGCGACGGTCCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Mycena_aurantiidisca AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTCTT-GCAGCCGTCCGAGTTGTAATTTAGAGAAGTGCTATCCGCGTTGGACCGTATACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGATACGGACTGCCAAGGCTT-TGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGGGATCAACCTTGCCTTTT-GCTTGGTGTACTTCCTAGTCGATGGGTCAACATCAGTTTTGATTGCTGGATAAAGTTCAGGGGAATGTGGCATCTTTAGATGTGTTATAGCCCTTGTTCGTATACAGTGGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGGTTTTTA-ACCACGTA-CGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCAGACTTGAGCTTTTGTGACGGTCCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA Pistillaria_sp._DJM1031 AACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGG--CTC----GTCGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAGGCTT-TGTGGTGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGG-ATCAACCTGGTTT----ACCTGGTGTACTTCCTAGTCAATGGGTCAACATCAGTTTTGA-GGCTGGAAAAAGATTGGAGGAATGTGGCATCTTCGGATGTGTTATAGCCTT-AGTTGTATACAGCATTTGGGACTGAGGAACTCAGCAC------------------------------CGTGCTTAGGATG--GGCATAATGGCTTTAATCGACCGGTCTTGAAACACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Pleurotopsis_longinqua AACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCGGTTCTT-GCAGCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTT-TGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGGGATCAACCTTGCTTTTTTGCTTGGCGTACTTCTCAGTTGATGGGTCAGCATCAGTTTTGACCGCTGGATAAAGATTGAGGGAATGTGGCATCCTCGGATGTGTTATAGCCCTTGGTTGTATACAGCGGTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGGTCTTTG-ACCACGTA-CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCGTGGAGAGCATTGACGCCCAGACCAGACCTTTTGTGACGGACCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Chaetotyphula_clade_28S_rDNA) = N: 1-863; CODONPOSSET CodonPositions (CHARACTERS = Chaetotyphula_clade_28S_rDNA) = N: 1-863; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M911] TITLE Physalacriaceae_clade_28S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=902; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Armillaria_NABSI_GC17 TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTC-GCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTACCAAGGCTTTGTGGTACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-ANCTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTTGGTTAGG-AATCAGCCTTGG------TTTT--CCTTGGTGTACTTCCTAA----TCGACGGGTCAACATCAGTTTTGACCGTTGGATAAAGGTCGAGGGAATGTGGCA-CCTTC-GGGTGTGTTATAGCCCTCGATTGTATACAGCGGTTGGGACT-GAGGA----ACTCAGCACGCCGAAA------GGCCGGG-TC--TTGTACCACGTTCGTG----CTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCATGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGAACTCTT-AGAGTGCATCGACGCCCGGAGCAGACCTTTT-GTGACGCATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Armillaria_irazuensis TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGGTTT--CCTGTCCGAGTTGTAATTTAGAGAAGTGTTGCCCGCGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTACCAAGGCATTGTGGTACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTTGGTTAGC-AATCAGCCTTGGGAAGAGATTT--CCTTGGTGGACTTGGTAA----TCGACGGGTCAACATCAGTTTTGAGCGTTGGATAAATGTCAAGGGAATGTGGCAT-CCTC-GGATGTGTTATAGGCCTTGATTGTATACAGCGGTTGGGACT-GAGGA----ACTCAGCACGCC-ATTTATTTTGGCCGGG-TC--TTGTACCACGTACGTG----CTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCATGCGAGTGTTTGGGTGTA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGAACTCTT-AGAGTGCATCGACGCCCGGAGCAGAGCTTTT-GTGAGGCATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Armillaria_tabescens TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAG-TTTC-ACTGTCCGAGTTGTAATTTAGAGAAGTGTTGCCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTACCAAGGCTTTGTGGTACGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTTGGTTAGG-AATCAGCCTTGG------TTTT--CCTTGGTGCACTTCCTAG----TCGACGGGTCAACATCAGTTTTGACCGTTGGATAAAGGTCAAGGGAATGTGGCA-CCTTC-GGGTGTGTTATAGCCTTTGATTGTATACAGCGGTTGGGACT-GAGGA----ACTCAGCACGCCGAAA------GGCCGGG-TC--TTGTACCACGTTCGTG----CTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGAACTCTT-AGAGTGCATCGACGCCCGGAGCAGACCTTTT-GTGACGCATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Cyptotrama_asprata TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAG-TTT--GCTGTCCGAGTTGTAAATTAGAGAAGTGTTGCCCGTGTTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGGAACCCCCAATACTTTGTGGTACACTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTTGGTTGGA-AATCAGTCTTGC----TTGTTT--GCTTGATGTACTTTCTGA---CTTGACGGGTCAACATCAGTTTTGACCGGTGGATAAAGGTTGAGGGAATGTGGCAC-CTTC-GGGTGTGTTATAGCCCTTGATTGTATGCATCGGTTGGGACT-GAGG-----CTTC---ACGCCGCAA------GG------------------------------TGTTGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCTTGCGAGTATTTGGGTGGA-AAACCCACATGCGCAATGAAAGTGAAAGTTGAGAACTCGTTAGAGTGCATCGACGCCCATACCTGACGTTTTACTGACGGATATGCGGTAGAGCAAGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCG Flammulina_velutipes TCCCCTAGTAACTGCGAGTGAA--GGGAAAAGCTCAAA---AAAATCTGG--G---TC-GCTGTCCGAGTTGTAATTTAGAGAAGTGTTGCCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTCCCAGTGCATTGTGGTACGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTCGGTTGGG-AATCAGTCTCGC----TCTCTT--GCTTGACGTACTTCCCAC----GTGACGGGTCAGCATCAGTTTTGATCGTTGGATAAAGGTTGGAGGAATGTGGCA--CTTC-GGGTGTGTTATAGCCTCTGATTGTATACAACGGTTGGGACT-GAGGA----ACTCAGCACGCCGAAA------GGCCGGG-TAC-TTGTACCCCGTACGTG----CTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGA-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGAACTCTTTAGAGTGCATCGACGCCCGGACCAGACGTTCT-CTGACGGATCCGCGGTAGAGCATGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Gloiocephala_menieri TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGC-GCTTT--GCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTACCAATGCTTTGTGGTATGCTCTCGAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTTGGTTGGA-AATCAGTCTTGC------TTCT--GCTTGATGTACTTTCTAA----TCGACGGGTCAACATCAGTTTTGACCGTTGGATAAAGGTTGAAGGAATGTGGCAT-CTTT-AGATGTGTTATAGCCTTCAATTGTATACAACGGTTGGGACT-GAGGA----ACTCAGCATGCCGCAA------GGCCGGG-TC--TTGTACCACGTTCATG----CTTAGGATGTTGGCATAATGGCTTTAATCGA-CCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGA-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGAACTCTTTAGAGTGCATCGACGCCCGGACCAGACGTTTT-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Gloiocephala_sp._TENN7573 TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTC-GCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTACCAAGGCTTTGTGGTACGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTTGGTTGGA-AATCAGTCTTGC------TTTT--GCTTGATGTACTTTCTAA----TTGACGGGTCAACATCAGTTTTGACCGTTGGATAAAGGTTGAAGGAATGTGGCAC-CCTC-GGGTGTGTTATAGCCTTTGATTGTATACAACGGTTGGGACT-GAGGA----ACTCAGCACGCCGAAA------GGCCGGG-TC--TTGTACCACGTACGTG----CTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGA-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGAACTCTTTAGAGTGCATCGACGCCCGGACCAGACGTTTT-CTGACGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Gloiocephala_spathularia TCCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTGAAATCTGGCAGC-CTC-GCTGTCCGAGTTGTAATCTAGAGAAGCGATGCCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGGGCGTC--ACAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTGCCAGTGCTCTGTGGTACGCTCTCGAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAACGGGTGGTAAATTCCATCTAAAGCTAAACATTGGCGAGA--GACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAG-CACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTC-AGACGCGTTGGCCGAG-AATCAGTCTTGC----TCT-CT-CGCTCGACGTACTTCTCGGTCCTCCAACGGGTCAGCATCAGTTTCGACCGCCGGAGAAGGGCGGAGGGAAGGTGGCA-CCCTC-GGGTGTGTTATAGCCCTCTGTCGCATGCGGCGGTTC---CTCGAG------ACTGAG----------------GG-----TTC--TTGTT-CA-GGCCGTGAGGCCGTGGGATGCTGGCGTAATGGCTTCAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGGTGAAACCCGTGCGCGAAATGAAAGTGAAAGTTGAGAGCTCCTCAGAGCGCATCGACGCCCGGACCTGAAGTCTCACTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Oudemansiella_canarii TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTC-GCTGTCCGAGTTGTAATTTAGAGAAGTGTTGCCCTTGCTGGACCGTGTACAAGTTTCCTGGAACGGAACGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTCCCAGTATGTTGTGGTGCGCTCTCGAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCTAGTCGCATCGGTTGGG-GATCAGTCTTGC------TTCT--GCTTGATGTATGTCACAA----TCGATGGGTCAGCATCAGTTTTGACCGTTGAATAAAGGTTGGGGGAATGTGGCAT-CTTC-GGATGTGTTATAGCCTCTGATTGTATACAACGGTTGGGACT-GAGGA----ACTCAGCACGCCGCAA------GGCCGGG-TAC-TTGTACCACGTTCGTG----CTTAGGATGCTGGCATAATAGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGAACTCATCAGAGTGCATCGACGCCCGGACCAGACGTTTT-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Physalacria_aff._orinocensis TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTC-GCTGTCCGAGTTGTAATTTAGAGAAGCAATGCCCGCGCTGGACCGTGTAAAAGTCTCCTGGAATGGTGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGATACGG-ACTACCAGTGCATTGTGGTATGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGTTGGG-AATCAGTCTTGC------TTCT--GCATGATGTACTTTCCAG----TCAATGGGTCAGCATCAGTTTTGACTGCTGGATAAAGGCTGAGGGAATGTGGCA-CCTTC-GGGTGTGTTATAGCCCTCGGTTGTATACAGTGGTTGGGACT-GAGGA----TCTCAG---GCCGCAA------GGC-----------------------------TGTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTCGGGTGGA-AAACCCGTGTGCGTAATGAAAGTGAAAGTTGAGAACTCTTTAGAGTGCATCGACGCCCGGACCAGATGTTTA-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Physalacria_corticola TCCCCTAGTA-CTGCGAGTGAAGAGGGAAAAGCTCAAATTTAGAATCTGGCAGC-TTC-GCTGTCCGAGTTGTAATTTAGAGAAGCAATGCCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGTGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGATACGG-ACTCCCAGTGCATTGTGGTATGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTC-AGTCGCATTGGTTGGG-AATCAGTCTTGC------TTTT--GCTTGATGTACTTTCCAG----TCAATGGGTCAGCATCAGTTTTGACTGCTGGACAAAGGCTGAGGGAATGTGGCA-CCTTC-GGGTGTGTTATAGCCCTCAGTTGTATACAGTAGTTGGGACT-GAGGT----TCTCAG---GCCGCAA------GGC-----------------------------TGTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTCGGGTGGT-AAACCCGTATGCGTAATGAAAGTGAAAGTTGAGAACTCTTTAGAGTGCATCGACGCCCGGACCTGATGTTTA-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Physalacria_inflata TCCCCTAGTAACTGCGAGTGAAGAGGGAGAAGCTCAAATTTAGAATCTGGCGGC-TTC-GTCGCCCGAGTTGTAATTTAGAGAAGCGATGCCTGCGCTGGACCGTGTACAAGTCTCCTGGAACGGTGCGTC--ATAGAGGGTGAGAATCCCGTCTCTGACACGG-ACTGCCAGCGCTCTGTGGTACGCTCTCGAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAACATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGCCGGG-AATCAGTCTTGC----TCTTCTGGGCTCGACGCACTTCTCGG----TNGACGGGTCAGCATCAGTTTCGACCGTCGGACAAAGGCCGAGGGAAGGTGGCATCCTTCNGGGTGTGTTATAGCCCTCGGTTGCATGCGATGGCTGGGACT-GAGGAAGGCTCTCAG---GCCGCAA------GGC-----------------------------CGCGGGATGCTGGCGTAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTCGGGTGGC-AAACCCGCGTGCGCAATGAAAGTGAAAGTTGAGAACTCTTTAGAGTGCATCGACGCCCGGACCAGACGTTTA-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Physalacria_maipoensis TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGC-TTC-GCTGTCCGAGTTGTAATTTAGAGAAGCAATGCCCGCGCTGGACCGTGTAAAAGTCTCCTGGAATGGTGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGATACGG-ACTACCAGTGCATTGTGGTATGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGTTGGG-AATCAGTCTTGC------TTCT--GCATGATGTACTTTCCAG----TCAATGGGTCAGCATCAGTTTTGACTGCTGGATAAAGGCTGNGGGAATGTGGCA-CCTTT-GGGTGTGTTATAGCCCTTGGTTGTATACNGTGGTTGGGACT-GAGGA----TCTCAG---GCCGCAA------GGC-----------------------------TGTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTCGGGTGGA-AAACCCGTGTGCGTAATGAAAGTGAAAGTTGAGAACTCTNTAGAGTGCATCGACGCCCGGACCAGATGTTTA-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Physalacria_sp._DJM_1035 TCCC----TAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGC--T--GCTGTCCGAGT-GTAATTTAGAGAAGCAATGCCCGCGCTGGACCGTGTAAAAGTCTCCTGGAATGGTGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGATACGG-ACTACCAGTGCATTGTGGTATGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTC-AGTCGCGTTGGTTGGG-AATCAGTCTTG-------TTCT--GCATGATGTACTTTCCAG----TCAATGGGTCAGCATCAGTTTTGAC-GCTGGATAA-GGCTGAGGGAATGTGGCA-CCTTC-GGGTGTGTTATAGCCCTCGTTG-TATACAGTGGTTGGGACT-GAGGA----TCTCAG---GCC------------------------------------------TGTAGGATGCTGGCATAATGGCTTTAATCGACCGGTCTTGAAACACGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Rhizomarasmius_pyrrhocephalus TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCTTT--GCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTACCAAGGCTTTGTGGTACGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTAAAGTCCAGTCGCGTTGGTTGGA-AATCAGTCTTGC-----TTTTT--GCTTGATGTACTTTCTAA----CTGACGGGTCAGCATCAGTTTTGATCGTTGGATAAAGGTTGAAGGAATGTGGCAT-CCTC-GGATGTGTTATAGCCTTCGATTGTATACAACGGTTGGGACT-GAGGA----ACTCAGCACGCCGAAA------GGCCGGG-TC--TTGTACCACGTTCGTG----CTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGA-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGAACTCTTTAGAGTGCATCGACGCCCGGACCAGACGTTTT-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Rhodotus_palmatus TCCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGGCAGC-TTC-GCTGTCCGAGTTGTAATTTAGAGAAGCGATGCCCGTGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTCCCAGTGCATTGTGGTACGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTCTTCTGGG-AATCAGTCTTGC------TTCT--GCATGATGTACTTTCTAG----TCGACGGGTCAGCATCAGTTTTGACCGGTGGACAAGAGTTGGAGGAATGTGGCA-CCCTC-GGGTGTGTTATAGCCTCTGATTGTATACGCCGGTTGGGACT-GAGGA----ACTCAGCACGCCGCAA------GGCCGGG-TCTTTTG-ACCACGTTCGTG----CTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGA-AAACCCGAGTGCGTAATGAAAGTGAAAGTTGAGAACTCTCTAGAGTGCATCGACGCCCGGACCAGATGTTTT-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Strobilurus_trullisatus TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGC-G---TC-GCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCGTGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTCCCAGTGCATTGTGGTACGCTCTCAAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGAGACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCCAGTCGCGTTGGTTGGA-AATCAGTCTTGC------TTCT--GCTTGATGTACTTTCTAA----CTGACGGGTCAGCATCAGTTTTGACCGTTGGATAAAGGTTGGAGGAATGTGGCAT-CTTC-GGGTGTGTTATAGCCTTCGATTGTATACAACGGTTGGGACT-GAGGA----ACTCAGCACGCCGAAA------GGCCGGG-TC--TTGTAC-ACGTTCGTG----CTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGA-AAACCCGAGTGCGCAATGAAAGTGAAAGTTGAGAACTCTTTAGAGTGCATCGACGCCCGGACCAGACGTTTT-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Xerula_furfuracea TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCAGCTTTCCGCTGTCCGAGTTGTAATTTAGAGAAGTGTTGCCCTTGCTGGACCGTGTACAAGTTTCCTGGAACGGAACGTC--ATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTCCCAGCATTTTGTGGTACGCTCTCGAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAAGATGAAAAG-AACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCTAGTCGCGTCGGTTGGG-AATCAGTCTTGC------TTCT--GCTTGACGTACTTTCTAA----TCGACGGGTCAGCATCAGTTTTGACCGTTGGATAAAGGTTGGGGGAAGGTGGCAT-CCTC-GGATGTGTTATAGCCTCTGATTGTATACAACGGTTGGGACT-GAGGA----ACTCAGCACGCCGCAA------GGCCGGG-TAC-TTGTACCACGTACGTG----CTTAGGATGCTGGCATAATAGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGAGAACTCATCAGAGTGCATCGACGCCCGGACCAGACGTTTT-CTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG Xerula_megalospora TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGC-G--TTC-GCTGTCCGAGTTGTAATTTAGAGAAGTGTTACCCTTGCTGGACCGTGTACAAGTTTCCTGGAACGGAACGTCATATAGAGGGTGAGAATCCCGTCTTTGACACGG-ACTCCCAGCATTTTGTGGTACGCTCTCGAAGAGTCGTGTTGTTTGGGAATGCAGCACTAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGA--GACCGATAGCAAACAAGTACCGTGAGGGAAGGATGAAAAGAAACTTTGGAAAGACAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCTAGTCGCGTCGGTTGGGAAATCAGTCTTGC------TTCT--GCTTGACGTACTTTCTAA----TCGACGGGTCAGCATCAGTTTTGACCGTTGGATAAAGGTTGGAGGAAGGTGGCAT-CCTC-GGATGTGTTATAGCCTCTGATTGTATACAACGGTTGGGACT-GAGGA----ACTCAGCACGCCGCAA------GGCCGGG-TAC-TTGTAC-ACGTTCGTG----CTTAGGATGCTGGCATAATAGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGA-AAACCCGAGCGCGCAATGAAAGTGAAAGTTGAGAACTCATCAGAGTGCATCGACGCCCGGACCAGACGTTTT-CTGACGGATCCGCGGTAGAGCATG-ATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Physalacriaceae_clade_28S_rDNA) = N: 1-902; CODONPOSSET CodonPositions (CHARACTERS = Physalacriaceae_clade_28S_rDNA) = N: 1-902; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M913] TITLE Macrotyphula_clade_28S_rDNA; LINK TAXA = Taxa3; DIMENSIONS NCHAR=870; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Bulbillomyces_farinosus GAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGT{CT}CTTGTAGCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTATAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAGGGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAAGGAAACGCTTGAAGTCAGTCGCGTTAGCCAGGGATCAACTTAGC--TTTT-GCTGAGAGCACTTTCTGGTTGACGGGTCAGCATCAATTTTGATTGTTGGATAAAGGTCAGTGGAATGTGGCATCCTCGGATGTGTTATAGCCATTGGTTCGTATACAACAGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGG--TATTC--GTACCAC-GTA--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGTAAAACCCGAGCGCGTAATGAAAGTGAAAGTTCAGACCTCTGTCGTGGAGGGCATTGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG Henningsomyces_candidus GAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGTCCTTGTGATTGTCCGAGTTGTAATTTAGAGAAGTGCTATCCGCGCTGGACCGTGTACAAGTCTGCTGGAACGCAGCGTCGTAGAGGGTGAGAATCCCGTAT{AT}TGACACGGACTACCAGGGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCTAGAAATCAACCTTGC--TTTT-GCTGGGAGCACTTTCTAGTTGACGGGTCAGCATCAGTTTTGATTGTTGGATAAAGGTTGGAGGAATGTGGCATCTCCGGATGTGTTATAGCCTCTGATTCACATACGACAGTTGGGACTGAGGAACTCAGCACGCCGCAAGGCCGGG--TTTTT--A-ACCAC-GTAA-CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTATTTGGGTGGAAAACTCGAATGCGTAATGAAAGTGATAGTTGAGATCTCTGTCGTGGAGAGCATCGACGCCCGGACCAGACCTTCTGTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG Macrotyphula_defibulata GAAGCGGGAAAAGCTCAAATTTAAAATCTGATAGTCCTTGTGGCTGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTATAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAAGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGGGATCAACTTAGC--TTTT-GCTGAGAGTACTTTCCGGTTAACGGGTCAGCATCAATTTTGATTGTTGGATAAAGGTCAGTGGAATGTGGCATCTTCGGATGTGTTATAGCCATTGGTTCGTATACAACAGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGG--TATTT--ATACCAC-GTA--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGATAAACCCGAGCGCATAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGANGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCNGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG Macrotyphula_fistulosa GA-GCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTCTTGTAGCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTATAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAGGGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAAGGAAACGCTTGAAGTCAGTCGCGTTAGCCAGGGATCAACTTAGC--TTTT-GCTGAGAGCACTTTCTGGTTGACGGGTCAGCATCAATTTTGATTGTTGGATAAAGGTCAGTGGAATGTGGCATCCTCGGATGTGTTATAGCCATTGGTTCGTATACAACAGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGG--TATTC--GTACCAC-GTA--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGTAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG Macrotyphula_juncea_DJM_1032 GAAGCGGGAAAAGCTCAAATTTAAAATCTGATAGTCCTTGCGGCTGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTATAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAAGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGGGATCAACTTAGC--TTTT-GCTGAGAGCACTTTCCGGTTAACGGGTCAGCATCAATTTTGATTGTTGGATAAAGGTCAGTGGAATGTGGCATCTTCGGATGTGTTATAGCCATTGGTTCGCATACAACAGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGG--TATTT--ATACCAC-GTA--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCGGTCTTGAAACACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Macrotyphula_juncea_DJM_975 GAAGCGGGAAAAGCTCAAATTTAAAATCTGATAGTCC-----GCTGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTATAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAAGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGGGATCAACTTAG---TTTT-GCTGAGAGCACTTTCCGGTTAACGGGTCAGCATCAATTTTGATTGTTGGATAA-GGTCAGTGGAATGTGGCATCTTCGGATGTGTTATAGCCATTG-TTCGCATACAACAGTTGGGATTGAGGAACTCAGCAC------------------------------------CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCGGTCTTGAAACACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Phyllotopsis_nidulans GAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCT--GATCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTATATGGCACGGACTACCAGGGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAAGGATCAACCTAGC-TTTTTTGCTGGGAGCACTTCTTGGTTGACGGGTCAGCATCAGTTTTGATTGTTGGATAAAGTTCAAGGGAATGTGGCATCTTCGGATGTGTTATAGCCTTTG-TTCGTATACAACAGTTGGGACTGAGGAACTCAGCATGCCGCAAGGCCGAG--TACTTTTGTACTAANGTAAACATGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTATAACATGCCCGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCGTGGAGAGCATCGACGCCCGGACCAGACCTTTTGTGACGGTTCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG Pleurocybella_porrigens GAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAATCCTCGTGGTTGTCCGAGTTGTAATTTAGAGAAGTGCTATCTGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAAGGCTTTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGGAATCAACCTTGCATTTTTTGCTGGGAGCACTTTCTGGTTGACGGGTCAGCATCAATTTTGATTGTTGGATAAAGGTTAAGGGAATGTGGCATCCTCGGATGTGTTATAGCCCTTGATTCGCATACAACAGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGG--TACTT--GTACCAC-GTAA-CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCATGGAGGGCATCGACGCCCGGACCAGACCTTTTGTGACGGTCCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG Typhula_phacorrhiza_AF393079 GAAGCGGGAAAAGCTCAAATTTAAAATCTGATGGTCCTTGCGGCTGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGACCGTGTATAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAAGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGGATCAACTTAGC--TTCT-GCTGAGAGCACTTTCTGGTTAACGGGTCAGCATCAATTTTGATCGTTGGATAAAGGTCAGTGGAATGTGGCATCTTCGGATGTGTTATAGCCATTGGTTCGTATACAACGGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGG--TATTC--GTACCAC-GTA--CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGATAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG Typhula_phacorrhiza_AY586724 GAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCCTTGTGGCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAAGGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAAGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGGGATCAACTTGGC-TTTTTAGCTGAGAGCACTTTCCGGTCGACGGGTCAACATCAATTTTGATTGTTGGATAAAGGTCAGTGGAATGTGGCATCTTCGGGTGTGTTATAGCCATTGGTTCGCATACAACGGTTGGGATTGAGGAACTCAGTACGCCGCAAGGCCGGA--TAGCA--ATATCAC-GTA--CGTACTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTGGGGAGCATCGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG Typhula_phacorrhiza_DAOM195241 GAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCCTTGTGGCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGTTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCGTAGAGGGTGAGAATCCCGTATATGACACGGACTACCAAGGCTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAAGGAAACGCTTGAAGTCAGTCGCGTTAACCGGGGATCAACTTGGC-TTTCTAGCTGAGAGCACTTTCCGGTTGACGGGTCAACATCAATTTTGACTGTTGGATAAAGGTCAGTGGAATGTGGCATCTTCGGGTGTGTTATAGCCATTGGTTCGCATACAACGGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGA--GATTC--GTCTCAC-GTA--CGTGCTTAGGATGTTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCCGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTGGGGAGCATCGACGCCCGGACCAGACCTTTTGTGACGGATCCGCGGTAGAGCGTGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Macrotyphula_clade_28S_rDNA) = N: 1-870; CODONPOSSET CodonPositions (CHARACTERS = Macrotyphula_clade_28S_rDNA) = N: 1-870; END; BEGIN TREES; TITLE Tb8136; LINK TAXA = Taxa4; TRANSLATE 1 Pleurotopsis_longinqua, 2 Pistillaria_sp._DJM1031, 3 Mycena_aurantiidisca, 4 Mycena_adonis, 5 Hemimycena_ignobilis, 6 Hemimycena_delicatella, 7 Chaetotyphula_sp._BDCR0419_2C, 8 Chaetotyphula_hyalina, 9 Calyptella_capula, 10 Bioluminescent_mycenoid, 11 Actiniceps_laevis; TREE Fig._5 = [&R] (3,(4,(10,(1,(6,(5,(9,((8,11),7,2)))))))); END; BEGIN TREES; TITLE Tb8132; LINK TAXA = Taxa2; TRANSLATE 1 Ramariopsis_kunzei, 2 Phlebia_tristis, 3 Mucronella_sp_DJM1309, 4 Mucronella_calva, 5 Hebelomina_neerlandica, 6 Gymnopilus_spectabilis, 7 Gymnopilus_penetrans, 8 Gymnopilus_junonius, 9 Gymnopilus_aeruginosus, 10 Galerina_paludosa, 11 Clavulinopsis_laeticolor, 12 Clavulinopsis_helvola, 13 Clavaria_zollingeri, 14 Clavaria_vermicularis, 15 Clavaria_sulcata, 16 Clavaria_redoleoalli, 17 Clavaria_fusiformis, 18 Clavaria_fumosa, 19 Clavaria_argillacea, 20 Ramariopsis_sp._DJM1049; TREE Fig._3 = [&R] (((9,((6,8),(7,5))),10),((4,3),((((17,12),15),(1,20)),(((16,(19,18)),14),(11,13))))); END; BEGIN TREES; TITLE Tb8128; LINK TAXA = Taxa5; TRANSLATE 1 Trichaptum_abietinum, 2 Rickenella_pseudogrisella, 3 Rickenella_mellea, 4 Resinicium_bicolor, 5 Ramaria_eumorpha, 6 Omphalina_rosella, 7 Omphalina_marchantiae, 8 Omphalina_brevibasidiata, 9 Hyphodontia_radula, 10 Cotylidia_diaphina, 11 Cotylidia_aurantiaca, 12 Cotylidia_alba, 13 Clavulina_cristata, 14 Clavaria_purpurea_DJM1334, 15 Clavaria_purpurea_BD299, 16 Clavaria_nebulosoides, 17 Cantharellopsis_prescotii, 18 Auriscalpium_vulgare; TREE Fig._1 = [&R] (5,(13,(18,(((((((((14,16),15),17),8),3),((1,9),7),2),6),((12,10),11)),4)))); END; BEGIN TREES; TITLE Tb8137; LINK TAXA = Taxa4; TRANSLATE 1 Pleurotopsis_longinqua, 2 Pistillaria_sp._DJM1031, 3 Mycena_aurantiidisca, 4 Mycena_adonis, 5 Hemimycena_ignobilis, 6 Hemimycena_delicatella, 7 Chaetotyphula_sp._BDCR0419_2C, 8 Chaetotyphula_hyalina, 9 Calyptella_capula, 10 Bioluminescent_mycenoid, 11 Actiniceps_laevis; TREE Chaetotyphula_MP = [&R] (3,(4,(10,(1,(((6,(8,(11,(7,2)))),5),9))))); END; BEGIN TREES; TITLE Tb8134; LINK TAXA = Taxa1; TRANSLATE 1 Armillaria_irazuensis, 2 Xerula_megalospora, 3 Xerula_furfuracea, 4 Strobilurus_trullisatus, 5 Rhodotus_palmatus, 6 Rhizomarasmius_pyrrhocephalus, 7 Physalacria_sp._DJM_1035, 8 Physalacria_maipoensis, 9 Physalacria_inflata, 10 Physalacria_corticola, 11 Physalacria_aff._orinocensis, 12 Oudemansiella_canarii, 13 Gloiocephala_spathularia, 14 Gloiocephala_sp._TENN7573, 15 Gloiocephala_menieri, 16 Flammulina_velutipes, 17 Cyptotrama_asprata, 18 Armillaria_tabescens, 19 Armillaria_NABSI_GC17; TREE Fig._4 = [&R] (18,((19,(((((((((10,(8,7,11)),(9,13)),5),((2,3),12)),16),4),6),(17,14)),15)),1)); END; BEGIN TREES; TITLE Tb8129; LINK TAXA = Taxa5; TRANSLATE 1 Trichaptum_abietinum, 2 Rickenella_pseudogrisella, 3 Rickenella_mellea, 4 Resinicium_bicolor, 5 Ramaria_eumorpha, 6 Omphalina_rosella, 7 Omphalina_marchantiae, 8 Omphalina_brevibasidiata, 9 Hyphodontia_radula, 10 Cotylidia_diaphina, 11 Cotylidia_aurantiaca, 12 Cotylidia_alba, 13 Clavulina_cristata, 14 Clavaria_purpurea_DJM1334, 15 Clavaria_purpurea_BD299, 16 Clavaria_nebulosoides, 17 Cantharellopsis_prescotii, 18 Auriscalpium_vulgare; TREE Hymenochaetoid_MP2 = [&R] ((5,13),18,((((((((14,16),15),8),((4,17),3)),((1,(7,9)),2)),6),(12,10)),11)); TREE Hymenochaetoid_MP1 = [&R] ((5,13),18,(((((((((14,16),15),8),(4,17)),3),((1,(7,9)),2)),6),(12,10)),11)); TREE Hymenochaetoid_MP4 = [&R] ((5,13),18,(((((((((14,16),15),17),8),3),((1,(7,9)),2)),6),((12,10),11)),4)); TREE Hymenochaetoid_MP3 = [&R] ((5,13),18,(((((((((14,16),15),17),8),(1,(7,9))),2),(((12,10),11),6)),3),4)); TREE Hymenochaetoid_MP7 = [&R] ((5,13),18,(((((((((14,16),15),17),8),3),2),(((12,10),11),6)),(1,(7,9))),4)); TREE Hymenochaetoid_MP6 = [&R] ((5,13),18,(((((((((14,16),15),17),8),3),(((12,10),11),6)),2),(1,(7,9))),4)); TREE Hymenochaetoid_MP5 = [&R] ((5,13),18,(((((((((14,16),15),17),8),(((12,10),11),6)),(1,(7,9))),2),3),4)); END; BEGIN TREES; TITLE Tb8131; LINK TAXA = Taxa3; TRANSLATE 1 Typhula_phacorrhiza_DAOM195241, 2 Typhula_phacorrhiza_AY586724, 3 Typhula_phacorrhiza_AF393079, 4 Pleurocybella_porrigens, 5 Phyllotopsis_nidulans, 6 Macrotyphula_juncea_DJM_975, 7 Macrotyphula_juncea_DJM_1032, 8 Macrotyphula_fistulosa, 9 Macrotyphula_defibulata, 10 Henningsomyces_candidus, 11 Bulbillomyces_farinosus; TREE Macrotyphula_MP = [&R] (6,(7,((3,(((2,1),((10,4),5)),(8,11))),9))); END; BEGIN TREES; TITLE Tb8133; LINK TAXA = Taxa2; TRANSLATE 1 Ramariopsis_kunzei, 2 Phlebia_tristis, 3 Mucronella_sp_DJM1309, 4 Mucronella_calva, 5 Hebelomina_neerlandica, 6 Gymnopilus_spectabilis, 7 Gymnopilus_penetrans, 8 Gymnopilus_junonius, 9 Gymnopilus_aeruginosus, 10 Galerina_paludosa, 11 Clavulinopsis_laeticolor, 12 Clavulinopsis_helvola, 13 Clavaria_zollingeri, 14 Clavaria_vermicularis, 15 Clavaria_sulcata, 16 Clavaria_redoleoalli, 17 Clavaria_fusiformis, 18 Clavaria_fumosa, 19 Clavaria_argillacea, 20 Ramariopsis_sp._DJM1049; TREE Clavaria_Clade_MP = [&R] (9,((6,8),(7,5)),(10,((4,3),((((17,12),15),(1,20)),(((16,19),18),((11,13),14)))))); END; BEGIN TREES; TITLE Tb8130; LINK TAXA = Taxa3; TRANSLATE 1 Typhula_phacorrhiza_DAOM195241, 2 Typhula_phacorrhiza_AY586724, 3 Typhula_phacorrhiza_AF393079, 4 Pleurocybella_porrigens, 5 Phyllotopsis_nidulans, 6 Macrotyphula_juncea_DJM_975, 7 Macrotyphula_juncea_DJM_1032, 8 Macrotyphula_fistulosa, 9 Macrotyphula_defibulata, 10 Henningsomyces_candidus, 11 Bulbillomyces_farinosus; TREE Fig._2 = [&R] (6,(7,((3,(((2,1),((10,4),5)),(8,11))),9))); END; BEGIN TREES; TITLE Tb8135; LINK TAXA = Taxa1; TRANSLATE 1 Armillaria_irazuensis, 2 Xerula_megalospora, 3 Xerula_furfuracea, 4 Strobilurus_trullisatus, 5 Rhodotus_palmatus, 6 Rhizomarasmius_pyrrhocephalus, 7 Physalacria_sp._DJM_1035, 8 Physalacria_maipoensis, 9 Physalacria_inflata, 10 Physalacria_corticola, 11 Physalacria_aff._orinocensis, 12 Oudemansiella_canarii, 13 Gloiocephala_spathularia, 14 Gloiocephala_sp._TENN7573, 15 Gloiocephala_menieri, 16 Flammulina_velutipes, 17 Cyptotrama_asprata, 18 Armillaria_tabescens, 19 Armillaria_NABSI_GC17; TREE Physalacriaceae_Clade_MP2 = [&R] (18,((19,(((((((((10,((8,11),7)),(9,13)),5),((2,3),12)),16),4),6),(17,14)),15)),1)); TREE Physalacriaceae_Clade_MP1 = [&R] (18,((19,(((((((((10,(8,7,11)),(9,13)),5),((2,3),12)),16),4),6),(17,14)),15)),1)); END;