#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:42 GMT TreeBASE (cc) 1994-2008 Study reference: Chen Y.Y. 2016. A new species of Antrodia sensu stricto based on morphology and molecular data. Mycoscience, 1-10. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S17044] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=30; TAXLABELS 'Antrodia favescens 0309_103' 'Antrodia favescens 0412_4J' 'Antrodia favescens Vlasak_0809' 'Antrodia heteromopna Yuan_2466' 'Antrodia heteromopna Yuan_826' 'Antrodia heteromorpha 0509_187' 'Antrodia heteromorpha Dai_1274' 'Antrodia heteromorpha Dai_1275' Antrodia_heteromorpha_X1474 Antrodia_heteromorpha_X1841 'Antrodia macra MUAF_887' Antrodia_mappa_4132 Antrodia_mappa_4239 'Antrodia mappa Vlasak_0509.170' Antrodia_mappa_X1500 'Antrodia serialis Cui_10519' 'Antrodia serpens Vlasak_8609.15' Antrodia_serpens_X1511 'Antrodia subserpens Cui_8310' 'Antrodia subserpens Dai_13233' 'Antrodia subserpens Dai_6380' Antrodia_tanakai_11453 'Antrodia tanakai Cui_6080' 'Antrodia tanakai Cui_9275' 'Antrodia tanakai Cui_9758' 'Antrodia tanakai Dai_11782' Antrodia_tanakai_X1504 Antrodia_tanakai_X1505 Antrodia_tanakai_X1779 'Antrodia tanakai Yuan_1106' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=44; TAXLABELS 'Amyloporia sinuosa Otto_Miettine_X725' 'Amyloporia sitchensis HHB_5320' 'Amyloporia sordida L_3393_R' 'Amyloporia xantha Otto_Miettinen_X701' 'Antrodia favescens 0309_103' 'Antrodia favescens 0412_4J' 'Antrodia favescens Vlasak_0809' 'Antrodia heteromopna Yuan_2466' 'Antrodia heteromopna Yuan_826' 'Antrodia heteromorpha Dai_12755' Antrodia_heteromorpha_X1379 Antrodia_heteromorpha_X1438 'Antrodia huangshanensis Dai_6082' Antrodia_juniperina_11190 'Antrodia macra MUAF_887' 'Antrodia malicola Otto_Miettinen_X1382' Antrodia_mappa_4132 Antrodia_mappa_4239 'Antrodia pulvinascens Otto_Miettinen_X8022' 'Antrodia serialis Cui_10519' 'Antrodia serialis Otto_Miettinen_X732' 'Antrodia serpens Vlasak_8609_15' Antrodia_serpens_X1508 Antrodia_serpens_X1511 'Antrodia subserpens Cui_8310' 'Antrodia subserpens Dai_13233' 'Antrodia subserpens Dai_6380' 'Antrodia tanakai Cui_6080' 'Antrodia tanakai Cui_9275' 'Antrodia tanakai Cui_9758' 'Antrodia tanakai Dai_11782' Antrodia_tanakai_X1521 'Antrodia tanakai Yuan_1106' 'Antrodia tropica Cui_6471' 'Antrodia wangii Cui_5525' Daedalea_quercina_8085 'Fibroporia albicans Dai_10595' Fibroporia_gossypium_X1403 'Fibroporia radiculosa FP_105309_R' 'Fibroporia vaillantii RWD_63_263' 'Fomitopsis pinicola Otto_Miettinen_X772' 'Laetiporus montanus Cui_10011' 'Laetiporus sulphureus Dai_12154' Piptoporus_betulinus_8086 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M43311] TITLE 'Antrodia ITS+LSU'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1551; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Amyloporia sinuosa Otto_Miettine_X725' TGTAGCTGGTCTTTTC----CGAG-ACAT-------GTGCACGCCCTGCT-C-ATCCATTCT------ACCCCTGTGCACACTCTGTAGG----TCGGTTTTG-----AAGTGAT------TCCTCACGGAATCGC----TCG--------GGCCT---TCCTATGTTTTCAT-ACAAACACTTTAA-AGTCAAA--GAATGTA-AT-CGCGT--GTAA-CGCATTTAAT-ACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCC----TCTTATCTTTG---------TTATGAGATGGGC---TTGGACTTGGAGG----------TT-ATTGCCGGCTTGTCATGAGTCTGGCT----CCTCTTGAATT--CATT--AGCTTGAACCCTT--GTGGA---TCGGCTACTCGGTGTGATAAT-TGTCTACGCCGTGT-GCTGTGAAGCTTTCAAA-CACTTTGTTGTGTTGAGGGATT-{AT}GCTTCTAA-TCGTC-----C-TTCAAT--GGA{CT}AATTTTTGACCT---CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGCTTT--TGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTTGC--T--TTTGCTTGGTGCACTTTCT-GGTTGACGGGCCAGCATCAATTTTGATTGTTGGATAAAGGCTGGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTCGGTCACATACAACAGTTGGGATTGAGGATCTCAGCACGCCTTTAT-GGTCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCATG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Amyloporia sitchensis HHB_5320' TGTAGCTGGTCTTTTC----CGAG-ACAT-------GTGCACGCCCTGCT-C-ATCCATTTC------ACCCCTGTGCACACTCTGTAGG----TCGGTTTTG-----AAGTGAT------TCCTCACGGAGTCGC----TCG--------GGCCT---TCCTATGTTTTCAT-ACAAACACTTTAA-AGTCAAA--GAATGTA-AT-CGCGT--GTAA-CGCATTTAAT-ACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCC----TCTTATCTTTG---------TTATGAGATGGGC---TTGGACTTGGAGG----------TT-ATTGCCGGCTTGTCATGAGTCTGGCT----CCTCTTGAATT--CATT--AGCTTGAACCCTT--GTGGA---TCGGCTACTCGGTGTGATAAT-TGTCTACGCCGTGT-GCTGTGAAGCTTTCAAA-CACTTTGTTGTGTTGAGGGATT-TGCTTCTAA-TCGTC-----C-TTCAGT--GGACAATTT----------CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGCTTT--TGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGACCAGAACTCAGCCTTGC--T--TTTGCTTGGTGCACTTTCT-GGTTGACGGGCCAGCATCAATTTTGATTGTTGGATAAAGGCTGGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTCGGTCACATACAACAGTTGGGATTGAGGATCTCAGCACGCCTTTAT-GGTCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCATG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Amyloporia sordida L_3393_R' TGTAGCTGGCCTTTCT----TCAG-GCA--------GTGCACGCCCCGCTTC-ATCCATCTC------TCACCTGTGCAT-CTTTGTAGG----TTGTCTTCA------ATTGGCT------TCTCCGGAGGTTGAT---TTG--------GACCT---TCCTATGTTTT-AT-ACACTTACCCTGTCAGTATCA--GAATGTC-AT-TGCGT--ATAA-CGCATTTTATTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC-GCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAA-CTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTT-AGTGTCATGGAATTCTCAACTCG---TCTTGCTTTTTA-------TTTGTGAGATGG-T---GTGGATTTGGAGG----------TTTATTGCTG--TTGTCATTTATTTGATGATGGCTCCTCCAATTG-CATT--AGCTGGAACCTTT--GTGGA---TCGGCTCTTCAGTGTGATAAT--GTCTACGCTGTGGAGTTGTGAGACGGTT----TGCGTCTTTCTGACGTGAGGTC-TGCTTCTAG-TTGTC-----CTTTTACCG-GGACAATTTCT--------CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGTCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGAACTCAGCCTTGC--T--TTTGCTTGGTGCATTTTCT-GGTTGACGGGTCAGCATCAGTTTTGATCATTGGAGAAAGGCCAGAGGAATGTGGCACCTCCGGGTGTGTTATAGCCTCTGGTCACATACGATGATTGGGACTGAGGGTCTCAGCACGCCTTTAT-GGCCGGGGT----TTGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGACGT-TCTCTGACGGCTCCGCGGTAGAGCATGTATGCTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Amyloporia xantha Otto_Miettinen_X701' TGTAGCTGGCCTTTCA----CGAG-GCAT-------GTGCACGCTCCGCT-C-ATCCATTCT------ACACCTGTGCACATTCTGTAGG----TCGGTTTGA-------ATGGTTTC--TCTCTTGGGGAACTG----TTT---------GGCCT---TCCTATGTTTTATT-ATATAAACTCTAA--GTTAAA--GAATGTA-ATCTGCGT--CTAA-CGCATCTTAT-ACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTC----TCTTACCTTTG--------CTGGTAAGCAGAGC---TTGGATTTGGAGG----------CT-TCTGCTGG-CTCTCACTGAGTCAGCT----CCTCTTGAATG--CATC--AGCTTGGACCTTT--GTGGA---ATGGCT-TTCGGTGTGATAAT-TGTCTACGCCGTTT-GCTGTGAAGCTTATA---CACTTCGGTGTGA----GGGTC-AGCTTCTAA-TGGTC-----CCTTCAGT--GGACAAATCTTTGACCT--CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTT--TGGCCATCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAAT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGAACTCAGCCTTGC--T--TTTGCTAGGTGCACTTTCT-GGTTGACGGGCCAGCATCAATTTTGATTGTTGGATAAAGGCTGGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTCGGTCACATACAACAGTTGGGATTGAGGATCTCAGCACGCCTTTAT-GGCCGGGGC----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAATCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGATCTCTGTCATG-GAGAGCACCGACGCCCGGACCTGACCT-TCTGTGACGGCTCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia favescens 0309_103' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CATTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAA{CT}GAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-{AG}CTGAGACGCAT{AG}A-------------ATGG-----GATC-GGCTTACAA-TCGT------CCTCTA-CGGACAATTTA--TTATGACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia favescens 0412_4J' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CATTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAACGCAGT------TGGATTTGGAGG{CT}TA-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTACAA-TCGT------CCTCTA-CGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTCGGTCGTCGGATAAAGGTTGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATG{CT}TGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia favescens Vlasak_0809' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--{AC}ATTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAA{CT}GCAGT------TGGATTTGGAGGC{CT}A-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCAT{AG}A-------------ATGG-----GATC-GGCTTACAA-TCGT------CCT{CT}TA-CGGACAATTTA--TTATGACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia heteromopna Yuan_2466' TGTAGCTGGCCTTTCA-----AAGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCTTGTGAACACTCTGTAGG----TCGGCTCAA--------GGGACAAA---TTCTTAACGGGGTTTGTTCTG--------GGCCT---TCCTATGTTTT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTG----TTTATCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCCA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTACAG-TCGT------CCTTGAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCGCCAGGACTCACCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACAGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia heteromopna Yuan_826' TGTAGCTGGCCTTTCA-----AAGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCTTGTGAACACTCTGTAGG----TCGGCTCAA--------GGGACAAA---TTCTTAACGGGGTTTGTTCTG--------GGCCT---TCCTATGTTTT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTG----TTTATCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCCA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTACAG-TCGT------CCTTGAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCGCCAGGACTCACCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACAGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia heteromorpha Dai_12755' TGTAGCTGGCCTTTCA-----AAGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGAACACTCTGTAGG----TCGGCTCAA--------GGGACAAA---TTCTTAACGGGGTTTGTTTTG--------GGCCT---TCCTATGTTTT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTG----TTTATCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCCA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATT-GGCTTACAG-TCGT------CCTTGAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCGCCAGGACTCACCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACAGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC Antrodia_heteromorpha_X1379 TGTAGCTGGCCTTTCA-----AAGGGC{AG}T-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGAACACTCTGTAGG----TCGGCTCAA--------GGGACAAA---T{CT}CTTAACGGGGTTTGTTTTG--------GGCCT---TCCTATGTTTT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTG----TTTATCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCCA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGAC{AG}CATGA-------------ATGG-----GAT{CT}-GGCTTACAG-TCGT------CCTTGAACGGACAATTTA--TTATGACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antrodia_heteromorpha_X1438 TGTAGCTGGCCTTTCA-----AAGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGAACACTCTGTAGG----TCGGCTCAA--------GGGACAAA---TTCTTAACGGGGTTTGTTTTG--------GGCCT---TCCTATGTTTT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTG----TTTATCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCCA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATT-GGCTTACAG-TCGT------CCTTGAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCGCCAGGACTCACCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGTATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACAGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia huangshanensis Dai_6082' TGTAGCTGGCCTTAC-----GGG--GCATTT----TGTGCACGCCCTGCT-CATTTGTCCCCA-TCTCACACCTGTGCACACTCTGTAGG----ATGGTTA-T------AGCAGTGAAG---CCTTCAGTGG-TTTTGCTATG----CGT-AGCCT---TCCTATGTTTT-ATCACACA--CTACT-CAGTTTAAA-GAATGTC-CTTTGCGT--CTAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACTCC---CTTT--CACTT---------GTGAACATGGGAT--GTTGGATGTGGAGGTTTT-------TGCTGGATGCTCTTATGTATT------CAGCTCCTCTTGAATG--CATT--AGCTTGAACCTTT-TGTGGA---TCAGCTT-C-GGTGTGATAAT-TGTCTACGCCGTTC--TG-TGAAGCAATA-------T-ATATGTTA----G-----AGCTTCCAA-CCGT----GTCCTGTACAC-AATTCTTGACCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antrodia_juniperina_11190 TGTAGCTGGCCTTTTCGTTTGAGAGGCATTT----TGTGCACGCCCTGAT-CATCATCCATT--TT-CACACCTGTGCACATTCTGTAGG----TCGGTTTTTTG------GGGGTGAGG-GTCTTTATTGGCTTTTGCTCC----TTGG--GCCT---TCCTATGTTTT-ATTATAAA-ACTACA--AGTTTAAAAGAATGTC-TATTGCAT--ATAA-TGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCT---ATTCGCTTTTTTTT---TTTGTGAATAGAGC-----TTGGACTTGGAGGTTT------ATTGCTGGATACTG--ATGTGTT------CAGCTCCTCTTGAATG--CATT--AGCTTGGACCTTC-TGTGGA---TCAGCTTATCGGTGTGATAAT-TGTCTACGCCGTT---CTGTGAAGCA-TA-------TAT-CTATGG----G-TTTCAGCTTCCAA-TAGTT-----CCTTTGTTGGACAAATACA--TTTGACCTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC-TT--TT-GCTTGGTGCACTTTCT-GGTTGACGGGCCAGCATCGATTTTGACCGCTGGAAAAAGGTTGGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTCAGTCACATACGGTGGTTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGAACT-TCGGTGATGGCTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia macra MUAF_887' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACGCCTCTCTTCAATCCATTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTTTAACGGGACCTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CACTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAATTCG----TTTGTCTTCGT--------ATGAACGCAGT------TGGATTTGGAGGCTG-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTACAG-TCGT------CCGTGTACGGACAATTTA--TTATGACCT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia malicola Otto_Miettinen_X1382' TGTAGCTGGCGTTCT-----CGGACGCATTT----TGTGCACGCCCTGAT-CATTA---TCCA-TCTCACACCTGTGCACACTCTGTAGG----TGGGTTACT---------GGGGCTACTGTCTTTATTGG-TGGTGCTCTG----TG---GCCT---TCCTATGTTTT-TATACAAA--CTACT-CAGTTTAAA-GAATGTC-AATTGCGT--GTAA-CGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCT---ATTTGCTATTT---------GTGAATAGGGC-----TTGGACTTGGAGGTTTTG----AATGCTGGATACTACTTTGTATT------CAGCTCCTCTTAAATG--CATT--AGCTCGAGCCTGT-TGTGGA---TCAGCTT-C-AGTGTGATAAT-TGTCTACGCTGTTC--TG-TGAAGCATTA-------TTATATATGG----GCCTTCGGCTTCTAA-TTGT------CCTGTACTGGACAA-CAT--CTATGACCTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGCTTT--TTTGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGACTGTCGGAAAAAGGCTGGGGGAATGTGGCACCTTCGGGTGTGTTATAGCTCTCAGTCACATACGGCAGTTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGAACT-TCGGTGATGGCTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC Antrodia_mappa_4132 TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTC-------ACCACTGTGCACAATTTGTAGG----TCGGCTTTA--------GGATCGGG---TCTCTAGCGGGATCTGTTTCG--------GGCCG---TCCTATGTATC-ATTACAAA--CATTTAAAGTCTA{CT}-AGAATGTA--CTCGCGT---TAAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCG----CCAATCTT--------TGCATTGGCGCTGT------TGGACTTGGAGGCT----TTTTT-GCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--TATT--AGCTCGGACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGTGATGCATGA-----------GTAGGA-------TC-GGCTTACAA-TCGT------CTTTAAACGGACAATAAAACTTATGACC-CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGATGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTAGCCAGGACTCAGCCTTGC--T--TTTGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTAGCATCTTCGGATGTGTTATAGCCCTCGGTCACATACGACGGCTAGGATCGAGGACCGCAGCACGCCTTCAT-GGCCGGGGT----TCGCCCACGTA-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCATG-GAGAGCATCGACGCCCGGACCTGACCT-TCTGTGAGGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC Antrodia_mappa_4239 TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTC-------ACCACTGTGCACAATTTGTAGG----TCGGCTTTA--------GGATCGGG---TCTCTAGCGGGATCTGTTTCG--------GGCCG---TCCTATGTATC-ATTACAAA--CATTTAAAGTCTAA-AGAATGTA--CTCGCGT---TAAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCG----CCAATCTT--------TGCATTGGCGCTGT------TGGACTTGGAGGCT----TTTTTTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--TATT--AGCTCGGACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGTGATGCATGA-----------GTAGGA-------TC-GGCTTACAA-TTGT------CTTTAAACGGACAATAAAACTTATGACC-CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGATGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTAGCCAGGACTCAGCCTTGC--T--TTTGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCGGTCACATACGACGGCTAGGATCGAGGACCGCAGCACGCCTTCAT-GGCCGGGGT----TCGCCCACGTA-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCATG-GAGAGCATCGACGCCCGGACCTGACCT-TCTGTGAGGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia pulvinascens Otto_Miettinen_X8022' TGTAGCTGGCCTTTTCGTTTGAGAGGCATTT----TGTGCACGCCCCGAT-CATCATCCATT--TTTCACACCTGTGCACACTCTGTAGGC---TTGGCTGTTTC------GGGGCGAG--GTCTTTATTGA-CTTGGCTCTG-----ATTGG--TCTTGCCTATGTCTT-ATCACAAA--CTAGT-TTGTCAAAA-GAATGTA-CAATGTGT--GTAA-CACACTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATCATCAACTTT---ATTTACTTTC----------GTGAGTAAAGC-----TTGGATTTGGAGGTTT------AGTGCCGGATACTTTTCTGTATT------CGGCTCCTCTTAAATG--TATT--AGCTCGAACCTTT-TGTGGA---TCAGCTT--CGGTGTGATAAT-TGTCTACGCCGTT---CTGTGAAGCA-TA-------TGTTGTATAG----GTTTTCGGCTTCCAA-TTGT------CTTCAAT{AG}AGACAACTTG-------ACCTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTTTTCGGTCACCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCTGGAACTCAGCCTTGCTTT--TTTGCTTGGTGCATTTTCT-AGTTGACGGGCCAGCATCGATTTTGACTGCTGGAAAAAGGCTGGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTCAGTCGCATACAGTGGTTGGGATCGAGGATCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACTCGAGCGCGCAATGAAAGTGAAAGTTGAGATCCCTGTCATG-GGGAGCATCGACGCCCGGACTTGAACT-TCGGTGATGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia serialis Cui_10519' TGTAGCTGGCC---------GGAAGGCAT-------GTGCACGCCTCGAT-CATCATCCATC--T--CACACCTGTGCACACACTGTAGG----TCGGTTTGT--------GGGGCGAGG--TCTTCATTGA-{CT}TTTGCTTT----GCGG--GCCT---TCCTATGTTTT-ATCACAAA--CTACT--AGTT{CT}AAA-GAATGTC-TACTGCGT--GTAA-CGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTC---ATTTGCTTTT----------GTGAATGAAGC-----TTGGACTTGGAGGT--------ATTGCTGGCCG------TACGGT------CGGCTCCTCTTGAATT--TATT--AGCTCGAACCTT--TGTGGA---TCAGCTT--CGGTGTGATAAT-TGTCTACGCCGTT---CTGTGAAGCA-TA-------A---CTATGG----G-TTTCGGCTTCCAA-CAGT------CCTTCACTGGACAA-TAT--CTTTGACCTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--CGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTAGCCAGGACTCAGCCTTG--TT--TTTACTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGACTGCCGGAAAAAGATTGGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTCAGTCACATACGGCGATTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACTTGAACT-TCGGTGATAGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia serialis Otto_Miettinen_X732' TGTAGCTGGCC---------GGAAGGCAT-------GTGCACGCCTCGAT-CATCATCCATC--T--CACACCTGTGCACACACTGTAGG----TCGGTTTGT--------GGGGCGAGA--TCTTCAT{CT}GA-TTTTGCTTT----GCGG--{AG}CCT---TCCTATGTTTT-ATCACAAA--CTACT--AGTTTAAA-GAATGTC-TACTGCGT--GTAA-CGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTC---ATTTGCTTTT----------GTGAATGAAGC-----TTGGACTTGGAGGT--------ATTGCTGGCCG------TACGGT------CGGCTCCTCTTGAATT--TATT--AGCTCGAGCCTT--TGTGGA---TCAGCTT--CGGTGTGATAAT-TGTCTACGCCGTT---CTGTGAAGCA-TA-------A---CTATGG----G-A{CT}TCGGCTTCCAA-TAGT------CCTTCACTGGACAA-TAT--CTTTGACCTCCCCTAGTAACTGCGAGTGAAGCGGGAA{AG}AGCTCAAATTTAAAATCTGGCGGTCTT--CGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTAGCCAGGACTCAGCCTTG--TT--TTTACTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGACCGCCGGAAAAAGATTGGGGGAATGTGGCACCT{CT}CGGGTGTGTTATAGCCCTCAGTCACATACGG{CT}GATTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACTTGAACT-T{CT}GGTGATAGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia serpens Vlasak_8609_15' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGCACACTTTGTAGG----TCGGCTCAA--------GGGACAGA---TTCTTAACGGGATTTGTTTCC--------AGTCT---TCCTATGTTTT-ATTATAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAG{CT}ATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTGTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCCA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAA{CT}CTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGATGCATGA-------------ATGG-----GATC-GGCTTACAA-TCGT------CCTTGAA-GGACAATTTA--TTATGACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antrodia_serpens_X1508 TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGCACACTTTGTAGG----TCGGCTCAA--------GGGACAGA---TTCTTAACGGGATTTGTTTCC--------AGTCT---TCCTATGTTTT-ATTATAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTGTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCCA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAA{CT}CTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGATGCATGA-------------ATGG-----GATC-GGCTTACAA-TCGT------CCTTGAA-GGACAATTTA--TTATGACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antrodia_serpens_X1511 TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGCACACTTTGTAGG----TCGGCTCAA--------GGGACAGA---TTCTTAACGGGATTTGTTTCC--------AGTCT---TCCTATGTTTT-ATTATAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTGTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCCA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAA{CT}CTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGATGCATGA-------------ATGG-----GATC-GGCTTACAA-TCGT------CCTTGAA-GGACAATTTA--TTATGACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia subserpens Cui_8310' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGCACACTTTGTAGG----TCGGCTCAA--------GGGACAGA---TTCTTGACGGGATTTGTTTCG--------GGCCT---TCCTATGTTTT-ATTACAAA--CGTTTAAAGTTCAA-AGAATGTA--GTCGCGT--TTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTGTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAATGAC-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-AGCTTACAA-TCGT------CTTTGAACGGACAATCTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGTGAGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia subserpens Dai_13233' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGCACACTTTGTAGG----TCGGCTCAA--------GGGACAGA---TTCTTGACGGGATTTGTTTCG--------GGCCT---TCCTATGTTTT-ATTACAAA--CGTTTAAAGTTCAA-AGAATGTA--GTCGCGT--TTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTGTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-AGCTTACAA-TCGT------CTTTGAATGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGTGAGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia subserpens Dai_6380' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACGCCTCGCTTCAATCCACTT-------ACCCCTGTGCACACTTTGTAGG----TCGGCTCAA--------GGGACAGA---TTCTTGACGGGATTTGTTTCG--------GGCCT---TCCTATGTTTT-ATTACAAA--CGTTTAAAGTTCAA-AGAATGTA--GTCGCGT--TTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTGTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTG{CT}CGGAT----TGTAATGA{CT}-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-AGCTTACAA-TCGT------CTTTGAATGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGTGAGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia tanakai Cui_6080' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTATAA-TCGT------CCTCTAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia tanakai Cui_9275' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCAGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTATAA-TCGT------CCTCTAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGACCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia tanakai Cui_9758' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GACC-GGCTTATAA-TCGT------CCTCTAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia tanakai Dai_11782' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTT{AG}--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCAGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTATAA-TCGT------CCTCTAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAG------------------------------------AAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC Antrodia_tanakai_X1521 TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GC{AG}GA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTATAA-TCGT------CCTCTAACGGACAATTTA--TTATGACTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia tanakai Yuan_1106' TGTAGCTGGCCTTTCA-----ACGGGCAT-------GTGCACACCTCGCTTCAATCCACTT-------ACACCTGTGCACACTTTGTAGG----TCGGCTTTA--------GGAACGGG---TCTCTAACGGGGCTTGTTTCG--------GGCCT---TCCTATGTATT-ATTACAAA--CGTTTAAAGTCTAA-AGAATGTA--CTCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCG----TTTGTCTTTGT--------ATGAACGCAGT------TGGATTTGGAGGCTA-------TTGCCGGAT----TGTAATGAT-----TCGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCTT-TTGGTGTGATAAT-TGTCTACGCCGCTA-ACTGAGACGCATGA-------------ATGG-----GATC-GGCTTATAA-TCGT------CCTCTAACGGACAATTTA--TTATGACTTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC--T--TTAGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGGTTGTCGGATAAAGGCAGGGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTCAGTCACATACGACGGCTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGCG-GGGAGCATCGACGCCCGGACCTGACCT-TCTGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Antrodia tropica Cui_6471' TGTAGCTGGCCTTTC-----AGGAGGCATATAT--TGTGCACGCCCTGAT-CATTATCCACCA-TCATACACCTGTGCACACACTGTAGG----TTGGCTC---------------GAG---CCTCTGTTGC-TCTTGCTGG------------------TCTATGTCCT-TTTA-ATA--ACACA-T-GTTGAGA-GAATGTT-CATTGCGT--GTAA-CGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAAATCTCAACTCT---GTTTGCTTTTT---------GTGAACAGAGC-----TTGGACTTGGGGGATTTT----ATTGCCGGAACCCTTTGTGTGTTT-----CGGCTCCTCTTAAATG--CATC--AGCTTGGGCTCTT-TGTGGGGAGTCAGCTT-TTGGTGTGATAAT-TGTCTACGCCTGGC--TGATGAAGCG-CA-------TAGTA-ATGA----GCTCTTAGCTTCCAA-TGGT------CCTGTGGAC-ACACTTTGACCT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia wangii Cui_5525' TGTAGCTGGCCGTCTCTTTGGGGCGGCAT-------GTGCACGCCCTGAT-CACTATCCATC--TCACACACCTGTGCACACACTGTAGG----TTGGCTTGTGAT-----TGGAGCTACGGTCTTCATTGA-CTTTGCTCT--GGTTGGAGGCCC---TCCTATGTATT-ATCACAAA--CTACTTCAGTTTAAA-GAATGTACTCTTGCGT--CTAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCT---ATTTGCTTTT----------GTGAATAGAGC-----TTGGATTTGGAGGTTTT-----ATTGCTGGTACT-----TGTGAT------CGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT--GCGGA---TCAGCT-ATCGGTGTGATAAT-TGTCTACGCCGTTG--CAGTGAAGCA-TA-------T----CAATG----G-GCTCGGCTTCCAA-TCGT------CCTTATCTGGACAA-TGA--CTTTGACCT-CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC-TT--TTTGCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGACCACTGGAAAAAGGCTAGGGGAATGTGGCACTTTCGGGTGTGTTATAGCCCTTAGTCACATACAGTGGTTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGAACT-TCGGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC Daedalea_quercina_8085 TGTAGCTGGCCTTCC--------AGGCATTT----TGTGCACGCCCCGAT-CATCATCCTTT-----CACACCTGTGCACCCTCTGTAGT----TGGGCTGTC--------TGGCAAAG---TCTTTGATGT-CTTTGCTCT------GTTGGCCC---TCCTATGTTTT-ATTACAAA---CTTTACAGTTCAAA-GAATGTC-{CT}ATCGCGT--CTAA-CGCAT-TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGGAATCCTCAACTCT---ATTTGCTTTT----------GTGAATAGAGC-----TTGGACTTGGAGGTTA------ATTGCCGGATGCGTC--AGTGTC------TGGCTCCTCTTGAATG--TATT--AGCTTGAACCTTT--GTGGA---TCAGCTT--CGGTGTGATAAT-TGTCTACGCCGTC---CTGAGAAGCAT{CT}A-------T----TGTGG----G-TTTTGGCTTCCAA-TCGT-------CCTCATGGGACAAATCA--TTATGACCTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGTTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGATCAGAACTCAGCCTTGC-TT--TT-GCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGACCATCGGAAAAAGGCCAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTGGTCACATACGGTGGTTGGGATCGAGGACCGCAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGAACT-TCGGTGATGGCTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Fibroporia albicans Dai_10595' TGTAGCTGGCTCTAAT----CGG--GCAT-------GTGCACACCCTATT-C-ATCCATTTCT-ATA--CACCTGTGCACCCTT-GTAGGA-TTTTGGTTG--------TACGGGAAGG---CTGTCAAAGGCTTTC---CTA--------GACCGG--TCCTATGTTTTTATTATAAACCCT-TGAATGTCTTT--GAATGTC-TT-TGCATTAATAA-TGCATTTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAAATCTTC-ACTTTAATTTAT------TTTAGAGGGTTGGT----TTGGATTTGGAGGTTTT-----ATTGCTGGCCGTATTTTTGTGT----GGTCGGCTCCTCTTGAATG--CATT--AGCTTGAGCCTTT-AACGGG---TCGGCTTATCGGTGTGATAAT-----AAAATTACTACGCCGTT--GTCGGGT------T----T-CGT----GAGTCGAGCTTCCAA-TCGTC-----CTTT--TGGGACAAATAACAT--------CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTTAT-TAGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGTGCTGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGAAATCAGCCTTGCTTT----CGCTTGGTGTATTTTCT-GGTTGACGGGCCAGCATCGATTTTGACCGTTGGATAAAGGTGAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTTGTCACATACAACGGTTGGGATCGAGGAACTCAGCACGCCTTTAT-GGTCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGTAAACCCGAGCGCGTAATTAAAGTAAAAGTTGAGATCCCCTTCGCAAGGGAGCATCGACGCCCGGACTTGACCT-TTTGTGATAGCTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC Fibroporia_gossypium_X1403 TGTAGCTGGCTCTCTC----TGGGGGCAT-------GTGCACACTCTATT-C-ATCTATTTCT-ATATACACCTGTGCACCTTTTGTGGG----TCGGTCATA------TGAGGGAAAG---TTG--AAAGGCTTTTGTTCTA--------GACCT---TCCTACGTTTTTATTATAAACCC{AT}-AGCATGTCTTT--GAATGTC-TT-TGCATTAATGA-TGCATTTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAATCCT---GTTTTACTTTAT------TGTGAAATG--GGC----TTGGATTTGGAGGCTTT------TTGCTGGCTGCATTTATATTTGCT-GGTCGGCTCCTCTTGAATA--TATT--AGCTTGAGTCTTTTAATGAGA--TTGGCTTATCGGTGTGATAA---------ATT--TGCGCCGTG--GTTGGTT------T----CATGT----AAATTAAGCTTCTAAATCGTC-----CCGCGCAGGGACAAATA-CAT--------CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGCTTA--TAGTCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTTGTCTGGAAGTCAGCCTTGCAAT--TTTGTTTGGTGTATTTTTCAGATTGACGGGCCAGCATCGATTTTGACCGTTGGATAAAGATGAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCCTTGTCACATACAACGGTTGGGATCGAGGAACTCAGCACGCCTTTATTGGTCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGTAAACCCGAGCGCGTAATTAAAGTAAAAGTTGAGATCCCCGTTACAAGGGAGCATCGACGCCCGGACTTGACCT-TCTGTGATAGCTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Fibroporia radiculosa FP_105309_R' TGTAGCTGGCTTTTAA----TCGA-GCAT-------GTGCACGCCCTATT-C-ATCCATTTCT-ATATACACCTGTGCACCTTTTGTAGG----TCGGTCGTT------ACGGGAAAAG---CCTTTCGGTTTTTTC---TTA--------CACTTCCTTCCTATGTTTTTATTATAAACTCTGTGAATGTCTAT--GAATGTC-TT-TGCGTAAATAAACGCATCATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAAACCC---CTTTTACTTTAT------TGTAAAA-GTGGGC----TTGGATTTGGAGGTTTA------TTGCTGGCTGCATTAAATTGT---TGGTCAGCTCCTCTTGAATG--CATT--AGCTTTGAGCCTTTAACGGG---TCGGCTTATCGGTGTGATAA---------ATT-TTATGCCGTG--GTCGGTT------TCGTGAATAA----AAATCAAGCTTCTAA-TCGTC-----CTTCTTAATGGGACAATACAT--------CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTT--TGATTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTTCGGAAATCAGCCTTGCATTTATTTGTTTGGTGTATTTTCT-GTTTGACGGGCCAACATCGATTTTAATCGTTGGATAAAGATAAAGGAAATGTGGCACCTTCGGGTGTGTTATAGTCTTTTATTGCATACAACGGTCGGGATCGAGGAACTCAGCACGCCTTTATTGGTCGGGGT----TCGCCCACGTTTCGTGCTTAGGATGTTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGTTAAACCCGAGCGCGTAATTAAAGTAATAGTTGAGATCCCCCTTAAAAGGGAGCATCGACGCCCGGACTTGACCT-TTTGTGATAGCTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Fibroporia vaillantii RWD_63_263' TGTAGCTGGCTCTAAC----AAGG-GCAT-------GTGCACACTCTATT-C-GT-TATAT-T-ATA--CACCTGTGCACCTTTTGTAGT----TCGGTTGTT------ACGGGGAGAG---TCG--AAAGGCTTTC---TCA--------GACCCCCGTTCTATGTTTTTATTATAAACCTT-TGAATGTCTTT--GAATGTC-T---GCATTAATAA-TGCATTTTA-TACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAAACCTTT-CTTTAAATTTAT------TTTAAAG-GTTGGC----TTGGACTTGGAGG----------TTGCTGGCCGCGCCATTTTGTAGTCAGTCAGCTCCTCTTGAATG--CATT--AGCTTGAGTCTTT-AATGAG---TCGGCTTATCGGTGTGATAA---------ACT--TATGCCGTTA-GTCAACT------TG---TAAAC----AAATCGAGCTTCTAA-TCGTC-----TTT-----GGACAAACATTATAAT-----CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTTTAA-TAGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGTGCTAGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACTAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGAAATCAGCCTTGCATTTATTTGCTTGGTGTATTTTCT-GGTTGACGGGCCAGCATCGATTTTAATCGTTGGATAAAGGCGAGGGAAATGTGGCACCTTCGGGTGTGTTATAGTCCCTTGTCACATACAACGGTCGGGATCGAGGAACTCAGCACGCCTTTATTGGTCGGGGT----TCGCCCACGTTTCGTGCTTAGGATGTTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGTAAACCCGAGCGCGTAATTAAAGTAATAGTTGAGATCCCCGTTACAAGGGAGCATCGACGCCCGGACTTGACCT-TCTGTGATAGCTCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Fomitopsis pinicola Otto_Miettinen_X772' TGTAGCTGGC{CT}GTTTCGTTTGAGCGGCAT-------GTGCACGCCCTGAT-CATTATCCATC--TCACACACCTGTGCACATACTGTAGG----TCGGCTTTTGAT-----TGGAG-TGGGGTCTTCATCGA-CTCTGCTTTTTAGTTGG-GGCCT---TCCTATGTTTT-ATCACACA--CTACTTCAGTT{AT}AAA-GAATGTCCTCTTGCGT--CTAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCT---ATTTGCTTTT----------GTGAATAGAGC-----TTGGACTTGGAGGTTT------ATTGCCGGTACC-----TGTGAT------CGGCTCCTCTTGAATG--CATT--AGCTCGAACCTTT-TGTGGA---TCAGCTTATCGGTGTGATAAAATGTCTACGCCGTTA--CTGTGAAGCA-TA-------T----TA----------TTCGGCTTCCAA-TCGT------CCTTCACGGGACAA-TAA--CTTTGACCTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGTGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC-TT--TT-GCTTGGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGACCGCTGGAAAAAGGTTAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTAGTCGCATACAGTGGTTGGGATCGAGGACC{AG}CAGCACGCCTTTAT-GGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCCTGTCGTG-GGGAGCATCGACGCCCGGACCTGAACT-TCGGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC 'Laetiporus montanus Cui_10011' ------------------------CACG------GGGTCCGCCC-TTGTC---ACAAACAC-------ACCCCTGTGCACG--TTGAAGGC---CCGGCTCGT--------TGAGTGGG---TGGGCGACCGCCCAGGATTCG--------------TAGCCTCGCTTTCTTACACAAACTTC-GGAATGTACATCAGAATGTC-TTACGCGT--GTAA-CGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCC---TGCCATCTTTGC------GGATGAGCGTCGG-----TTGGATTTTGGAGG---------TTGCCGGAC--------TCGTT------CGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTG---ACCGA---CCGAGTG---GACGTGATAGAAAGT---CACCGTCG-ACTGAAGGGTCCGT-------CGTTGAACGG------TTCAAGCTT-TGTTTCAT------CGTCTTCGGACGAAACATCTCTGACCT--CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCTACGCCGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACCGCCGGC-GGTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCCGGGGCTCAGCCTTGCATTCGTTTGCTCGGTTTACTTCCC-GGTCGACGGGCCAGCGTCGATTTTGACCGTCGGAAAAGGGTCAGAGGAAAGTGGCACCTTCGGGTGTGTTATAGCCTTTGGTCGCATACGGCGGTCGGGATCGAGGAACGCAGCACGCCTTCATTGGCCGGGGCATTCTTGCCCACGCATCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGCAATGAAAGTGAAAGTCGAGATCTCTGTCACG-GAGAGCATCGACGCCCGGACCTGAGCTGCTTGCGAAGGATCTGCGGTAGAGCACGCACGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGAC 'Laetiporus sulphureus Dai_12154' TGCGGACGACATTAAC----GAACAACG------GGGTTCGCCCCTTGTC-C-ACAAACAC-------ACCCCCGTGCACG--TTGAAGGC---CCGGCTCGT--------TGAGTGGG---TGGGCGACCGCCCAGGATTCG--------------TAGCCTCGCTTTCTTACACAAACTTC-AGAATGTACATCAGAATGTC-TTACGCGT--GTAA-CGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCC---TGCCATCTTTGC------GGATGAGCGTCGG-----TTGGATTTTGGAGG---------TTGCCGGAC--------TCGTT------CGGCTCCCCTTGAAAGCATAGTAAAGCTTGGACCTG---ACCGA---CCGGGTG---GACGTGATAGAAAGT---CACCGTCG-ACCGAAGGGTCCGT-------CGCTGAACGG------TTCAAGCTT-TGTTT-GT------CGTCTTCGGACGAA-CATCTCTGACCT--CCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTT--TGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCTACGCCGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACCGCCGGT-GGTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCCGGGGCTCAGCCTTGCATTCGTTTGCTCGGTTTACTTCCC-GGTCGACGGGCCAGCGTCGATTTTGACCGTCGGAGAAGGGCCAGAGGAAAGTGGCACCTTCGGGTGTGTTATAGCCTTCGGTCGCATACGACGGTTGGGATCGAGGAACGCAGCACGCCTTCAATGGCCGGGGCATTCGTGCCCACGCATCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGCAATGAAAGTGAAAGTCGAGATCTCTGTCATG-GAGAGCATCGACGCCCGGACCTGAGCTGCTTGCGAGGGATCTGCGGTAGAGCACGCACGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGAC Piptoporus_betulinus_8086 TGTCGCTGGCTGTT-------AGCAGCAT-------GTGCACGCTCTGAT-CATTATCCATC--TTACACACCTGTGCACACACTGTAAG----TCGGCTTTTGATG----CAAAGTAAGGGTCTTCATTGA-CTCTGCTTCA-AATTGGGAGCCT---TCTTATGTTTT-ATCACACA--CTACTTCAGTTTAAA-GAATGTCAAATCGCGT--TTAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATCATCAACTCT---ATTTACTTTT----------GTGAATAGGGC-----TTGGACTTGGAGGTTT--------TGCCGGTACT-----TGTGAT------CGGCTCCTCTTGAATG--CATT--AGCTTGAACCTTT--GTGGA---TCAGCTTATCGGTGTGATAAT-TGTCTACGCCGTTA--CTGTGAAGCA-TA-------TA--TTAAAG----G-GCTCGGCTTCTAA-TCGT------CCTTTACGGGACAA-TAA--CTTTGACCTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTA-TGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGT-GCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGC-TT--TT-GCT{CT}GGTGCATTTTCT-GGTTGACGGGCCAGCATCGATTTTGACCATTGGAAAAAGATTAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTAGTCACATACAGTGGTTGGGATCGAGGACCGCAGCACGCCTTTATTGGCCGGGGT----TCGCCCACGTT-CGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGATCCTTGTCATG-GGGAGCATCGACGCCCGGACCTGAACT-TCGGTGATGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGAC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M43310] TITLE 'Antrodia ITS+Tef1'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1110; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] 'Antrodia favescens 0309_103' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACATTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAA{CT}GATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTA{AG}CTGAGACGCAT{AG}A--ATGGGAT-CGGCTTACAATCGTCCTCTA-CGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGCCAGACTCGCGAGCACGCCCTGCTTGCCTTCACCCTGGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACTACCAAGGTTAGTGTGCGGTCTCCGAGCATATAACAGCGAATGAAACCCGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTCGGATACAACCCGAAGGCGGTCGCGTTCGTGCCCATCTCTGGCTGGCACGGTGACAACATGTTGGAAGAGTCCGCCAAGTGAGTACATTA-TGGCAGATGCCCCGCGTTCCACGCATTCTAACCCCT-TGCGCGCAATAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGGCGGTGTCCTCAAGGGTAAGACCCTCCTCGACGCCATCGATGCCATCGAGCCGCCAGTCCGTCCCTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA 'Antrodia favescens 0412_4J' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACATTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGG{CT}TATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTACAATCGTCCTCTA-CGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGCCAGACTCGCGAGCACGCCCTGCTTGCCTTCACCCTGGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACTACCAAGGTTAGTGTGCGGTCTCCGAGCATATAACAGCGAATGAAACCCGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGT{CT}AAGGAGACGTCCACCTTCATTAAGAA{AG}GTCGGATACAACCCGAAGGCGGTCGCGTTCGTGCCCATCTCTGGCTGGCACGGTGACAACATGTTGGA{AG}GAGTCCGCCAAGTGAGTACATTA-TGGCAGATGCCCCGCGTTCCACGCATTCTAACC{CT}CT-TGCGCGCAATAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGGCGGTGTCCTCAAGGGTAAGACCCTCCTCGACGCCATCGATGC{CT}ATCGAGCCGCCAGTCCGTCCCTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA 'Antrodia favescens Vlasak_0809' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAA{AC}ATTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAA{CT}GCAG-TTGGATTTGGAGGC{CT}ATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCAT{AG}A--ATGGGAT-CGGCTTACAATCGTCCT{CT}TA-CGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGCCAGACTCGCGAGCACGCCCTGCTTGCCTTCACCCTGGGCGTCAGGCAGCTCATCGTTGC{CT}ATCAACAAGATGGATACTACCAAGGTTAGTGTG{CT}GGTCTCCGAGCATATAACAGCGAATGAAACCCGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTCGGATACAACCCGAAGGCGGTCGCGTTCGTGCCCATCTCTGGCTGGCACGGTGACAACATGTTGGAAGAGTCCGCCAAGTGAGTACATTA-TGGCAGATGCCCCGCGTTCCACGCATTCTAACCCCT-TGCGCGCAATAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGGCGGTGTCCTCAAGGGTAAGACCCTCCTCGACGCCATCGATGCCATCGAGCCGCCAGTCCGTCCCTCCGACAAGCCCCT{CG}CGTCTCCCCCTGCAGGATGTCTACAAGA 'Antrodia heteromopna Yuan_2466' TGTAGCTGGCCTTTCAAAGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCTTGTGAACACTCTGTAGGTCGGCTCAAGGGACAAATTCTTAACGGGGTTTGTTC--TGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTACAGTCGTCCTTGAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATTATTGCCGCTGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTTCTTGCGTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACCACTAAGGTGAGTGTGTGGACTTCAAGTACATCACAGCAACTTAACCTTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACATCCACCTTCATAAAGAAGGTTGGATACAACCCGAAGACGGTCGCGTTCGTCCCGATCTCTGGCTGGCACGGTGACAACATGTTGGAGGAATCCGCCAAGTGAGTATAGTGGTGACAGGTGCTCCATGATCCATGTATTCTGACCACT-AGCGCGCACCAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGCCGGTGTCGTTAAGGGCAAGACCCTCCTCGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCCGACAAGCCCCTCCGTCTGCCCCTGCAGGATGTCTACAAGA 'Antrodia heteromopna Yuan_826' TGTAGCTGGCCTTTCAAAGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCTTGTGAACACTCTGTAGGTCGGCTCAAGGGACAAATTCTTAACGGGGTTTGTTC--TGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTACAGTCGTCCTTGAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATTATTGCCGCTGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTTCTTGCGTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACCACTAAGGTGAGTGTGTGGACTTCAAGTACATCACAGCAACTTAACCTTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACATCCACCTTCATAAAGAAGGTTGGATACAACCCGAAGACGGTCGCGTTCGTCCCGATCTCTGGCTGGCACGGTGACAACATGTTGGAGGAATCCGCCAAGTGAGTATAGTGGTGACAGGTGCTCCATGATCCATGTATTCTGACCACT-AGCGCGCACCAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGCCGGTGTCGTTAAGGGCAAGACCCTCCTCGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCCGACAAGCCCCTCCGTCTGCCCCTGCAGGATGTCTACAAGA 'Antrodia heteromorpha 0509_187' TGTAGCTGGCCTTTCAAAGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGAACACTCTGTAGGTCGGCTCAAGGGACAAATCCTTAACGGGGTTTGTTT--TGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-TGGCTTACAGTCGTCCTTGAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATTATTGCCGCTGGCACCGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTTCTTGCGTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACCACTAAGGTGAGTGTGTGGACTTCAAGTACATCACAGCAACTTAACCTCGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATAAAGAAGGTTGGATACAACCCGAAGACGGTCGCGTTCGTCCCGATCTCTGGCTGGCACGGTGACAACATGTTGGAGGAATCCACCAAGTGAGTATAATGGTGACAGATGCTCCATGATCCATGTATTCTGACCACT-AGCGCGCACCAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGCCGGTGTCGTTAAGGGCAAAACCCTCCTCGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTGCAGGATGTCTACAAGA 'Antrodia heteromorpha Dai_1274' TGTAGCTGGCCTTTCAAAGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGAACACTCTGTAGGTCGGCTCAAGGGACAAATCCTTAACGGGGTTTGTTT--TGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-TGGCTTACAGTCGTCCTTGAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia heteromorpha Dai_1275' TGTAGCTGGCCTTTCAAAGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGAACACTCTGTAGGTCGGCTCAAGGGACAAATTCTTAACGGGGTTTGTTT--TGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-TGGCTTACAGTCGTCCTTGAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATTATTGCCGCTGGCACCGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTTCTTGCGTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACCACTAAGGTGAGTGTGTGGACTTCAAGTACATCACAGCAACTTAACCTCGCATACAGTGGAGCGAGGACCGTTTCAACGAAATTGTCAAGGAGACGTCCACCTTCATAAAGAAGGTTGGATACAACCCGAAGACGGTCGCGTTCGTCCCGATCTCTGGCTGGCACGGTGACAACATGTTGGAGGAATCCACCAAGTGAGTATAATGGTGACAGATGCTCCATGATCCATGTATTCTGACCACT-AGCGCGCACCAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGCCGGTGTCGTTAAGGGCAAAACCCTCCTCGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTGCAGGATGTCTACAAGA Antrodia_heteromorpha_X1474 TGTAGCTGGCCTTTCAAAGGGC{AG}TGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGAACACTCTGTAGGTCGGCTCAAGGGACAAAT{CT}CTTAACGGGGTTTGTTT--TGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGAC{AG}CATGA--ATGGGAT-{CT}GGCTTACAGTCGTCCTTGAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTA-----------------CGCTGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTTCTTGCGTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACCACTAAGGTGAGTGTGTGGACTTCAAGTACATCACAGCAACTTAACCTCGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATAAAGAAGGTTGGATACAACCCGAAGACGGTCGCGTTCGTCCCGATCTCTGGCTGGCACGGTGACAACATGTTGGAGGAATCCACCAAGTGAGTATAG--GTGACAGGTGCTCCATGATCCATGTATTCTGACCACT-AGCGCGCACCAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGCCGGTGTCGTTAAGGGCAAAACCCTCCTCGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTGCAGGATGTCTACAAGA Antrodia_heteromorpha_X1841 TGTAGCTGGCCTTTCAAAGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGAACACTCTGTAGGTCGGCTCAAGGGACAAATTCTTAACGGGGTTTGTTT--TGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTTGTTTATCTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACACATGA--ATGGGAT-CGGCTTACAGTCGTCCTTGAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATTATTGCCGCTGGCACTGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTTCTTGCGTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACCACTAAGGTGAGTGTGTGGACTTCAAGTACATCACAGCAACTTAACCTCGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCTACCTTCATAAAGAAGGTTGGATACAACCCGAAGACGGTCGCGTTCGTCCCGATCTCTGGCTGGCACGGTGACAACATGTTGGAGGAATCCACCAAGTGAGTATAG--GTGACAGGTGCTCCATGATCCATGTATTCTGACCACT-AGCGCGCACCAGCATGACATGGTACAAGGGCTGGACGAGGGAGACCAAGGCCGGTGTCGTTAAGGGCAAAACCCTCCTCGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCCGACAAGCCCCTCCGTCTTCCCCTGCAGGATGTCTACAAGA 'Antrodia macra MUAF_887' TGTAGCTGGCCTTTCAACGGGCATGTGCACGCCTCTCT--TCAATCCATTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTTTAACGGGACCTGTTT--CGGGCCTTCCTATGTATTATTACAAACACTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAATTCGTTTGTCTTCGTATGAACGCAG-TTGGATTTGGAGGCTGTT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTACAGTCGTCCGTGTACGGACAATTTA--TTATGACCTCTGACCTCAAATCAGGTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antrodia_mappa_4132 TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTCACCACTGTGCACAATTTGTAGGTCGGCTTTAGGATCGGGTCTCTAGCGGGATCTGTTT--CGGGCCGTCCTATGTATCATTACAAACATTTAAAGTCTA{CT}AGAATGTACTC-GCGTTAAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCGCCAATCTTTGCATTGGCGCTG-TTGGACTTGGAGGCTTTTTT-GCCGGATTGTAATGATTCGGCTCCTCTTGAATGTATTAGCTCGGACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGTGATGCATGA--GTAGGAT-CGGCTTACAATCGTCTTTAAACGGACAATAAAACTTATGACCTCTGACCTCAAATCAGGTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antrodia_mappa_4239 TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTCACCACTGTGCACAATTTGTAGGTCGGCTTTAGGATCGGGTCTCTAGCGGGATCTGTTT--CGGGCCGTCCTATGTATCATTACAAACATTTAAAGTCTAAAGAATGTACTC-GCGTTAAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCGCCAATCTTTGCATTGGCGCTG-TTGGACTTGGAGGCTTTTTTTGCCGGATTGTAATGATTCGGCTCCTCTTGAATGTATTAGCTCGGACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGTGATGCATGA--GTAGGAT-CGGCTTACAATTGTCTTTAAACGGACAATAAAACTTATGACCTCTGACCTCAAATCAGGTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia mappa Vlasak_0509.170' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTCACCACTGTGCACAATTTGTAGGTCGGCTTTAGGATCGGGTCTCTAGCGGGATCTGTTT--CGGGCC{GT}TCCTATGTATCATTACAAACATTTAAAGTCTAAAGAATGTACTC-GCGTTAAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCGCCAATCTTTGCATTGGCG{CT}TG-TTGGACTTGGAGGCTTTTTT-GCCGGATTGTAATGATTCGGCTCCTCTTGAATGTATTAGCTCGGACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGTGATGCATGA--GTAGGAT-CGGCTTACAATCGTCTTTAAACGGACAAT{AG}AAACTTATGACCTCTGACCTCAAATCAGGTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antrodia_mappa_X1500 TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTCACCACTGTGCACAATTTGTAGGTCGGCTTTAGGATCGGGTCTCTAGCGGGATCTGTTT--CGGGCCGTCCTATGTATCATTACAAACATTTAAAGTCTAAAGAATGTACTC-GCGTTAAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCGCCAATCTTTGCATTGGCGCTG-TTGGACTTGGAGGCTTTTTTTGCCGGATTGTAATGATTCGGCTCCTCTTGAATGTATTAGCTCGGACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGTGATGCATGA--GTAGGAT-CGGCTTACAATTGTCTTTAAACGGACAATAAAACTTATGACCTCTGACCTCAAATCAGGTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Antrodia serialis Cui_10519' TGTAGCTGGCC----GGAAGGCATGTGCACGCCTCGATCATCATCCATCTCACACCTGTGCACACACTGTAGGTCGGTTTGTGGGGCGAGGTCTTCATTGA{CT}TTTGCTTTGCGGGCCTTCCTATGTTTTATCACAAACTACTA--GTT{CT}AAAGAATGTCTACTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTCATTTGCTTT-TGTGAATGAAGCTTGGACTTGGAGG-TATT---GCTGG-CCGTACGG--TCGGCTCCTCTTGAATTTATTAGCTCGAACCTTTGTGGATCAGCTT-CGGTGTGATAATTGTCTACGCCGTT--CTGTGAAGCATAACTATGGGTTTCGGCTTCCAACAGTCCTTCACTGGACAATATC---TTTGACCTTTGACCTCAAATCAGGTAGCTGTCCTCATCATTGCCGCCGGTACCGGTGAGTTCGAGGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCTCTCCTTGCCTTCACGCTCGGTGTGAGGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGGTGCGCTTTTATCGTAATCGCTGAGAATTTT-GCTCATCGTCGC-TACAGTGGAGCGAGGACCGCTTCAACGAAATTGTCAAGGAGACGTCCACCTTCATCAAGAAGGTCGGCTACAACCCGAAGGCGGTTGCCTTCGTGCCCATCTCTGGCTGGCACGGCGACAACATGTTGGAGGAGTCCGCCAAGTACGTATCGTCAGCGTTATTGCACGCTTGTTTACTGACTATATGCGCCTCGTG-----TAGCATGACATGGTACAAGGGTTGGTCCAGGGAGACTAAGGCTGGCGTCGTCAAGGGCAAGACCCTCCTCGATGCTATTGACGCCATTGAGCCCCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTGCCCCTCCAGGATGTCTACAAGA 'Antrodia serpens Vlasak_8609.15' TGTAGCTGGCCTTTCAACGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGCACACTTTGTAGGTCGGCTCAAGGGACAGATTCTTAACGGGATTTGTTT--CCAGTCTTCCTATGTTTTATTATAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAG{CT}ATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTGTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAA{CT}CTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGATGCATGA--ATGGGAT-CGGCTTACAATCGTCCTTGAA-GGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Antrodia_serpens_X1511 TGTAGCTGGCCTTTCAACGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGCACACTTTGTAGGTCGGCTCAAGGGACAGATTCTTAACGGGATTTGTTT--CCAGTCTTCCTATGTTTTATTATAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTGTTTGTATGAACGCAG-TTGGATTTGGAGGCCATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAA{CT}CTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGATGCATGA--ATGGGAT-CGGCTTACAATCGTCCTTGAA-GGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTGTCCTCATCATCGCCGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGATGGTCAGACTCGCGAGCACGCCCTCCTTGCCTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGATACCACTAAGGTGAGTCTGGAT--TTCAAGCATATGATAGTAACGTCACATTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTCGGATACAACCCGAAGACGGTCGCCTTCGTCCCGATCTCTGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACGGTA--------GCCTCCGCGATCCACGCATTCTGACACCT-TGCGCGCATCAGCATGCCATGGTACAAGGGCTGGACGAGGGAAACCAAGGGCGGTGTCGTTAAGGGCAAGACCCTGCTTGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCCGACAAGCCCCTTCGTCTTCCCCTCCAGGATGTCTACAAGA 'Antrodia subserpens Cui_8310' TGTAGCTGGCCTTTCAACGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGCACACTTTGTAGGTCGGCTCAAGGGACAGATTCTTGACGGGATTTGTTT--CGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTTCAAAGAATGTAGTC-GCGTTTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTGTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGACTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CAGCTTACAATCGTCTTTGAACGGACAATCTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATTATCGCCGCCGGCACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACTCGCGAGCACGCCCTGCTTGCGTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACTAAGGTGAGTATGCGGATTTCAAGCTTATGACAGCAACTTAACGTTGCATTCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGACGGTCGCCTTTGTCCCGATCTCTGGCTGGCACGGCGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACGATAGCGGTAGATTCTCCGCGATCCACGCATTCTGATCACT-TGCGCGCCCCAGCATGACATGGTACAAGGGCTGGACGAAGGAAAACAAGAGCGGTGTCGTTAAGGGCAAGACCCTGCTTGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCAGACAAGCCCCTCCGCCTTCCTCTCCAGGATGTCTACAAGA 'Antrodia subserpens Dai_13233' TGTAGCTGGCCTTTCAACGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGCACACTTTGTAGGTCGGCTCAAGGGACAGATTCTTGACGGGATTTGTTT--CGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTTCAAAGAATGTAGTC-GCGTTTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTGTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CAGCTTACAATCGTCTTTGAATGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATTATCGCCGCCGGCACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACTCGCGAGCACGCCCTGCTTGCGTTCACCCTCGGTGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACTAAGGTGAGTATGCGGATTTCAAGCTTATGACAGCAACTTAACGTTGCATTCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGACGGTCGCCTTTGTCCCGATCTCTGGCTGGCACGGCGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACGATAGCGGTAGATTCTCCGCGATCCACGCATTCTGATCACT-TGCGCGCCCCAGCATGACATGGTACAAGGGCTGGACGAAGGAAAACAAGAGCGGTGTCGTTAAGGGCAAGACCCTGCTTGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCAGACAAGCCCCTCCGCCTTCCTCTCCAGGATGTCTACAAGA 'Antrodia subserpens Dai_6380' TGTAGCTGGCCTTTCAACGGGCATGTGCACGCCTCGCT--TCAATCCACTTACCCCTGTGCACACTTTGTAGGTCGGCTCAAGGGACAGATTCTTGACGGGATTTGTTT--CGGGCCTTCCTATGTTTTATTACAAACGTTTAAAGTTCAAAGAATGTAGTC-GCGTTTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTGTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---G{CT}CGGATTGTAATGA{CT}TCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CAGCTTACAATCGTCTTTGAATGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATTATCGCCGCCGGCACCGGTGAGTTCGAGGCCGGTATCTCCAAGGATGGTCAGACTCGCGAGCACGCCCTGCTTGCGTTCACCCTCGGCGTCAGGCAGCTCATCGTTGCCATCAACAAGATGGACACTACTAAGGTGAGTATGCGGATTTCAAGCTTATGACAGCAACTTAACGTTGCATTCAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGACGGTCGCCTTTGTCCCGATCTCTGGCTGGCACGGCGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACGATAGCGGTAGATTCTCCGCGATCCACGCATTCTGATCACT-TGCGCGCCCCAGCATGACATGGTACAAGGGCTGGACGAAGGAAAACAAGAGCGGTGTCGTTAAGGGCAAGACCCTGCTTGATGCCATCGACGCCATCGAGCCCCCAGTCCGTCCCTCAGACAAGCCCCTCCGCCTTCCTCTCCAGGATGTCTACAAGA Antrodia_tanakai_11453 TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTATAATCGTCCTCTAACGGACAATTTA--CTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTCCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCACCAAGGTTAGCGCGCGGTCTCCAACTACATGACAGCATTCTAAACCTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCCATCTCCGGCTGGCACGGCGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACAGTTGTGACAGATGCCCCGTGATCCGCGCATTCTAAGCCCT-TGCGCGTAACAGCATGCCATGGTACAAGGGTTGGTCGAGGGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA 'Antrodia tanakai Cui_6080' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTATAATCGTCCTCTAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGGCAGACTCGCGAGCACGCCCTCCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCACCAAGGTTAGCGCGCGGTCTCCAACTACATGACAGCATTCTAAACCTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACAGTTGTGACAGATGCCCCGTGATCCGCGCATTCTAAGCCCT-TGCGCGTAACAGCATGCCATGGTACAAGGGTTGGTCGAGGGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA 'Antrodia tanakai Cui_9275' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCAGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTATAATCGTCCTCTAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTCCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCACCAAGGTTAGCGCGCGGTCTCCAACTACATGACAGCATTCTAAACCTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTGAGTATAGTTGTGACAGATGCCCCGTGATCCGCGCATTCTAAGTCCT-TGCGCGTAACAGCATGCCATGGTACAAGGGCTGGTCGAGAGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA 'Antrodia tanakai Cui_9758' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAC-CGGCTTATAATCGTCCTCTAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTCCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCACCAAGGTTAGCGCGCGGTCTCCAACTACATGACAGCATTCTAAACCTGCATACAGTGGAGCGAGGATCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACAGTTGTGACAGATGCCCCGTGATCCGCGCATTCTAAGCCCT-TGCGCGTAACAGCATGCCATGGTACAAGGGCTGGTCGAGGGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA 'Antrodia tanakai Dai_11782' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTT{AG}GGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCAGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTATAATCGTCCTCTAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTTCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCACTAAGGTTAGCGCGCGGTCTCCAACTACATGACAGCATTCTAAACCTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACAGTTGTGACAGATGCCCCGTGATCCGCGCATTCTAAGCCCT-TGCGCGTAACAGCATGCCATGGTACAAGGGCTGGTCGAGGGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTTCCCCTGCAGGATGTCTACAAGA Antrodia_tanakai_X1504 TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACT{CT}ACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGC{CT}ATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGC{AG}GATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTATAATCGTCC{CT}CTAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTCCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCAC{CT}AAGGTTAGCGCGCGGTCTCCAACT{AC}CATGACAGCATTCTAAACCTGCATACAGTGGAGCGAGGA{CT}CGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACAGTTGTGACAGATG{CT}C{AC}CGTGATCCGCGCATTCTAAGCCCT-TGCGCGTAACAGCATGCCATGGTACAAGGG{CT}TGGTCGAGGGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA Antrodia_tanakai_X1505 TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGC{AG}GATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTATAATCGTCCTCTAACGGACAA{CT}TTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTCCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCACTAAGGTTAGCGCGCGGTCTCCAACTACATGACAGCATTCTAA{AG}CCTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCTATCTCCGGCTGGCACGGCGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACAGTTGTGACAGATGCCCCGTGATCCGCGCATTCTAAGTCCT-TGCGCGTAACAGCATGCCATGGTACAAGGGCTGGTCGAGGGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA Antrodia_tanakai_X1779 TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGC{AG}GATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTATAATCGTCCTCTAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTCCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCACTAAGGTTAGCGCGCGGTCTCCAACTACATGACAGCATTCTAAACCTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACAGTTGTGACAGATGCCCCGTGATCCGCGCA{CT}TCTAAGCCCT-TGCGCGTAACAGCATGCCATGGTACAAGGGCTGGTCGAGGGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA 'Antrodia tanakai Yuan_1106' TGTAGCTGGCCTTTCAACGGGCATGTGCACACCTCGCT--TCAATCCACTTACACCTGTGCACACTTTGTAGGTCGGCTTTAGGAACGGGTCTCTAACGGGGCTTGTTT--CGGGCCTTCCTATGTATTATTACAAACGTTTAAAGTCTAAAGAATGTACTC-GCGTCTAACGCATT-ATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTATCAACTCGTTTGTCTTTGTATGAACGCAG-TTGGATTTGGAGGCTATT---GCCGGATTGTAATGATTCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTTTTGGTGTGATAATTGTCTACGCCGCTAACTGAGACGCATGA--ATGGGAT-CGGCTTATAATCGTCCTCTAACGGACAATTTA--TTATGACTTCTGACCTCAAATCAGGTAGCTATCCTCATCATCGCTGCCGGCACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGTCAGACTCGCGAGCACGCCCTCCTTGCGTTCACCCTCGGTGTCAGGCAGCTTATCGTTGCCATCAACAAGATGGACACCACTAAGGTTAGCGCGCGGTCTCCAACTACATGACAGCATTCTAAACCTGCATACAGTGGAGCGAGGACCGTTTCAACGAAATCGTCAAGGAGACGTCCACCTTCATTAAGAAGGTTGGATACAACCCGAAGGCGGTTGCGTTCGTCCCCATCTCCGGCTGGCACGGTGACAACATGTTGGAGGAGTCCGCCAAGTGAGTACAGTTGTGACAGATGCCCCGTGATCCGCGCATTCTAAGCCCT-TGCGCGTAACAGCATGCCATGGTACAAGGGCTGGTCGAGGGAGACCAAGGCTGGTGTTGTCAAGGGCAAGACCCTCCTCGACGCCATCGACGCCATCGAGCCCCCAGTCCGTCCGTCCGACAAGCCCCTCCGTCTCCCCCTGCAGGATGTCTACAAGA ; END; BEGIN TREES; TITLE 'Antrodia ITS+Tef1'; LINK TAXA = Taxa1; TRANSLATE 1 'Antrodia favescens 0412_4J', 2 'Antrodia favescens 0309_103', 3 'Antrodia favescens Vlasak_0809', 4 Antrodia_heteromorpha_X1841, 5 Antrodia_heteromorpha_X1474, 6 'Antrodia heteromorpha 0509_187', 7 Antrodia_serpens_X1511, 8 'Antrodia serpens Vlasak_8609.15', 9 Antrodia_tanakai_X1779, 10 Antrodia_tanakai_X1505, 11 Antrodia_tanakai_X1504, 12 'Antrodia subserpens Cui_8310', 13 'Antrodia subserpens Dai_6380', 14 'Antrodia subserpens Dai_13233', 15 'Antrodia heteromopna Yuan_2466', 16 'Antrodia heteromopna Yuan_826', 17 'Antrodia tanakai Cui_9275', 18 'Antrodia tanakai Dai_11782', 19 'Antrodia tanakai Cui_9758', 20 'Antrodia tanakai Yuan_1106', 21 'Antrodia tanakai Cui_6080', 22 Antrodia_tanakai_11453, 23 'Antrodia heteromorpha Dai_1275', 24 'Antrodia heteromorpha Dai_1274', 25 'Antrodia macra MUAF_887', 26 Antrodia_mappa_4239, 27 Antrodia_mappa_X1500, 28 'Antrodia mappa Vlasak_0509.170', 29 Antrodia_mappa_4132, 30 'Antrodia serialis Cui_10519'; TREE MajRule = [&R] (30:75.66964285714286,((28:0.0,29:1.0,(26:0.0,27:0.0):0.5):23.607142857142858,(25:10.392857142857142,((1:0.0,2:0.0,3:0.0):9.732142857142858,((9:0.0,11:0.0,18:2.142857142857143,19:2.267857142857143,20:0.17857142857142858,(10:2.0,17:3.0):1.1428571428571428,(21:2.1964285714285716,22:2.1964285714285716):1.21875):14.388392857142858,(((7:0.0,8:0.0):12.0,(12:1.0,(13:0.0,14:1.0):2.0):27.0):19.696428571428573,((15:0.0,16:0.0):4.0,((4:0.0,5:0.0):1.0,(23:1.0,(6:0.0,24:0.0):0.5):4.0):1.5):11.151785714285714):28.5):12.615384615384615):2.8482142857142856):4.5):75.66964285714286):0.0; END; BEGIN TREES; TITLE 'Antrodia ITS+LSU'; LINK TAXA = Taxa2; TRANSLATE 1 'Antrodia heteromorpha Dai_12755', 2 Antrodia_heteromorpha_X1379, 3 Antrodia_heteromorpha_X1438, 4 'Antrodia heteromopna Yuan_2466', 5 'Antrodia heteromopna Yuan_826', 6 'Antrodia favescens 0412_4J', 7 'Antrodia favescens 0309_103', 8 'Antrodia favescens Vlasak_0809', 9 Antrodia_tanakai_X1521, 10 'Antrodia tanakai Cui_6080', 11 'Antrodia tanakai Cui_9758', 12 'Antrodia tanakai Yuan_1106', 13 'Antrodia tanakai Dai_11782', 14 'Antrodia tanakai Cui_9275', 15 Antrodia_serpens_X1508, 16 Antrodia_serpens_X1511, 17 'Antrodia serpens Vlasak_8609_15', 18 Antrodia_mappa_4239, 19 Antrodia_mappa_4132, 20 'Antrodia macra MUAF_887', 21 'Antrodia serialis Otto_Miettinen_X732', 22 'Antrodia serialis Cui_10519', 23 'Antrodia malicola Otto_Miettinen_X1382', 24 'Antrodia subserpens Cui_8310', 25 'Antrodia subserpens Dai_6380', 26 'Antrodia subserpens Dai_13233', 27 'Fomitopsis pinicola Otto_Miettinen_X772', 28 'Antrodia pulvinascens Otto_Miettinen_X8022', 29 Daedalea_quercina_8085, 30 Antrodia_juniperina_11190, 31 Piptoporus_betulinus_8086, 32 'Antrodia huangshanensis Dai_6082', 33 'Antrodia tropica Cui_6471', 34 'Antrodia wangii Cui_5525', 35 'Amyloporia sordida L_3393_R', 36 'Amyloporia sitchensis HHB_5320', 37 'Amyloporia xantha Otto_Miettinen_X701', 38 'Amyloporia sinuosa Otto_Miettine_X725', 39 'Fibroporia vaillantii RWD_63_263', 40 'Fibroporia radiculosa FP_105309_R', 41 Fibroporia_gossypium_X1403, 42 'Fibroporia albicans Dai_10595', 43 'Laetiporus sulphureus Dai_12154', 44 'Laetiporus montanus Cui_10011'; TREE MajRule = [&R] ((43:0.010696,44:0.007982):0.173175,((40:0.07617,(39:0.051818,41:0.052458,42:0.038092):0.02078):0.087973,((35:0.109106,(37:0.068469,(36:0.0,38:0.004327):0.037804):0.015983):0.056691,((29:0.040555,((31:0.030243,(27:0.006165,34:0.027777):0.002474):0.026096,((23:0.036123,(32:0.07049,33:0.105124):0.017284):0.016539,(30:0.023031,(28:0.065576,(21:0.002876,22:0.001583):0.030744):0.007955):0.003842):0.007271):0.017205):0.043489,((18:6.39E-4,19:0.001923):0.042228,(20:0.012736,((6:0.003456,7:0.0,8:0.0,(9:0.0,10:0.001719,11:8.58E-4,12:0.0,13:8.67E-4,14:0.001718):0.001751):0.004353,((15:0.0,16:0.0,17:0.0):0.007185,(24:8.32E-4,(25:0.0,26:0.0):0.001759):0.010371,(1:0.0,2:0.0,3:8.57E-4,(4:0.0,5:0.0):0.003445):0.012735):0.012203):0.003356):0.001394):0.044162):0.032271):0.033781):0.173175); END;